Effect of Uniaxial Tensile Cyclic Loading Regimes on Matrix Organization and Tenogenic Differentiation of Adipose-Derived Stem Cells Encapsulated within 3D Collagen Scaffolds

Abstract

Adipose-derived mesenchymal stem cells have become a popular cell choice for tendon repair strategies due to their relative abundance, ease of isolation, and ability to differentiate into tenocytes. In this study, we investigated the solo effect of different uniaxial tensile strains and loading frequencies on the matrix directionality and tenogenic differentiation of adipose-derived stem cells encapsulated within three-dimensional collagen scaffolds. Samples loaded at 0%, 2%, 4%, and 6% strains and 0.1 Hz and 1 Hz frequencies for 2 hours/day over a 7-day period using a custom-built uniaxial tensile strain bioreactor were characterized in terms of matrix organization, cell viability, and musculoskeletal gene expression profiles. The results displayed that the collagen fibers of the loaded samples exhibited increased matrix directionality with an increase in strain values. Gene expression analyses demonstrated that ASC-encapsulated collagen scaffolds loaded at 2% strain and 0.1 Hz frequency showed significant increases in extracellular matrix genes and tenogenic differentiation markers. Importantly, no cross-differentiation potential to osteogenic, chondrogenic, and myogenic lineages was observed at 2% strain and 0.1 Hz frequency loading condition. Thus, 2% strain and 0.1 Hz frequency were identified as the appropriate mechanical loading regime to induce tenogenic differentiation of adipose-derived stem cells cultured in a three-dimensional environment.

Full text

Research Article
Effect of Uniaxial Tensile Cyclic Loading Regimes on Matrix
Organization and Tenogenic Differentiation of Adipose-Derived
Stem Cells Encapsulated within 3D Collagen Scaffolds
Gayathri Subramanian,
1
Alexander Stasuk,
1
Mostafa Elsaadany,
1
and Eda Yildirim-Ayan
1,2
1
Department of Bioengineering, University of Toledo, Toledo, OH 43606, USA
2
Department of Orthopedic Surgery, University of Toledo Health Sciences Campus, Toledo, OH 43614, USA
Correspondence should be addressed to Eda Yildirim-Ayan; eda.yildirimayan@utoledo.edu
Received 11 May 2017; Revised 22 October 2017; Accepted 31 October 2017; Published 11 December 2017
Academic Editor: Heinrich Sauer
Copyright © 2017 Gayathri Subramanian et al. This is an open access article distributed under the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original
work is properly cited.
Adipose-derived mesenchymal stem cells have become a popular cell choice for tendon repair strategies due to their relative
abundance, ease of isolation, and ability to differentiate into tenocytes. In this study, we investigated the solo effect of different
uniaxial tensile strains and loading frequencies on the matrix directionality and tenogenic differentiation of adipose-derived
stem cells encapsulated within three-dimensional collagen scaffolds. Samples loaded at 0%, 2%, 4%, and 6% strains and 0.1 Hz
and 1 Hz frequencies for 2 hours/day over a 7-day period using a custom-built uniaxial tensile strain bioreactor were
characterized in terms of matrix organization, cell viability, and musculoskeletal gene expression profiles. The results displayed
that the collagen fibers of the loaded samples exhibited increased matrix directionality with an increase in strain values. Gene
expression analyses demonstrated that ASC-encapsulated collagen scaffolds loaded at 2% strain and 0.1 Hz frequency showed
significant increases in extracellular matrix genes and tenogenic differentiation markers. Importantly, no cross-differentiation
potential to osteogenic, chondrogenic, and myogenic lineages was observed at 2% strain and 0.1 Hz frequency loading condition.
Thus, 2% strain and 0.1 Hz frequency were identified as the appropriate mechanical loading regime to induce tenogenic
differentiation of adipose-derived stem cells cultured in a three-dimensional environment.
1. Introduction
More than 32 million acute and chronic tendon injuries are
reported annually in the United States, at an estimated treat-
ment cost of $30 billion per year [1, 2]. Native tendons have a
limited capacity for self-healing when injured, owing to the
hypocellular nature of the tissue, with the tenocytes consti-
tuting less than 5% of the total volume [3–5]. The tendon
healing process causes scar tissue formation that is different
in morphology, composition, and mechanical properties
compared to healthy tendons. Low cell number and scar tis-
sue formation lead to inadequate tissue regeneration, weak
matrix structure, and compromised tissue function [6, 7].
Therefore, cell-based therapies for tendon healing are para-
mount to augment the cell number at the repair site and
aid the native healing process.
Mesenchymal stem cells (MSCs), especially bone-
marrow derived stem cells (BMSCs) and adipose-derived
stem cells (ASCs), are popular cell choices for tendon repair
strategies due to their proliferative capacity and ability to
undergo tenogenic differentiation [8–10]. Injecting autolo-
gous stem cells directly into the site of tendon repair has
revealed that delivery of MSCs alone was insufficient to
improve the healing. Though the cells initially showed signs
of accelerating the healing process, the effect was transitional
and did not result in significant differences in the tendon
regeneration at long-term evaluation [11–13]. This indicated
that an engineered carrier capable of sustained cell delivery in
presence of appropriate chemical and mechanical cues was
essential for successful tendon repairs. In the recent years,
promising results have been achieved by incorporating
BMSCs within tissue-engineered scaffolds, with increased
Hindawi
Stem Cells International
Volume 2017, Article ID 6072406, 16 pages
https://doi.org/10.1155/2017/6072406

tendon-related gene expression and tissue stiffness [14–16].
However, incorporating BMSCs for tendon repair strategies
comes with potential complications of triggering inflamma-
tory reactions or ectopic bone formation which would be of
concern for tendon regeneration [17, 18]. Hence, nowadays,
the use of ASCs for tendon tissue engineering is widely
explored because of their relative abundance, ease of
isolation, anti-inflammatory properties, low susceptibility
to ossification, and minimal risk of donor morbidity when
compared to BMSCs [19–21].
Previous studies have demonstrated that the application
of cyclic mechanical loads to BMSCs cultured on elastic sur-
faces or within collagen matrix increases tenogenic gene
expression profiles [22–24]. Mechanical stimulation is also
seen to enhance tenogenic differentiation of ASCs in collagen
constructs in the presence of tendon-derived extracellular
matrix (ECM) [25]. However, there is no comprehensive
study yet that evaluates the magnitudes of stretch and rate
of loading needed for adipose-derived stem cells to commit
towards a tenogenic lineage.
The objective of this in vitro study was to investigate the
effect of different uniaxial tensile loading modalities on the
matrix alignment and tenogenic differentiation of ASCs
encapsulated within the three-dimensional (3D) collagen
scaffolds. A custom-made uniaxial tensile strain bioreactor
[26] was utilized to apply cyclic loading at 2%, 4%, and 6%
strains and 0.1 Hz and 1 Hz loading frequencies to the cell-
embedded collagen scaffolds over a period of seven days.
Samples loaded with the aforementioned loading conditions
were first evaluated in terms of viability, proliferation, and
morphology of ASCs, and collagen matrix organization
within the 3D scaffolds. Next, a detailed gene expression
study was performed to quantify the mRNA levels of various
musculoskeletal differentiation markers including ECM
genes (collagens and glycosaminoglycans (GAGs)) and teno-
genic, osteogenic, chondrogenic, and myogenic genes. The
combined data obtained from morphological and biochemi-
cal expression analyses were used to identify the uniaxial
strain magnitude and loading frequency that induce teno-
genic differentiation of ASCs cultured in a 3D environment.
2. Materials and Methods
2.1. Cell Culture, Scaffold Synthesis, and Mechanical Loading
Regimes. Human adipose-derived stem cells (ThermoFisher
Scientific, US) were cultured in MesenPRO RS™basal media
with MesenPRO RS growth supplement (ThermoFisher
Scientific, US), 200 mM glutamine (Sigma-Aldrich, US),
and 1% penicillin-streptomycin solution (Gibco, US). Being
the major constituent of the tendon ECM, collagen I was
the preferred biomaterial to encapsulate ASCs in order to
elucidate its behavior in a 3D environment [27]. Collagen I
solution (Corning, US) extracted using 0.5 N acetic acid from
rat tail tendons was used to synthesize the cellular 3D colla-
gen scaffolds. Briefly, ASCs (passage 4) were encapsulated
at 750,000 cells/ml seeding density within 3 mg/ml collagen
I solution and neutralized to pH 7~8 with chilled 1 N NaOH
solution along with PBS and cell culture media according to
the manufacturer’s instructions. The cell-collagen solutions
were added into the loading chambers of our custom-built
uniaxial tensile strain bioreactor [28] and polymerized at
37
°
C for 1 hour. Then, 3D cell-encapsulated collagen scaf-
folds were incubated in the culture media for 48 hours in a
standard cell culture incubator at 37
°
C and 5% CO
2
.
The samples were subjected to cyclic uniaxial loading
using the bioreactor at 2%, 4%, and 6% uniform linear strains
at 0.1 Hz and 1 Hz loading frequencies for 2 hours/day for a
period of 7 days. The strain values to mechanically stimulate
the ASC-encapsulated collagen scaffolds were chosen based
on the in vivo tendon physiology: 2% that mimics normal
physiological loading (low), 4% that corresponds to intense
physiological loading (medium), and 6% that induces the
onset of the pathophysiological condition (high) [27]. Also,
the two physiological cyclic loading frequencies selected,
0.1 Hz (low) and 1 Hz (high), correspond to gentle and
rapid stretching of tendons during body movement [29].
The regular tendon rehabilitation regime of short cyclic
loading (2 hours/day) for a minimum period of one week
was the chosen loading duration for this study [30]. Since
uniaxial tensile force governs the dynamic in vivo environ-
ment of tendons, it was considered to be the most relevant
type of mechanical loading to stimulate ASCs towards
tenogenic differentiation [27].
The samples were then harvested to characterize the cell
viability, proliferation, matrix organization, and gene expres-
sion profiles of ASC-encapsulated 3D collagen scaffolds.
ASC-encapsulated collagen scaffolds subjected to no loading
(0%) were used as a negative control. For gene expression
studies, ASC-encapsulated scaffolds cultured in media con-
taining 1000 ng/ml BMP- 12 based on a previous study [20]
was used as the positive control. This was to provide a refer-
ence for direct comparison of the gene expression profile
obtained due to chemical versus mechanical stimulation of
ASCs within collagen scaffolds.
2.2. ASC Viability and Proliferation within 3D Collagen
Scaffolds. The viability of ASCs encapsulated within the
loaded and nonloaded 3D collagen scaffolds was examined
after 7 days of loading using Live-Dead Assay kit (Life Tech-
nologies, US). The samples were incubated in 1 : 2 ratio of
calcein and ethidium homodimer-1 dyes for 30 minutes
at 37
°
C and were subsequently fixed with 4% paraformal-
dehyde (Sigma, US) for 30 minutes at room temperature.
The cells within the scaffolds were examined using confo-
cal microscopy at 490/525 nm and 557/576 nm excitation/
emission wavelengths to visualize live (green) and dead
(red) cells, respectively.
ASC proliferation within the loaded and nonloaded
scaffolds was indirectly quantified by estimating the
amount of DNA within each scaffold using PicoGreen ds
DNA kit (ThermoFisher, US). The samples were snapped
frozen in liquid nitrogen and the cells were subsequently
liberated from the collagen scaffolds by mechanical disrup-
tion using a homogenizing pestle. The crushed samples
were then resuspended in lysis buffer (50 mM Tris HCl,
1 mM CaCl
2
, 400 μg/ml, pH = 8), and 200 μg/ml of pro-
teinase K was added to each sample solution and incu-
bated at 55
°
C overnight. The lysed samples were diluted
2 Stem Cells International

