Content uploaded by Yu-ming Wang
Author content
All content in this area was uploaded by Yu-ming Wang on Mar 21, 2018
Content may be subject to copyright.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
author guidelines.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the ethical guidelines, outlined
in our author and reviewer resource centre, still apply. In no
event shall the Royal Society of Chemistry be held responsible
for any errors or omissions in this Accepted Manuscript or any
consequences arising from the use of any information it contains.
Accepted Manuscript
rsc.li/food-function
Food &
Function
Linking the chemistry and physics of food with health and nutrition
www.rsc.org/foodfunction
ISSN 2042-6496
PAPER
T. J. Wooster et al.
Impact of gastric pH profi les on the proteolytic digestion of mixed
lg-Xanthan biopolymer gels
Volume 7 Number 1 January 2016 Pages 1–612
Food &
Function
Linking the chemistry and physics of food with health and nutrition
View Article Online
View Journal
This article can be cited before page numbers have been issued, to do this please use: C. Chen, X. Han,
P. Dong, Z. Li, T. Yanagita, C. Xue, T. Zhang and Y. Wang, Food Funct., 2017, DOI: 10.1039/C7FO01599B.
Sea cucumber saponins liposomes ameliorate obesity-induced inflammation and
1
insulin resistance in high-fat diet-fed mice
2
Cheng Chen
1
, Xiuqing Han
1
, Ping Dong
1
, Zhaojie Li
1
, Teruyoshi Yanagita
3
, Changhu Xue
1,2
, 3
Tiantian Zhang
1
*, Yuming Wang
1,2
* 4
1
College of Food Science and Engineering, Ocean University of China, No.5 Yushan Road, 5
Qingdao 266003, P. R. China 6
2
Qingdao National Laboratory for Marine Science and Technology, Laboratory of Marine Drugs 7
& Biological products, Qingdao 266237, Shandong, China 8
3
Department of Health and Nutrition Science, Nishikyushu University, Kanzaki, Japan 9
*Author (Tiantian Zhang) for correspondence (E-mail: zhangtiantian@ouc.edu.cn; phone: 10
+86-532-82032597) 11
*Author (Yuming Wang) for correspondence (E-mail: wangyuming@ouc.edu.cn; phone: 12
+86-532-82032597) 13
14
Page 1 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Abstract: Obesity has become a worldwide concern in recent years, which may cause many 15
diseases. Much attention has been paid to food components that are considered to be beneficial in 16
preventing chronic metabolic diseases. The present study was conducted to investigate the effects 17
of sea cucumber saponins liposomes on certain metabolic markers associated with obesity. 18
C57/BL6 mice fed with high-fat diet were treated with different forms of sea cucumber saponins 19
for eight weeks. Results showed that liposomes exhibited better effects on anti-obesity and 20
anti-hyperlipidemia activities than common form of sea cucumber saponins. Sea cucumber 21
saponins liposomes could also effectively alleviate adipose tissues inflammation by reducing 22
pro-inflammatory cytokines releases and macrophage infiltration. Moreover, sea cucumber 23
saponins liposomes improved insulin resistance by altering uptake and utilization of glucose. 24
Taken together, our results indicated that intake of sea cucumber saponins liposomes might be 25
able to ameliorate obesity-induced inflammation and insulin resistance. 26
27
Key words: sea cucumber saponins; liposomes; obesity; inflammation; insulin resistance 28
29
Page 2 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
1. Introduction 30
Obesity gradually becomes a serious threat to health worldwide, which is considered to be 31
strongly associated with prevalence of the Metabolic Syndrome (MetS), type 2 diabetes (T2D) and 32
non-alcoholic fatty liver disease (NAFLD), endangering the morbidity and quality of life
1
. The 33
fundamental characteristic of obesity is an imbalance between caloric intake and consumption, 34
leading to storage of excess energy in adipose tissues
2
. It has been suggested that expanding 35
adipocytes would release large amounts of free fatty acid and then adipose tissues started to 36
produce chemotactic signals to recruit macrophage, which finally resulted in a chronic low-grade 37
inflammation state
3
. Besides, insulin resistance, characterized by inefficient utilization of glucose 38
and disturbance of glucose homeostasis, played an essential role in the development of metabolic 39
syndrome
4
. Dietary intervention has been proved to be good strategies for chronic metabolic 40
diseases resulted from unhealthy lifestyle. A large number of researches have been focusing on the 41
use of bioactive compounds including saponins originated from food in the treatment Japanese 42
researchers have indicated that Holothuria atra reduced serum total cheolesterol level of MetS
5-8
. 43
Japanese researchers have indicated that Holothuria atra reduced serum total cheolesterol level
9
. 44
Our previous studies showed that a dietary saponin supplement significantly suppressed adipose 45
accumulations, and reduced serum and hepatic lipids, moreover, saponin proved to be more 46
effective than other isolated components and was considered to be the main lipid-lowering 47
components in sea cucumber
10
. 48
Liposomes are spherical colloidal particles in which the internal aqueous cavity is surrounded by 49
a self-assembled lipid membrane
11
. Plenty of drug delivery vehicles have been developed from 50
different biomaterials, such as natural polymers and liposomes
12 13.
