Content uploaded by Vishwajit S Chowdhury
Author content
All content in this area was uploaded by Vishwajit S Chowdhury on Dec 06, 2017
Content may be subject to copyright.
ORIGINAL RESEARCH
Central NPY-Y5 sub-receptor partially functions as a
mediator of NPY-induced hypothermia and affords
thermotolerance in heat-exposed fasted chicks
Hatem M. Eltahan
1,
*, Mohammad A. Bahry
1
, Hui Yang
1
, Guofeng Han
1
,
Linh T. N. Nguyen
1
, Hiromi Ikeda
1
, Mohamed N. Ali
2
, Khairy A. Amber
3
, Mitsuhiro Furuse
1
&
Vishwajit S. Chowdhury
4
1 Laboratory of Regulation in Metabolism and Behavior, Graduate School of Bioresource and Bioenvironmental Sciences, Faculty of Agriculture,
Kyushu University, Fukuoka, Japan
2 Agriculture Research Center, Animal Production Research Institute, Agriculture Ministry, Cairo, Egypt
3 Division for Poultry Production, Faculty of Agriculture, Kafr-Elsheikh University, Kafr-Elsheikh, Egypt
4 Division for Experimental Natural Science, Faculty of Arts and Science, Graduate School of Bioresource and Bioenvironmental Science, Kyushu
University, Fukuoka, Japan
Keywords
Fasted chicks, HSP, NPY sub-receptors, NPY,
rectal temperature.
Correspondence
Vishwajit S. Chowdhury, Faculty of Arts and
Science, Kyushu University, Fukuoka, Japan.
Tel: +81-92-802-6015
Fax: +81-92-802-6015
E-mail: vc-sur@artsci.kyushu-u.ac.jp
Funding Information
This work funded in part by JSPS KAKENHI
grant awarded to V.S. Chowdhury
(JP15K07694) and M. Furuse (JP17H01503)
as well as supported by Egyptian High
Education Ministry to V. S. Chowdhury.
Received: 27 October 2017; Accepted: 30
October 2017
doi: 10.14814/phy2.13511
Physiol Rep, 5 (23), 2017, e13511,
https://doi.org/10.14814/phy2.13511
*Visiting Researcher from Animal Production
Research Institute, Agriculture Research
Center, Agriculture Ministry, and Division for
Poultry Production, Faculty of Agriculture,
Kafr-Elsheikh University, Egypt.
Abstract
Exposure of chicks to a high ambient temperature (HT) has previously been
shown to increase neuropeptide Y (NPY) mRNA expression in the brain. Fur-
thermore, it was found that NPY has anti-stress functions in heat-exposed
fasted chicks. The aim of the study was to reveal the role of central adminis-
tration of NPY on thermotolerance ability and the induction of heat-shock
protein (HSP) and NPY sub-receptors (NPYSRs) in fasted chicks with the
contribution of plasma metabolite changes. Six- or seven-day-old chicks were
centrally injected with 0 or 375 pmol of NPY and exposed to either HT
(35 1°C) or control thermoneutral temperature (CT: 30 1°C) for 60 min
while fasted. NPY reduced body temperature under both CT and HT. NPY
enhanced the brain mRNA expression of HSP-70 and -90, as well as of
NPYSRs-Y5, -Y6, and -Y7, but not -Y1, -Y2, and -Y4, under CT and HT. A
coinjection of an NPYSR-Y5 antagonist (CGP71683) and NPY (375 pmol)
attenuated the NPY-induced hypothermia. Furthermore, central NPY
decreased plasma glucose and triacylglycerol under CT and HT and kept
plasma corticosterone and epinephrine lower under HT. NPY increased
plasma taurine and anserine concentrations. In conclusion, brain NPYSR-Y5
partially afforded protective thermotolerance in heat-exposed fasted chicks.
The NPY-mediated reduction in plasma glucose and stress hormone levels
and the increase in free amino acids in plasma further suggest that NPY might
potentially play a role in minimizing heat stress in fasted chicks.
Introduction
Neuropeptide Y (NPY), a 36-amino acid peptide, is mul-
tifunctional (Malva et al. 2012; Reichmann and Holzer
2016). It has the orexigenic potential to increase food
intake and energy homeostasis in mammals and avians
(Kuenzel et al. 1987; Kuenzel and McMurtry 1988; Furuse
et al. 1997; Tachibana et al. 2004, 2006; Cline and Furuse
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
This is an open access article under the terms of the Creative Commons Attribution License,
which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
2017 | Vol. 5 | Iss. 23 | e13511
Page 1
Physiological Reports ISSN 2051-817X
2012). Fasting has been shown to increase the expression
of NPY in the chicken hypothalamus (Boswell et al.
1999), and brain NPY has recently been found to increase
with a decrease in food intake in heat-exposed chicks (Ito
et al. 2015) and broiler-type Taiwan country chickens (Tu
et al. 2016). Rapid-growing commercial chickens have
limited tolerance for high ambient temperatures (HT),
and heat stress in the summer is therefore an increasing
challenge globally for high-producing commercial chick-
ens. Chickens at all stages are susceptible to HT, includ-
ing broilers of market age (Sandercock et al. 2001; Aksit
et al. 2006), adult layers (Rozenboim et al. 2007; Ebeid
et al. 2012) and also young chicks (Chowdhury et al.
2014; Ito et al. 2015). In young chicks, heat stress leads to
an increase in body temperature (Chowdhury et al. 2012)
and a decrease in food intake and body weight gain
(Chowdhury et al. 2014). Recently, we found that central
administration of NPY acted as a hypothermic agent in
nonheat-exposed fasted chicks and that it reduced plasma
corticosterone in fasted, but not fed, chicks that had been
exposed to heat, as well as in similarly fasted but not fed
chicks that were nonheat exposed (Bahry et al. 2017).
Moreover, central NPY stimulated food intake in chicks
at control thermoneutral temperature (CT) and HT
(Bahry et al. 2017). From these findings, it is clear that
the regulation of food intake and also the regulation of
stress and body temperature are important functions of
NPY in fasted chicks under heat stress. However, whether
NPY has any protective thermotolerance action in fasted
chicks under heat stress is not yet known. We hypothe-
sized that NPY may afford thermotolerance in chicks.
Heat shock proteins (HSPs) are proteins that are evo-
lutionarily conserved and that have important functions
in the environmental adaptation of all living organisms.
They protect against a variety of stressful stimuli and
are important in the acquisition of thermotolerance and
stress resistance (Feder and Hofmann 1999; Nollen and
Morimoto 2002; Fasulo et al. 2010). They have a chap-
erone function under stressful conditions as well as dur-
ing the de novo synthesis of polypeptides, and are also
involved in a range of specific cellular processes, includ-
ing protein metabolism and homeostasis, signal trans-
duction, DNA replication, immune defense reactions and
metabolic detoxification (Pockley 2003; Richter et al.
2010; Zhao and Jones 2012). HSP-70 and HSP-90 are
the most conserved and most widely studied of all
HSPs. In birds, increased expression of HSP-70 during
heat stress has been found to prevent abnormal protein
synthesis and aggregation (Quinteiro-Filho et al. 2010;
Najafi et al. 2015). HSP-90 has been shown to be the
most abundant constitutively expressed protein inside
the cell (Stetler et al. 2010) and to have a regulatory
function for the glucocorticoid receptor (GR; Hao and
Gu 2014). Hence, it is important to know whether NPY
regulates HSP expression.
NPY appears to carry out its biological actions via one
of its sub-receptors or via a combination of them. The
NPY sub-receptors (NPYSRs) couple to G-proteins (Per-
saud and Bewick 2014), which, in chickens, include six
identified NPYSRs (Brom
ee et al. 2006). On the basis of
their amino acid sequence, the NPYSRs have been subdi-
vided into three subfamilies: the NPYSR-Y1 subfamily
(Y1, Y4, and Y6); the -Y2 subfamily (Y2 and Y7); and the
-Y5 subfamily (Y5) (Larsson et al. 2008; He et al. 2016;
Gao et al. 2017). All of these NPYSRs appear to be
expressed in the chicken hypothalamus, although NPYSR-
Y3 has not yet been identified in chickens (Yi et al.