1 : 10 in TE buffer and mixed in 1 : 1 ratio with 1 : 200
working dilution of PicoGreen dye in microplate wells.
After incubating the samples at room temperature for 5
minutes, they were measured for fluorescence at 480/
520 nm excitation/emission wavelengths using a microplate
fluorometer (Wallac 1420). DNA in each sample was eval-
uated using a standard curve generated using the amounts
of DNA (in ng) extracted from different cell densities of
ASC and their corresponding fluorescence readings.
2.3. Matrix Organization within ASC-Encapsulated 3D
Collagen Scaffolds. The matrix organization exhibited by the
ASC-encapsulated collagen scaffolds under various mechan-
ical loading regimes was visualized using scanning electron
microscopy (SEM). After 7 days of mechanical stimulation,
the loaded and nonloaded samples were fixed overnight with
4% paraformaldehyde. The samples were dehydrated by
incubating them for 15 minutes each in a series of ethanol/
water gradients followed by 20 minutes each in hexamethyl-
disilazane/ethanol gradients, both ranging from 30% to
100%. The samples were air-dried in a chemical hood over-
night, sputter-coated with gold, and imaged through SEM
to examine the morphology and structural changes in the
loaded and nonloaded scaffolds. Further, the degree of matrix
organization of the collagen fibers of each sample was quan-
tified by obtaining directionality histograms (n=4) using
Fiji/ImageJ Directionality plugin (NIH, US) [31, 32].
2.4. Gene Expression Analysis of ASCs Encapsulated within
3D Collagen Scaffolds. The differentiation response of ASC-
encapsulated 3D collagen scaffolds at various strains and
loading frequencies was studied by performing expression
analysis of extracellular matrix and tenogenic, osteogenic,
and chondrogenic genes through quantitative real-time poly-
merase chain reaction (qPCR). The scaffolds were crushed,
RNA was extracted using TRIzol reagent (Thermo Fisher
Scientific, US), and reverse transcription was performed
using Omniscript RT kit (Qiagen, US) as per the manufac-
turer’s instructions. Quantitative real-time PCR was per-
formed using SYBR Green PCR master mix (Thermo Fisher
Scientific, US) for detecting the expression of ECM genes
collagen I (COL I), collagen III (COL III), decorin (DCN),
and aggrecan (ACAN); tenogenic markers tenascin-C
(TCN), scleraxis (SCX), and tenomodulin (TNMD); osteo-
genic markers Runt-related transcription factor 2 (RUNX2)
and alkaline phosphatase (ALP); chondrogenic markers Sox
9 and collagen II (COL II); and myogenic markers myogenic
differentiation antigen (MyoD) and myogenin (MYOG),
with glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
as the normalizing gene. The primer sequences were
obtained from published literature as listed in Table 1 and
purchased from Integrated DNA Technologies. PCR was
performed in the iCycler iQ detection system (Biorad, US)
with thermocycling performed for 40 cycles. Expression of
each gene was normalized to the gene expression level of
GAPDH for each sample. The data was analyzed for fold
difference in gene expression with respect to the nonloaded
negative control samples using the ΔΔCt method.
2.5. Statistical Analysis. Four samples (n=4) were used for all
image-based studies, and biological assays and eight samples
(n=8) were utilized for gene expression studies. Statistical
analysis was performed by ANOVA followed by Fisher’s
LSD post hoc using IBM SPSS Statistics software. The data
is reported as the mean and all error bars are ±standard
deviation of the mean. ∗indicates significant fold increase
in loaded samples with respect to 0% nonloaded group. ∗
indicates p<005,∗∗ denotes p<0 01, and ∗∗∗ corre-
sponds to p<0001.†represents a significant difference
between 2% and 4% groups loaded at the same magnitude
Table 1: Forward and reverse primers used for real-time PCR.
Gene Forward primer Reverse primer Ref
GAPDH 5′AGAAGGCTGGGGCTGATTTG 3′5′AGGGCCCATCCACAGTCTTC 3′[33]
COL I 5′GGCTCCTGCTCCTCTTAGCG 3′5′CATGGTACCTGAGGCCGTTC 3′[25]
COL III 5′CAGCGGTTCTCCAGGCAAGG 3′5′CTCCAGTGATCCCAGCAATCC 3′[25]
DCN 5′CGCCTCATCTGAGGGAGCTT 3′5′TACTGGACCGGGTTGCTGAA 3′[25]
ACAN 5′CACTGTTACCGCCACTTCCC 3′5′ACCAGCGGAAGTCCCCTTCG 3′[34]
TCN 5′GGTGGATGGATTGTGTTCCTGAGA 3′5′CTGTGTCCTTGTCAAAGGTGGAGA 3′[25]
SCX 5′ACACCCAGCCCAAACAGA 3′5′GCGGTCCTTGCTCAACTTTC 3′[25]
TNMD 5′CCATGCTGGATGAGAGAGGT 3′5′CTCGTCCTCCTTGGTAGCAG 3′[34]
RUNX2 5′CAACCACAGAACCACAAGTGC 3′5′TGTTTGATGCCATAGTCCCTCC 3′[25]
ALP 5′GATCTTCTTTCTCCTTTGCCTGG 3′5′TGTTTGCAGTGGTGGTTCTGGCA 3′[26]
COL II 5′GGCAATAGCAGGTTCACGTACA 3′5′CGATAACAGTCTTGCCCCACTT 3′[35]
Sox 9 5′CACACAGCTCACTCGACCTTG 3′5′TTCGGTTATTTTTAGGATCATCTCG 3′[26]
MyoD 5′GCAGGTGTAACCGTAACC 3′5′ACGTACAAATTCCCTGTAGC 3′[36]
MYOG 5′GCCACAGATGCCACTACTTC 3′5′CAACTTCAGCACAGGAGACC 3′[36]
3Stem Cells International

of frequency while ‡is the statistical difference with respect
to 6% group loaded at the same magnitude of frequency, both
with a 95% confidence interval. # represents a significant dif-
ference between 0.1 Hz and 1 Hz groups at the same magni-
tude of strain with p<005. § depicts significant difference
with respect to nonloaded samples chemically stimulated
with BMP-12 with p<005.
3. Results
3.1. Effect of Uniaxial Tensile Loading on ASC Viability and
Proliferation within 3D Collagen Scaffolds. The effect of
uniaxial tensile loading on the viability of ASCs within 3D
collagen scaffolds was evaluated by performing confocal
microscopy of samples stained with calcein and ethidium
homodimer. The representative cell viability images for each
group, namely, samples loaded at 0% (nonloaded), 2%, 4%,
and 6% strains at 0.1 Hz and 1 Hz frequencies are presented
in Figure 1(a).
The images indicate that the ASCs are predominantly
viable (green) and no visible cell death is observed in the
control and any of the loaded samples. Looking at the
morphology of ASCs subjected to mechanical loading, a
prominent change is evident in the sample loaded with
2% strain at 0.1 Hz frequency, where the cells are elon-
gated, appear to have cytoplasmic extensions similar to
spindle-shaped tendon cells, and are in the process of
orienting themselves within the matrix. Cells from the rest
of the groups including all samples loaded at 1 Hz and
scaffolds loaded at 4% and 6% strain at 0.1 Hz have a
0.1 Hz
1 Hz
0% strain 2% strain 4% strain 6% strain
(a)
400,000
350,000
300,000
250,000
200,000
Cell number within scaold
150,000
100,000
50,000
0
0%
0.1 Hz
1 Hz
2%
Applied strain
4% 6%
⁎
⁎
(b)
Figure 1: Effect of uniaxial tensile loading on ASC viability and proliferation within 3D collagen scaffolds. (a) Confocal images of ASC-seeded
collagen constructs subjected to 7 days of uniaxial loading at 0%, 2%, 4%, and 6% strains and 0.1 Hz and 1Hz frequencies. Green represents
live cells and dead cells are stained red. Scale bar represents 100 μm. Cells are viable within the loaded collagen scaffolds. (b) Quantification of
cell number within scaffolds by estimating the DNA content. Red dotted line indicates the initial cell number in each sample. ∗represents the
statistical difference from the other groups. Cells subjected to mechanical stimulation remain viable but show limited proliferation when
compared to control samples.
4 Stem Cells International