Many evidences suggested that 51
liposomes could be able to enhance activities of functional components in medicine or food
14
. Sea 52
cucumber saponins, also named as triterpene glycoside, are secondary metabolite of sea cucumber 53
and mainly distributed in the body wall and internal organs
15
. As one of the most important sea 54
cucumber compositions, they possess a wide range of biological activities including anti-tumor, 55
anti-fungal and anti-angiogenic effects
16
. In addition, sea cucumber saponins also play an effective 56
role in the treatment of metabolic syndrome. It has been reported that dietary saponions of sea 57
Page 3 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
cucumber could ameliorate obesity, hyperlipaemia, glucose intolerance and fatty liver in high-fat 58
diet-fed mice and NAFLD rats
17, 18
. Sea cucumber saponins have good solubility in water and this 59
property could reduce permeability and absorption in intestine
19
, which probably limits 60
bioavailability and bioactivity to a large degree. The usage of liposomes may overcome this 61
weakness and thus effectively increase the biological activities of sea cucumber saponions. 62
However, until now, little research has focused on the effects of sea cucumber saponins liposomes 63
on obesity-induced inflammation and insulin resistance. 64
Therefore, we evaluated the protective activity of sea cucumber saponins liposomes using 65
high-fat diet-induced mice. The aim of this work was to observe whether sea cucumber saponins 66
liposomes had better effects on some aspects of metabolic syndrome than its common form. 67
Furthermore, preliminary research was performed to study the possible mechanisms, which 68
provided a theoretical basis for utilization of sea cucumber saponins in form of liposomes. 69
2. Materials and methods 70
2.1 Extraction and analysis of sea cucumber saponins 71
Sea cucumbers, Pearsonothuria graeffei, were purchased from Nanshan aquatic market of 72
Qingdao (Shandong, China). Sea cucumber saponins were prepared according to the method of 73
Hu and made some alterations
17
. Air-dried body walls of sea cucumbers were grinded into powder 74
and extracted six times with 60% ethanol. The combined extracts were evaporated in vacuum and 75
then the water layers were collected. Samples dissolved in water layer were applied with HP20 76
resin column, eluted with water and 80% ethanol in turn. The fraction eluted with 80% ethanol 77
was collected to evaporate and sea cucumber saponins were finally obtained. The extracts were 78
analyzed with an Agilent 1100 high-performance liquid chromatography (HPLC) system. 79
2.2 Preparation of sea cucumber saponins liposomes 80
Egg phosphatidylcholine was selected for the wall material to entrap sea cucumber saponins in 81
this study due to the relatively high stability. It was purchased from Aoboxing Biology Technology 82
Co., Ltd (Beijing, China). A certain amount of egg phosphatidylcholine was weighted and 83
dissolved in chloroform-methanol (2:1) and then the solution was evaporated at 30 °C until it 84
formed a thin film in container. Sea cucumber saponins were weighted at the lipid-drug ratio of 85
Page 4 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
1:10 and dissolved in saline thoroughly. The sea cucumber saponins solution was added to the 86
container coating with a thin film, and then was dealt with ultrasonic processing in low 87
temperature to obtain crude liposomes with smaller particle size and higher entrapping efficiency. 88
Finally, the opalescent liposomes were suffered in a homogeneous system. It is noteworthy that 89
the sea cucumber saponins liposomes must be prepared every two days and preserved in low 90
temperature. 91
2.3 Animals and diets 92
The experiment was conducted according to guidelines provided by the ethical committee of 93
experimental animal care at Ocean University of China (Qingdao, China) ,according to guidelines 94
provided by the Ethical Committee of the University(Approval No.: SPXY2015012). Eight-week 95
male C57BL/6J mice (20-25 g) were purchased from Vital River (Beijing, China). After one-week 96
adaptation feeding, mice were randomly divided into four groups consisting of eight mice each. 97
Mice were assigned to the following groups: 1) low-fat group (LF); 2) high-fat group (HF); 3) sea 98
cucumber saponins liposomes group (SEL); 4) sea cucumber saponins and egg 99
phosphatidylcholine solution group (SW+EL). Basic diet was given in LF group and the rest of 100
groups were all given high-fat diet adding 20% lard to develop obesity. Meanwhile, two 101
experiment groups were treated with sea cucumber saponins in the way of drinking. The details 102
were as follows: SEL-liposomes solution (0.45 mg/ml mL sea cucumber saponins) and 103
SW+EL-simple mixture (containing the same concentration of sea cucumber saponins and egg 104
phosphatidylcholine). SW+EL were designed for contrast to SEL in this experiment. Diets were 105
prepared on the basis of AIN-93G, and detailed diet compositions were summarized in Table 1. All 106
mice had free access to water and food, and were housed individually in a room at a 12 h 107
light/dark cycle, constant temperature of 22 ± 2 °C. Daily food and water intakes were recorded 108
during experiment. After eight weeks, mice were sacrificed after fasting overnight. Blood was 109
collected by orbital venipuncture and serum was separated by centrifuging at 7,500 rpm for 15 110
min at 4 °C. Liver, adipose tissues and muscle were quickly excised, weighted and stored at 111
-80 °C until analysis. 112
2.4 Glucose tolerance tests 113
Glucose tolerance test was performed at the seventh week. Following 10 h of food deprivation, 114
Page 5 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
20 uL of tail blood was used to measure the fasting blood glucose levels. The glucose (2g/kg body 115
weight) was injected orally before experiment started. The measurement of serial blood glucose 116
was taken at 30, 60, and 120 min after injection. Blood glucose levels were determined using 117
diagnostic kit (Biosino, Beijing, China). 118
2.5 Analysis of serum lipids and glucose 119
Serum triacylglycerol (TG), total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-C) 120
and glucose level were determined using enzymatic reagent kits according to the manufacturer’s 121
instructions (Biosino, Beijing, China). 122
2.6 Assay of free fatty acid, glycerol and cytokines in adipose tissues 123
Frozen epididymal adipose tissues (100 mg) were homogenized in phosphate buffer saline (1 124
mL) at 4°C. Homogenates were centrifuged at 12,000 rpm for 15 min, and supernatants were 125
