The Catocala naganoi species group (Lepidoptera: Noctuidae), with a new species from Vietnam

Abstract

The Asian Catocala naganoi species group is delimited and reviewed, with a diagnosis of the constituent species based on genitalic, wing pattern, and COI 5' mtDNA characters. The included species are Catocala naganoi Sugi, 1982, C. solntsevi Sviridov, 1997, C. naumanni Sviridov, 1996, and C. katsumii sp. n. which is described here as new.

Full text

Accepted by L. Pinheiro: 16 Oct. 2017; published: 28 Nov. 2017
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN
1175-5334
(online edition)
Copyright © 2017 Magnolia Press
Zootaxa 4358 (1): 079
–
106
http://www.mapress.com/j/zt/
Article
79
https://doi.org/10.11646/zootaxa.4358.1.3
http://zoobank.org/urn:lsid:zoobank.org:pub:E936B6DF-72C8-4F78-9BB4-99AC1C99C36A
The Catocala naganoi species group (Lepidoptera: Noctuidae),
with a new species from Vietnam
HUGO L. KONS JR.
1
, ROBERT J. BORTH
2
, AIDAS SALDAITIS
3, 5
& SERGEI DIDENKO
4
1
719 West Summer Street, Appleton, WI USA. E-mail: hkonsjr@yahoo.com;
2
Lepidoptera Biodiversity, LLC. E-mail: bobborth@sbcglobal.net;
3
Nature Research Centre, Akademijos str. 2, LT-08412 Vilnius-21, Lithuania. E-mail: saldrasa@gmail.com;
4
National University of Science and Technology MISiS, Leninskiy pr. 4, Moscow 119049, Russia. E-mail: sdi13@mail.ru;
5
Corresponding author
Abstract
The Asian Catocala naganoi species group is delimited and reviewed, with a diagnosis of the constituent species based
on genitalic, wing pattern, and COI 5' mtDNA characters. The included species are Catocala naganoi Sugi, 1982, C. solnt-
sevi Sviridov, 1997, C. naumanni Sviridov, 1996, and C. katsumii sp. n. which is described here as new.
Key words: underwing moth, new species, mitochondrial DNA, cytochrome oxidase subunit I, Ngoc Linh Mountain
Introduction
Among the Asian Catocala Schrank is a small array of medium sized, yellow hindwinged species defined by a
number of genitalic and mtDNA characters. These include C. naganoi Sugi, 1982, C. solntsevi Sviridov, 1997, and
C. naumanni Sviridov, 1996, and we refer to them as the C. naganoi species group (the recently described C.
kishidai Ishizuka, 2009 [Figs. 2: J–K] may also be a member of this group as suggested by mtDNA, but C. kishidai
remains known only from the single female holotype and comparative genitalic data are as yet unavailable).
Examples of synapomorphies shared by the three confirmed naganoi group species include: diverticulum 2b
expanded terminally, and with a distinct notch in the expanded region (Figs. 6: A–H, white arrows); diverticulum
13 large and fairly triangular in shape (dorsal aspect) (Figs. 7: A–F); left and right cucullus unsclerotized except for
a prominent patch of sclerotization at the ventral anterior margin fusing with the saccular projection (Figs. 9: A–H
& 10: A–H); right lobe of anellus (ventral aspect) with a posterior translucent lightly scerotized membranous
extension (Figs. 13: A–H); left lobe of anellus strongly curved posteriorly (rather than anteriorly as in most
Catocala) (Figs. 11: A–F); and sinus vaginalis expanded and diamond–shaped posterior of lamella antevaginalis
(not examined for C. naumanni) (Fig. 5: F). This form of diverticulum 2b and the right anellar lobe are as far as
known unique to the C. naganoi species group. We compared both the morphology and mtDNA of the C. naganoi
group with most of the other Eurasian Catocala species with the hindwing median band fused to the marginal band
in two places (in some or all individuals), including: Catocala hyperconnexa Sugi, 1965, Catocala patala Felder &
Rogenhofer, 1874, Catocala butleri Leech, 1900, Catocala formosana Okano, 1958, Catocala kuangtungensis
Mell, 1931, Catocala dejeani Mell, 1936, Catocala pataloides Mell, 1931, Catocala joyka Ishizuka, 2006 (male
only), and C. nubilia Butler, 1881. These species lack all of the aforementioned synapomorphies for the C. naganoi
species group. Other Catocala species for which we examined three dimensional genitalic characters in a broad
survey of the genus have at most one of these character states (from apparent independent acquisition), and the
closest relatives of the C. naganoi group are unclear.
Here we describe another species in the C. naganoi species group, based on corresponding morphological and
mtDNA characters. This new species occurs in Vietnam, and is allopatric with and sister to the apparent Taiwanese
endemic C. naganoi.

KONS ET AL.
80
·
Zootaxa 4358 (1) © 2017 Magnolia Press
Materials and methods
Genitalia were dissected and imaged by HLK with GT Vision or Automontage imaging systems as described in
Kons and Borth (2015). Genitalic terminology follows “Genitalic Structural Terminology for Catocala and Related
Genera” at http://www.lepidopterabiodiversity.com/Terminology.htm. The 5' region of COI was sequenced by Paul
Hebert's lab at the University of Guelph as described in Hebert et al. (2003). Sequences were manually aligned in
Mesquite version 2.75 (Madison & Madison 2011). Diagnostic combinations of COI 5' characters were identified
with the "map characters (show hashmarks)" function of Winclada (Nixon 2002), and haplotypes for characters that
vary within the C. naganoi species group were identified with the "character diagnoser" function of Winclada.
Characters were mapped on the strict consensus of most parsimonious trees (MPTs) for the taxa included in Fig.
16. MPTs were calculated with all four search algorithms at default settings with the best score hit 1,000 times with
TNT software (Goloboff et al. 2008).
Collection acronyms are as follows: AS = Aidas Saldaitis (Vilnius, Lithuania); HS = Helmut Seibald (Vienna,
Austria); KI = Katsumi Ishizuka (Nagano, Japan); MGC = McGuire Center for Lepidoptera Research (Gainesville,
FL); NSMT = National Museum of Nature and Science (Tokyo); RJB = Robert J. Borth (Mequon, WI); SD = Sergei
Didenko (Moscow, Russia); YPM = Yale Peabody Museum of Natural History (New Haven, CT); ZFMK =
Zoologisches Forschungsmuseum, A. Konig (Bonn, Germany).
All specimens examined for this paper are illustrated on the adult plates, with data labels, with the exception of
one female C. pataloides (dissection No. HLK: 2398, China, Bamianshan, 1800 m, Ruchent side, S–W. Hunnan,
June 2005, leg. Wen et al. [RJB]).
Catocala katsumii sp. n., Kons, Borth, Saldaitis & Didenko
(Figs. 1: A–G, 3: A–AC, 4: A–F, 5: A–K, 6: A–B, 7: A, 8: A, 9: A–B, 10: A–B, 11: A, 13: A, F, & L, 15: A)
Type material. Holotype: male (Fig. 1: A), DNA voucher No. 22027–150616–VI, Dissection No. HLK:2407,
Vietnam, Kon Tum Prov., Ngoc Linh Mountain, vic. N 15.05° W108.02° 1700 m, June 2016 (YPM). Paratypes:
(Figs. 1:B–G) Vietnam: Kon Tum Prov.: Ngoc Linh Mountain, vic. N 15.05° W108.02° 1700 m: 1 male, Dissection
No. HLK: 2409, June 2016 (RJB); 1 female, Dissection No. HLK:2420, June 2016 (RJB); 6 males, June 2016
(RJB); 2 females, June 2016 (RJB); 1 male , DNA voucher No. 22030–150616–VI, May 2015 (RJB); 1 male May
2015, (RJB); 4 males, 6 females, May 2016 (AS, SD); 1 male, 3 females, July 2016 (HS); 1 female, DNA voucher
No. 22029–150616–VI, October 2016 (RJB); 3 males, 2 females, December 2016 (RJB). Lào Cai Prov.: 1 female,
Dissection No. HLK: 2408, Sapa Mountain, 1600 m, May 2015 (RJB).
Diagnosis. This section allows diagnosis of the four confirmed members of the C. naganoi species group. We
note that genitalia and COI 5' allow much better delimitation of these species than wing pattern, and we
recommend that material from new localities be assessed by genitalia and/or DNA and not solely on wing pattern.
Although C. hyperconnexa Sugi, 1965 (Figs. 2: L–R) is similar to C. katsumii in wing pattern, the genitalic
structure of C. hyperconnexa is highly divergent and suggests no close relationship with the C. naganoi species
group (Figs. 9: I, 10: I, 11: G–H, 12: D, 13: I & Q, 14: A–D, & 15: D). C. pataloides Mell, 1931 (Figs. 2: S–T)
occurs in sympatry with C. katsumii and has a similar hindwing to the C. naganoi species group, but, as with C.
hyperconnexa, the divergent genitalia suggest no close relationship (Figs. 9: J, 10: J, 11: I, 12: E & I, 13: J–K, 14:
E–I & 15: E). Some additional Asian Catocala species have hindwings similar to C. katsumii (i.e., median and
marginal dorsal hindwing bands doubly connected by black bands along veins Cu2 and 2A) but these are broadly
allopatric and again have divergent genitalia (some of these species are compared with the C. naganoi species
group in supplemental plates available at: http://www.lepidopterabiodiversity.com/SP.htm). Within the C. naganoi
species group, C. naganoi and C. katsumii are supported as sister taxa. Examples of synapomorphies include:
serrate region present on phallus posterior of ventral hood (Figs. 3: P & 13: B); in ventral aspect the apex of
diverticulum 2b projects approximately perpendicular to the base of the phallus hood (Figs. 4: A–B & 18: A, C–D
(red arrows)); diverticulum 7.1 present (Figs. 4: A–B & 8: A, C–D); apex of diverticulum 12 curves posteriorly
(Figs. 4: A–B & 10: A, C–D (purple arrows)); ventral/posterior surface of diverticulum 7 heavily undulated (Figs.
4: C, E & 8: A, C–D); ventral anterior opening of antrum with roughly symmetrical concave lobes nearly
perpendicular to the vertical plane of the antrum; and ventral anterior side of antrum opening nearly as wide as the
horizontal width of the antrum (Figs. 5: A & 15: A–B).