rounded appearance similar to those of the nonloaded
control samples.
Next, ASC proliferation within the collagen scaffolds sub-
jected to the different uniaxial tensile loading regimes was
indirectly estimated by quantifying the amount of DNA
within each sample through PicoGreen dsDNA assay (Life
Technologies, US) and correlating it with cell number as
shown in Figure 1(b). The results confirm that there is
no decrease in cell number over 7 days of culture com-
pared to the initial density of 200,000 cells encapsulated
within each scaffold indicated by the red dotted line.
Further, no correlation of cell proliferation is visible with
respect to both variations in strains and frequencies of
the loading regimes. However, the ASCs in all the loaded
groups, though viable, show limited proliferation, with
the numbers ranging between 200,000 and 250,000 cells.
On the other hand, a 1.5-fold increase in cell proliferation
is observed within nonloaded control scaffolds (p<0 05).
3.2. Effect of Uniaxial Tensile Loading on Matrix
Organization of ASC-Encapsulated 3D Collagen Scaffolds.
The matrix organization induced in ASC-encapsulated colla-
gen scaffolds due to the application of uniaxial tensile loading
at different strains and frequencies was visualized through
SEM. The representative SEM images of samples loaded at
0% (nonloaded), 2%, 4%, and 6% strains at 0.1 Hz and 1 Hz
frequencies are shown in Figures 2(a) and 3(a), respectively.
The SEM images of control (nonloaded) scaffolds and
uniaxial tensile-loaded scaffolds for both frequencies indicate
that matrix organization is clearly visible in the scaffolds
loaded at 2%, 4%, and 6% uniaxial tensile strains, while
control scaffolds demonstrate random collagen fiber distri-
bution. To quantify the extent of matrix organization of each
sample, directionality histograms were generated using Fiji/
ImageJ. The representative histograms for samples loaded
at 0%, 2%, 4%, and 6% strains at 0.1 Hz and 1 Hz frequencies
are presented in Figures 2(b) and 3(b), respectively. The
image for the nonloaded control sample (0%) exhibits no
definitive peak in the histogram indicating random distribu-
tion of collagen fibers, with directionality amount of 0.015.
Significantly, the loaded samples exhibit higher directional-
ity, with values of 0.03, 0.035, and 0.04 at 0.1 Hz and 0.03,
0.04, and 0.05 at 1 Hz, when loaded at strains of 2%, 4%,
and 6%, respectively. It is also observed that the peak in each
loaded sample occurs around 0
°
in angle, which implies that
the fiber orientation of the scaffold matrix is in the direction
of the uniaxial tensile load application.
To determine whether the changes in the extent of matrix
directionality are statistically significant, histograms obtained
from images taken for each loaded group and the nonloaded
control were combined and consolidated in one graph for
direct comparison as shown in Figure 4.
Figure 4 demonstrates that the loaded samples at 2%,
4%, and 6% strains show statistically significant increases
in their matrix alignment in comparison to nonloaded
samples at both 0.1 Hz and 1 Hz loading frequencies. The
applied strain values of 2%, 4%, and 6% induced a 2-fold,
3-fold, and 4-fold increase, respectively, in the amount of
matrix directionality (p<005) (Figure 4). On the other
hand, no such correlation is observed with change in
loading frequencies at the same applied physiological strains
of 2% and 4%. Interestingly, the higher strain magnitude of
6% corresponding to the pathophysiological loading of
tendon depicts a significant increase in matrix directionality
with a change in frequency from 0.1 Hz to 1 Hz (p<005).
3.3. Effect of Uniaxial Tensile Loading on ECM Gene
Expression of ASCs Encapsulated within 3D Collagen
Scaffolds. The effect of uniaxial tensile loading on the expres-
sion of ECM genes such as collagen and glycosaminogly-
cans (GAGs) was investigated through qPCR. PCR was
performed after 7 days of mechanical stimulation at 0%
(nonloaded; negative control), 2%, 4%, and 6% strains at
0.1 Hz and 1 Hz frequencies. ASC-encapsulated collagen
scaffolds chemically stimulated with BMP-12 were used
as the positive control. Figure 5(a) shows the fold change
in collagen I and collagen III gene expression in ASCs at
2%, 4%, and 6% uniform strains at 0.1 Hz and 1 Hz fre-
quencies of cyclic loading and BMP-12 treated samples
with respect to the 0% (nonloaded) group.
Figure 5(a) demonstrates significant increases in both
collagen I and collagen III expressions in mechanically
loaded samples at the aforementioned applied strains and
frequencies when compared to the 0% group. Collagen III
shows 5- to 25-fold increase in expression in the ASC-
encapsulated samples subjected to uniaxial tensile strains of
2%, 4%, and 6% at loading frequencies of 0.1 Hz and 1 Hz
in comparison to the nonloaded samples (p<0 05). The
chemically stimulated positive control group (BMP-12) is
observed to have a 5-fold increase in collagen III expression
(p<005). Further, collagen I displays a 3- to 5-fold statisti-
cally higher expression in all ASC samples subjected to uni-
axial tensile mechanical loading, including 2%, 4%, and 6%
strains at 0.1 Hz and 1 Hz frequencies (p<0 05), except for
samples loaded at 6% strain and 1 Hz. Interestingly, BMP-
12 is unable to elicit a significant increase in collagen I when
compared to nonloaded scaffolds.
Figure 5(b) depicts the fold difference in GAG expression
exhibited by loaded ASC-encapsulated collagen scaffolds and
positive control group through studying the expression levels
of decorin and aggrecan. GAGs do not exhibit a global
increase in expression with uniaxial tensile loading, unlike
collagens. In fact, the only groups that show predominantly
significant increases in both decorin and aggrecan are the
ones loaded at 2% strain at both 0.1 Hz and 1Hz frequencies.
Samples subjected to 2% at 0.1 Hz result in a 2-fold
increase in decorin and aggrecan in comparison to the
control (p<005), while 2% at 1 Hz group exhibits 8–10
times increase in decorin (p<0 001) and aggrecan expres-
sion (p<001). No significant rise in GAG expression is
seen in the rest of the mechanically loaded regimes except
for a 3-fold increase in aggrecan at the loading condition
of 4% and 0.1 Hz (p<0 01). Finally, ASC-encapsulated
scaffolds treated with BMP-12 do not show a change in
the expression of decorin but exhibit a 5-fold increase in
aggrecan expression (p<0 05).
Observing the ECM results for 0.1 Hz and 1 Hz in
Figure 5, it appears that among 2% strained samples, the
5Stem Cells International

higher frequency of 1 Hz is able to stimulate more ECM pro-
duction than 0.1 Hz. However, statistical analysis between
0.1 Hz and 1 Hz groups strained at 2% reveals a significant
increase only in case of collagen III expression (p<0 05).
Samples strained at 4% and 6% show little variation in the
expression profiles of the four ECM genes between the load-
ing frequencies of 0.1 Hz and 1 Hz.
Thus, Figure 5 reveals that (a) mechanical loading at spe-
cific loading regimes effect an increase in the expression of
ECM genes of ASCs encapsulated in 3D collagen scaffolds,
(b) there are clear differences in ASC response in terms of
ECM stimulation with both varying strains and frequencies
with respect to both nonloaded and BMP-12-treated sam-
ples, and (c) significant increases in both tendon-specific
collagens and GAGs are seen for groups strained with 2%
at both 0.1 Hz and 1 Hz while 4% strain at 0.1 Hz and
1 Hz stimulates significant increases in predominantly the
collagen genes.
0%
2%
0.1 Hz
4%
6%
(a)
0
0.0025
0.005
0.0075
0.01
0.0125
0.015
−90 −60 −30 0 30 60 90
Amount
0
0.005
0.01
0.015
0.02
0.025
0.03
Amount
0
0.01
0.02
0.03
0.04
Amount
0
0.01
0.02
0.03
0.04
Amount
Direction (°)
−90 −60 −30 0 30 60 90
Direction (°)
−90 −60 −30 0 30 60 90
Direction (°)
−90 −60 −30 0 30 60 90
Direction (°)
(b)
Figure 2: Effect of uniaxial tensile loading at 0.1 Hz frequency on matrix organization of ASC-encapsulated 3D collagen scaffolds. (a) SEM
images and (b) directionality histograms of ASC-seeded collagen constructs subjected to 7 days of uniaxial loading at 0%, 2%, 4%, and 6%
strains at 0.1 Hz frequency. Scale bar in the image represents 100 μm. Sharper and higher peak in the histogram demonstrates a higher
degree of orientation of the fibers. The matrix orientation is parallel to the axis of tensile load application.
6 Stem Cells International