saved for analysis. The free fatty acid and glycerol content were measured by chemical method 126
according to the protocol supplied (Jiancheng Bioengineering Institute, Nanjing, China). 127
Commercially available ELISA kits were used to measure Tumor Necrosis Factor-α(TNF-α), Inter 128
Leukin-6(IL-6) and Prostaglandin G2(PGE2) levels in adipose tissues (Wuhan USCN Business 129
Co., Ltd, China). 130
2.7 Quantitative real-time PCR 131
Total RNA was extracted from frozen epididymal adipose tissues (100 mg) using Trizol reagent 132
(Invitrogen, USA) for analysis of gene expression. One microgram of total RNA, random primer 133
(TOYOBO, Japan) and Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) 134
(Promega, USA) were used for cDNA synthesis. The concentration of cDNA was analyzed by iQ5 135
Multicolor Real-Time PCR Detection System (Biorad, USA) using SYBR Green I Master Mix 136
(TOYOBO, Japan). Every sample was normalized to β-actin to determine the relative expression 137
level
20
. The primer sequences used for real-time PCR were listed in Table 2. 138
2.8 Western blotting 139
Frozen livers were homogenized in RIPA buffer at 4 °C. The homogenate was centrifuged at 140
12,000 rpm for 15 min, and the supernatant was used as total protein. The extraction of 14 1
cytoplasmic and membranous proteins of epididymal adipose tissue and muscle were performed 142
using protein extraction kits (Sangon, Shanghai, China). The proteins subjected to SDS–PAGE 143
Page 6 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
was transferred to polyvinylidene fluoride membranes (Merck Millipore, Billerica, USA). 144
Membranes were incubated for 2h at room temperature in TBST buffer containing 5% albumin 145
bovine V (Solarbio, Beijing, China), followed by washing and incubation with antibodies against 146
Extracellular Regulating Kinase (ERK1/2), phospho-Extracellular Regulating Kinase (p-ERK1/2), 147
Forkhead box protein O1 (foxO1), phosphor-Forkhead box protein O1 (p-foxO1), Glycogen 148
Synthase Kinase 3 (GSK3), phosphor-Glycogen Synthase Kinase 3 (p-GSK3), protein kinase B 149
(AKT), phosphor-protein kinase B (p-AKT), Glucose Transporter Type 4 (GLUT4) and β-actin 150
(Cell Signaling Technology) overnight at room temperature
2122
. Finally, membranes were 151
incubated with anti-rabbit IgG HRP-linked antibody (Cell Signaling Technology) for 2 h. Bands 152
were visualized by enhanced chemiluminescence (ECL) substrate with UVP Auto Chemi Image 153
system (UVP Inc., Upland, CA, USA). Normalization of protein expressions was conducted using 154
β-actin as control. 155
2.9 Statistical analyses 156
All values in tables were expressed as mean ± SEM. Statistical analyses were performed using 157
SPSS 18.0. t-test was used to compare means between LF group and HF group. Differences 158
among HF group and sea cucumber saponins groups were determined by Duncan’s multiple-range 159
test. 160
3. Results and discussion 161
3.1 Components analysis of sea cucumber saponins 162
The 100 mg extracts contained 90.6 mg total triterpene glycosides, suggesting that triterpene 163
glycosides were the main component. The result of HPLC analysis of the sea cucumber saponins 164
was shown in Fig. 1A. Holothurin A (HA) and Echinoside A (EA) were the main compounds in 165
sea cucumber saponins, and the structures of them were illustrated in Fig. 1B and 1C. 166
3.2 Effects of sea cucumber saponins liposomes on body weight, serum lipids and fat weight 167
in high-fat-diet induced obese mice 168
C57BL/6 mice were fed with experimental diets for 8 weeks. At the beginning of the feeding 169
experiment, the initial body weights were similar among all groups (22.85 to 22.88 g, Table 3). 170
The food intake of HF group was lower than LF group whereas the HF group gained higher body 171
weight (6.27 g) compared with the LF group (2.29 g), which indicated a successful model 172
Page 7 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
establishment (Table 3). Moreover, there was no statistically difference in water intake between 173
SEL and SW+EL groups, suggesting that the supplements of sea cucumber saponins were equal in 174
the two groups. After intaking saponins for 8 weeks, SEL group gained lower body weight (3.79 g) 175
than SW+EL group (5.07 g). In addition, the serum lipids were also evaluated. As expected, the 176
HF group showed the highest concentrations of serum TG, TC and LDL-C (Table 3). SEL-treated 177
group exhibited better effect on decreasing serum TC and LDL-C than SW+EL group. There were 178
no statistic differences (p>0.05) between SEL and SW+EL groups in serum TG but obvious 179
decrease for serum TG was observed in the SEL group (0.63 mmol/L) relative to the HF group 180
(0.80 mmol/L) (Table 3). The weights of liver and muscle had no statistical differences among all 181
groups (data not shown), while there were significant variations in weights of white adipose 182
tissues. The amount of total white adipose tissues in the SEL-treated mice were significantly 183
different (p<0.05) from those of HF group, which showed better effect than SW+EL group (Fig. 184
2A). Furthermore, both SEL and SW+EL groups had significant decreases in epididymal, 185
subcutaneous, mesenteric and perirenal fat relative to those of HF group and SEL group exhibited 186
the lowest values, suggesting that the liposomes solution had a better effect on fat accumulation 187
than simple mixture solution. However, there were no statistical differences in brown fat weight 188
among all groups (Fig. 2B), which probably because that excess energy was mainly accumulated 189
in white adipose tissues while brown fat played a part role in thermogenesis
23
. 190
3.3 Effects of sea cucumber saponins liposomes on GTT and fasting serum glucose 191
Mice were subjected to glucose tolerance test (GTT) in the seventh week of experiment. After 192
30 min, 60 min and 120 min of glucose administration, the blood glucose levels of HF group were 193
about 1.5 times higher than LF group (Fig. 2C), suggesting a severe impairment in glucose 194
tolerance. According to blood glucose levels in each time and calculated area under the curve of 195
GTT (Fig. 2D), we observed that SEL (p<0.05) could improve systemic glucose tolerance while 196
SW+EL did not exhibit improvement effect. The result from fasting blood glucose after scarifying 197
showed similar tendency as well (Fig. 2E). 198
3.4 Effects of sea cucumber saponins liposomes on inflammation in adipose tissues 199
Excessive accumulation of fat in adipose tissues led to aggravation of lipolysis
24.