Zootaxa 4358 (1) © 2017 Magnolia Press
·
81
THE CATOCALA NAGANOI SPECIES GROUP
Wing Pattern: The maculation of C. katsumii is like C. naganoi, but the forewings of C. katsumii are
generally browner and less mottled with white or pale brown, creating a smoother appearance, versus the greyer
and coarser appearance of C. naganoi (Fig. 1). C. solntsevi and C. naumanni may have more contrasting darker
brown in the basal area (basal to the antemedial line) than in the medial area, whereas in C. katsumii there tends to
be little contrast between these areas. Some but not all specimens of C. naganoi, C. solntsevi, and C. naumanni
have a variably sized band or patch of contrasting white in the medial area, which is unknown in C. katsumii. The
ventral wing surfaces separate C. hyperconnexa and C. katsumii. The basal side of the ventral forewing marginal
band is angled in C. hyperconnexa (Fig. 2: O) but smooth in C. katsumii (Figs. 1: D & G). Both species have a
ventral hindwing black streak along vein 2a which extends from the marginal band to the wing base. However, in
C. hyperconnexa the medial band extends distinctly beyond vein 2A into the anal cell, such that the black streak
bisects the medial band (Fig. 2: O). In C. katsumii the median band terminates at vein 2A or extends slightly into
the anal cell, such that the black streak is fused with the median band terminus creating a non–bisected continuous
loop (Figs. 1: D & G). The forewings of C. hyperconnexa tend to be coarser and more mottled with white than C.
katsumii, but are otherwise extremely similar. Some specimens of C. hyperconnexa have a contrasting white patch
inside the subreniform spot (Figs. 2: L–M) and/or a contrasting whitish band in the median area (Figs. 2: L–N &
R), and neither of these conditions has been found in C. katsumii. C. pataloides differs from all species in the C.
naganoi species group by having the dorsal hindwing medial and marginal bands fused or nearly so along vein M2
(Fig. 2: S). The thick black dorsal forewing postmedial line between veins Cu2 and M3 differs from the C. naganoi
group, where the postmedial line is thick along vein Cu2 and anterior of vein M3, but thin between these veins.
Many specimens of C. pataloides have a contrasting white patch in the subreniform spot (Fig. 2: S), and we have
not seen this in the C. naganoi group. It is not clear that C. solntsevi and C. naumanni can be reliably separated
from each other by wing pattern alone (see Remarks; we have found no consistent differences in wing pattern in the
limited series we have examined).
Male Genitalia: C. katsumii (n=2), C. naganoi (n=3), C. solntsevi (n=4), C. naumanni (n=4 capsule, n=1
vesica).
Vesica (anterior aspect): Inner terminal side of diverticulum 2b (distal of notch dividing sections A and B,
demarcated by a white arrow) concave in C. katsumii (Figs. 6: A–B) versus convex in C. naganoi (Figs. 6: C–D),
C. naumanni (Fig. 6: E), and C. solntsevi (Figs. 6: F–H) (see red arrows). Diverticulum 2b distal of notch globular
in C. katsumii and C. naganoi versus narrower in C. naumanni and C. solntsevi (Fig. 6). Outer side of diverticulum
1c with at most a shallow concave indentation in C. katsumii, C. naganoi, and C. naumanni, but with a deep
concave indentation in C. solntsevi (Fig. 6 (blue arrows)). Outer side of diverticulum 2a and inner side of
diverticulum 5 distinctly separated in C. katsumii (Figs. 6: A–B), but touching in the other three species (Figs. 6:
D–H) (except in one instance where diverticulum 2a slipped over the top of diverticulum 1a during eversion (Fig.
6: C) rather than being forced up closer to diverticulum 5 as in all other preparations in the C. naganoi species
group). Outer margin of diverticulum 5 with a concave indentation in C. katsumii (yellow arrows) but not in the
other three species (Fig. 6). Outer side of diverticulum 1a with four distinct lobes in C. naganoi (Figs. 6: C–D;
lobes designated A–D in blue font), three distinct lobes in C. katsumii (Figs. 6: A–B) and C. solntsevi (Fig. 6: F),
and two distinct lobes in C. naumanni (Fig. 6: E).
Vesica (dorsal or ventral aspect): Deep angular separation between diverticula 6 and 6.1 (blue arrows) in C.
naganoi (Figs. 7: C–D & 8: C–D), whereas only a shallow concave separation in C. katsumii (Figs. 7: A & 8: A)
and C. naumanni (Figs. 7: B & 8: B), and no discernible separation in C. solntsevi (Figs. 7: E–F and 8: E–F).
Diverticula 9a and 9b both conspicuous in C. katsumii (Fig. 7: A), C. naganoi (Figs. 7: C–D), and C. naumanni
(Fig. 7: B) versus 9a indiscernible in C. solntsevi (Figs. 7: E–F). Diverticula 9b largest and broadest in C. naumanni
(Figs. 7: B & 8: B), similar in C. katsumii and C. naganoi (Figs. 7: A, C–D & 8: A, C–D), but more elongate in C.
solntsevi (Figs. 7: E–F & 8: E–F).
Vesica (dorsal aspect, phallus hood behind image): Base of outer side of diverticulum 13 (left purple arrow)
arising from outer edge of diverticulum 10 in C. katsumii (Fig. 7: A) and C. naumanni (Fig. 7: B) versus rising
from the interior of diverticulum 10 in C. naganoi (Figs. 7: C–D) and C. solntsevi (Figs. 7: E–F). Diverticulum 7
small and not extending dorsally over the vesica in C. naumanni (Fig. 7: B) versus prominent and extending
dorsally over the vesica in the other species (Figs. 7: A, C–F). Deep separation between diverticula 6 and 7 (green
arrows) in C. katsumii (Fig. 7: A) and C. naganoi (Figs. 7: C–D) versus shallow separation in C. naumanni (Fig. 7:
B) and C. solntsevi (Figs. 7: E–F).