3.4. Effect of Uniaxial Tensile Loading on Tenogenic
Differentiation of ASCs Encapsulated within 3D Collagen
Scaffolds. The expression level of tenogenic markers tenas-
cin-C, scleraxis, and tenomodulin was quantified for samples
loaded with 0% (nonloaded), 2%, 4%, and 6% strains at
0.1 Hz and 1 Hz loading frequencies, along with samples
chemically treated with BMP-12 and presented in Figure 6.
The ASC-encapsulated scaffolds stimulated with BMP-
12 meanwhile exhibit increased tenogenic response as
established in previous studies [20, 37], with 10-fold rise
in tenascin and 2-fold increases in scleraxis and tenomo-
dulin. Among the mechanically stimulated groups, it is
observed that 2% strain groups at both 0.1 Hz and 1 Hz
display increases in tendon-related gene expression in
ASCs. The 2% at 0.1 Hz group shows 4-fold increases of
tenascin-C (p<0 01) and scleraxis (p<0 05) and 8-fold
rise in tenomodulin (p<005) while at 1 Hz tenascin and
tenomodulin increase by 6-fold (p<0 05) with scleraxis
0%
4%
2%
6%
1 Hz
(a)
0
0.0025
0.005
0.0075
0.01
0.0125
0.015
Amount
0
0.01
0.02
0.03
Amount
0
0.01
0.02
0.03
0.04
Amount
0
0.01
0.02
0.03
0.04
0.05
Amount
−90 −60 −30 0 30 60 90
Direction (°)
−90 −60 −30 0 30 60 90
Direction (°)
−90 −60 −30 0 30 60 90
Direction (°)
−90 −60 −30 0 30 60 90
Direction (°)
(b)
Figure 3: Effect of uniaxial tensile loading at 1 Hz frequency on matrix organization of ASC-encapsulated 3D collagen scaffolds. (a) SEM
images and (b) directionality histograms of ASC-seeded collagen constructs subjected to 7 days of uniaxial loading at 0%, 2%, 4%, and 6%
strains at 1 Hz frequency. Scale bar in the image represents 100 μm. Sharper and higher peak in the histogram demonstrates a higher
degree of orientation of the fibers. The matrix orientation is parallel to the axis of tensile load application.
7Stem Cells International

rising as high as 15-fold (p<0 01) in comparison to the
0% (nonloaded) samples. Similar to the trend seen with
the ECM gene expression, though 2% loaded samples at
1 Hz appear to have higher tenogenic gene expression
compared to 0.1 Hz loaded samples, only scleraxis is statis-
tically different between 1 Hz and 0.1 Hz at 2% loading
regime (p<005). Also showing higher ASC tenogenesis
are samples subjected to 4% strain at 1 Hz, with 15, 9,
and 6-fold increases in tenascin, scleraxis, and tenomodu-
lin, respectively.
On the other hand, samples loaded at 6% strain at both
0.1 Hz and 1 Hz frequencies and 4% at 0.1 Hz do not show
any marked increases in tenogenic genes. Thus, amongst
the mechanically stimulated groups, the only three groups
exhibiting significant fold increases in tenogenic markers
were 2% at 0.1 Hz, 2% at 1 Hz, and 4% at 1 Hz (Figure 6).
These samples notably coincide with the groups that also
showed increased ECM gene expression in Figure 5.
3.5. Effect of Mechanical Loading on Osteogenic, Chondrogenic,
and Myogenic Differentiation of ASCs Encapsulated within
3D Collagen Scaffolds. To identify the potential for the ASCs
to undergo multilineage musculoskeletal differentiation,
nontenogenic markers were also evaluated. We quantified
the expression levels of osteogenic, chondrogenic, and
myogenic markers in ASCs encapsulated within 3D collagen
scaffolds subjected to uniaxial tensile loading at 0% (non-
loaded), 2%, 4%, and 6% at 0.1 Hz and 1 Hz frequencies for
7 days as shown in Figures 7, 8, and 9, respectively.
Figure 7 displays the ASC expression profile of osteogenic
genes RUNX2 and ALP. Cells stimulated with the growth
factor BMP-12 do not show any change in the level of osteo-
genic markers. Among the mechanically loaded samples, 4%
strain at 1 Hz frequency is the only uniaxial tensile loading
regime that exhibits increases in both osteogenic gene expres-
sion, with 4-fold increases of RUNX2 and ALP when
compared to the 0% (nonloaded) group.
Figure 8 depicts the ASC expression profile of chondro-
genic genes collagen II and Sox 9. The results clearly demon-
strate that ASCs seeded within the collagen scaffolds undergo
a chondrogenic response only when stimulated at 2% strain
at 1 Hz frequency, with over 10-fold increases in both colla-
gen II (p<001) and Sox 9 expression (p<0001) when
compared to the 0% (nonloaded) samples. The rest of the
groups, including the samples treated with BMP-12, do not
exhibit any increase in chondrogenic markers.
Finally, the myogenic lineage commitment potential of
ASCs in response to uniaxial tensile loading for myogenic
genes MyoD and myogenin is displayed in Figure 9. The data
reveals that there are no significant changes observed in the
levels of myogenic markers in any of the groups, and neither
mechanical loading nor BMP-12 treatment was able to elicit a
myogenic response from ASCs after 7 days in culture within
3D collagen scaffolds.
4. Discussion
ASCs have been gaining popularity over BMSCs for tendon
tissue-engineering strategies in recent years due to their rela-
tive abundance, ease of isolation, and anti-inflammatory
properties [19, 38]. Apart from their ability to differentiate
into various mesodermal lineages in the presence of chemical
factors, it is known that ASCs also can respond to mechanical
stimuli by undergoing changes in their morphology and bio-
chemical expression [25, 39, 40]. However, the effect of dif-
ferent mechanical loading regimes on the proliferation and
differentiation of ASCs remains largely unknown. Signifi-
cantly, though ASCs and BMSCs are similar in many of their
characteristics, there are strong evidences that ASCs tend to
respond differently to mechanical stimulation when com-
pared to BMSCs. One such early finding revealed that
mechanical loading suppressed the myogenic protein expres-
sion in ASCs, whereas others studies that used similar load-
ing parameters enhanced myogenesis of BMSCs [41–43].
These contrasting results call for a systematic study with
ASCs to investigate their morphological and differentiation
response to different mechanical loading regimes. Also, most
of the current literature that reports the effect of mechanical
forces involves monolayer cells subjected to a single and con-
tinuous mechanical loading regime ranging up to 72 hours of
duration [39, 44–47]. Thus, to the best of our knowledge,
there is no study that explores the effect of different physio-
logically relevant cyclic uniaxial tensile loading regimes in
influencing the lineage commitment and morphology of
ASCs within a 3D microenvironment that would be relevant
to the ongoing tissue-engineering efforts for tendon healing
and regeneration. Hence, through this work, we aimed to
identify the magnitude of uniaxial tensile strain and loading
⁎⁎
⁎
⁎⁎
⁎
#
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0% 2% 4% 6%
Amount of directionality
Applied strain
0.1 Hz
1 Hz
Figure 4: Effect of uniaxial tensile loading on matrix organization of
ASC-encapsulated 3D collagen scaffolds. Quantified directionality
of ASC-seeded collagen constructs subjected to 7 days of uniaxial
loading at 0%, 2%, 4%, and 6% strains at 0.1 Hz and 1 Hz
frequencies after consolidating the directionality histograms of
SEM images obtained using ImageJ analysis shown in Figures 2
and 3. ∗represents statistical difference from the adjacent strain
group. # denotes statistical significance between same strain
groups at different frequencies. The directionality of collagen
fibers increases with an increase in the magnitude of strain but
largely remains unaffected by the change in frequency (except for
6% group).
8 Stem Cells International