Consistent 200
with it, adipocytes in HF group released more free fatty acids (p<0.05) and glycerol (p<0.01) than 201
Page 8 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
those of LF group (Fig. 3A and 3B). Both SEL and SW+EL showed significant inhibition effects 202
on lipolysis (p<0.05) and SEL had better effect in reducing free fatty acid (p<0.05). More and 203
more studies had suggested that increased adipocyte lipolysis led to macrophages infiltration in 204
obese condition
25
. In addition, elevated circulating free fatty acid resulted from increased lipolysis 205
in obesity also potentially contributed to the impairment in insulin sensitivity
26
. Therefore, the 206
inhibition of lipolysis is advantageous for systemic metabolism. 207
Obesity is often accompanied by inflammation in adipose tissues and the pathological state is 208
associated with macrophages infiltration
27
. In this study, we first examined the release of 20 9
cytokines in epididymal adipose tissues. Mice fed with high-fat diet secreted more TNF-α (p<0.05) 210
and IL-6 (p<0.01) than LF group (Fig. 3C and 3D), which reflected an inflammatory state. SEL 211
exhibited apparent alleviation effect on inhibiting pro-inflammatory cytokines production (p<0.05) 212
whereas SW+EL did not show any effects on them. Adipose tissue acted as a crucial site for 213
generation of inflammatory adipokines and mediators, including TNF-α, IL-6 and MCP1, which 214
was probably the main cause of systemic insulin resistance
28
. 215
Next, we observed the macrophages infiltration in this experiment. F4/80 and CD11b are the 216
surface markers of macrophages and may reflect the number of macrophages. High-fat-diet 217
feeding recruited more macrophages in adipose tissues than LF group, manifested by increasing 218
mRNA expressions of F4/80 (p<0.05) and CD11b (p<0.05) (Fig. 3E and 3F). Notably, SEL could 219
significantly reduce macrophages infiltration (p<0.05; p<0.05) whereas SW+EL showed no 220
alterations. These results were in accordance with those of pro-inflammatory cytokines. 221
During inflammation and obesity development, S100A8 and A9 recruited macrophages in 222
adipose tissue and might regulate inflammation through inflammasome activation
29
. Consistent 223
with previous studies
30
, the mRNA expressions of S100A8 and A9 in adipose tissues of obese 224
mice were three times higher than that in low-fat-diet feeding mice (p<0.05), and both SEL and 22 5
SW+EL were able to decrease the mRNA expressions of the heterodimer effectively (Fig. 3G). It 226
has been suggested that S100A8 and S100A9 induced the secretion of several pro-inflammatory 227
cytokines including IL-6, TNF-α and IL-1β by stimulating production of reactive oxygen species 228
(ROS)
31
. Their causations were unknown and subsequent research could target on this point. 229
3.5 The mechanism investigation on the production of PGE2 230
Page 9 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Previous research had indicated that adipocyte-originated prostaglandin E2 (PGE2) played 231
important roles in mediating lipolysis-induced macrophage recruitment and inducing the 232
inflammatory response
32
. We examined the level of PGE2 and found a remarkable increase in HF 233
group (Figure 4A). Both SEL and SW+EL showed inhibition effects (p<0.05). PGE2 has been 234
defined as a pro-inflammatory molecule and metabolic product of arachidonic acid
33
. cPLA2 235
promoted the release of arachidonic acid from the plasmatic membrane, leading to the synthesis of 236
prostaglandins and leukotrienes through cyclooxygenases (COX) action
34
. It has been reported 237
that cPLA2α was activated by phosphorylation at serine-505 by extracellular signal-regulated 238
kinase (ERK)
35
. Therefore, the expressions of proteins and mRNA in this pathway were then 239
investigated. Results showed that high-fat diet induced the phosphorylation of ERK (p<0.05) and 240
downstream mRNA expressions of cPLA2 (p<0.05) and COX1 (p<0.05) (Figure 4B-4D). SEL had 241
significant inhibitory actions on p-ERK, cPLA2 and COX1 (p<0.05), whereas SW+EL only 242
showed inhibition on the phosphorylation of ERK (P<0.05). There were no significant differences 243
(p>0.05) in the mRNA expression of COX2 among all groups (Figure 4E). COX is an important 244
enzyme involved in production of prostaglandin, which exists two isoforms referred to as COX1 245
and COX2
36
. COX1 is expressed constitutively in most cells and COX2 is induced by 246
inflammatory stimuli, hormones and growth factors. Both enzymes contributed to the release of 247
prostaglandin but most studies indicated that COX2-derived PGs appeared to be more important in 248
inflammatory process
37
. However, our results showed no differences in COX2 mRNA expression 249
while that of COX1 was in line with alterations of p-ERK and cPLA2, which were different from 250
previous studies. In addition, previous study had showed that suppression of the phosphorylation 251
of ERK could regulate inflammation thus the levels of TNF-α and IL-6 were down regulated
38
. 252
Hence, the inhibition of the phosphorylation of ERK was probably one of the main causes to 253
reduce pro-inflammatory cytokines releases and macrophages infiltration in present study. 254
3.6 Effects of sea cucumber saponins liposomes on insulin responding in liver and peripheral 255
tissues 256
Insulin exercise its function on regulating glucose mainly through the PI3K/AKT 257
(phosphoinositide-3-kinase/protein kinase B) signal pathway. Activated PI3K can phosphorylate 258