2015). NPYSRs-Y1 and -Y5 mediate NPY-dependent food
intake regulation in chicks (Tachibana et al. 2006; Den-
bow and Cline 2015). NPYSRs-Y6 and -Y7 are widely
expressed in all chicken tissues, but their function in the
chicken genome is still unknown (He et al. 2016; Gao
et al. 2017). Using NPYSRs-Y1 and -Y5 antagonists, Dark
and Pelz (2008) demonstrated that NPYSR-Y1 was
involved in hypothermia in cold-acclimated Siberian
hamsters. Therefore, the NPY antagonist is useful for
revealing the functions of NPY-mediated hypothermia.
To the best of our knowledge, there are no reports con-
cerning the effect of NPY on the expression of NPYSRs
or on receptor functions in connection with thermoregu-
lation in chickens.
Heat stress has been found to increase plasma corticos-
terone (Ito et al. 2015) and glucose (Chowdhury et al.
2012) concentrations in chicks. Central administration of
NPY has been shown to decrease plasma glucose concen-
trations in fasted chicks under CT (Tachibana et al. 2006;
Bahry et al. 2017) and to decrease plasma triacylglycerol
and corticosterone concentrations in heat-exposed fasted
chicks (Bahry et al. 2017). The concentration of several
plasma amino acids was found to alter as a result of
short-term (Ito et al. 2014) and long-term heat stress
(Chowdhury et al. 2014) in chicks. Recently, D-aspartate
(Erwan et al. 2014) and L-citrulline (Chowdhury et al.
2017) have been found to play important roles in regulat-
ing body temperature and affording thermotolerance in
chicks. An examination of the effects of NPY on changes
in plasma metabolites, stress hormones, and amino acids
in heat-exposed chicks is therefore also needed.
In this study, we aimed to investigate the function of
NPY and its NPYSR-Y5 antagonist in relation to body
temperature regulation in fasted chicks. We further aimed
to determine brain expression of HSPs and NPYSRs,
plasma metabolites and free amino acids, as well as stress
hormones, corticosterone, norepinephrine (NE), and epi-
nephrine (E) to reveal the role of NPY in heat-exposed
fasted chicks.
2017 | Vol. 5 | Iss. 23 | e13511
Page 2
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
NPY Induces Hypothermia and Thermotolerance in Chicks H. M. Eltahan et al.
Materials and Methods
Animals
One-day-old male layer chicks (Julia strain; Gallus gallus
domesticus) were obtained from a local hatchery (Murata
Hatchery, Fukuoka, Japan) and kept under a constant
room temperature of 30 1°C and in continuous light
in metal wire-meshed cages (50 935 933 cm) in
groups of 20–25 birds until they were 4 or 5 days old.
Food (Adjust diets (metabolizable energy: >12.55 MJ/kg,
protein: >23%)); Toyohashi Feed and Mills Co. Ltd.,
Aichi, Japan) and water were provided ad libitum. This
study was conducted in accordance with the guidelines
for animal experiments in the Faculty of Agriculture of
Kyushu University and with Law No. 105 and Notifica-
tion No. 6 of the Japanese government.
Drug preparation and
intracerebroventricular (i.c.v.) injection
NPY (Porcine, Peptide Institute, Osaka, Japan) and
CGP71683 (TOCRIS bioscience, Wako Pure Chemical
Industries, Ltd, Bristol, U.K.), an NPYSR-Y5 antagonist
(Holmberg et al. 2002), were dissolved in a vehicle of
0.85% saline containing 0.1% Evans Blue (Wako Pure
Chemical Industries, Ltd., Osaka, Japan). Porcine NPY
showed a similar affinity to chicken NPYSRs-Y1, -Y4,
and -Y5 (Lundell, 2002), so we used it in this study.
Evans Blue saline solution was used for the control
group, as in previous studies (Tachibana et al. 2006,
2007; Bahry et al. 2017). The NPY, the NPYSR-Y5
antagonist and the saline solutions were kept on ice
during the experimental period. I.c.v. injections were
performed following the method of Davis et al. (1979).
Briefly, the head of the chick was inserted into an
acrylic device which positioned a hole in a plate overly-
ing the skull immediately over the left lateral ventricle.
A micro syringe was then inserted into the left lateral
ventricle through the hole and the drug was injected.
The syringe was kept in place for 10 s to prevent over-
flow. Chicks were not anesthetized, as in previous stud-
ies the i.c.v. injection of 0.85% saline, which was used
for control injections, was not found to affect feeding
behavior (Furuse et al. 1999) or plasma corticosterone
concentrations (Saito et al. 2005) compared with nonin-
jected chicks. Chicks in this study moved normally
immediately after the injection. At the end of the
experiment, following euthanasia, the brain was sliced
and the presence of Evans Blue dye in the lateral ven-
tricle was confirmed. The results from chicks without
Evans Blue dye in the lateral ventricle were not used
for further analysis.
Experimental design
In Experiment 1, chicks (6 and 7 days old) were isolated
in individual plastic cages (floor space: 15 cm 928 cm;
height: 13 cm) for 48 h prior to the start of the experi-
ment for adaptation. On the day of the experiment,
chicks (n=16) were intracerebroventricularly injected
with 10 lL of either 0 or 375 pmol NPY based on our
previous reports showing that 375 pmol was the effective
dose of NPY (Tachibana et al. 2006; Bahry et al. 2017).
Chicks were returned to their cages and placed in a tem-
perature-controlled chamber (Sanyo Electric Co. Ltd.,
Japan; catalog number: Sanyo MIR-253) under fasting
condition and maintained at either HT (35 1°C) for
the heat stress challenge or CT (30 1°C) for 1 h. We
chose the HT (35 1°C) based on our previous report
where the thermoneutral temperature was 30 1°C
(Bahry et al. 2017). The chicks’ rectal temperature was
measured immediately before i.c.v. injection, and this was
considered the data at 0 min, followed by measurements
at 30 and 60 min after the treatment. Rectal temperature
was measured using a digital thermometer with an accu-
racy of 0.1°C (Thermalert TH-5, Physitemp Instruments
Inc.); the thermistor probe was inserted into the colon
(rectum) through the cloaca to a depth of 2 cm as
reported previously (Chowdhury et al. 2015; Ito et al.
2015; Bahry et al. 2017). At the end of experiment, the
chicks were euthanized following anesthesia by isoflurane
(Mylan Inc., Tokyo, Japan) in order to collect blood and
brain samples. Blood from the jugular vein was immedi-
ately collected into heparinized tubes and centrifuged at
10,000gfor 4 min at 4°C to collect plasma. The collected
plasma samples were stored at 80°C for further analysis
of metabolites, free amino acids, corticosterone, NE, and
E. The brains were dissected and the diencephalon (con-
sisting of the thalamus and hypothalamus) was collected
as described elsewhere (Kuenzel and Masson 1988;
Chowdhury et al. 2014). Brain samples were snap frozen
in liquid nitrogen and stored at 80°C for analysis of
brain expression of HSP-70 and -90 as well as of NPYSRs.
Because some chick brains did not have Evans Blue dye
in the lateral ventricle, the number of samples to obtain
data on rectal temperature became smaller (n=12–15).
Then, after analysis of brain and plasma samples, the out-
liers were rejected by Thompson rejection test as
described later in the Statistical Analysis section. There-
fore, the final numbers to get the data on gene expres-
sions and plasma metabolites became smaller (n=10–14/
group). We randomly chose 10 samples from each group
(n=10/group) for corticosterone ELISA analysis since
the analysis process was sensitive to get reliable data with
a minimum sample number. However, the final number
became smaller (n=6–7/group) to get the corticosterone
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
2017 | Vol. 5 | Iss. 23 | e13511
Page 3
H. M. Eltahan et al. NPY Induces Hypothermia and Thermotolerance in Chicks
data after the rejection of the outliers by Thompson rejec-
tion test.
In Experiment 2, chicks (6 days old) were isolated as
described in Experiment 1. On the day of the experiment,
chicks (n=12) were intracerebroventricularly injected
with saline (control), 375 pmol NPY alone or 375 pmol
NPY plus 3750 pmol CGP71683, an NPYSR-Y5 antago-
nist, under fasting conditions. The CGP71683 dose was
decided upon on the basis of previous reports (Holmberg
et al. 2002; Tachibana et al. 2006). Rectal temperatures
were measured as described above under CT. The number
of samples to determine the changes in rectal temperature
finally became smaller (n=8–10) due to excluding the
chicks whose brains were not stained properly as
explained above.