frequency appropriate for initiating tenogenic differentiation
of ASCs cultured within 3D collagen scaffolds in response to
short durations of uniaxial tensile loading on a daily basis
over a period of 7 days.
ASC-encapsulated 3D collagen scaffolds loaded at 2%,
4%, or 6% strain at 0.1 Hz or 1 Hz frequency for 2
hours/day over a period of 7 days demonstrated significant
differences between each loading regime, in terms of their
the cell morphology, matrix organization, and cell differ-
entiation response.
The cell morphology of ASCs within most loaded
groups appeared spherical in shape, similar to those in
the nonloaded samples, except for the samples subjected
to 2% strain at 0.1 Hz frequency. The cells in this group
displayed striking changes, notably their elongated cell
structure with the presence of cytoplasmic extensions sim-
ilar to spindle-shaped tendon cells, and were found to be
in the process of reorienting themselves within the matrix
(Figure 1(a)). Further investigation of the ASC morpholog-
ical response to 2% strain and 0.1 Hz loading regime
would be essential to understanding its mechanotransduc-
tion signaling mechanism over the 7-day loading period.
Previous mechanistic studies have demonstrated that actin
cytoskeleton remodeling directs cell realignment which
occurs within 12 hours of continuous loading [48, 49].
Quantification of ASC proliferation within the mechani-
cally stimulated scaffolds revealed that though ASCs in the
loaded groups were viable, they all show limited proliferation
over the period of 7 days when compared to their original
seeding density (Figure 1(b)). Thus, no correlation was
observed between the loading strain or frequency and the
extent of cell proliferation. This result concurs with certain
published articles who reported little or inhibited prolifer-
ation of ASCs, BMSCs, and tendon fibroblasts when
subjected to mechanical loading. Significantly, this was
accompanied with higher ECM gene expression and pro-
tein synthesis compared to the nonloaded samples. In
another research, BMSCs encapsulated within a polymeric
biomaterial were subjected to 10% strain at 1 Hz frequency
for 3 hours/day and demonstrated no significant cell pro-
liferation over a 21-day period, but resulted in enhanced
expression of collagen I, collagen III, and tenascin markers
[14]. Hence, we hypothesize that the limited proliferation
of ASCs on the application of uniaxial tensile loading
regimes observed in this study could be an indicator of
an onset of cell differentiation.
The SEM images of loaded ASC-encapsulated scaffolds
showed distinct compaction of collagen fibers at each of the
applied strains and frequencies, while the nonloaded control
group exhibited a highly random matrix (Figures 2(a) and
3(a)). Our previous study demonstrated that even on apply-
ing the same uniaxial tensile loading regime, the extent of
collagen matrix compaction can vary significantly based on
the type of cells encapsulated within the scaffold [28]. Also,
higher cell densities within the scaffold are known to increase
the extent of matrix compaction and increase the diameter of
collagen fibers [50]. Thus, this matrix organization is attrib-
uted to a combinatorial effect of mechanical loading and
ASC-mediated compaction of collagen fibers, which is also
in agreement with other studies that performed mechanical
loading of cell-encapsulated biomaterials [51, 52]. Further-
more, a positive correlation between the strain magnitude
⁎⁎ ⁎⁎ #
⁎
⁎§
‡
†
⁎⁎⁎
⁎⁎⁎
§
⁎⁎
⁎
#
§
‡
†
§
⁎⁎ ⁎⁎
⁎⁎
0
5
10
15
20
25
30
35
40
45
0% 2% 4% 6% 2% 4% 6% BMP-12
Fold dierence in gene expression
Collagen I
Collagen III
0.1 Hz 1 Hz
ECM markers
(a)
Fold dierence in gene expression
§
§
§
‡
†
⁎⁎⁎
§§
‡
‡
⁎⁎
0
2
4
6
8
10
12
14
16
0% 2% 4% 6% 2% 4% 6% BMP-12
Decorin
Aggrecan
0.1 Hz 1 Hz
⁎⁎
⁎⁎
⁎
(b)
Figure 5: Effect of uniaxial tensile loading on ECM gene expression of ASCs encapsulated within 3D collagen scaffolds. (a) Gene
expression profiles of ASCs encapsulated within collagen scaffolds subjected to BMP-12 treatment or uniaxial loading at 0%, 2%, 4%, and
6% strains at 0.1 Hz and 1 Hz. The graphs depict fold changes in various extracellular matrix genes: collagen I and collagen III, (b) GAGs:
decorin and aggrecan. ∗indicates significant fold increase with respect to the 0% samples. ∗indicates p<005,∗∗ denotes p<0 01, and
∗∗∗ corresponds to p<0001.†represents a significant difference between 2% and 4% groups while ‡is the statistical difference with
respect to 6% group, both with a 95% confidence interval. # represents a significant difference between 0.1 Hz and 1 Hz groups at the same
magnitude of strain with p<005. § depicts significant difference with respect to unloaded samples chemically stimulated with BMP-12
with p<005. The mechanically stimulated samples display an increased level of ECM markers compared to the nonloaded scaffolds.
9Stem Cells International

and the degree of organization of collagen fibers was evident
at both loading frequencies of 0.1 Hz and 1 Hz (Figure 4).
However, no specific trend in the scaffold matrix directional-
ity was observed between different frequencies at the same
magnitude of applied strain (Figure 4). Though there was
an apparent difference in the directionality between samples
loaded at 0.1 Hz and 1 Hz frequencies at 6% applied strain, a
closer examination of the images used for directionality anal-
yses revealed that it was mainly influenced by a very small
region of dense matrix organization at the ends of the width
of the scaffolds. This is most likely due to the increased accel-
eration required by the bioreactor to achieve the high strain
and frequency regime.
The expression profiles of the prominent ECM genes and
various mesenchymal tissue markers were quantified for
ASC-encapsulated scaffolds loaded at 0% (nonloaded), 2%,
4%, and 6% strain at 0.1 Hz and 1 Hz frequencies for 7 days.
Significantly, collagen I, the main constituent of the tendon
ECM [27], exhibited a 3–5-fold increase in mRNA expres-
sion under all of the uniaxial tensile loading regimes with
the exception of 6% at 1 Hz (Figure 5(a)). Interestingly,
BMP-12 treatment was unable to elicit a significant increase
in collagen I levels (Figure 5(a)). This result conforms to
the previous study where BMP-12 did not induce a rise in
collagen I expression within ASCs [20]. This suggests that
mechanical stimulation is more effective when compared to
treatment with chemical factors in its ability to direct colla-
gen I gene expression, possibly due to the combination of
cell- and mechanical loading-mediated matrix organization.
Collagen III, which is secreted in the early stages of ECM
synthesis [53], displayed significantly higher expression in
all of the loaded ASC-encapsulated samples, with the fold
increases being even higher than collagen I (Figure 5(a)).
This is in accordance with many previous studies that have
observed increased collagen III expression in MSCs seeded
with 3D tissue-engineered scaffolds [44, 54, 55]. In fact, one
study involving culture of human MSCs within collagen
scaffolds noticed an increase only in collagen III level but
no difference in collagen I expression upon mechanical stim-
ulation [56]. This could imply that the collagen I microenvi-
ronment induces the ASCs to increase collagen III expression
more than collagen I. Nevertheless, our results are relevant to
tendon tissue-engineering applications because, in a normal
tendon-healing response, collagen III is secreted initially
and then later replaced with collagen I [57].
‡
#
#
§
‡
0
5
10
15
20
25
30
0% 2% 4% 6% 2% 4% 6% BMP-12
Fold change in gene expression
Tenascin
Scleraxis
Tenomodulin
0.1 Hz 1 Hz
Tenogenic lineage
⁎⁎⁎
‡
⁎
⁎⁎⁎
⁎
⁎
⁎
⁎
⁎
⁎⁎
⁎⁎
⁎⁎
Figure 6: Effect of uniaxial tensile loading on tenogenic gene
expression of ASCs encapsulated within 3D collagen scaffolds.
Gene expression profiles of ASCs encapsulated within collagen
scaffolds subjected to BMP-12 treatment or uniaxial loading at 0%
(unloaded), 2%, 4%, and 6% strains at 0.1 Hz and 1 Hz loading
frequencies. The graph depicts fold changes in various tenogenic
markers: tenascin-C, scleraxis, and tenomodulin. ∗indicates
significant fold increase with respect to the 0% samples. ∗
indicates p<005,∗∗ denotes p<0 01.‡is the statistical
difference with respect to 6% group, both with a 95% confidence
interval. # represents a significant difference between 0.1 Hz
and 1 Hz groups at the same magnitude of strain with p<005.
§ depicts significant difference with respect to unloaded samples
chemically stimulated with BMP-12 with p<005. Samples
stimulated with 2% strain at both 0.1 Hz and 1 Hz show increased
levels of all three tenogenic markers.
†
§
§
§
‡
0
1
2
3
4
5
6
7
8
9
0% 2% 4% 6% 2% 4% 6% BMP-12
Fold change in gene expression
RUNX2
ALP
0.1 Hz 1 Hz
Osteogenic lineage
⁎
⁎
⁎
⁎
⁎⁎
Figure 7: Effect of uniaxial tensile loading on osteogenic gene
expression of ASCs within 3D collagen scaffolds. Gene expression
profiles of ASCs encapsulated within collagen scaffolds subjected
to BMP-12 treatment or uniaxial loading at 0% (unloaded), 2%,
4%, and 6% strains at 0.1 Hz and 1 Hz loading frequencies. The
graphs depict fold changes in osteogenic markers: RUNX2 and
ALP. ∗indicates significant fold increase with respect to the 0%
samples. ∗indicates p<005,∗∗ denotes p<0 01.†represents a
significant difference between 2% and 4% groups while ‡is the
statistical difference with respect to 6% group, both with a 95%
confidence interval. # represents a significant difference between
0.1 Hz and 1 Hz groups at the same magnitude of strain with
p<005. § depicts significant difference with respect to unloaded
samples chemically stimulated with BMP-12 with p<005.
Samples stimulated with 4% strain at 1 Hz showed increased levels
of both osteogenic markers.
10 Stem Cells International