AKT to activate AKT so that insulin signal can be transducted
44
. Gluconeogenesis and glycogen 259
Page 10 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
synthesis are two major responding to insulin in liver
45
. The phosphorylation of glycogen synthase 260
kinase 3(GSK3) inhibits the acitivity of itself and leads to the activition of glycogen synthase and 261
enhancement in glucose uptake
46
. However, the decrease in hepatic Akt-dependent FoxO1 262
phosphorylation can enhance glycogenesis
47
. Skeletal muscle and adipose tissues are the main 263
sites for insulin-stimulated glucose uptake and glucose transporter type 4 (GLUT4) is an important 264
protein involved in this process. 265
An impairment in glucose tolerance was observed based on the GTT result. Dietary alteration 266
might affect the protein expressions invloved in gluconeogenesis, glycogen synthesis and glucose 267
uptake. In our experiment, high-fat-diet feeding significantly decreased the phosphorylation of 268
GSK3 (p<0.05) and FoxO1 (p<0.05) in liver(Fig. 5A and 5B). Compared with HF group, SEL and 269
SW+EL could statistically increase the phosphorylations of GSK3 and FoxO1, importantly, SEL 270
exhibited better effects than SW+EL group. In skeletal muscle, high-fat diet-feeding decreased the 271
phosphorylation of AKT significantly(p<0.01)(Fig. 5C) and the same tendency was observed in 272
adipose tissues(Fig. 5D). GLUT4 contents in both cytoplasm and plasma membrane decreased in 273
both skeletal muscle and adipose tissues (p<0.05;p<0.05)(Figure 5E and 5F). Compared with HF 274
group, SEL increased the phosphorylation of AKT (p<0.05;p<0.05) and thus increased the uptake 275
of glucose through the action of GLUT4(p<0.05;p<0.05) in the two peripheral tissues. However, 276
SW+EL showed no alterations on p-AKT and GLUT4. The failure in insulin signal transduction 277
by a series of proteins interactions might account for the decrease in insulin sensitivity. 278
The good performances of sea cucumber saponins liposomes were probably resulted from the 279
similar phospholipid bilayer structure of liposomes to intestinal epithelial cell so that liposomes 280
could be relative easily absorbed in intestinal tract. Previous studies had demonstrated that the 281
improved absorption of calcitonin as well as insulin using liposomes were due to prolonged 282
retention and higher mucoadhesiveness in intestinal tract
43
. These findings might support our 283
hypothesis in some aspects. Beyond that, the embedding effect of liposomes could protect sea 284
cucumber saponins from enzymes and microorganism, which probably further contributed to the 285
utilization of liposomes. 286
Together, our findings suggested that the sea cucumber saponins liposomes had therapeutic 287
potential in treating obesity and related diseases through mitigating adipose inflammation and 288
Page 11 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
impaired glucose metabolism induced by a high-fat diet while the same dosages of common sea 289
cucumber saponins could not achieve equivalent effects. Sea cucumber saponins liposomes could 29 0
effectively reduce the release of pro-inflammatory cytokines and infiltration of macrophage by 291
inhibition of ERK activation. Moreover, the uptake of sea cucumber saponins liposomes improved 292
insulin resistance, which could be attributed to alteration in uptake and utilization of glucose 293
through up-regulating GSK3 and foxO1 phosphorylation and GLUT4 content (Fig. 6). 294
4. Conclusion 295
In present study, sea cucumber saponins liposomes proved to be a better form in alleviating 296
obesity-induced inflammation and insulin resistance than its common form. Both forms of sea 297
cucumber saponins could regulate body weight, fat weight and serum lipid levels effectively, in 298
which the liposomes exhibited superior performances. Interestingly, only sea cucumber saponins 299
liposomes could reduce the release of pro-inflammatory cytokines and infiltration of macrophage 300
in obese mice. Especially, sea cucumber saponins liposomes could effectively act on 301
p-ERK/cPLA2/COX1 pathway and finally reduced PGE2 level in adipose tissues. The insulin 302
resistance in high-fat-diet feeding mice was only improved in the action of sea cucumber saponins 303
liposomes, which might be attributed to the enhanced abilities of liver to utilize glucose and 304
peripheral tissues to uptake glucose. Overall, liposomes proved to be a good form in the intake of 305
sea cucumber saponins, which exhibited better bioactivity in preventing diseases related to 306
metabolic syndrome. 307
Acknowledgement 308
This work was supported by the State Key Program of National Natural Science of China 309
(Grant No. 31330060), National Natural Science Foundation of China (No. 31571771), National 310
Natural Science Foundation of China(NSFC)-Shandong Joint Fund for Marine Science Research 311
Centers (U1606403), the Fundamental Research Funds for the Central Universities (No. 312
201762028). 313
References 314
1. R. P. Blackstone, Obesity-Related Diseases and Syndromes: Insulin Resistance, Type 2
315
Diabetes Mellitus, Non-alcoholic Fatty Liver Disease, Cardiovascular Disease, and Metabolic
316
Syndrome, Springer International Publishing, 2016.
317
2. E. D. Rosen and B. M. Spiegelman, Adipocytes as regulators of energy balance and glucose
318
Page 12 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
homeostasis, Nature, 2006, 444, 847.