KONS ET AL.
82
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 1. Imagos of C. katsumii, C. naganoi, & C. solntsevi.

Zootaxa 4358 (1) © 2017 Magnolia Press
·
83
THE CATOCALA NAGANOI SPECIES GROUP
FIGURE 2. Imagos of C. solntsevi, C. naumanni, C. kishidai, C. hyperconnexa and C. pataloides.

KONS ET AL.
84
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 3. Male genitalia and leg structures of the C. katsumii holotype.

Zootaxa 4358 (1) © 2017 Magnolia Press
·
85
THE CATOCALA NAGANOI SPECIES GROUP
FIGURE 4. Three dimensional vesica structure of the C. katsumii holotype.

KONS ET AL.
86
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 5. Female genitalic structures of C. katsumii.

Zootaxa 4358 (1) © 2017 Magnolia Press
·
87
THE CATOCALA NAGANOI SPECIES GROUP
FIGURE 6. Diagnostic vesica characters between C. katsumii, C. naganoi, C. naumanni, and C. solntsevi (part); anterior
aspect zoomed in on the anterior rosette of diverticula 2–5 and diverticulum 1.

KONS ET AL.
88
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 7. Diagnostic vesica characters between C. katsumii, C. naganoi, C. naumanni, and C. solntsevi (part); dorsal aspect
(opposite posterior phallus hood).

Zootaxa 4358 (1) © 2017 Magnolia Press
·
89
THE CATOCALA NAGANOI SPECIES GROUP
FIGURE 8. Diagnostic vesica characters between C. katsumii, C. naganoi, C. naumanni, and C. solntsevi (part); ventral aspect
(posterior phallus hood in front).

KONS ET AL.
90
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 9. Comparison of the left valva (inner side, ventral edge on top) between six Catocala species.
Vesica (ventral aspect, phallus posterior hood in front of image): Apex of diverticulum 2b (red arrows) projects
approximately perpendicular to the posterior phallus hood in C. katsumii (Fig. 8: A) and C. naganoi (Figs. 8: C–D)
versus approximately parallel in C. naumanni (Fig. 8: B) and C. solntsevi (Figs. 8: E–F). Diverticulum 7.1
indiscernible in C. naumanni (Fig. 8: B), versus present and conspicuous in the other species (Figs. 8: A, C–F).
Apex of diverticulum 12 (purple arrows) projects posteriorly–inward in C. katsumii (Fig. 8: A) and C. naganoi
(Figs. 8: E–F) versus anteriorly–inward in C. naumanni (Fig. 8: B) and C. solntsevi (Figs. 8: E–F). Posterior side of
diverticulum 7 strongly undulated in C. katsumii and C. naganoi (most clearly seen in lateral aspect (Figs. 4: E–C),
but also clear in ventral aspect (Figs. 8: A, C–D), much more weakly undulated in C. solntsevi (Figs. 8: E–F), and
not discernibly undulated in C. naumanni (Fig. 8: B).
Valv ae: While the apex of valvae costa can be highly variable infraspecifically in Catocala species where it
extends posteriorly beyond the cucullus, there are some differences within the naganoi species group that we
observed to be consistent within all of the species among the series examined. Left valva costal apex tapering and
narrowly rounded in C. solntsevi (Figs. 9: F–H) versus widening in the other three species (Figs. 9: A–E). The
ventral corner of the flared left costal apex tapers to a point in C. katsumii (Figs. 9: A–B) whereas it is more
smoothly rounded in C. naganoi (Figs. 9: C–D) and C. naumanni (Fig. 9: E). The dorsal corner of the flared left

Zootaxa 4358 (1) © 2017 Magnolia Press
·
91
THE CATOCALA NAGANOI SPECIES GROUP
costal apex tapers to a point in C. naumanni (Fig. 9: E), but is irregularly rounded in C. katsumii (Figs. 9: A–B) and
C. naganoi (Figs. 9: C–D). The width of the left valve costa between the clasper base and the posterior edge of the
cucullus is distinctly narrower in C. naganoi than in the other three species (Fig. 9). The left clasper curves inward
to the least extent in C. solntsevi such that it appears the longest in inner aspect (Figs. 9: F–H); it curves inward to
the greatest extent in C. naumanni and projects posteriorly to the least extent (Fig. 9: E). In C. solntsevi the left
costa is widest across from the clasper shaft and narrows anterior and posterior of this point, whereas in the other
three species the costa is wider at the base of the clasper, constricts posteriorly across from the clasper shaft, then
widens posteriorly beyond the clasper, constricts again, and finally widens again apically (Fig. 9). Right clasper
narrower in C. naumanni (Fig. 10: E) and C. solntsevi (Figs. 10: F–H) than for C. katsumii (Figs. 10: A–B) and C.
naganoi (Figs. 10: C–D). Sclerotized area in ventral anterior corner of right cucullus borders a distinct ventral lobe
in C. katsumii, C. naganoi, and C. naumanni, whereas the ventral edge of the cucullus is smooth at the border of the
membranous and sclerotized areas in C. solntsevi (Fig. 10).
FIGURE 10. Comparison of the right valva (inner side, ventral edge on bottom) between six Catocala species.
Juxta/Anellus (Figs. 3 L & 11): The posterior left side of the anellus has a sharp angular bend (slightly obtuse
to nearly 90 degrees) in C. katsumii, C. naganoi, and C. naumanni whereas this area is broadly concave in C.
solntsevi. The apex of the left anellus lobe abruptly narrows apically (due to a strong bend on the anterior side) in
C. solntsevi and C. naumanni, versus a much more progressive tapering in C. katsumii and C. naganoi. The anellus
is similar and not clearly diagnosable between C. katsumii and C. naganoi. The posterior outer apex of the juxta is

KONS ET AL.
92
·
Zootaxa 4358 (1) © 2017 Magnolia Press
less narrowly fused with the anellus in C. katsumii and C. naganoi versus C. naumanni and C. solntsevi, such that
when the juxta/anellus is flattened out the juxta lobes form an obtuse angle in C. katsumii and C. naganoi but an
acute angle in C. naumanni and C. solntsevi.
FIGURE 11. Comparison of the juxta and anellus between six Catocala species (ventral and flattened on slide unless
designated "lateral").
Phallus: In all four species the apex of the posterior phallus hood is divided into two lobes (yellow arrows)
divided by a concave gouge; however, the left lobe extends distinctly farther posteriorly than the right lobe in C.
katsumii (Figs. 4: A & 8: A) and C. naumanni (Fig. 8: B) versus both lobes extending a comparable distance
posteriorly in C. naganoi (Figs. 8: C–D) and C. solntsevi (Figs. 8: E–F). In C. katsumii and C. naganoi the
subapical ventral side of the phallus has a serrate keel covered with minute spines (Figs. 3: P & 13: B), whereas this
area has a single much larger quadrate tooth in C. naumanni (Fig. 15: H) but is smooth in C. solntsevi (Figs. 15: D–
E). The phallus of all of these species is curved in three dimensions and apparent shape vary greatly between
different orientations of the same individual specimen. However, when viewed from comparable orientations, such
as with the coecum opening oriented laterally and on top (Figs. 3: P & 15: A–E) or face on (Figs. 3: N & 15: F–H)
C. katsumii and C. naganoi are similar in shape (any possible differences between these two species are too small
to detect above apparent differences that result from not being able to align different individuals in exactly the same
orientation); however, C. naumanni and C. solntsevi each have unique and distinctive shapes within this group.
Female Genitalia: C. katsumii (n=2), C. naganoi (n=2), C. solntsevi (n=2), C. naumanni (not studied). The
anterior margin of the antrum opening has two shallow convex lobes in C. katsumii (Fig. 5: A) and C. naganoi with
a small medial triangular depression, whereas in C. solntsevi the entire anterior margin is triangular shaped. The
opening is also much wider anteriorly in C. katsumii and C. naganoi than in C. solntsevi. The anterior margin of the
lobes of the lamella antevaginalis are concave in C. katsumii (Fig. 5: A), convex in C. naganoi, and convex with a