Unlike collagen, GAGs, that are known to play a role in
regulating the alignment and orientation of collagen fibers
[53], exhibit significant increases in expression only when
loaded at 2% strain at both 0.1 Hz and 1 Hz frequencies
(Figure 5(b)). Though widely associated with cartilage
tissues, GAGs also are an essential component of the native
tendon ECM, and hence, their increase in expression is
encouraging for tendon tissue-engineering strategies. This
result conforms to prior studies focusing on tenogenic differ-
entiation of ASCs that have observed an elevation in aggre-
can expression [20].
Tenogenic differentiation of ASCs due to mechanical
loading was determined by quantifying the expression levels
of tenascin, scleraxis, and tenomodulin. Tenascin is a protein
expressed during tendon development and plays a role in
increasing the tissue elasticity in response to mechanical
loading [14]. Scleraxis is a transcription factor detected in
tendon precursor cells and is considered to be a definitive
marker for tenogenic differentiation. Tenomodulin is a regu-
lator of cell differentiation and collagen maturation [53].
Thus, the three genes are known to play a vital role in the
initiation of tenogenic differentiation of MSCs. The results
obtained in Figure 6 led to the identification of three groups:
2% at 0.1 Hz, 2% at 1 Hz, and 4% at 1 Hz that showed
statistically significant increases in fold expression of all
three tenogenic markers. Remarkably, these groups coin-
cided with the groups that showed increased collagens
and GAG expression (Figure 5).
From the combined gene expression data for ECM and
tenogenic markers, no obvious correlation could be deter-
mined between the applied strain and the fold change in
gene expression within ASCs at the same loading fre-
quency. While collagens have similar expression levels
when subjected to 2%, 4%, or 6% strains, GAG expression
is observed to be highest at 2% strain, beyond which there
is a significant decrease at the applied strains of 4% and
6%. Tenogenic markers also show no particular trend in
gene expression with increasing magnitudes of strain,
though 2% strain exhibits the highest tendon-specific gene
expression among the applied loads. Published literature
indicates that there is no threshold for applied strains after
which MSC differentiation to tenocytes is always ensured.
In fact, it is observed that there is an upper limit to the
applied strain beyond which the gene expression either
remains constant or starts decreasing [22], which is
reflected in our set of results as well.
Comparing the effect of different frequencies on the ASC
gene expression profile at the same applied strain value, our
results indicate that tenogenic markers demonstrate a clear
increase in gene expression from 0.1 Hz to 1 Hz. In case of
ECM genes, both collagen and GAG expression are similar
at 0.1 Hz and 1 Hz for the applied strains of 4% and 6%.
Interestingly, for 2% strain, 1 Hz shows higher ECM and
gene expression when compared 0.1 Hz. Though certain
monolayer cell studies have suggested that higher applied
#
§
‡
†
⁎⁎
‡
†
§
‡
†
0
2
4
6
8
10
12
14
16
18
20
22
24
0% 2% 4% 6% 2% 4% 6% BMP-12
Fold change in gene expression
Collagen II
Sox 9
0.1 Hz 1 Hz
Chondrogenic lineage
⁎⁎⁎
Figure 8: Effect of uniaxial tensile loading on chondrogenic gene
expression of ASCs within 3D collagen scaffolds. Gene expression
profiles of ASCs encapsulated within collagen scaffolds subjected
to BMP-12 treatment or uniaxial loading at 0% (unloaded), 2%,
4%, and 6% strains at 0.1 Hz and 1 Hz loading frequencies. The
graphs depict fold changes in various chondrogenic markers:
collagen II and Sox 9. ∗∗ denotes p<001 and ∗∗∗ corresponds
to p<0001.†represents a significant difference between 2% and
4% groups while ‡is the statistical difference with respect to
6% group, both with a 95% confidence interval. # represents a
significant difference between 0.1 Hz and 1 Hz groups at the same
magnitude of strain with p<005. § depicts significant difference
with respect to unloaded samples chemically stimulated with
BMP-12 with p<005. Samples stimulated with 2% strain at 1 Hz
showed increased levels of both chondrogenic markers.
0
1
2
3
4
5
6
7
8
9
0% 2% 4% 6% 2% 4% 6% BMP-12
Fold change in gene expression
MyoD
Myogenin
0.1 Hz 1 Hz
Myogenic lineage
Figure 9: Effect of uniaxial tensile loading on myogenic gene
expression of ASCs within 3D collagen scaffolds. Gene expression
profiles of ASCs encapsulated within collagen scaffolds subjected
to BMP-12 treatment or uniaxial loading at 0% (unloaded), 2%,
4%, and 6% strains at 0.1 Hz and 1 Hz loading frequencies. The
graphs depict fold changes in various myogenic markers: MyoD
and myogenin. No significant increase of myogenic markers in
ASCs was observed in any of the mechanically stimulated groups.
11Stem Cells International

frequency results in higher folds of gene expression possi-
bly due to the acceleration of the cell signaling cascade
[58, 59], other studies have failed to identify such correla-
tion [22, 23]. From our results, it could be broadly stated
that at low magnitudes of applied strain, an increase in
loading frequency is able to elicit a higher amount of gene
expression from ASCs.
ASCs being mesenchymal stem cells have the potential to
differentiate into various musculoskeletal lineages including
the bone, cartilage, and skeletal muscles in response to
mechanical loading [19, 60]. For instance, an earlier study
has reported the synergistic expression of bone and tendon
proteins in bone marrow-derived MSCs stimulated due to
mechanical loading [61]. This is undesirable for tendon
tissue-engineering strategies because of the risk of the tendon
getting mineralized [37]. Thus, in order to identify the appro-
priate uniaxial tensile strain and loading frequency for
tenogenic differentiation, we also evaluated the expression
levels of osteogenic, chondrogenic, and myogenic markers
in mechanically stimulated ASCs encapsulated within 3D
collagen scaffolds. The key findings of the overall gene
expression analysis have been presented in a concise manner
in Figure 10.
The previously identified groups of 2% at 0.1 Hz, 2% at
1 Hz, and 4% at 1 Hz that demonstrated significant increases
in tenogenic and ECM markers were consolidated into one
graph for direct comparison. Figure 10 demonstrates that
the samples loaded at 2% strain and 0.1 Hz frequency display
only the tenogenic differentiation markers, along with
increased levels of ECM genes. The groups loaded at 2%
and 4% strains at 1 Hz frequency, though exhibit increased
levels of tenogenic markers, are also accompanied by elevated
expression of chondrogenic and osteogenic markers, respec-
tively. Thus, among the various uniaxial tensile loading
regimes applied to stimulate the ASC-encapsulated 3D colla-
gen scaffolds, 2% strain at 0.1 Hz frequency emerges to be the
appropriate condition that is able to initiate tenogenic
differentiation of ASCs, without any potential evidence of
multilineage differentiation. Published studies that have
investigated the effect of mechanical loading on MSCs and
BMSCs have often identified the 1 Hz frequency to be
suitable for tenogenic differentiation [22, 23, 62]. Even our
results display equal if not higher ECM and tenogenic gene
expression at 1 Hz when compared to 0.1 Hz (Figures 5 and
6). However, the risk of cross-differentiation into other mus-
culoskeletal lineages seems to be significantly enhanced with
the use of higher loading frequency of 1 Hz and hence makes
0.1 Hz the preferred choice of cycling rate when developing
strategies for tendon tissue engineering. Additionally, since
2% strain and 0.1 Hz is the normal physiological loading
condition for tendons, it should be appropriate for the
tendon healing and rehabilitation phase.
Though the experimental design of this study was formu-
lated and executed after thorough consideration and litera-
ture search, there exist several limitations that need to be
mentioned. Firstly, since the study was designed with the
aim of catering to tissue-engineering applications towards
tendon healing, short duration of cyclic uniaxial tensile load-
ing on a daily basis simulating a regular rehabilitation regime
was employed, where the ASCs-encapsulated scaffolds were
loaded for 2 hours/day over a 7-day duration. By applying
varied combinations of low, medium, and high physiological
uniaxial tensile strains and low and high loading frequencies,
we identified: (A) the appropriate loading condition suitable
for initiating tenogenic differentiation of ASCs without any
cross-differentiation potential, and (B) a possible correlation
between the magnitude of strain or frequency and the ASCs-
mediated matrix organization or gene expression profiles.
This, however, limited the possibility to track the morpholog-
ical and functional responses of ASCs at frequent and regular
intervals, which would have shed more light on the mecha-
nistic aspect of the results. Nevertheless, having identified
the most appropriate loading condition for ASC tenogenesis
through this research, the next step would be to dwell deeper
into the mechanisms driving the changes in ASC structure
and gene expression profiles. This could be performed by
including multiple time points such as day 1, 3, 5, and 7. Also,
since Rho/GTPase is reported to play a major role in the
transduction of mechanical strains into intracellular signals
by influencing the alignment of cytoskeletal proteins like
actin, using an appropriate inhibitor would allow identify-
ing the underlying signaling mechanism governing ASCs
[23, 63, 64]. Further, the correlation between the angle of
ASC orientation within the matrix and the corresponding
fold-changes in tenogenic expression could reveal further
information regarding the mechanical signal transduction
involved in the process [22].
Secondly, while the human ASCs used in this study were
purchased from a commercial vendor (Thermofisher, US)
and have been through rigorous quality control to meet
their specifications in terms of purity, cell homogeneity,
and ability to differentiate into multiple mesenchymal lin-
eages to ensure data reproducibility, there could still be
some batch-to-batch variations in terms of the cell behav-
ior and response. Nevertheless, since this study focuses on
the effect of differentloading conditions on the cells, the
relative differences in cell response observed between the
different magnitudes of strains and frequencies regimes
are considered reliable and relevant.
Thirdly, although comprehensive gene expression analy-
ses have been performed in this work, which not only
included ECM and tenogenic genes but also other mesoderm
lineage markers belonging to the osteogenic, chondrogenic,
and myogenic tissues, the translation of the mRNA expres-
sion into protein synthesis was not evaluated. This would
be important to evaluate in order to determine whether the
mechanostimulated scaffolds are able to elicit a functional
response from the ASCs and contribute to deposition of
new matrix.
5. Conclusion
In conclusion, the combined results of the ASC-encapsulated
collagen scaffolds subjected to mechanical stimulation at 2%
strain and 0.1 Hz frequency indic ate key features: (a) there is
adefinitive change in the ASC morphology with the rounded
cells resembling more like tendon fibroblasts, with their elon-
gated shape and the cytoplasmic extensions, (b) the scaffold
12 Stem Cells International