319
3. D. Kim, J. H. Yoon, J. Kim and S. H. Ryu, Adipokines Involved in Macrophage Recruitment,
320
2014.
321
4. T. T. Zhang and J. G. Jiang, Active ingredients of traditional Chinese medicine in the treatment
322
of diabetes and diabetic complications, Expert Opinion on Investigational Drugs, 2012, 21,
323
1625-1642.
324
5. Z. Lin, W. Liao and J. Ren, Structural Characterization of a Polysaccharide Fraction from
325
Platycladus Orientalis (L.) Franco and Its Macrophage Immunomodulatory and Anti-Hepatitis
326
B Virus Activities, Journal of Agricultural & Food Chemistry, 2016, 64, 5813.
327
6. C. P. Wong, T. Kaneda and H. Morita, Plant natural products as an anti-lipid droplets
328
accumulation agent, Journal of Natural Medicines, 2014, 68, 253.
329
7. T. T. Zhang, M. Wang, L. Yang, J. G. Jiang, J. W. Zhao and W. Zhu, Flavonoid glycosides from
330
Rubus chingii Hu fruits display anti-inflammatory activity through suppressing MAPKs
331
activation in macrophages, Journal of Functional Foods, 2015, 18, 235-243.
332
8. M. Marrelli, F. Conforti, F. Araniti and G. A. Statti, Effects of Saponins on Lipid Metabolism:
333
A Review of Potential Health Benefits in the Treatment of Obesity, Molecules, 2016, 21, 1404.
334
9. Tanaka, K., Nishizono, S., Kase, A., Ogura, S., Kurita, M., & Murakami, T., et al. Effects of
335
dietary black sea cucumber on serum and liver lipid concentrations in rats, Bulletin of the
336
Kyoto Prefectural Institute of Agriculture, 2003, 56, 175-179.
337
10. Hu X Q, Xu J, Xue Y, et al. Effects of bioactive components of sea cucumber on the serum,
338
liver lipid profile and lipid absorption. Bioscience Biotechnology & Biochemistry, 2012, 76,
339
2214-2218.
340
11. D. D. Lasic, Recent developments in medical applications of liposomes: sterically stabilized
341
liposomes in cancer therapy and gene delivery in vivo, Journal of Controlled Release, 1997,
342
48, 203-222.
343
12. Yu Z, Paul R, Bhattacharya C, et al. Structural features facilitating tumor cell targeting and
344
internalization by bleomycin and its disaccharide, Biochemistry, 2015, 54,3100-3109.
345
13. Madathil M, Bhattacharya C, Yu Z, et al. Modified Bleomycin Disaccharides Exhibiting
346
Improved Tumor Cell Targeting, Biochemistry, 2015, 53,6800-10.
347
14. H. Yu, L. Teng, Q. Meng, Y. Li, X. Sun, J. Lu, R. J. Lee and L. Teng, Development of
348
liposomal Ginsenoside Rg3: Formulation optimization and evaluation of its anticancer effects,
349
International Journal of Pharmaceutics, 2013, 450, 250-258.
350
15. D. S. Van, P. Gerbaux and P. Flammang, Elucidation of molecular diversity and body
351
distribution of saponins in the sea cucumber Holothuria forskali (Echinodermata) by mass
352
spectrometry, Comparative Biochemistry & Physiology Part B Biochemistry & Molecular
353
Biology, 2009, 152, 124.
354
16. W. H. Yuan, Y. H. Yi, H. F. Tang, B. S. Liu, Z. L. Wang, G. Q. Sun, Z. Wen, L. Ling and S.
355
Peng, Antifungal triterpene glycosides from the sea cucumber Bohadschia marmorata, Planta
356
Medica, 2009, 75, 168-173.
357
17. X. Q. Hu, Y. M. Wang, J. F. Wang, Y. Xue, Z. J. Li, K. Nagao, T. Yanagita and C. H. Xue,
358
Dietary saponins of sea cucumber alleviate orotic acid-induced fatty liver in rats via PPARα
359
and SREBP-1c signaling, Lipids in Health & Disease, 2010, 9, 25.
360
18. X. Hu, Z. Li, Y. Xue, J. Xu, C. Xue, J. Wang and Y. Wang, Dietary saponins of sea cucumber
361
ameliorate obesity, hepatic steatosis, and glucose intolerance in high-fat diet-fed mice, Journal
362
Page 13 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
of Medicinal Food, 2012, 15, 909-916.
363
19. Z. Hossain, H. Kurihara, M. Hosokawa and K. Takahashi, Docosahexaenoic acid and
364
eicosapentaenoic acid-enriched phosphatidylcholine liposomes enhance the permeability,
365
transportation and uptake of phospholipids in Caco-2 cells, Molecular & Cellular
366
Biochemistry, 2006, 285, 155-163.
367
20. Yu Z, Cai Z, Chen Q, et al. Engineering β-sheet peptide assemblies for biomedical applications,
368
Biomaterials Science, 2016, 4,365.
369
21. Huang Y, Yang X, Xu T, et al. Overcoming resistance to TRAIL-induced apoptosis in solid
370
tumor cells by simultaneously targeting death receptors, c-FLIP and IAPs, International
371
Journal of Oncology, 2016, 49,153-163.
372
22. Liao W, Lai T, Chen L, et al. Synthesis and Characterization of a Walnut Peptides–Zinc
373
Complex and Its Antiproliferative Activity against Human Breast Carcinoma Cells through the
374
Induction of Apoptosis, Journal of Agricultural & Food Chemistry, 2016, 104,849-859.
375
23. A. Fenzl and F. W. Kiefer, Brown adipose tissue and thermogenesis, Hormone Molecular
376
Biology & Clinical Investigation, 2014, 19, 25-37.