Zootaxa 4358 (1) © 2017 Magnolia Press
·
93
THE CATOCALA NAGANOI SPECIES GROUP
small concave depression on the inner side in C. solntsevi (Fig. 15, red arrows). The sides of the antrum are
asymmetric in C. katsumii and C. naganoi but symmetric in C. solntsevi. In C. solntsevi both sides the antrum
strongly taper anteriorly for over 2/3 of their length, whereas in C. katsumii and C. naganoi the left side (ventral
aspect) strongly tapers in the posterior third of the antrum length. The lagena is shaped like an inverted triangle in
C. katsumii (Fig. 5: I), ovuloid in C. naganoi (Fig. 5: L), and irregular in C. solntsevi (Fig. 5: M). The utriculus and
stalk of the lagena is distinctly longer in C. naganoi (Fig. 5: L) than in the other two species (Figs. 5: I & M).
FIGURE 12. Comparison of the uncus between six Catocala species (left side: lateral aspect; right side: posterior aspect).

KONS ET AL.
94
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 13. Comparison of the phallus and ductus ejaculatorius between six Catocala species: A–E & K: phallus with
coecum opening lateral and on top; F–J: phallus with coecum opening face on; L–Q: ductus ejaculatorius.
COI 5': Three consistent character state differences were recorded between C. katsumii (n=3, all from type
locality) and C. naganoi (n=1, plus 1 partial sequence): C. katsumii has 50 (T), 136 (C), and 343 (C), whereas C.
naganoi has 50 (C), 136 (T), and 343 (T) (Table 1). States 50 (C), 136 (C), 343 (C), and 343 (T) are recorded from
only one C. naganoi group species. The clade of C. katsumii + C. naganoi can be distinguished from all other
sequenced Catocala by the following unique combination of character states: 28 (G), 40 (G), 88 (T), 235 (T), and
574 (C). All these states are unique to the C. katsumii + C. naganoi clade within the C. naganoi species group.

Zootaxa 4358 (1) © 2017 Magnolia Press
·
95
THE CATOCALA NAGANOI SPECIES GROUP
Catocala naumanni is diagnosed by the combination 241 (A), 289 (G), 364 (C), 400 (C), and 477 (A), and C.
solntsevi is diagnosed by 180 (G), 265 (C), and 438 (C) (Fig. 16). Character states with black circles in Fig. 16 are
unique to the specimens above their node among the specimens included in the analysis (all included in Fig. 16).
All haplotypes recorded within the C. naganoi species group are presented in Table 1.
FIGURE 14. Three dimensional vesica structure for C. hyperconnexa and C. pataloides.

KONS ET AL.
96
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 15. Comparison of female genitalia between five Catocala species (ventral habitus and lateral anal papillae; black
arrows associate lateral anal papillae and ventral habitus photos).
TABLE 1. COI 5' haplotypes in the C. naganoi species group.
Description. Head. Vertex with mixed brown, grey, and whitish scales. Frons with predominately brown
scales medially and white bands laterally. Labial palp basal segment almost exclusively white, with sparse grey
scales on the lateral side; middle segment with white band on basal, distal, and ventral sides, predominately dark
grey elsewhere; terminal segment predominately dark grey, with scattered light grey and white scales. Antennae
dorsally and laterally covered by grey scales, except for pedicel which is covered with white scales.

Zootaxa 4358 (1) © 2017 Magnolia Press
·
97
THE CATOCALA NAGANOI SPECIES GROUP
FIGURE 16. Diagnostic unique combinations of COI 5' characters for the Catocala naganoi species group and its constituent
species. Diagnostic characters are mapped on the strict consensus of most parsimonious cladograms.

KONS ET AL.
98
·
Zootaxa 4358 (1) © 2017 Magnolia Press
FIGURE 17. Ngoc Linh Mountain, the type locality of C. katsumii (photo by Vadim Golovizin).
Thorax. Patagia predominantly dark grey with transverse white bands and lighter grey with mixed white
scales distally. Tegulae with mixed dark grey, light grey, brown, and whitish scales, without distinct bands.
Elsewhere dorsally a mix of different shades of grey and brown scales and hairs with scattered white. Some whitish
scales on thorax and tegulae with a bluish tint. Ventrally with dense whitish tan hairs.
Wings (Figs. 1: A–G). Length of anterior forewing base to apex: 25–29 mm males (n=9), 23–29 mm females
(n=9); ratio of (anterior forewing base to apex)/ (anterior forewing base to tornal angle): 1.2–1.4 in both genders
(wing shape not sexually dimorphic). Comparative forewing data: Males: C. katsumi (range=25–29 mm,
mean=26.4, n=9); C. naganoi (range=30 mm, mean=30 mm, n=2); C. solntsevi (Vietnam: range=28–33 mm,
mean=30.4 mm, n=25) (China: 33 mm, n=1); C. hyperconnexa (range=24–25 mm, mean=24.7 mm, n=4). Females:
C. katsumii (range=23–29 mm, mean=26.2 mm, n=9); C. naganoi (range=26–29 mm, mean=28.0 mm, n=3); C.
solntsevi (Vietnam: range=29–31mm, mean=30.3 mm, n=7); C. hyperconnexa (27 mm, n=1).
Forewing upperside (Figs. 1: A–C & E–F): Background color predominantly brown and grey with variable
peppering of pale tan scales. Slightly denser brown scaling between postmedial and subterminal lines, and
sometimes along basal sides of postmedial and antemedial lines. Basal dash present in both genders, short and thin,
not extending distal of basal line, dark greyish–black, typically sharp with thin diffuse area around edges,
occasionally diffuse throughout. Basal line sharp and black above cell CuA2, comprised of two loops, anterior loop
fused with a black costal patch. Antemedial line single, comprised of five loops: posterior loop (below vein 2A)
convex, thick and sharp contrasting black, margins more diffuse with black and dark brown; second (medial) loop
large and convex spanning between veins 2A and lower margin of discal cell, of variable intensity but the most
diffuse and least contrasting loop, comprised of brown or black and brown scales, sometimes medial section barely
discernible from background (as in holotype); remaining loops thick and contrasting, comprised of dark brown or
dark brown and black scales, midline regions sharp but edges may be diffuse; third loop convex, spanning posterior
margin of discal cell to veinlet; fourth loop roughly triangular with apex near anterior margin of discal cell; fifth
loop short and thick, convex, anterior to radial vein. Medial line double but limited to two black–dark brown
patches between costa and the anterior margin of discal cell. Postmedial line of variable thickness, black; bordered
distally by thin band of pale whitish grey to tan posterior of vein CuA2. Postmedial line undulations: below vein
2A convex, thick, mostly sharp but with more diffuse edges; between Cu2 and 2A single to weakly doubly dentate
at apex; posterior side thickest part of postmedial line, anterior side thin, subreniform closed, connected to
postmedial line by a single thin line; thin triangular tooth between veins Cu1 and Cu2; thicker but narrower
triangular tooth between veins M3 and Cu1; two dentate distally protruding teeth between veins M1 and M3 with
deep triangular division between them across vein M2, the tooth anterior to vein M2 extends slightly farther