matrix shows distinct organization with the directionality of
collagen fibers being parallel to the axis of load application,
(c) the gene expression data demonstrates significant
increases in ECM and tendon-related genes, and (d) no
cross-differentiation potential of ASCs to osteogenic, chon-
drogenic, or myogenic lineage is observed giving rise to pure
tenogenic differentiation. Thus, 2% strain at 0.1 Hz frequency
is identified to be the appropriate uniaxial mechanical
COL I TNC RUNX2 COL II
MYOD
COL III SCX
ALP Sox9 MYOG
DCN
TNMD
ACAN
0
5
10
15
20
25
30
35
ECM
Tenogenic
Osteogenic
Chondrogenic
Myogenic
ECM
Tenogenic
Osteogenic
Chondrogenic
Myogenic
Fold change in gene expression
Fold change in gene expression
2%, 0.1 Hz
COL I
TNC
RUNX2
COL II
MYOD
COL III
SCX
ALP
Sox9
MYOG
DCN TNMD
ACAN
0
5
10
15
20
25
30
35 2%, 1 Hz
COL I
TNC
RUNX2
COL II MYOD
COL III
SCX ALP
Sox9
MYOG
DCN
TNMD
ACAN
0
5
10
15
20
25
30
35
ECM
Tenogenic
Osteogenic
Chondrogenic
Myogenic
Fold change in gene expression
4%, 1 Hz
SCX
Figure 10: Effect of uniaxial tensile loading on ASC differentiation within collagen 3D scaffolds. Gene expression profile of ECM, tenogenic,
osteogenic, chondrogenic, and myogenic markers mapped for samples loaded at 2% strain at 0.1 Hz, 2% strain at 1Hz, and 4% strain at 1 Hz.
Genes highlighted in yellow indicate statistically higher expressions when compared to nonloaded samples (p<005).
13Stem Cells International

loading strain and frequency to induce tenogenic differentia-
tion of ASCs for tendon tissue engineering. This study
primarily uses gene expression analyses to determine the
role of different physiological mechanical strains and
frequencies in eliciting a tenogenic response from ASCs.
Further work is required to evaluate the protein expression
profile exhibited by ASCs, and the signaling pathways that
drive the mechanical loading-induced ASC tenogenesis
within 3D collagen scaffolds at the identified uniaxial ten-
sile strain of 2% with 0.1 Hz frequency.
Conflicts of Interest
The authors declare that there are no any conflicts of interest
regarding the publication of this paper.
References
[1] D. L. Butler, C. Gooch, K. R. Kinneberg et al., “The use of
mesenchymal stem cells in collagen-based scaffolds for
tissue-engineered repair of tendons,”Nature Protocols, vol. 5,
no. 5, pp. 849–863, 2010.
[2] J. L. Chen, Z. Yin, W. L. Shen et al., “Efficacy of hESC-MSCs in
knitted silk-collagen scaffold for tendon tissue engineering and
their roles,”Biomaterials, vol. 31, no. 36, pp. 9438–9451, 2010.
[3] R. Bray, R. Rangayyan, and C. Frank, “Normal and healing lig-
ament vascularity: a quantitative histological assessment in the
adult rabbit medial collateral ligament,”Journal of Anatomy,
vol. 188, Part 1, pp. 87–95, 1996.
[4] K. Hildebrand, C. Frank, and D. Hart, “Gene intervention in
ligament and tendon: current status, challenges, future direc-
tions,”Gene Therapy, vol. 11, no. 4, pp. 368–378, 2004.
[5] P. Manske, “Flexor tendon healing,”The Journal of Hand
Surgery: British & European Volume, vol. 13, no. 3, pp. 237–
245, 1988.
[6] S. Chaudhury, C. Holland, M. S. Thompson, F. Vollrath, and
A. J. Carr, “Tensile and shear mechanical properties of rotator
cuffrepair patches,”Journal of Shoulder and Elbow Surgery,
vol. 21, no. 9, pp. 1168–1176, 2012.
[7] A. Moshiri and A. Oryan, “Tendon and ligament tissue engi-
neering, healing and regenerative medicine,”Journal of Sports
Medicine & Doping Studies, vol. 03, no. 02, 2013.
[8] H. Fan, H. Liu, S. L. Toh, and J. C. Goh, “Anterior cruciate
ligament regeneration using mesenchymal stem cells and silk
scaffold in large animal model,”Biomaterials, vol. 30, no. 28,
pp. 4967–4977, 2009.
[9] M. Garcia-Fuentes, A. J. Meinel, M. Hilbe, L. Meinel, and H. P.
Merkle, “Silk fibroin/hyaluronan scaffolds for human mesen-
chymal stem cell culture in tissue engineering,”Biomaterials,
vol. 30, no. 28, pp. 5068–5076, 2009.
[10] N. Juncosa-Melvin, J. T. Shearn, G. P. Boivin et al., “Effects of
mechanical stimulation on the biomechanics and histology of
stem cell-collagen sponge constructs for rabbit patellar tendon
repair,”Tissue Engineering, vol. 12, no. 8, pp. 2291–2300, 2006.
[11] A. K. Chong, A. D. Ang, J. C. Goh et al., “Bone marrow-derived
mesenchymal stem cells influence early tendon-healing in a
rabbit Achilles tendon model,”The Journal of Bone and Joint
Surgery American Volume, vol. 89, no. 1, pp. 74–81, 2007.
[12] L. V. Gulotta, D. Kovacevic, J. R. Ehteshami, E. Dagher, J. D.
Packer, and S. A. Rodeo, “Application of bone marrow-
derived mesenchymal stem cells in a rotator cuffrepair
model,”The American Journal of Sports Medicine, vol. 37,
no. 11, pp. 2126–2133, 2009.
[13] J. Y-J, T. Muneta, H. Yoshimura, H. Koga, and I. Sekiya,
“Synovial mesenchymal stem cells accelerate early remodeling
of tendon-bone healing,”Cell and Tissue Research, vol. 332,
no. 3, pp. 469–478, 2008.
[14] D. M. Doroski, M. E. Levenston, and J. S. Temenoff,“Cyclic
tensile culture promotes fibroblastic differentiation of marrow
stromal cells encapsulated in poly (ethylene glycol)-based
hydrogels,”Tissue Engineering Part A, vol. 16, no. 11,
pp. 3457–3466, 2010.
[15] R. I. Issa, B. Engebretson, L. Rustom, P. S. McFetridge, and
V. I. Sikavitsas, “The effect of cell seeding density on the cellu-
lar and mechanical properties of a mechanostimulated tissue-
engineered tendon,”Tissue Engineering Part A, vol. 17,
no. 11-12, pp. 1479–1487, 2011.
[16] X. Zhang, D. Bogdanowicz, C. Erisken, N. M. Lee, and L. HH,
“Biomimetic scaffold design for functional and integrative ten-
don repair,”Journal of Shoulder and Elbow Surgery, vol. 21,
no. 2, pp. 266–277, 2012.
[17] L. V. Gulotta, S. Chaudhury, and D. Wiznia, “Stem cells for
augmenting tendon repair,”Stem Cells International,
vol. 2012, Article ID 291431, 7 pages, 2012.
[18] J. Ross, M. Duxson, and A. Harris, “Neural determination of
muscle fibre numbers in embryonic rat lumbrical muscles,”
Development, vol. 100, no. 3, pp. 395–409, 1987.
[19] J. M. Gimble, W. Grayson, F. Guilak, M. J. Lopez, and
G. Vunjak-Novakovic, “Adipose tissue as a stem cell source
for musculo-skeletal regeneration,”Frontiers in Bioscience,
vol. S3, no. 1, pp. 69–81, 2011.
[20] H. Shen, R. H. Gelberman, M. J. Silva, S. E. Sakiyama-Elbert,
and S. Thomopoulos, “BMP12 induces tenogenic differentia-
tion of adipose-derived stromal cells,”PLoS One, vol. 8,
no. 10, article e77613, 2013.
[21] H. Tapp, E. N. Hanley, J. C. Patt, and H. E. Gruber, “Adipose-
derived stem cells: characterization and current application in
orthopaedic tissue repair,”Experimental Biology and Medicine,
vol. 234, no. 1, pp. 1–9, 2009.
[22] Y. Morita, S. Watanabe, Y. Ju, and B. Xu, “Determination of
optimal cyclic uniaxial stretches for stem cell-to-tenocyte
differentiation under a wide range of mechanical stretch con-
ditions by evaluating gene expression and protein synthesis
levels,”Acta of Bioengineering and Biomechanics, vol. 15,
no. 3, pp. 71–79, 2013.
[23] H. Y. Nam, B. Pingguan-Murphy, A. A. Abbas, A. M.
Merican, and T. Kamarul, “The proliferation and tenogenic
differentiation potential of bone marrow-derived mesenchy-
mal stromal cell are influenced by specific uniaxial cyclic
tensile loading conditions,”Biomechanics and Modeling in
Mechanobiology, vol. 14, no. 3, pp. 649–663, 2015.
[24] E. Potier, J. Noailly, and K. Ito, “Directing bone marrow-
derived stromal cell function with mechanics,”Journal of
Biomechanics, vol. 43, no. 5, pp. 807–817, 2010.
[25] G. Yang, B. B. Rothrauff, H. Lin, R. Gottardi, P. G. Alexander,
and R. S. Tuan, “Enhancement of tenogenic differentiation
of human adipose stem cells by tendon-derived extracellu-
lar matrix,”Biomaterials, vol. 34, no. 37, pp. 9295–9306,
2013.
[26] J. W. Park, J. Y. Suh, and H. J. Chung, “Effects of calcium ion
incorporation on osteoblast gene expression in MC3T3-E1
cells cultured on microstructured titanium surfaces,”Journal
14 Stem Cells International