Isolation of total RNA and quantitative
real-time PCR
Total RNA was extracted from the chick diencephalon
using RNAiso Plus (TakaRa Bio Inc., Shiga, Japan),
according to the manufacturer’s instructions. cDNA was
synthesized using 1 lg of total RNA and the
PrimeScript
RT reagent Kit with gDNA Eraser (Takara,
Shiga, Japan), according to the manufacturer’s instruc-
tions. All primers were tested by carrying out routine
PCR and gel electrophoresis prior to real-time PCR
(TaKaRa PCR Thermal Cycler Dices, Takara, Shiga,
Japan). The cDNA of the diencephalic tissues was ana-
lyzed for expression of HSP-70 and -90, as well as of
NPYSRs-Y1, -Y2, -Y4, -Y5, -Y6, and -Y7, by routine PCR.
To quantify the expression of HSPs and NPYSRs in the
diencephalon, real-time quantitative PCR was conducted
using Startagene MX 3000P (Agilent Technologies, Tokyo,
Japan) with a denaturation step at 95°C for 30 sec, with
40 cycles of amplification at 95°C for 5 sec, and a pri-
mer-specific temperature for 30 sec. The primer
sequences are listed in Table 1. Relative mRNA expres-
sions have been calculated by comparing the number of
thermal cycles that were needed to generate threshold
amounts of product (PCR-ct). PCR-ct was calculated for
the HSPs and NPYSRs and for the chicken RNA poly-
merase-II (RP-II). It was confirmed that the RP-II expres-
sion level was not altered under the current experimental
conditions. For each cDNA sample, the PCR-ct for RP-II
was subtracted from the PCR-ct for HSP-70, -90,
NPYSRs-Y1, -Y2, -Y4, -Y5, -Y6, -Y7, and GR to give the
parameter DPCR-ct, thus normalizing the initial amount
of RNA used. The HSP, NPYSR, and GR mRNA expres-
sion was calculated as 2
DDPCR-ct
, where DDPCR-ct is the
difference between the DPCR-ct of the two cDNA samples
to be compared, as described elsewhere (Schmittgen and
Livak 2008). The single melting peak for each sample was
detected to confirm the specificity of the PCR conditions.
Analysis of plasma corticosterone, NE, E,
and metabolites
Plasma corticosterone concentrations were determined
using an enzyme immunoassay kit (Corticosterone ELISA
Kit, Enzo Life Science Inc., Farmingdale, NY) and
expressed as ng/mL. Each plasma sample was thawed and
diluted with an assay buffer by a factor of 3. Two doses
of corticosterone solution in an assay buffer which gave
around 80% and 20% binding on the standard curve were
used as low- and high-quality controls in every assay.
Standards, samples and quality controls were assayed in
duplicate wells. The intra-assay coefficients of variation
were 3.4% and 9.3%, and the interassay coefficients of
variation were 19.8% and 27.8% for low- and high-
Table 1. Primers used for real-time PCR.
Gene Accession no. Sequences 5030(forward/reverse)
Annealing
temperature
(°C)
Product size
(bp)
HSP-70 AY143691.1 50GGGAGGACTTTGACAACCGA30/50CAAAGCGTGCACGAGTGATG3060 219
HSP-90 NM_001109785 50GAAGACTCCCAGAACCGCAA30/50ACCTGGTCCTTTGTCTCACC3060 155
NPYR-Y1 NM_001031535.1 50TAGCCATGTCCACCATGCA30/50GGGCTTGCCTGCTTTAGAGA3060 58
NPYR-Y2 NM_001031128.1 50TGCCTACACCCGCATATGG30/50GTTCCCTGCCCCAGGACTA3060 58
NPYR-Y4 NM_001031555.1 50CCTGCCCTTTCTGACCACAT30/50GGGATGCAGTATTGCAGAAGC3060 165
NPYR-Y5 NM_001031130.1 50TGATCGGTGGATGTTTGGCA30/50AGCCAACGGCCCAAATGATA3060 191
NPYR-Y6 NM_001044687.1 50GAACGAGAGCAGGTTGAGTGA3/50ACGAGGTGGCACAGTGTAAA3060 174
NPYR-Y7 NM_001037824.1 50TGGCCATCTTCAGAGAGTTCC3/50GGACTGACGTGGTTTTTCAGC3064 208
GR NM_001037826.1 50TATGACAGCACGCTGCCCGA3/50CTACCACTTGCCGTCCTCCTAACAT3062 76
RP-II NM_001006448.1 50CGACGGTTTGATTGCACCTG30/50CAATGCCAGTCTCGCTAGTTC3064 161
Primers were designed with Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/) for heat shock protein (HSP-70 and -90), neuropep-
tide Y receptors (NPYR-Y1, -Y2, -Y4, -Y5, -Y6, and -Y7), glucocorticoid receptor (GR), and RNA polymerase-II (RP-II).
2017 | Vol. 5 | Iss. 23 | e13511
Page 4
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
NPY Induces Hypothermia and Thermotolerance in Chicks H. M. Eltahan et al.
quality controls. Plasma E and NE concentrations were
measured using high performance liquid chromatography
(HPLC) following the method described by Takahashi
et al. (2005). Fifty lL plasma was diluted with 500 lL
Tris buffer (pH 8.6) and 100 lL EDTA2Na, and 5 mg
alumina was added and shaken by a thermomixer com-
pact covered by aluminum foil to protect it from the
light, at 4°C, 90 g/10 min, to absorb E and NE from the
plasma. After removal of the liquid, the alumina was
rinsed with ultrapure water and transferred to centrifuge-
filtration units (0.22 lm Ultra Free-MC, Millipore,
Massachusetts). Alumina-absorbed E and NE were sepa-
rated by adding 2% acetic acid solution containing
100 lmol/L EDTA2Na, and then the solution was fil-
trated at 2000gfor 5 min at 4°C. Thirty lL of filtrate was
injected into an HPLC system. The mobile phase con-
sisted of 0.1 mol/L pH 5.7 phosphoric acid buffer (2 L of
0.1 mol/L sodium dihydrogen-phosphate and 170 mL of
0.1 mol/L disodium hydrogen-phosphate), 296 mL
methanol, 1.48 g sodium 1-octane sulfonate (600 mg/L),
and 0.12 g disodium ethylene-diamine-tetraacetic acid
(50 mg/L) at a flow rate of 0.5 mL/min. A standard solu-
tion was prepared by diluting it with 0.01 N HCl (stan-
dard concentrations were 3000, 1500, 750, 375, 187.5, and
93.75 pg/30 lL). The concentrations of NE and E in
plasma were expressed as pg/lL. Plasma metabolites (glu-
cose, triacylglycerol, calcium, sodium, potassium and
chloride) were determined by Dri-Chem 7000 system
(Fuji Medical System Co. Ltd., Japan).
Analysis of free amino acids in the plasma
To analyze the effect of NPY on amino acid metabolisms,
free amino acid and dipeptides were analyzed in plasma
using HPLC according to the method of Boogers et al.
(2008) with slight modifications as described by Ito et al.
(2015). Briefly, plasma was deproteinized by filtration
through a 10,000 dalton molecular weight cut-off filter
(Millipore, Bedford, MA) via centrifugation at 12,000gfor
10 min at 4°C (MX-307, Tommy, Japan). Each 10 lL sam-
ple of the plasma was dried under reduced pressure at
100 kPa (Centrifugal Vaporizer, CVE-200D, Eyela,
Japan). The dried residues were dissolved in 10 lLof
1 mol/L sodium acetate-methanol-triethylamine (2:2:1),
re-dried under reduced pressure and then converted to
their phenylthiocarbamoyl derivatives by dissolving them
in 20 lL of methanol-distilled water-triethylamine-pheny-
lisothiocyanate (7:1:1:1) and allowing them to react for
20 min at room temperature. The samples were dried again
and dissolved in 200 lL of Pico-Tag Diluent (Waters, Mil-
ford, CT). These diluted samples were filtrated through a
0.20 lm filter (Millipore). The same methods were per-
formed on standard solutions which were prepared by
diluting a commercially available L-amino acid solution
(type ANII, type B, L-asparagine, L-glutamine, and L-tryp-
tophan; Wako, Osaka, Japan) with distilled water. The
solution containing the derivatives was applied to a Waters
HPLC system (Pico-Tag free amino acid analysis column
(3.9 mm 9300 mm), Alliance 2690 separation module,
2487 dual-wavelength UV detector and Millennium 32
Chromatography manager; Waters). They were equilibrated
with buffer A (70 mmol/L sodium acetate adjusted to pH
6.45 with 10% acetic acid-acetonitrile, ratio 975:25) and
eluted with a linear gradient of buffer B (water-acetonitrile-
methanol (40:45:15) (0%, 3%, 6%, 9%, 40%, and 100%))
at a flow rate of 1 mL/min at 46°C. The concentrations of
free amino acids and dipeptides (phosphoserine, aspartic
acid, glutamine, a-aminoadipic acid, hydroxyproline, ser-
ine, asparagine, glycine, glutamic acid, b-alanine, taurine,
histidine, GABA, threonine, alanine, carnosine, arginine,
proline, 1 methylhistidine, anserine, 3-methylhistidine, tyr-
osine, valine, methionine, cystathionine, isoleucine, leucine,
phenylalanine, tryptophan, ornithine, and lysine) were
determined by their absorbance at a wave length of
254 nm. The plasma amino acid concentrations were
expressed as pmol/lL.