Zootaxa 4358 (1) © 2017 Magnolia Press
·
99
THE CATOCALA NAGANOI SPECIES GROUP
distally than the tooth posterior to vein M2, apices and sometimes base of each tooth distinctly thickened; jagged
and angling basally between veins R5 and M1, then sharply turned basally along vein R4, roughly perpendicular to
costa, then thickened as a wide black patch slightly distal to the outer border of the reniform. Reniform spot closed
with diffuse, double, brown to black border, diffuse brown scaling inside slightly contrasting with the more greyish
median area. Subterminal line indistinct, a series of diffuse, light grey, dentate to undulate, distally protruding
chevrons; one chevron between each pair of veins between R4 and 2A, half chevron between R4 and the costa,
indistinct or half chevron between 2A and the inner margin. A diffuse dark brownish band sometimes present distal
of the postmedial line between veins M2 and R5, slanting posteriorly outward to outer margin at vein R5. Wing
margin with series of thin, diffuse, black to dark grey, concave bars between each pair of veins from R4 to 2A.
Fringe peppered with variable shades of grey.
Hindwing upperside (Figs. 1: A–C & E–F): Background color orange–yellow throughout, no dark suffusion in
hindwing background basal area inside or posterior to median band. Black median band sharp and thick, forming a
complete loop with anterior and posterior sides converging at base of wing where only separated by a thin sliver of
hindwing background color, distal side smooth to slightly angled along vein M2, both sides bulged between veins
M2 and Cu1, band curved distally in cell CuA2, posterior side of loop thick along vein 2A. A dark band all along
the inner margin paralleling the median band, but thinner, more diffused, and sometimes more greyish than the
medial band. Posterior side of median band connected or nearly connected with inner marginal band by a diffuse
black patch in the anal cell, positioned slightly basal to the farthest distal extent of the median band (between veins
2A and Cu2). Marginal black band thickest anteriorly, progressively narrowing posteriorly as far as vein M3, of
fairly uniform thickness between veins M3 and Cu2, broken or narrow in cell CuA2, a wide patch at vein 2A,
terminating before inner margin. Median and marginal bands doubly connected by black bands along veins Cu2
and 2A, the latter contiguous with the posterior side of the median band. Fringe orange–yellow, with black patches
at ends of veins M1–Cu2, patches may be fused together between some veins; fringe black from the terminus of
vein 2A to the inner margin. Apical patch wide with orange–yellow scales matching background color.
Forewing underside (Figs. 1: D & G): Background color pale yellow–orange. Marginal band thick and black,
basal margin sharp, distal margin somewhat indistinct as area between marginal band and outer margin with dark
grayish black only slightly lighter than the marginal band. Medial and basal bands wide and black, connected by an
inner marginal band posterior of the veinlet between veins 2A and Cu2. Background color separates marginal and
medial bands throughout their length, may be clean throughout or diffused with blackish scaling posterior of vein
Cu1. Basal band thick and black, sharp posterior to discal cell, still predominately black with some diffusion of
lighter tan scales anterior to lower margin of discal cell. Basal area with a small patch of background color. Fringe
blackish.
Hindwing underside (Figs. 1: D & G): Background color pale orange–yellow like forewing. Medial black band
of similar shape as dorsally but slightly thinner. Marginal black band of similar shape as dorsally, but relatively
thicker across cell CuA2, and contiguous even if broken dorsally. Black band along inner margin much thinner and
more diffuse than dorsally, not fused with median band. Median and marginal bands doubly connected by black
bands along veins Cu2 and 2A, but connections narrower and more diffuse, more so along vein Cu2 than 2A.
Fringe similar to upperside.
Legs (Figs. 3: O & V–AC (male)). Male and female legs similar with two exceptions: (1) male profemur with
laterally flattened apical spine on dorsal corner (Fig. 3: O), (2) male mesotibia wider than female and with hair
pencil groove on inner side (Fig. 3: X).
Foreleg (Figs. 3: O, V, & Z): Protibia unspined, but with small convex sulcus with radiating spines near basal
extremity on the inner side (Fig. 3: V). Protibial flange in shallow ovuloid pit, ventral margin of flange with short
row of setae (Fig. 3: V). Protarsomeres 1–4 with three ventral rows of large triangular spines, and two rows of
minute hair–like curved spines between them (Fig. 3: AC); protarsomere 5 with four rows of large triangular
spines, with two rows of minute hair–like spines in–between (Fig. 3: AA). Minute hair–like spines present on
lateral sides of tarsomeres and along dorsal midline. Protarsomere 5 with pair of elongate, narrow, tubular spines
dorsally at apex, then curving ventrally at apex. Pretarsus simple, arolium translucent and ovuloid with lateral
sclerotized bands (Fig. 3: AA).
Midleg (Figs. 3: W–X, AA & AC): Mesotibia with a single row of seven heavily sclerotized large spines (Fig.
3: W). Tarsal spination like foreleg.
Hindleg (Figs. 3: Y & AB): Sclerotization pattern typical for Catocala, with femur sclerotized throughout,

KONS ET AL.
100
·
Zootaxa 4358 (1) © 2017 Magnolia Press
metatibia translucent white except at base (Fig. 3: Y), metatarsomere 1 translucent white except at apex, remaining
tarsomeres sclerotized throughout (Fig. 3: Y). Metafemur and metatibia unspined, metatarsal spination like foreleg.
Abdominal Scale Pattern. Dense brown colored scales dorsally over grey background, white, pale tan, and
lighter grey scales ventrally.
Abdominal cuticle. Male as shown in Figs. 3: S–U. Female: Segments 1–6 similar to male, tergite 7 as shown
in Fig. 5:G.
Male genitalia (Figs. 3: A–N & P–Q, 4: A–F, 6: A–B, 7: A, 8: A, 9: A–B, 10: A–B, 11: A, 13: A, F & L).
Capsule (Figs. 3: A–C): Juxta and vinculum strongly fused with valvae, vinculum weakly fused with tegumen,
vinculum arms prominently expanded and weakly fused midventrally. Diaphragma membranous except for juxta/
anellus, but weakly pigmented posterior of anellus.
Valv ae (Figs. 3: E & J–K, 9: A–B, 10: A–B): Outer surfaces densely covered with elongate tan hairs and scales
except for anterior portion of sacculus (Fig. 3: C), ventral half of "cucullus" (or the membranous valvae structure in
the equivalent position) with dense elongate brown hairs/scales (Fig. 3: C); inner surface of cucullus with shorter
scales and hairs along ventral margin (Fig. 3: C). Saccular process fused with band of ventral sclerotization on the
anterior side of the cucullus (Figs. 9: A–B & 10: A–B); left saccular process narrow and elongate, over 4.5X as
long as wide with a pointed posterior apex (Figs. 9: A–B); right saccular process thin and narrow, about 4X as long
as wide with a curved and pointed apex (Figs. 10: A–B). On both valvae with inner side of sacculus with about 20
elongate setae near fusion with cucullus (Figs. 9: A–B & 10: A–B). Additional setae scattered along posterior
margin of sacculus on inner side. Ventral inner sides of sacculus with concave indentation along margin of clasper
base (Fig. 3: A). Left and right cucullus unpigmented except for ovoid patches of sclerotization bordering the
ventral margin on the anterior side (Figs. 9: A–B & 10: A–B). Cucullus with scattered elongate setae on inner
surface along ventral margin, densest anteriorly. Left costa heavily sclerotized, wide at base and tapering distally,
of similar width for most of length with a slight medial expansion, then flared apically posterior to cucullus on the
ventral side, posterior edge serrate, ventral corner bluntly pointed, dorsal corner convex (Figs. 9: A–B). Right costa
dissimilar to left, wide and abruptly tapering distally at base, then progressively widening until terminating slightly
distal of clasper apex but well anterior to posterior edge of cucullus, posterior edge indistinct, dorsal edge sharp and
distinct, roughly semicircular subapical unpigmented area extending basally as a narrower band tapering to a point
and paralleling the ventral side of the sharp costal margin (Figs. 10: A–B). Dorsally both costae fairly smooth along
the length of the tegumen, distal to the sharp bend near base of uncus becoming slightly more irregular and
undulated (Fig. 3: B). Claspers asymmetric (Figs. 3: A & E); both dorsoventrally flattened basally, fairly tubular
distally. Left clasper (Fig. 3: J) in inner aspect ventral side concave; dorsal side irregularly undulated basally,
concave distally; apex flared about 2X the medial width of the shaft, convex posteriorly and on sides, with about 25
scattered, minute, short setae, including 15 in a coplanar arc across the lateral edge; sparse, scattered short setae
along clasper sides; patch of about ten elongate setae just anterior of the ventral side of clasper base. In ventral
aspect projects ventrally inward, appearing fairly straight (Fig. 3: A). Right clasper (Fig. 3: K) in inner aspect
ventral side concave; dorsal side convex basally and weekly concave medially–subapically; apex flared unevenly
to over 2X the medial width of the shaft, ventral side more flared than dorsal side, flared area curved inward at
apex, about 10–15 minute, short setae scattered around apex but none appearing in a coplanar arc along the edge;
sparse, scattered minute setae on sides of shaft but no elongate setae. In ventral aspect irregularly projecting
ventrally inward, shaft broadly curved ventrally, apex curved ventrally/inward at roughly a 90 degree angle (Fig. 3:
A).
Juxta (Figs. 3: L & 11: A): Two elongate nearly symmetrical lobes, narrowest posteriorly, progressively
widening anteriorly. Lobes broadly fused to anellus for over half the length of the posterior sides, touching at
posterior end but not fused together. Pitted pattern of anellus not extending to juxta lobes at extreme posterior and
posterior–outer edges.
Anellus (Figs. 3: L & 11: A): Lobes fused together throughout and appearing as a single sclerotized plate,
highly asymmetrical. Left lobe (ventral aspect) broad and widening basally, then strongly curved and tapering to a
narrow point distally; posterior side with a convex bulge basally, then deeply concave; anterior side strongly
convex basally, broadly and shallowly concave distally. Right lobe over twice as wide as left lobe at widest point,
widening for a short distance basally, then tapering to a narrow point distally, apex slightly curved posteriorly;
posterior side convex basally, concave distally; anterior side convex basally, shallowly concave distally. Right lobe
of anellus with a posterior translucent lightly scerotized membranous extension, base of this expansion including