377
24. A. Girousse, G. Tavernier, C. Valle, C. Moro, N. Mejhert, A. L. Dinel, M. Houssier, B.
378
Roussel, A. Bessepatin and M. Combes, Partial inhibition of adipose tissue lipolysis improves
379
glucose metabolism and insulin sensitivity without alteration of fat mass, Plos Biology, 2013,
380
11, e1001485.
381
25. G. Schoiswohl, M. Stefanovic-Racic, M. N. Menke, R. C. Wills, B. A. Surlow, M. K.
382
Basantani, M. T. Sitnick, L. Cai, C. F. Yazbeck and D. B. Stolz, Impact of Reduced
383
ATGL-Mediated Adipocyte Lipolysis on Obesity-Associated Insulin Resistance and
384
Inflammation in Male Mice, Endocrinology, 2015, 156, 3610.
385
26. P. Morigny, M. Houssier, E. Mouisel and D. Langin, Adipocyte lipolysis and insulin
386
resistance, Biochimie, 2016, 125, 259.
387
27. J. Ren, Y. Zheng, Z. Lin, X. Han and W. Liao, Macroporous resin purification and
388
characterization of flavonoids from Platycladus orientalis (L.) Franco and their effects on
389
macrophage inflammatory response, Food & Function, 2017, 8, 86.
390
28. H. Zand, N. Morshedzadeh and F. Naghashian, Signaling pathways linking inflammation to
391
insulin resistance, Diabetes & Metabolic Syndrome Clinical Research & Reviews, 2017.
392
29. R. D. Shah, C. Xue, H. Zhang, S. Tuteja, M. Li, M. P. Reilly and J. F. Ferguson, Expression of
393
Calgranulin Genes S100A8, S100A9 and S100A12 Is Modulated by n-3 PUFA during
394
Inflammation in Adipose Tissue and Mononuclear Cells, Plos One, 2017, 12, e0169614.
395
30. Nagareddy, Prabhakara, nbsp, Kraakman, Michael, Seth, nbsp, Stirzaker, Roslynn and nbsp,
396
Adipose Tissue Macrophages Promote Myelopoiesis and Monocytosis in Obesity, Cell
397
Metabolism, 2014, 19, 821-835.
398
31. J. C. Simard, A. Cesaro, J. Chapetonmontes, M. Tardif, F. Antoine, D. Girard and P. A. Tessier,
399
S100A8 and S100A9 Induce Cytokine Expression and Regulate the NLRP3 Inflammasome
400
via ROS-Dependent Activation of NF-κB1, PLoS ONE, 2013, 8, e72138.
401
32. X. Hu, V. Cifarelli, S. Sun, O. Kuda, N. A. Abumrad and X. Su, Major role of adipocyte
402
prostaglandin E2 in lipolysis-induced macrophage recruitment, Journal of Lipid Research,
403
2016, 57, 663.
404
33. D. M. Duffy, Novel contraceptive targets to inhibit ovulation: the prostaglandin E2 pathway,
405
Human Reproduction Update, 2015, 21, 652.
406
Page 14 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
34. H. Flaster, J. Bernhagen, T. Calandra and R. Bucala, The macrophage migration inhibitory
407
factor-glucocorticoid dyad: regulation of inflammation and immunity, Molecular
408
Endocrinology, 2007, 21, 1267.
409
35. Z. Pavicevic, C. C. Leslie and K. U. Malik, cPLA2 phosphorylation at serine-515 and
410
serine-505 is required for arachidonic acid release in vascular smooth muscle cells, Journal of
411
Lipid Research, 2008, 49, 724.
412
36. W. L. Smith, D. L. Dewitt and R. M. Garavito, Cyclooxygenases: structural, cellular, and
413
molecular biology, Annual Review of Biochemistry, 2000, 69, 145.
414
37. E. Ricciotti and G. A. FitzGerald, Prostaglandins and inflammation, Arteriosclerosis,
415
thrombosis, and vascular biology, 2011, 31, 986-1000.
416
38. S. O. Kim, J. Y. Park, S. Y. Jeon, C. H. Yang and M. R. Kim, Saikosaponin a, an active
417
compound of Radix Bupleuri, attenuates inflammation in hypertrophied 3T3-L1 adipocytes
418
via ERK/NF-kappaB signaling pathways, International journal of molecular medicine, 2015,
419
35, 1126-1132.
420
39. X. T. Feng, T. Z. Wang, J. Leng, Y. Chen, J. B. Liu, Y. Liu and W. J. Wang, Palmitate
421
contributes to insulin resistance through downregulation of the Src-mediated phosphorylation
422
of Akt in C2C12 myotubes, Biosci Biotechnol Biochem, 2012, 76, 1356-1361.
423
40. R. B. Bazotte, L. G. Silva and F. P. Schiavon, Insulin resistance in the liver: deficiency or
424
excess of insulin?, Cell Cycle, 2014, 13, 2494-2500.
425
41. G. W. Cline, K. Johnson, W. Regittnig, P. Perret, E. Tozzo, L. Xiao, C. Damico and G. I.
426
Shulman, Effects of a novel glycogen synthase kinase-3 inhibitor on insulin-stimulated
427
glucose metabolism in Zucker diabetic fatty (fa/fa) rats, Diabetes, 2002, 51, 2903.
428
42. M. P. Sajan, R. A. Ivey, M. C. Lee and R. V. Farese, Hepatic insulin resistance in ob/ob mice
429
involves increases in ceramide, aPKC activity, and selective impairment of Akt-dependent
430
FoxO1 phosphorylation, J Lipid Res, 2015, 56, 70-80.