Statistics
The data relating to rectal temperature from Experi-
ment 1 were statistically analyzed by three-way analysis
of variance (ANOVA), and the rectal temperature data
in Experiment 2 were statistically analyzed by two-way
ANOVA, followed by the Tukey-Kramer test as a post
hoc analysis when a significant interaction was detected.
The data concerning the expression of HSPs, NPYSRs,
plasma metabolites, corticosterone, E, and NE were
analyzed by two-way ANOVA with respect to HT and
NPY, and Fisher least significant different (LSD) was
used as a post hoc analysis. Values were presented as
means SEM. Statistical analysis was performed using
a commercially available package –Stat View (version
5, SAS Institute, Cary 1998). All data were subjected to
a Thompson’s rejection test, as described by Kobayashi
and Pillai (Kobayashi and Pillai 2013), to eliminate out-
liers (P<0.01), and the remaining data were used for
the analysis among groups.
Results
Rectal temperature and diencephalic mRNA
abundance of HSPs and GRs in chicks under
CT and HT
NPY i.c.v. injection significantly (P<0.05) decreased
rectal temperature in fasted chicks under both CT and
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
2017 | Vol. 5 | Iss. 23 | e13511
Page 5
H. M. Eltahan et al. NPY Induces Hypothermia and Thermotolerance in Chicks
HTasshowninFigure1A.Thereweresignificant
(P<0.001) effects of temperature and time on
changes in the rectal temperature. A significant
(P<0.001) interaction was also found between NPY
and time, indicating that NPY-dependent reduction in
body temperature became pronounced with special
referencetoCTastimewenton.Theexpressionof
HSP-70 mRNA increased significantly (P<0.05) in
the brain by HT (Fig. 1B). Interestingly, NPY induced
asignificant(P<0.05) increment in HSP-70 and -90
under both CT and HT (Fig. 1B and C). The mRNA
expression of GR was not significantly changed by
NPY under CT or HT (Table 3). In summary, NPY
central injection decreased rectal temperature and
increased brain mRNA expression of HSP-70 and -90
in fasted chicks under both CT and HT.
The diencephalic mRNA abundance of
NPYSRs in chicks under CT and HT and
changes in rectal temperature by the
coinjection of CGP71683 (an NPYSR-Y5
antagonist) plus NPY in chicks under CT
The mRNA expression of NPYSRs-Y5, -Y6, and -Y7
significantly (P<0.05) increased in the brain follow-
ing NPY injection under both CT and HT (Fig. 2A–
C). HT also significantly (P<0.05) increased
NPYSR-Y6 mRNA expression (Fig. 2B). Figure 2D
shows the effect of i.c.v. NPY and coinjection of
CGP71683 plus NPY on rectal temperature under CT.
The NPY-induced decreased rectal temperature was
significantly (P<0.05) attenuated by coinjection of
CGP71683 plus NPY. Significance of time (P<0.001)
and interaction (P<0.001) between treatment and
time were found, indicating that the NPY-dependent
reduction in body temperate became pronounced with
the progression of time; however, CGP71683 some-
what attenuated this effect. The mRNA expression of
NPYSRs-Y1, -Y2, and -Y4 was not significantly chan-
ged by either HT or NPY (Table 3). In sum, NPY
central injection caused to increase NPYSRs-Y5, -Y6,
and -Y7 significantly (P<0.05) under CT and HT.
NPY-dependent reduced rectal temperature was atten-
uated by the coinjection of NPYSRs-Y5 antagonist.
0
1
2
3
4
5
6
7
8
9
Saline NPY
Relative mRNA level
CT HT
Results of ANOVA
NPY P< 0.05
Temp P< 0.01
NPY ×Temp P> 0.05
HSP-70
0
0.3
0.6
0.9
1.2
1.5
1.8
2.1
Saline NPY
Relative mRNA level
CT HT
Results of ANOVA
NPY P< 0.05
Temp P> 0.05
NPY ×Temp P> 0.05
HSP-90
Results of ANOVA
NPY P< 0.05
Time P< 0.001
Temp P< 0.001
Time ×Temp P< 0.001
NPY ×Time P< 0.001
NPY ×Time ×Temp P > 0.05
–0.6
–0.3
0
0.3
0.6
0.9
1.2
Saine CT NPY CT
Saline HT NPY HT
Time (min)
0
30 60
a
bb
c
c
c
c
0.
a
Changes in rectal temperature (°C)
A
B
C
Figure 1. Rectal temperatures (A) and mRNA expression of
diencephalic HSP-70 (B) and HSP-90 (C) in fasted chicks following
i.c.v. injection of NPY (375 pmol) or saline under control
thermoneutral temperature (CT: 30 1°C) or a high ambient
temperature (HT: 35 1°C) for 1 h. Different letters indicate
significant differences at P<0.05 between groups. Values are
mean SEM of the 12–15 chicks in each group.
2017 | Vol. 5 | Iss. 23 | e13511
Page 6
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
NPY Induces Hypothermia and Thermotolerance in Chicks H. M. Eltahan et al.
Plasma metabolites, corticosterone, NE, and
E in chicks under CT and HT
Plasma glucose concentrations were significantly
(P<0.05) reduced by NPY i.c.v. injection (Fig. 3A).
Temperature also had a significant (P<0.05) effect on
plasma glucose. Although plasma triacylglycerol concen-
trations significantly (P<0.05) increased as a result of
HT, NPY injection caused them to decrease (Fig. 3B). A
significant (P<0.05) interaction between NPY and tem-
perature was found for plasma corticosterone concentra-
tions, indicating that they were increased in NPY-treated
chicks under CT, while this increment disappeared under
HT (Fig. 3C). Moreover, a significant (P<0.05) interac-
tion between NPY and temperature was also found for
plasma E, indicating that plasma E increased in control
chicks under HT; however, this stress response disap-
peared in NPY-treated chicks (Fig. 3D). Plasma concen-
trations of calcium, sodium, potassium, chloride, and NE
were not changed by NPY or HT (data not shown). In
sum, NPY central injection reduced plasma glucose, tria-
cylglycerol, and plasma E concentrations under CT and
HT.
Free amino acid concentrations in plasma in
chicks under CT and HT
Plasma taurine and anserine significantly (P<0.05)
increased following NPY i.c.v. injection in chicks under
CT and HT (Table 2). Although tyrosine and valine were
significantly (P<0.05) higher, histidine was lower
(P<0.05) in chick plasma under heat stress. A significant
0
0.4
0.8
1.2
1.6
2
2.4
2.8
Saline NPY
lev
elA
NRm
evita
l
eR
CT
HT
Results of ANOVA
NPY P< 0.05
Temp P> 0.05
NPY ×Temp P> 0.05
NPYSR-Y5
Results of ANOVA
NPY P< 0.01
Temp P< 0.05
NPY ×Temp P> 0.05
0
0.3
0.6
0.9
1.2
1.5
1.8
Saline NPY
Relative mRNA level
CT
HT
NPYSR-Y6
0.2
0.4
0.6
Saline
NPY
NPY + CGP71683
Time (min)
0
30 60
a
ab
ab
b
b
Results of ANOVA
Treatment P< 0.05
Time P< 0.001
Treatment ×Time P< 0.001
Changes in rectal temperature (°C)
0.
Results of ANOVA
NPY P< 0.001
Temp P> 0.05
NPY ×Temp P> 0.05
0
0.4
0.8
1.2
1.6
2
2.4
2.8
3.2
Saline NPY
levelANRme
v
i
t
aleR
CT
HT
NPYSR-Y7
a
–0.6
–0.4
–0.2
0
AB
CD
Figure 2. The diencephalic mRNA expression of NPYSR-Y5 (A), NPYSR-Y6 (B), and NPYSR-Y7 (C) in fasted chicks following i.c.v. injection of
NPY (375 pmol) or saline under control thermoneutral temperature (CT: 30 1°C) or a high ambient temperature (HT: 35 1°C) for 1 h.