Zootaxa 4358 (1) © 2017 Magnolia Press
·
101
THE CATOCALA NAGANOI SPECIES GROUP
about the posterior half of the inner side of the right lobe and a short distance around the posterior apex of the lobe.
Left lobe with dense shallow depressions (pits) throughout, but less dense in a small ovuloid interior area adjacent
the basal edge of the bend; right lobe with the pits around the entire margin of the lobe, but with a broad area in the
interior of the wide basal section devoid of pits.
Uncus (Figs. 3: H–I): In lateral aspect (Fig. 3: I) widest medially, slightly widening from base to median area,
progressively tapering and distinctly narrowing from medial area to apex; posterior side strongly convex, anterior
side strongly concave. In posterior aspect widest subbasally, then narrowing and constricting before slightly
widening medially and then tapering distally. Terminating in heavily sclerotized curved spine, laterally appearing
pointed apically but narrowly rounded in dorsoventral view. Setae densest and longest at swollen base, longest
setae over 1.6 X the maximum width of the uncus in posterior aspect (Fig. 3: H), dense nearly as long setae extend
into medial area (clearest in posterior aspect), then abruptly shortening distal of the medial area and decreasing in
density.
Tuba analis (Fig. 3: F): Membranous except for scaphium. Scaphium an elongate rectangular plate terminating
slightly dorsally to the uncus apex.
Phallus (Figs. 3: G, M–N & P, 4: A, 13: A & F): Translucent throughout. Curved in three dimensions, cannot be
viewed two dimensionally in any plane, apparent shape highly variable depending on orientation (Fig. 13: A versus
F). Coecum shape clearest with opening orientated face on (Figs. 3: N & 13: F), posterior portion with a broad
curve to the left, anterior apex with a weaker posterior curve. Shaft between coecum and hood doubly bent but
bends occur in different planes and each are clearer in different orientations. With the coecum opening orientated
face on, the first (anterior–most) bend is co–planar with the coecum; the shaft is curved to the left, such that the left
side is convex and the right side is concave. The second bend curves ventrally and is clearest with the coecum
opening viewed laterally and on top (Figs. 3: M & 13: A); this is the medial bend that is present in most Catocala
species. Serrate band of small triangular teeth on the ventral side of the phallus posterior of the ventral bend,
terminating posteriorly in a laterally flattened serrate keel reaching the base of the phallus hood (Fig. 3: P). Left
flank of posterior ventral extension ("hood" over everted vesica) (Fig. 4: A) with a deep medial concave gouge
(CG) and a convex expansions anterior and posterior of the gouge; right flank weakly convex, but appearing
concave as the outer sclerotization is faint, and the boundary between lighter and darker sclerotization is concave;
apex emarginate with two convex lobes divided medially by a concave gouge. Four sclerotized chords present on
the ventral hood; inner chords (LIC and RIC) cross near base of the hood where they are prominent, then
approximately parallel and much fainter throughout the length of the hood; right outer chord (ROC) prominent for
over half the basal length of the hood, then abruptly becoming much fainter; right sclerotized plate (RSP)
prominent, extending along entire right flank; left outer chord (LOC) disjunctive, discontinuous near base of hood,
moderately distinct until convex posterior expansion.
Ductus ejaculatorius (Figs. 3: Q & 17: L): Slender region with distinct bend just before scoop–shaped region.
Scoop shaped region had a S–shaped curve with a medial twist in both preparations (Fig. 3: Q), but the twist can be
curved over 180 degrees to create the C–shaped curve typical of most Catocala (Fig. 13: L); subsequently, the apex
of the scoop crosses the apex of the slender region and broad overlaps with the base of the scoop (Fig. 13: L).
Vesi c a (Figs. 4: A–F, 6: A–B, 7: A & 8: A): Vesica diverticulum 1 trilobal: each lobe of similar width with 1a
longer than and partially curved over the apex of 1b in anterior aspect (Figs. 6: A–B), 1b slightly longer than 1c
(Figs. 4: A & 6: A–B); 1a arched and pointed with three convex lobes on outer side (anterior aspect, Figs. 6: A–B),
1b and 1c convex lobes (Figs. 4: A & 6: A–B). Diverticulum 2 bilobal: 2a a small convex lobe; 2b with broad
tapering triangular base, then with a narrower tubular section following a sharp bend, apex greatly expanded and
covered with minute inverted teeth (teeth limited to expanded area), expanded area with a distinct triangular gouge
on inner side, slightly concave on the inner side distal to this gouge, convex on outer side (Figs. 6: A–B).
Diverticulum 3 a simple convex bulge, covered with inverted teeth (Figs. 6: A–B). Diverticulum 4 a simple convex
lobe narrower than 3, with sparser and scattered inverted teeth (Figs. 6: A–B). Diverticulum 5 prominent and
elongate, outer side with two shallow but distinct lobes, apex and inner sides convex (Figs. 6: A–B). Diverticulum
6 large and broad, wider than high, densely covered with inverted teeth (Figs. 4: B & D). Diverticulum 7 narrower
and much longer than 6, curved around about 180 degrees and arching over the dorsal surface of the vesica for
roughly 2/3 of its length (Figs. 4: D & F). Diverticulum 8 thin and narrow, not extending around the distal edge of
the phallus hood (Fig. 4: B). Diverticulum 9 distinctly bilobal, 9a a shallow convex bulge, 9b curved with the outer
side much longer than inner side and a more narrowly rounded apex (Figs. 4: A & D). Diverticulum 10a broad