431
43. H. Takeuchi and H. Sugihara, [Absorption of calcitonin in oral and pulmonary administration
432
with polymer-coated liposomes], Yakugaku Zasshi Journal of the Pharmaceutical Society of
433
Japan, 2010, 130, 1135-1142.
434
435
Page 15 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Fig 1- HPLC analysis of saponins extracted from Pearsonothuria graeffei and structures of the two
main glycosides. (A) HPLC analysis of the crude sea cucumber saponins. The structure of sea
cucumber saponins Holothurin A (HA) (B) and Echinoside A (EA) (C).
Page 16 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Fig.2- Effects of SEL and SW+EL on adipose tissues weights and glucose tolerance in high-fat
diet-fed C57/BL6 mice. Total white adipose tissues weight (A) and each adipose tissue weight (B)
in every group. Glucose tolerance test (GTT) curve (C) and the area under curve (D) in the
seventh week of experiment. (E) Fasting blood glucose levels after sacrificing.
*
p < 0.05,
**
p <
0.01,
***
p < 0.001 compared to LF group; different letters indicate significant difference at p<
0.05.
Page 17 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Fig.3- Lipolysis and adipose tissues inflammation in high-fat diet-fed C57/BL6 mice. Free fatty
acid (A), glycerol (B), TNF-α (C) and IL-6 (D) levels in adipose tissues. mRNA expressions of
F4/80 (E), CD11b (F) and S100A8/9 (G) in adipose tissues determined by RT-PCR.
*
p < 0.05,
**
p
< 0.01 compared to LF group; different letters indicate significant difference at p< 0.05.
Page 18 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Fig.4- The production of PGE2 through ERK-cPLA2-COX1 pathway in adipose tissues of
high-fat diet-fed C57/BL6 mice. (A) The PGE2 concentration in adipose tissues. (B) Western blot
analysis of expression of ERK phosphorylation. mRNA expressions of cPLA2 (C), COX1 (D) and
COX2 (E) in adipose tissues determined by RT-PCR.
*
p<0.05 compared to LF group; different
letters indicate significant difference at p< 0.05.
Page 19 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Fig.5- Effects of SEL and SW+EL on protein expressions involved in insulin pathway in high-fat
diet-fed C57/BL6 mice. Western blot analysis of the expressions of GSK3 phosphorylation (A)
and foxO1 phosphorylation (B) in liver. Western blot analysis of the expressions of AKT
phosphorylation (C、E) and GLUT4 contents (D、F) in peripheral tissues.
*
p < 0.05,
**
p < 0.01
compared to LF group; different letters indicate significant difference at p< 0.05.
Page 20 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Fig.6– Possible mechanism investigations of sea cucumber saponins liposomes on obesity-induced
adipose tissues inflammation and insulin resistance in high-fat diet–fed C57/BL6 mice.
Page 21 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Table 1 Compositions of experimental diets (g/kg diet)
LF HF SEL SW+EL
Casein 200 200 200 200
Fructose 0 200 200 200
Corn starch 650 250 248.425 248.425
lard oil 0 200 196.625 196.625
Corn oil 50 50 50 50
Cellulose 50 50 50 50
Mineral mix 35 35 35 35
Vitamin mix 10 10 10 10
DL-Methionine 3 3 3 3
Choline bitartrate
2 2 2 2
Page 22 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
Table 2 Primers used in this study
Gene Forward primer Reverse primer
F4/80 TTTCCTCGCCTGCTTCTTC CCCCGTCTCTGTATTCAACC
CD11b AGTTGCCGAATTGCATCGA GGCGTTCCCACCAGAGAGA
S100A8
ATTTCCATGCCGTCTACAGG CACCAGAATGAGGAACTCCT
S100A9
TCAAAGAGCTGGTGCGAAAA AACTCCTCGAAGCTCAGCTG
cPLA2a CCTTTGAGTTCATTTTGGATCCTAA TGTAGCTGTGCCTAGGGTTTCAT
COX1 GGAGAGAAAGAAATGGCTGC ACCCGTCATCTCCAGGGTAA
COX2 AGAAGGAAATGGCTGCAGAA GCTCGGCTTCCAGTATTGAG
β-actin
CAGGCATTGCTGACAGGATG TGCTGATCCACATCTGCTGG
Page 23 of 24 Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
TG, triacylglycerol; TC, total cholesterol; LDL-C, low-density lipoprotein-cholesterol
-- means the water intakes in LF group and HF group are not determined.
**
P < 0.01,
***
P < 0.001
compared to LF group; different letters indicate significant difference at P< 0.05 among HF diet
groups.
Table 3 Growth parameters and serum lipids in mice
LF HF SEL SW+EL
Initial body weight (g) 22.85±0.94 22.85±0.45
a
22.88±0.37
a
22.85±0.40
a
Body weight gain (g) 2.29±0.91 6.27±0.62
**a
3.79±0.32
b
5.07±0.47
ab
Food intake (g/day) 4.56±0.51 3.19±0.32
a
3.00±0.44
a
3.22±0.36
a
Water intake (mL/day) -- -- 3.25±0.56
a
3.40±0.44
a
TG (mmol/L) 0.77±0.04 0.80±0.06
a
0.63±0.08
a
0.61±0.06
a
TC( mmol/L) 3.65±0.10 5.14±0.08
***a
3.63±0.09
b
3.80±0.12
b
LDL-C(mmol/L) 1.71±0.07 2.06±0.07
***a
1.63±0.06
b
1.85±0.09
ab
Page 24 of 24Food & Function
Food & Function Accepted Manuscript
Published on 11 December 2017. Downloaded on 19/12/2017 03:07:17.
View Article Online
DOI: 10.1039/C7FO01599B