Rectal temperatures (D) of chicks following i.c.v. injection of NPY (375 pmol), saline, or NPY (375 pmol) plus CGP71683 (3750 pmol) under CT
for 1 h values are mean SEM for each group of 10–14 chicks in A–C and 8–10 chicks in D. Different letters indicate significant differences at
P<0.05 between groups.
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
2017 | Vol. 5 | Iss. 23 | e13511
Page 7
H. M. Eltahan et al. NPY Induces Hypothermia and Thermotolerance in Chicks
(P<0.05) interaction was found between NPY and tem-
perature for plasma valine, suggesting that the level of
plasma valine was high under HT in control chicks; how-
ever, NPY caused a reduction in this level in heat-exposed
chicks (Table 2). In sum, NPY central injection increased
plasma taurine and anserine under CT and HT, while
heat stress increased plasma tyrosine and valine and
decreased plasma histidine.
Discussion
In this study, we conducted i.c.v. injection of NPY in
chicks to examine, in Experiment 1, its effect on ther-
moregulation, plasma metabolites, the stress hormone,
and free amino acids in plasma, as well as the mRNA
expression of HSPs and NPYSRs in the brain. In Experi-
ment 2, an NPYSR-Y5 antagonist was used to confirm
the involvement of NPYSR in the process of NPY-
induced hypothermia.
It has been reported that body temperature reduced as
a result of NPY in neonatal fasted chicks (Tachibana et al.
2006; Bahry et al. 2017) and mammals (Szekely et al.
2004; Dark and Pelz 2008) under CT. In this study, we
found that central administration of NPY decreased rectal
temperature not only under CT but also under HT in
fasted chicks (Fig. 1A). To the best of our knowledge, this
is the first report showing that NPY can afford thermotol-
erance. It is well known that HSP expression occurs to
protect and facilitate cellular functions under thermal
stress (Feder and Hofmann 1999; Nollen and Morimoto
2002; Fasulo et al. 2010; Najafi et al. 2015). It has been
further reported that the expression of HSPs could be
increased by the ingestion of some nutritional supple-
ments which help to protect cellular functions against
stress (Chen et al. 2012). On the other hand, HSP-90 not
only provides protective functions (Miyata and Yahara
1992; Jakob et al. 1995), it also controls the GR functions
(Hao and Gu 2014). In this study, NPY showed a ten-
dency (P=0.07) to increase GR mRNA expression
(Table 3), which indicates that the NPY-dependent
changes in plasma corticosterone in this study may have
some connection to HSP-90 since HSP-90 regulates the
functions of GR (Hao and Gu 2014). NPY-dependent
expression of HSPs-70 and -90 in the diencephalon
implies that NPY may support protective thermotolerance
and induce cellular processes in the brain under heat
stress.
NPYSRs have specific functions to carry out the stress
response. For example, NPYSR-Y1 mediates anxiolytic
effect, whereas NPYSR-Y2 mediates anxiogenic functions
(Reichmann and Holzer 2016). In this study, it was found
that the expression of NPYSRs-Y5, -Y6, and -Y7 was
Table 2. Effect of high ambient temperature (35 1°C, 1 h) and i.c.v. injection of NPY (375 pmol/10 lL/chick) or saline on plasma-free
amino acids in fasted chicks.
Amino acids
Saline NPY P-value
CT HT CT HT NPY Temperature
Temperature 9
NPY
Essential amino acids
1
Histidine 136 8 107 7 138 6 122 6NS P<0.005 NS
Arginine 235 17 210 28 238 28 240 23 NS NS NS
Leucine 271 25 259 50 262 35 3388 14 NS NS NS
Phenylalanine 180 18 191 18 168 11 156 10 NS NS NS
Threonine 443 29 521 99 572 80 524 54 NS NS NS
Valine 287 17
a
381 21
b
329 15
ac
332 119
abc
NS P<0.05 P<0.05
Isoleucine 110 11 143 11 134 12 122 9NS NS NS
Methionine 77.2 3.5 89.0 6.1 84.9 4.5 80.9 3.3 NS NS NS
Tryptophan 143 10 140 10 137 11 146 5NS NS NS
Lysine 552 67 610 79 429 45 597 82 NS NS NS
Nonessential amino acids and dipeptide
1
Anserine 25.1 1.9 21.1 1.2 27.6 2.0 26.1 1.5 P<0.05 NS NS
Taurine 43.6 2.4 43.4 3.9 54.5 6.0 52.7 4.6 P<0.0 NS NS
Tyrosine 111 8 134 8 105 5 117 10 NS P<0.05 NS
The number of chicks used in each group was 8. Different superscripts in the same row indicate significant differences between groups.
Values are means SEM in pmol/lL. NPY, neuropeptide Y; CT, control thermoneutral treatment (30 1°C); HT, high temperature treatment;
NS, not significant.
1
All the analyzed essential amino acids and only significantly changed nonessential amino acids are shown.
2017 | Vol. 5 | Iss. 23 | e13511
Page 8
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
NPY Induces Hypothermia and Thermotolerance in Chicks H. M. Eltahan et al.
stimulated by NPY, which indicates that the hypothermic
functions of NPY were mediated through all or any of
these receptors. NPY-induced food intake in chickens
occurred through NPYSRs-Y1 and -Y5 (Holmberg et al.
2002), although NPYSR-Y5 was also found to slightly
contribute to food intake in mammals (Marsh et al.
1998). In this study, the mRNA expression of NPYSR-Y1
was not changed, but that of NPYSR-Y5 increased. Subse-
quently, it was further confirmed that a coinjection of
CGP71683 (an NPYSR-Y5 antagonist) plus NPY slightly
attenuated the NPY-induced hypothermia (Fig. 2D),
which suggests that NPYSR-Y5 is partially, but not
entirely, involved with hypothermia. In addition, only
NPYSR-Y6 was increased by heat stress, suggesting that
HT has a strong influence on NPYSR-Y6. The function of
NPYSRs-Y6 and -Y7 in chickens remains unknown. How-
ever, until now, no antagonist has been available for
NPYSRs-Y6 and -Y7. Although it will be needed to ana-
lyze the protein level corresponding to the mRNA expres-
sion in future, previous reports (Boswell et al. 1998; He
et al. 2016; Gao et al. 2017) showed that the mRNA
expression of NPY and its receptors displayed the same
pattern of changes with the protein expressions.
In this study, it was found that plasma concentrations
of sodium, potassium, and chloride were not changed by
NPY under CT or HT (data not shown), which indicates
that NPY did not affect the electrolyte balance. This may
have been due to the short experimental period (i.e.,
60 min) and the specific feeding condition (i.e., fasting).
It is possible that there might be an orexigenic effect of
NPY under a longer experimental period with ad libitum
feeding. Plasma glucose concentrations were lower in
NPY-treated chicks, and it could be speculated that the
decline in glucose might be due to the anabolic function
of NPY. Hypoglycemia is a well-known phenomenon
which combines with hypothermia in mammals (Bucha-
nan et al. 1991) and amphibians (Branco 1997; Rocha
and Branco 1998). Thaxton et al. (1974) reported that
oral administration of glucose increased the body temper-
atures of the chicks that were exposed to a cold environ-
ment and suggested that carbohydrate metabolism is
involved in the physiological regulation of body
Results of ANOVA
NPY P< 0.05
Temp P< 0.05
NPY ×Temp P> 0.05
Results of ANOVA
NPY P< 0.05
Temp P< 0.05
NPY ×Temp P> 0.05
CT
HT
Results of ANOVA
NPY P> 0.05
Temp P> 0.05
NPY ×Temp P< 0.01
** *
0
2
4
6
8
10
12
Saline NPY
Plasma epinephrine (pg/µL)
CT
HT
Results of ANOVA
NPY P> 0.05
Temp P> 0.05
NPY ×Temp P< 0.02
0
1
2
3
4
5
6
NPY
L)m/gn(enore
t
socit
roc
a
m
salP
CT
HT
Saline
)Lm001/gm(esoculgamsalP
Plasma triacylglycerol (mg/100 mL)
AB
CD
Figure 3. Plasma glucose (A), triacylglycerol (B), corticosterone (C), and E (D) concentrations in fasted chicks following i.c.v. injection of NPY
(375 pmol) or saline under control thermoneutral temperature (CT: 30 1°C) or a high ambient temperature (HT: 35 1°C) for 1 h. Values
are mean SEM for each group of 10–14 chicks in A and B and 6–7 chicks in C and D. *Significant difference between groups at P<0.05.