KONS ET AL.
102
·
Zootaxa 4358 (1) © 2017 Magnolia Press
simple lobe, posterior portion densely covered with inverted teeth, teeth continue more sparsely anteriorly along
outer margin (Fig. 4: D). Diverticulum 11 not discernible. Diverticulum 12 a simple convex lobe with apex
extending ventrally over the left side of the phallus hood, densely covered with inverted teeth (Figs. 4: A–B).
Diverticulum 13 a prominent fang–shaped lobe, with scattered inverted teeth along outer edge (Fig. 4: C). Vesica
unpigmented throughout (Fig. 4).
Female genitalia (Figs. 5: A–K & 15: A) (n=2).
Papillae analis (Figs. 5: A–B, H, & J): Transparent except for a thin band of dorsal sclerotization on each
papilla, terminating subapically. Longest setae at base, projecting posterior/outward. Shorter setae throughout
papillae project posterior/outward. Apices densely covered with setae of highly variable lengths (Figs. 5: H & J).
Papillae curved such that dorsal side strongly convex and ventral side weakly and doubly concave, but with small
convex area at base (Fig. 5: J). Papillae widest at base and gradually tapering but with a slight subapical widening,
narrowest apically (Fig. 5: J).
Intersegmental membrane between papillae and segment 8 (Figs. 5: A–B & 15: A): Bulging out with sides
convex, posterior end nearly as wide as anterior end, widest medially. Ratio of length to width at anterior end =
1.7–1.8.
Segment A8 (Fig. 5: B): Anterior edge of sides overlapping with posterior edge of lamella antevaginalis. Shape
as shown in Fig. 5: B. Elongate, posteriorly projecting setae scattered throughout sclerotized surfaces, greatest
density posteriorly along edge.
Intersegmental membrane between lamella and segment 8 on ventral side (Figs. 5: A & F): Heavily sclerotized
with three differently shaped sections; posterior section triangular and tapering anteriorly; medial section roughly
diamond–shaped, contrastingly heavily sclerotized band on sides contiguous along posterior edge, but
noncontiguous on anterior edge; anterior section inverted U–shaped, widening anteriorly, longitudinal sclerotized
band along midline. Posterior and medial sections densely covered with minute spiculations, spiculations in
anterior section limited to the posterior portion of the sclerotized midline band.
Lamella antevaginalis (LAV) (Figs. 5: A & 15:A): Sides bent dorsally, somewhat asymmetrical, appearing less
asymetrical if sides flattened out, but thicker where connected to antrum on the left side (ventral aspect) than the
right side. Posterior margins convex; anterior margins convex for a short distance beyond fusion with antrum but
concave for remainder of length, not contiguous along dorsal midline, rather disjunct and not connecting across
antrum. Slit in LAV along ventral midline wide and progressively widening anteriorly to the full width of the
antrum at anterior terminus, sides slightly thickened at anterior margin.
Antrum (Figs. 5: A–C & 15: A): Sclerotized throughout. Sides convex, widest at anterior end of slit in LAV,
gradually tapering anterior to this position and more strongly tapering posteriorly.
Ductus bursae (Figures 5: A–C & 15: A): Rectangular and strongly dorso–ventrally flattened with a sclerotized
plate on each side, curved ventrally and to the right. Sclerotization variable, partially unsclerotized, in one
preparation sclerotization limited to the ventral anterior edge, in the other preparation sclerotization widest at
anterior edge, then tapering posteriorly but extending as far as the antrum.
Corpus bursae (Figs. 5: A–C & 15: A): Posterior section with longitudinal wrinkles elongate, about 3.5–4 X as
long as wide at anterior base (ventral aspect), widening posteriorly, widest point slightly anterior to junction with
ductus bursae. Anterior section densely covered with minute inverted teeth, vertically ovoid.
Ductus seminalis (Fig. 5: K): Total length approximately 12.5 mm. Section between corpus bursae and bula
seminalis about 6.4 mm, coiled portion of this section with 6–8 coils and about fourteen inflexion points. Thicker
fairly straight section distal to bulla seminalis about 3.0 mm.
Colleterial gland complex (Figs. 5: D–E & I): Terminology follows Mitter (1987). Adjoining differentiated
canals of receptacle duct with three coils basal to the vesicle; abrupt transition to undifferentiated section at base of
vesicle; vesicle sclerotized, comma shaped, thinner than preceding coils (Fig. 5: E). Utriculus elongate with many
narrow longitudinal grooves throughout (Fig. 5: I). Lagena with two distinct sections, base narrow and tubular and
progressively but slightly widening distally, distal section abruptly, progressively, and strongly widening,
somewhat fan–shaped with an irregularly but somewhat flattened apical margin (in contrast to the ovoid shape
typical of most Catocala species) (Fig. 5: I). Colleterial gland narrowest at base and irregularly widening distally,
curved and asymmetric, the sack from which the paired glands arise not clearly differentiated from stalk (Fig. 5:
D). Oviductus communalis with simple section about twice as long as paired section (Fig. 5: D). Vagina ovoid (Fig.
5: D).

Zootaxa 4358 (1) © 2017 Magnolia Press
·
103
THE CATOCALA NAGANOI SPECIES GROUP
Rectum/Intestine. Rectum sculptured throughout with small ovuloid shapes with slightly raised walls. Male
intestine thin, as shown in Fig. 3: R.
COI 5' Mitochondrial DNA: All three sequenced specimens of C. katsumii have the following haplotype for
positions 1 to 658:
AACTTTATATTTTATTTTCGGAATTTGGGCAGGAATAGTGGGAACTTCATTAAGATTATTAATTCGAGCT
GAATTAGGTAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCTT
TTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATAT
TAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGACTTTTACCCCCCTCATTAACT
TTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTATATCCCCCTCTTTCC
TCTAATATTGCTCATAGAGGTAGTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTC
AATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTAATATTTGATCAAAT
ACCTTTATTTATTTGAGCTGTAGGAATTACTGCATTCCTTCTTCTTCTCTCATTACCAGTATTAGCTGGAG
CTATTACCATACTTTTAACTGATCGAAATTTAAATACTTCTTTCTTTGATCCAGCTGGAGGAGGAGATCC
TAT TT TATAT C AA CAT TTAT T T
Etymology. The new species is named for Katsumi Ishizuka, who has devoted many years to advancing the
understanding of Catocala.
Biology and distribution. Catocala katsumii appears to be endemic to the Indochinese Peninsula. All but one
of the specimens have been taken at the type locality of Ngoc Linh Mountain in the Central Highlands of Vietnam
at 1700 m (Fig. 17; the other specimen was taken at 1600 m in the northwestern mountainous region of Vietnam
adjacent to Yunnan, China). Catocala solntsevi, C. pataloides and Ulotrichopus macula (Hampson, 1891) occur
with C. katsumii at the type locality. The larval hosts of C. katsumii and other species in the C. naganoi species
group are unknown. The recorded phenology for C. katsumii is unusual among Catocala species, with fresh
specimens recorded from May, June, July, October, and December. In the Nearctic, some larger Catocala species
have a nearly comparably extended flight season, but fresh specimens predominate in the summer months.
On Ngoc Linh Mountain, Sino–Himalayan (Juglandaceae, Ulmaceae, Lauraceae) and Malesian (Myrtaceae,
Sterculiaceae) tree families are intermixed and present at all altitudes. Above 1000 m. typical Vietnamese medium
montane broad–leaved evergreen forest becomes increasingly dominant, with Sino–Himalayan floral elements
(Fagaceae, Lauraceae, Magnoliaceae) and some conifers mixed in, and disturbance levels are lower and
precipitation is heavier (>3500 mm annually; Hurley 2001). High lepidopteran diversity in Vietnam is in part due
to changes in topography and climate patterns with links to adjacent Sino–Himalayan, Sundanian and Indo–
Burmese faunas, with the Kon Tum plateau alone having 16 endemic butterfly species (including 9 of Indo–
Burmese origin; Monastyrskii and Holloway, 2013). The newly described Catocala becheri Borth, Kons, &
Saldaitis, 2017 also appears to be endemic to the Central Highlands.
Remarks.
Catocala naganoi Sugi, 1982
(Figs. 1: H–L, 5: L, 6: C, D, 7: C, D, 8: C, D, 9: C, D, 10: C, D, 11: B, C, 12: A, F, 13: B, G, M & P, 15: B)
Catocala naganoi Sugi, 1982, Tyo to Ga, 32(3–4), 147–159, (TL: Taiwan, Taoyuan Hsien [HT: coll. NSMT, Tokyo).
This species appears to be endemic to Taiwan, where it is recorded from Taoyuan (Fig 1: H & K–L) and Hsinchu
Counties (Figure 1: I–J). The holotype of C. naganoi (Sugi 1982, Fig. 5) is typical in wing pattern to material we
studied, and the valvae (Sugi 1982, Fig. 12) are similar to our dissections except for the left clasper, which appears to
have been damaged and bent by ca. 180 degrees as a result of slide mounting.