of Biomedical Materials Research Part A, vol. 86A, no. 1,
pp. 117–126, 2008.
[27] J. H.-C. Wang, “Mechanobiology of tendon,”Journal of
Biomechanics, vol. 39, no. 9, pp. 1563–1582, 2006.
[28] G. Subramanian, M. Elsaadany, C. Bialorucki, and E. Yildirim-
Ayan, “Creating homogenous strain distribution within 3D
cell-encapsulated constructs using a simple and cost-effective
uniaxial tensile bioreactor: design and validation study,”
Biotechnology and Bioengineering, vol. 114, no. 8, pp. 1878–
1887, 2017.
[29] V. S. Nirmalanandhan, J. T. Shearn, N. Juncosa-Melvin et al.,
“Improving linear stiffness of the cell-seeded collagen sponge
constructs by varying the components of the mechanical stim-
ulus,”Tissue Engineering Part A, vol. 14, no. 11, pp. 1883–
1891, 2008.
[30] A. Scott, P. Danielson, T. Abraham, G. Fong, A. Sampaio,
and T. M. Underhill, “Mechanical force modulates scleraxis
expression in bioartificial tendons,”Journal of Musculoskele-
tal & Neuronal Interactions, vol. 11, no. 2, pp. 124–132,
2011.
[31] J. Schindelin, I. Arganda-Carreras, E. Frise et al., “Fiji: an
open-source platform for biological-image analysis,”Nature
Methods, vol. 9, no. 7, pp. 676–682, 2012.
[32] C. A. Schneider, W. S. Rasband, and K. W. Eliceiri, “NIH
image to ImageJ: 25 years of image analysis,”Nature Methods,
vol. 9, no. 7, pp. 671–675, 2012.
[33] L. Guo, B. Xie, and Z. Mao, “Autophagy in premature
senescent cells is activated via AMPK pathway,”Interna-
tional Journal of Molecular Sciences, vol. 13, no. 3,
pp. 3563–3582, 2012.
[34] M. F. Pietschmann, M. U. Wagenhäuser, M. F. Gülecyüz,
A. Ficklscherer, V. Jansson, and P. E. Müller, “The long head
of the biceps tendon is a suitable cell source for tendon tissue
regeneration,”Archives of Medical Science, vol. 10, no. 3,
pp. 587–596, 2014.
[35] N. Indrawattana, G. Chen, M. Tadokoro et al., “Growth fac-
tor combination for chondrogenic induction from human
mesenchymal stem cell,”Biochemical and Biophysical
Research Communications, vol. 320, no. 3, pp. 914–919,
2004.
[36] C.-H. Cui, T. Uyama, K. Miyado et al., “Menstrual blood-
derived cells confer human dystrophin expression in the
murine model of Duchenne muscular dystrophy via cell fusion
and myogenic transdifferentiation,”Molecular Biology of the
Cell, vol. 18, no. 5, pp. 1586–1594, 2007.
[37] D. Docheva, S. A. Müller, M. Majewski, and C. H. Evans,
“Biologics for tendon repair,”Advanced Drug Delivery
Reviews, vol. 84, pp. 222–239, 2015.
[38] H. Mizuno, M. Tobita, and A. C. Uysal, “Concise review:
adipose-derived stem cells as a novel tool for future regenera-
tive medicine,”Stem Cells, vol. 30, no. 5, pp. 804–810, 2012.
[39] M. Rabbani, M. Janmaleki, M. Tafazzoli-Shadpour,
M. Teymoori, and S. Rezvaninejad, “Effects of uniaxial cyclic
stretch loading on morphology of adipose derived stem cells,”
Tissue engineering and Regenerative Medicine, vol. 13, no. 4,
pp. 396–402, 2016.
[40] S. S. Raghavan, C. Y. Woon, A. Kraus, K. Megerle, H. Pham,
and J. Chang, “Optimization of human tendon tissue engineer-
ing: synergistic effects of growth factors for use in tendon
scaffold repopulation,”Plastic and Reconstructive Surgery,
vol. 129, no. 2, pp. 479–489, 2012.
[41] D. W. Hamilton, T. M. Maul, and D. A. Vorp, “Characteriza-
tion of the response of bone marrow-derived progenitor cells
to cyclic strain: implications for vascular tissue-engineering
applications,”Tissue Engineering, vol. 10, no. 3-4, pp. 361–
369, 2004.
[42] N. Kobayashi, T. Yasu, H. Ueba et al., “Mechanical stress
promotes the expression of smooth muscle-like properties in
marrow stromal cells,”Experimental Hematology, vol. 32,
no. 12, pp. 1238–1245, 2004.
[43] W.-C. C. Lee, T. M. Maul, D. A. Vorp, J. Rubin, and K. G.
Marra, “Effects of uniaxial cyclic strain on adipose-derived
stem cell morphology, proliferation, and differentiation,”Bio-
mechanics and Modeling in Mechanobiology, vol. 6, no. 4,
pp. 265–273, 2007.
[44] G. Altman, R. Horan, I. Martin et al., “Cell differentiation by
mechanical stress,”The FASEB Journal, vol. 16, no. 2,
pp. 270–272, 2002.
[45] V. Bayati, Y. Sadeghi, M. A. Shokrgozar et al., “The evaluation
of cyclic uniaxial strain on myogenic differentiation of
adipose-derived stem cells,”Tissue and Cell, vol. 43, no. 6,
pp. 359–366, 2011.
[46] C. Berry, C. Cacou, D. Lee, D. Bader, and J. Shelton, “Dermal
fibroblasts respond to mechanical conditioning in a strain pro-
file dependent manner,”Biorheology, vol. 40, no. 1-3, pp. 337–
345, 2003.
[47] X. Yang, P. Gong, Y. Lin et al., “Cyclic tensile stretch modu-
lates osteogenic differentiation of adipose-derived stem cells
via the BMP-2 pathway,”Archives of Medical Science, vol. 6,
no. 2, pp. 152–159, 2010.
[48] V. P. Shirinsky, A. S. Antonov, K. G. Birukov et al., “Mechano-
chemical control of human endothelium orientation and size,”
The Journal of Cell Biology, vol. 109, no. 1, pp. 331–339, 1989.
[49] B. E. Sumpio and A. J. Banes, “Response of porcine aortic
smooth muscle cells to cyclic tensional deformation in culture,”
Journal of Surgical Research, vol. 44, no. 6, pp. 696–701, 1988.
[50] P. Fernandez and A. R. Bausch, “The compaction of gels by
cells: a case of collective mechanical activity,”Integrative
Biology, vol. 1, no. 3, pp. 252–259, 2009.
[51] B. C. Isenberg and R. T. Tranquillo, “Long-term cyclic disten-
tion enhances the mechanical properties of collagen-based
media-equivalents,”Annals of Biomedical Engineering,
vol. 31, no. 8, pp. 937–949, 2003.
[52] E. Sander and V. Barocas, Biomimetic Collagen Tissues: Collag-
enous Tissue Engineering and Other Applications, Springer,
Collagen, 2008.
[53] R. James, G. Kesturu, G. Balian, and A. B. Chhabra, “Tendon:
biology, biomechanics, repair, growth factors, and evolving
treatment options,”The Journal of Hand Surgery, vol. 33,
no. 1, pp. 102–112, 2008.
[54] K. R. Kinneberg, V. S. Nirmalanandhan, N. Juncosa-Melvin
et al., “Chondroitin-6-sulfate incorporation and mechanical
stimulation increase MSC-collagen sponge construct stiff-
ness,”Journal of Orthopaedic Research, vol. 28, no. 8,
pp. 1092–1099, 2010.
[55] U. Nöth, K. Schupp, A. Heymer et al., “Anterior cruciate
ligament constructs fabricated from human mesenchymal
stem cells in a collagen type I hydrogel,”Cytotherapy, vol. 7,
no. 5, pp. 447–455, 2005.
[56] C. K. Kuo and R. S. Tuan, “Mechanoactive tenogenic differen-
tiation of human mesenchymal stem cells,”Tissue Engineering
Part A, vol. 14, no. 10, pp. 1615–1627, 2008.
15Stem Cells International

[57] P. Sharma and N. Maffulli, “Biology of tendon injury: healing,
modeling and remodeling,”Journal of Musculoskeletal and
Neuronal Interactions, vol. 6, no. 2, pp. 181–190, 2006.
[58] J. Mosley and L. Lanyon, “Strain rate as a controlling influence
on adaptive modeling in response to dynamic loading of the
ulna in growing male rats,”Bone, vol. 23, no. 4, pp. 313–318,
1998.
[59] A. Zaritsky, D. Kaplan, I. Hecht et al., “Propagating waves of
directionality and coordination orchestrate collective cell
migration,”PLoS Computational Biology, vol. 10, no. 7, article
e1003747, 2014.
[60] A. Trumbull, G. Subramanian, and E. Yildirim-Ayan,
“Mechanoresponsive musculoskeletal tissue differentiation of
adipose-derived stem cells,”Biomedical Engineering Online,
vol. 15, no. 1, p. 43, 2016.
[61] Y. F. Rui, P. P. Y. Lui, M. Ni, L. S. Chan, Y. W. Lee, and K. M.
Chan, “Mechanical loading increased BMP-2 expression
which promoted osteogenic differentiation of tendon-derived
stem cells,”Journal of Orthopaedic Research, vol. 29, no. 3,
pp. 390–396, 2011.
[62] Y. Morita, T. Sato, S. Watanabe, and Y. Ju, “Evaluation of pre-
cise optimal cyclic strain for tenogenic differentiation of
MSCs,”Mechanics of Biological Systems and Materials, vol. 6,
pp. 149–155, 2017.
[63] C. B. Clark, N. L. McKnight, and J. A. Frangos, “Stretch activa-
tion of GTP-binding proteins in C2C12 myoblasts,”Experi-
mental Cell Research, vol. 292, no. 2, pp. 265–273, 2004.
[64] M. J. Dalby, N. Gadegaard, and R. O. Oreffo, “Harnessing
nanotopography and integrin-matrix interactions to influence
stem cell fate,”Nature Materials, vol. 13, no. 6, pp. 558–569,
2014.
16 Stem Cells International