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
2017 | Vol. 5 | Iss. 23 | e13511
Page 9
H. M. Eltahan et al. NPY Induces Hypothermia and Thermotolerance in Chicks
temperature. Moreover, Doerfler et al. (1998) found that
hypoglycemia occurred in turkeys when hypothermia was
also detected. Tachibana et al. (2006) reported that cen-
tral administration of NPY reduced plasma glucose in
fasted chicks, along with a reduction in body temperature,
which is comparable with the current findings. Although
it is not yet known how the decline in blood glucose
causes a reduction in body temperature in birds, we can
speculate that NPY might stimulate an energy-consuming
anabolic process to store glucose as glycogen in the liver
and muscle and reduce catabolic processes of glycogen in
the liver, and thereby reduce body heat so much as to
cause hypothermia. Body temperature is very high in
chickens (41.5°C) compared with humans (36.5–37.0°C),
with the blood glucose level in chickens correspondingly
very high (260 mg/100 mL), but low for humans
(100 mg/100 mL), which indicates that there may be
some relation between glucose level and body temperature
since glucose can produce body heat. Kuenzel and
McMurtry (1988) reported that central injection of NPY
increased plasma insulin. Therefore, it could be possible
that central NPY injection in this study increased periph-
eral insulin and reduced blood glucose and body heat.
In this study, we found that the plasma concentrations
of histidine were decreased, but valine and tyrosine were
increased, by heat stress. However, NPY did not show
any effect that might modulate their levels. Amino acids
have some roles in reducing body temperature in chicks
(Erwan et al. 2014; Chowdhury et al. 2015, 2017). In rab-
bits, i.c.v. injections of taurine at 10 or 23°C caused
hypothermia through reducing heat production and
peripheral vasomotor tone to inhibit arousal level (Harris
and Lipton 1977). Moreover, taurine increased in tissues
(retina, nerves, kidney, and heart) to prevent leakage of
the reactive compounds from the mitochondrial matrix,
and thus indirectly acted as an antioxidant (Fang et al.
2002; Hansen et al. 2006). In addition, taurine improved
lipid metabolism, reduced lipid peroxidation and
increased growth performance in heat-exposed chicks
(Shim et al. 2006). In this study, we found that plasma
taurine, a nonessential amino acid, increased as a result
of central injection of NPY, which suggests that NPY
might have stimulated the metabolic process to produce
taurine in the tissue and to release it into the blood. We
also found that i.c.v. injection of NPY increased the
plasma anserine level. It has been reported that anserine
decreased blood pressure and heart rate in rats (Tanida
et al. 2010) and showed an antioxidant effect that pre-
vented lipid peroxidation and scavenged free radicals in
mammals (Kohen et al. 1988; Wu et al. 2003). Anserine,
a dipeptide, is particularly abundant in the skeletal muscle
and nervous tissue, and is found predominantly in birds
(Aristoy et al. 2004). Therefore, it could be thought that
an NPY-mediated increase in plasma taurine and anserine
may enhance physiological supports to enable chicks to
adapt to heat stress.
Central administration of NPY has been found to
stimulate the hypothalamic–pituitary–adrenal axis and
increase the release of corticosterone in rats (Wahlestedt
et al. 1987; Zarjevski et al. 1993; Small et al. 1997). In
this study, it was also found that central injection of
NPY increased the plasma corticosterone level under
CT at 1 h; however, at the same time, the plasma cor-
ticosterone level decreased under heat stress. It could
be speculated that NPY and heat stress might have
stimulated to release more plasma corticosterone imme-
diately after the exposure to heat stress, which might
have caused GR-mediated feedback regulation to reduce
plasma corticosterone at 1 h. Moreover, we cannot pre-
clude the possibility for being desensitized of NPY
receptors somehow in the HT group. E is more potent
than NE in causing vasoconstriction and increasing the
heart rate, muscle strength, and blood pressure, as well
as raising body temperature (Wurtman 2002). In this
study, NPY caused a reduction in plasma E concentra-
tions in HT chicks. Therefore, the reduced plasma cor-
ticosterone and E demonstrate the anti-stress function
of NPY in heat-exposed fasted chicks.
Table 3. Effect of high ambient temperature (35 1°C, 1 h) and i.c.v. injection of NPY (375 pmol/10 lL/chick) or saline on the diencephalic
mRNA expression of NPYSRs and GR in fasted chicks.
Genes
Saline NPY P-value
CT HT CT HT NPY Temperature Temperature 9NPY
NPYSR-Y1 0.98 0.53 1.14 0.11 1.04 0.1 1.03 0.08 NS NS NS
NPYSR-Y2 1.03 0.07 0.98 0.08 0.87 0.05 0.95 0.05 NS NS NS
NPYSR-Y4 1.06 0.09 1.12 0.12 0.89 0.09 1.05 0.11 NS NS NS
GR 1.27 0.21 1.72 0.32 1.94 0.26 2.07 0.29 P=0.07 NS NS
The number of chicks used in each group was as follows: Saline CT 14; Saline HT 14; NPY CT 10 and NPY HT 14. Values are means SEM.
NPY, neuropeptide Y; GR, Glucocorticoid receptor; NPYSRs, neuropeptide Y sub-receptors -Y1, -Y2, and -Y4; CT, control thermoneutral treat-
ment (30 1°C); NS, Not significant.
2017 | Vol. 5 | Iss. 23 | e13511
Page 10
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
NPY Induces Hypothermia and Thermotolerance in Chicks H. M. Eltahan et al.
In summary, central injection of NPY afforded thermo-
tolerance along with increased mRNA expression of HSP-
70, -90, and NPYSRs (-Y5, -Y6, and -Y7) in heat-exposed
chicks. The result of coinjection of NPY and CGP71683,
an NPYSR-Y5 antagonist, suggests that NPYSR-Y5 may
partially mediate the NPY-induced hypothermia.
Decreased levels of plasma glucose, corticosterone and E
as well as increased plasma taurine and anserine further
suggest that central NPY may serve to control thermal
stress and body temperature to afford protective thermo-
tolerance.
Acknowledgments
We thank the Egyptian High Education Ministry for sup-
porting a scholarship to HME, who came from the Ani-
mal Production Research Institute, Agriculture Research
Center, Egypt to study at Kyushu University. Salaw Qotb
and Yahya Eid’s encouragement of HME to conduct the
study is gratefully appreciated.
Conflict of Interest
The authors declare that they have no conflicts of
interest.
References
Aksit, M., S. Yalcın, S. Ozkan, K. Metin, and D. Ozdemir.
2006. Effects of temperature during rearing and crating on
stress parameters and meat quality of broilers. Poult. Sci.
85:1867–1874.
Aristoy, M. C., C. Soler, and F. Toldra. 2004. A simple, fast
and reliable methodology for the analysis of histidine
dipeptides as markers of the presence of animal origin
proteins in feed for ruminants. Food Chem. 84:485–491.
Bahry, M. A., V. S. Chowdhury, H. Yang, P. V. Tran, P. H.
Do, G. Han, et al. 2017. Central administration of
neuropeptide Y differentially regulates monoamines and
corticosterone in heat-exposed fed and fasted chicks.
Neuropeptides 62:93–100.
Boogers, I., W. Pluggea, Y. Q. Stokkermansa, and B.
Duchateau. 2008. Ultra-performance liquid chromatographic
analysis of amino acids in protein hydrolysates using an
automated pre-column derivatization method. J.
Chromatogr. A 1189:406–409.
Boswell, T., J. R. Millam, Q. Li, and I. C. Dunn. 1998. Cellular
localization of neuropeptide Y mRNA and peptide in the
brain of the Japanese quail and domestic chicken. Cell
Tissue Res. 293:31–38.
Boswell, T., I. C. Dunn, and S. A. Corr. 1999. Hypothalamic
neuropeptide Y mRNA is increase after feed restriction in
growing broilers. Poult. Sci. 78:1203–1207.
Branco, L. G. S. 1997. Effects of 2-deoxy-D-glucose and insulin
on plasma glucose levels and behavioral thermoregulation of
toads. Am. J. Physiol. 272:R1–R5.
Brom
ee, T., P. Sj€
odin, R. Fredriksson, T. Boswell, T. A.
Larsson, E. Salaneck, et al. 2006. Neuropeptide Y-family
receptors Y6 and Y7 in chicken. Cloning, pharmacological
characterization, tissue distribution and conserved
synteny with human chromosome region. FEBS J.
273:2048–2063.
Buchanan, T. A., P. Cane, C. C. Eng, G. F. Sipos, and C. Lee.
1991. Hypothermia is critical for survival during prolonged
insulin-induced hypoglycemia in rats. Metabolism 40:330–
334.
Chen, X., Y. Zhu, X. Cheng, Z. Zhang, and S. Xu. 2012. The
protection of selenium against cadmium-induced
cytotoxicity via the heat shock protein pathway in chicken
splenic lymphocytes. Molecules 17:14565–14572.
Chowdhury, V. S., S. Tomonaga, S. Nishimura, S. Tabata, and
M. Furuse. 2012. Physiological and behavioral responses of
young chicks to high ambient temperature. J. Poult. Sci.
49:212–218.
Chowdhury, V. S., S. Tomonaga, T. Ikegami, E. Erwan, K. Ito,
J. F. Cockrem, et al. 2014. Oxidative damage and brain
concentrations of free amino acid in chicks exposed to high
ambient temperature. Comp. Biochem. Physiol. A: Mol.
Integr. Physiol. 169:70–76.
Chowdhury, V. S., A. Shigemura, E. Erwan, K. Ito, M. A.
Bahry, P. V. Tran, et al. 2015. Oral administration of L-
citrulline, but not L-arginine or L-ornithine, acts as a
hypothermic agent in chicks. J. Poult. Sci. 52:331–335.
Chowdhury, V. S., G. Han, M. A. Bahry, P. V. Tran, P. H. Do,
H. Yang, et al. 2017. L-Citrulline acts as potential
hypothermic agent to afford thermotolerance in chicks. J.
Therm. Biol 69:163–170.
Cline, M. A., and M. Furuse. 2012. Neuropeptide regulation of
food intake in chicks. Pp 1–34 in J. L. Morrison, ed. Food
intake: regulation, assessing and controlling. NOVA Science
Publishers, Inc., Hauppauge New York.
Dark, J., and K. M. Pelz. 2008. NPY Y1 receptor antagonist
prevents NPY-induced torpor like hypothermia in cold-
acclimated Siberian hamsters. Am. J. Physiol. Regul. Integr.
Comp. Physiol. 94:R236–R245.
Davis, J. L., D. T. Masuoka, L. K. Gerbrandt, and A. Cherkin.
1979. Autoradiographic distribution of L-proline in chicks
after intracerebral injection. Physiol. Behav. 22:693–695.
Denbow, D. M., and M. A. Cline. 2015. Food intake
regulation. Pp. 469–485 in C. G. Scanes, ed. Sturkie’s Avian
Physiology. Academic Press, New York.
Doerfler, R. E., F. W. Edens, C. R. Parkhurst, G. B.
Havenstein, and M. A. Qureshi. 1998. Hypothermia,
hypoglycemia, and hypothyrosis associated with poult
enteritis and mortality syndrome. Poult. Sci. 77:1103–1109.
Ebeid, T. A., T. Suzuki, and T. Sugiyama. 2012. High
temperature influences eggshell quality and calbindin-D28k
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
2017 | Vol. 5 | Iss. 23 | e13511
Page 11
H. M. Eltahan et al. NPY Induces Hypothermia and Thermotolerance in Chicks
localization of eggshell gland and all intestinal segments of
laying hens. Poult. Sci. 91:2282–2287.
Erwan, E., V. S. Chowdhury, M. Nagasawa, R. Goda, T.
Otsuka, S. Yasuo, et al. 2014. Oral administration of D-
aspartate, but not L-aspartate, depresses rectal temperature
and alters plasma metabolites in chicks. Life Sci. 109:65–71.
Fang, Y. Z., S. Yang, and G. Wu. 2002. Free radicals,
antioxidants, and nutrition. Nutrition 18:872–879.
Fasulo, S., S. Marino, A. Mauceri, M. Maisano, A. Giannetto,
A. D’Agata, et al. 2010. A multibiomarker approach in Coris
julis living in a natural environment. Ecotoxicol. Environ.
Saf. 73:1565–1573.
Feder, M. E., and G. E. Hofmann. 1999. Heat-shock
proteins, molecular chaperones, and the stress response:
evolutionary and ecological physiology. Annu. Rev.
Physiol. 61:243–282.
Furuse, M., M. Matsumoto, N. Saito, K. Sugahara, and S.
Hasegawa. 1997. The central corticotropin-releasing factor
and glucagon-like peptide-1 in food intake of the neonatal
chick. Eur. J. Pharmacol. 339:211–214.
Furuse, M., R. Ando, T. Bungo, R. Ao, M. Shimojo, and Y.
Masuda. 1999. Intracerebroventricular injection of orexins
does not stimulate food intake in neonatal chicks. Br. Poult.
Sci. 40:698–700.
Gao, S., J. Zhang, C. He, F. Meng, G. Bu, G. Zhu, et al. 2017.
Molecular characterization of neuropeptide Y (NPY)
receptors (Y1, Y4 and Y6) and investigation of the tissue
expression of their ligands (NPY, PYY and PP) in chickens.
Gen. Comp. Endocrinol. 240:46–60.
Hansen, S. H., M. L. Andersen, H. Birkedal, C. Cornett, and F.
Wibrand. 2006. The importance role of taurine in oxidative
metabolism. Adv. Exp. Med. Biol. 58:129–135.
Hao, Y., and X. H. Gu. 2014. Effects of heat shock protein 90
expression on pectoralis major oxidation in broilers exposed
to acute heat stress. Poult. Sci. 1:2709–2717.
Harris, W. S., and J. M. Lipton. 1977. Intracerebroventricular
taurine in rabbits: effects on normal body temperature,
endotoxin fever and hyperthermia produced by PGE1 and
amphetamine. J. Physiol. 266:397–410.
He, C., J. Zhang, S. Gao, F. Meng, G. Bu, G. Li, et al. 2016.
Molecular characterization of three NPY receptors (Y2, Y5
and Y7) in chickens: Gene structure, tissue expression,
promoter identification, and functional analysis. Gen.
Comp. Endocrinol. 236:24–34.
Holmberg, S. K. S., S. Mikko, T. Boswell, R. Zoorob, and D.
Larhammar. 2002. Pharmacological characterization of
cloned chicken neuropeptide Y receptors Y1 and Y5. J.
Neurochem. 81:462–471.
Ito, K., E. Erwan, M. Nagasawa, M. Furuse, and V. S.
Chowdhury. 2014. Changes in free amino acid
concentrations in the blood, brain and muscle of heat-
exposed chicks. Br. Poult. Sci. 55:644–652.
Ito, K., M. A. Bahry, Y. Hui, M. Furuse, and V. S.
Chowdhury. 2015. Acute heat stress up-regulates
neuropeptide Y precursor mRNA expression and alters brain
and plasma concentrations of free amino acids in chicks.
Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 187:13–19.
Jakob, U., H. Lilie, I. Meyer, and J. Buchner. 1995. Transient
interaction of Hsp90 with early unfolding intermediates of
citrate synthase. Implications for heat shock in vivo. J. Biol.
Chem. 270:7288–7294.
Kobayashi, K., and K. S. Pillai (eds). 2013. Transformation of
data and outliers. Pp. 37–46 in A Handbook of Applied
Statistics in Pharmacology. CRC Press: Taylor & Francis
Group, New York.
Kohen, R., Y. Yamamoto, C. K. Cundy, and N. B. Ames. 1988.
Antioxidant activity of carnosine, homocarnosine and
anserine present in muscle and brain. Proc. Natl Acad. Sci.
USA 85:3175–3179.
Kuenzel, W. J., and M. Masson. 1988. A Stereotaxic Atlas of
the Brain of the Chick (Gallus domesticus). The Johns
Hopkins University Press, Baltimore.
Kuenzel, W. J., and J. McMurtry. 1988. Neuropeptide Y: brain
localization and central effects on plasma insulin levels in
chicks. Physiol. Behav. 44:669–678.
Kuenzel, W. J., L. W. Douglass, and B. A. Davison. 1987.
Robust feeding following central administration of
neuropeptide Y or peptide YY in chicks. Gallus domesticus.
Peptides 8:823–828.
Larsson, T. A., F. Olsson, G. Sundstr€
om, L. G. Lundin, S.
Brenner, B. Venkatesh, et al. 2008. Early vertebrate
chromosome duplications and the evolution of the
neuropeptide Y receptor gene regions. BMC Evol. Biol. 8:184.
Lundell, I., T. Boswell, and D. Larhammar. 2002. Chicken
neuropeptide Y-family receptor Y4: a receptor with equal
affinity for pancreatic polypeptide, neuropeptide Y and
peptide YY. J. Mol. Endocrinol. 28:225–235.
Malva, J. O., S. Xapelli, S. Baptista, J. Valero, F. Agasse, R.
Ferreira, et al. 2012. Multifaces of neuropeptide Y in the
brain - neuroprotection, neurogenesis and
neuroinflammation. Neuropeptides 46:299–308.
Marsh, D. J., G. Hollopeter, K. E. Kafer, and R. D. Palmiter.
1998. Role of the Y5 neuropeptide Y receptor in feeding and
obesity. Nat. Med. 4:718–721.
Miyata, Y., and I. Yahara. 1992. The 90-kDa heat shock
protein, Hsp90 binds and protects casein kinase II from self-
aggregation and enhances its kinase activity. J. Biol. Chem.
267:7042–7045.
Najafi, P., I. Zulkifli, N. A. Jajuli, A. S. Farjam, S. K. Ramiah,
A. A. Amir, et al. 2015. Environmental temperature and
stocking density effects on acute phase proteins, heat shock
protein 70, circulating corticosterone and performance in
broiler chickens. Int. J. Biometeorol. 59:1577–1583.
Nollen, E. A. A., and R. I. Morimoto. 2002. Chaperoning
signaling pathways: molecular chaperones as stress-sensing
“heat shock” proteins. J. Cell Sci. 115:2809–2816.
Persaud, S. J., and G. A. Bewick. 2014. Peptide YY: more than
just an appetite regulator. Diabetologia 57:1762–1769.
2017 | Vol. 5 | Iss. 23 | e13511
Page 12
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
NPY Induces Hypothermia and Thermotolerance in Chicks H. M. Eltahan et al.
Pockley, A. G. 2003. Heat shock proteins as regulators of the
immune response. Lancet 362:469–476.
Quinteiro-Filho, W. M., A. Ribeiro, V. Ferraz-de-Paula, M. L.
Pinheiro, M. Sakai, L. R. M. S
a, et al. 2010. Heat stress
impairs performance parameters induces intestinal injury
and decreases macrophage activity in broiler chickens. Poult.
Sci. 89:1905–1914.
Reichmann, F., and P. Holzer. 2016. Neuropeptide Y: a
stressful review. Neuropeptides 55:99–109.
Richter, K., M. Haslbeck, and J. Buchner. 2010. The heat shock
response: life on the verge of death. Mol. Cell 40:253–266.
Rocha, P. L., and L. G. S. Branco. 1998. Physiological
significance of behavioral hypothermia in hypoglycemic
frogs (Rana catesbeiana). Comp. Biochem. Physiol. A: Mol.
Integr. Physiol. 19:957–961.
Rozenboim, I., E. Tako, O. Gal-Garber, J. A. Proudman, and
Z. Uni. 2007. The effect of heat stress on ovarian function
of laying hens. Poult. Sci. 86:1760–1765.
Saito, E. S., H. Kaiya, T. Tachibana, S. Tomonaga, D. M.
Denbow, K. Kangawa, et al. 2005. Inhibitory effect of
ghrelin on food intake is mediated by the corticotropin
releasing factor system in neonatal chicks. Regul. Pept.
125:201–208.
Sandercock, D. A., R. R. Hunter, G. R. Nute, M. A. Mitchell,
and P. M. Hocking. 2001. Acute heat stress-induced
alterations in blood acid-base status and skeletal muscle
membrane integrity in broiler chickens at two ages:
implications for meat quality. Poult. Sci. 80:418–425.
Schmittgen, T. D., and K. J. Livak. 2008. Analyzing real-time
PCR data by the comparative (CT) method. Nat. Protoc.
3:1101–1108.
Shim, K. S., K. T. Hwang, M. W. Son, and G. H. Park. 2006.
Lipid metabolism and peroxidation in broiler chicks under
chronic heat stress. Asian-Australas J. Anim. Sci. 19:1206–
1211.
Small, C. J., D. G. A. Morgan, K. Meeran, M. M. Heath, I.
Gunn, C. M. B. Edwards, et al. 1997. Peptide analogue
studies of the hypothalamic neuropeptide Y receptor
mediating pituitary adrenocorticotrophic. Proc. Natl Acad.
Sci. USA 94:11686–11691.
Stetler, R. A., Y. Gan, W. Zhang, A. K. Liou, Y. Gao, G. Cao,
et al. 2010. Heat shock proteins: cellular and molecular
mechanisms in the central nervous system. Prog.
Neuropsychopharmacol. Biol. 92:184–211.
Szekely, M., E. Petervari, and Z. Szelenyi. 2004. Orexigenic
vs. anorexigenic peptides and feeding status in the
modulation of fever and hypothermia. Front Biosci.
9:2746–2763.
Tachibana, T., S. Saito, S. Tomonaga, T. Takagi, E. S. Saito, T.
Nakanishi, et al. 2004. Effect of central administration of
prolactin-releasing peptide on feeding in chicks. Physiol.
Behav. 80:713–719.
Tachibana, T., M. Sato, D. Oikawa, H. Takahashi, T. Boswell,
and M. Furuse. 2006. Intracerebroventricular injection of
neuropeptide Y modifies carbohydrate and lipid metabolism
in chicks. Regul. Pept. 136:1–8.
Tachibana, T., D. Oikawa, N. Adachi, T. Boswell, and M.
Furuse. 2007. Central administration of alpha-melanocyte-
stimulating hormone changes lipid metabolism in chicks.
Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 148:408–
412.
Takahashi, H., M. Iigo, K. Ando, T. Tachibana, D. M.
Denbow, and M. Furuse. 2005. Regulation of body
temperature by thyrotropin-releasing hormone in neonatal
chicks. Dev. Brain Res. 157:58–64.
Tanida, M., J. Shen, D. Kubomura, and K. Nagai. 2010. Effects
of anserine on the renal sympathetic nerve activity and
blood pressure in urethane-anesthetized rats. Physiol. Res.
59:177–185.
Thaxton, P., R. D. Wyatt, and P. B. Hamilton. 1974. The effect
of environmental temperature on paratyphoid infection in
the neonatal chicken. Poult. Sci. 53:88–94.
Tu, W. L., C. Y. Cheng, S. H. Wang, P. C. Tang, C. F. Chen,
H. H. Chen, et al. 2016. Profiling of differential gene
expression in the hypothalamus of broiler-type Taiwan
country chickens in response to acute heat stress.
Theriogenology 85:483–494.
Wahlestedt, C., G. Skagerberg, R. Ekman, M. Heilig, F.
Sundler, and R. Hhkanson. 1987. Neuropeptide Y (NPY) in
the area of the hypothalamic paraventricular nucleus
activates the pituitary-adrenocortical axis in the rat. Brain
Res. 417:33–38.
Wu, H., C. Shiau, H. Chen, and T. Chiou. 2003. Antioxidant
activities of carnosine, anserine, some free amino acids and
their combination. J. Food Drug Anal. 11:148–153.
Wurtman, R. J. 2002. Stress and the adrenocortical control of
epinephrine synthesis. Metabolism 51:11–14.
Yi, J., E. R. Gilbert, P. B. Siegel, and M. A. Cline. 2015. Fed
and fasted chicks from lines divergently selected for low or
high body weight have differential hypothalamic appetite-
associated factor mRNA expression profiles. Behav. Brain
Res. 286:58–63.
Zarjevski, N., I. Cusin, R. Vettor, F. Rohner-Jeanrenaud, and
B. Jeanrenaud. 1993. Chronic intracerebroventricular
neuropeptide-Y administration to normal rats mimics
hormonal and metabolic changes of obesity. Endocrinology
133:1753–1758.
Zhao, L., and W. A. Jones. 2012. Expression of heat shock
protein genes in insect stress responses. Invertebrate Surviv.
J. 9:93–101.
ª2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society
2017 | Vol. 5 | Iss. 23 | e13511
Page 13
H. M. Eltahan et al. NPY Induces Hypothermia and Thermotolerance in Chicks