KONS ET AL.
104
·
Zootaxa 4358 (1) © 2017 Magnolia Press
Catocala solntsevi Sviridov, 1997
(Figs. 1: M–R, 2: A–C, 5: M, 6: F–H, 7: E, F, 8: E, F, 9: F–H, 10: F–H, 11: D, E, 12: B, G, 13: D, E, N & O, 15: C)
Catocala solntsevi Sviridov, 1997, Russian Journal of Zoology, 76(6), 763–765, (TL : North Vietnam, Tam Dao [HT: coll.
Zoological Museum of Moscow University).
This species is recorded from South China (Guangdong, Hunan and Guizhou Provinces) and Vietnam (Kon Tum,
Quàng Nam, Thừa Thiên–Huế, Lâm Ðồng Provinces and Da Nang Municipality). The male holotype (Sviridov &
Korb, 2010, Fig. 16) exhibits the forewing phenotype with a whitish medial area, similar to Fig. 1:Q. Drawings of
the holotype valvae and phallus (Sviridov, 1997, Fig. 1) are consistent with our dissections, including the tapering
costal apex of the left valve, in contrast to the flared costal apex of all of the other C. naganoi group species.
However, Sviridov's (1997, Fig. 1) drawing of the left anellus plate differs from our dissections by lacking an
abrupt tapering and elongate, narrow terminus, and we suspect this difference is an artifact of limitations of the
type drawing or dissection (note that care is needed during dissection to recover intact the fragile termini of the
anellar plates when separating the anellus/juxta from the valvae).
Sequenced specimens of C. solntsevi from China and Vietnam form separate clades with four consistent COI 5'
character state differences, but we found these to be indistinguishable by both external pattern and male genitalic
morphology. In contrast, C. katsumii and C. naganoi have three consistent COI 5' character state differences, yet
have numerous genitalic differences as elaborated above. This is yet another cautionary example of why degree of
divergence in COI 5’ sequences can be problematic when making species–level decisions, even within a group of
closely related species.
Catocala naumanni Sviridov, 1996
(Figs. 2: D–I, 6: E, 7: B, F, 8: B, 9: E, 10: E, 11: F, 12: C, H, 13: C, H)
Catocala naumanni Sviridov, 1996, Journal of the Ukraine Entomological Society, 2(3–4), 23–26, (TL : China, Yünnan, Li–kiang
[HT: coll. ZFMK).
All known specimens were collected in close proximity to the type locality in northern Yunnan Province, China, at
altitudes above 2000 m, and allopatric with the other members of the C. naganoi species group. Sviridov's (1996)
published male genitalic drawings of the holotype show some marked differences from the preparations we examined
(e.g., in the drawing, the left valva clasper parallels the dorsal edge of the costa and the phallus lacks a distinctive
quadrate tooth). However, actual photos of the C. naumanni holotype genitalia differ from these drawings, and the
features match our other preparations.
It is not clear that C. solntsevi and C. naumanni are separable by wing pattern alone, and we found no
consistent differences in the limited series we studied. All recently collected C. naumanni examined (3 males, one
female) have a dorsal forewing marginal shade posterior of vein 2A, which continues between the antemedial and
postmedial lines, although it may be not as dark in this area (Figs. 2: D–H). In some specimens of C. solntsevi the
marginal shade is relatively lighter between the antemedial and postmedial lines (Figs. 1: Q–R), or the darkest area
is limited to the vicinity of vein 2A but not extending to the anal margin (Figs. 1: M & O–P). All specimens of C.
naumanni examined (n=5) have the dorsal hindwing marginal band clearly unbroken in cell CuA2; three specimens
examined of C. solntsevi (n=31) match these (Fig. 1: R), but the remainder either have the band broken or more
narrowly joined in cell CuA2. However, the range of variation in this feature observed in C. solntsevi is typical of
infraspecific variation in many Catocala species, and longer series of both species may be needed to circumscribe
the patterns more crisply.
Acknowledgements
Larry Gall, Kyle Johnson, Hugo Kons, Sr., Sharon Kons, and David Wahl have supported our Catocala research in
numerous ways. David Wahl and the former American Entomological Institute provided use of a GT Vision

Zootaxa 4358 (1) © 2017 Magnolia Press
·
105
THE CATOCALA NAGANOI SPECIES GROUP
imaging system, and Daniel Young and Kyle Johnson arranged use of an Auto–Montage imaging system at the
University of Wisconsin–Madison. James Hayden, Katsumi Ishizuka, and Andre Sourakov loaned critical material
for study. Adult and male genitalia images of the male holotype of C. naumanni were provided by Dieter Stüning.
Katsumi Ishizuka and Alessandro Floriani provided corresponding adult and genitalia images for specimens of C.
naumanni, C. solntsevi and C. naganoi. Vadim Golovizin contributed the type locality image. Thanh Lunog Le,
John Heppner, Katsumi Ishizuka, Mamoru Owada, Andre Sourakov, and Hsiau–Yue Wang collected C. naganoi
group specimens used in this study. Thanh Lunog Le supplied field notes from where he collected C. katsumii
specimens. Paul Hebert’s BOLD (Barcode of Life Data Systems) lab at the University of Guelph sequenced COI 5'
for our Catocala samples. Mary Blair provided the citation for the Center for Biodiversity and Conservation at the
American Museum of Natural History. Larry Gall and two anonymous reviewers provided a helpful review of this
manuscript.
References
Borth, R. J., Kons Jr., H. L. & Saldaitis, A. (2017) A new species of Catocala (Lepidoptera: Noctuidae) from Vietnam. Bulletin
of the Peabody Museum of Natural History, 58 (1), 47–64.
https://doi.org/10.3374/014.058.0104
Butler, A.G. (1881) Lepidoptera Heterocera from Northern China, Japan, and Corea. Transactions of The Royal Entomological
Society of London, (48) 534.
Goloboff, P.A., Farris, J.S. & Nixon, K.C. (2008) TNT, a free program for phylogenetic analysis. Cladistics, 24, 1–13.
https://doi.org/10.1111/j.1096-0031.2008.00217.x
Felder & Rogenhofer (1874) Reise ost. Freg. Novara (Zool.)2 (2), Taf. 112:23.
Hampson, G.F. (1891) Illustrations of Typical Specimens of Lepidoptera Heterocera in Collection of the British Museum. Part
VIII. The Lepidoptera Heterocera of the Nilgiri District, Taylor and Francis, London, 144 pp.
Hebert, P.D.N., Cywinska, A., Ball, S.L. & Waard, de J.R. (2003) Biological identifications through DNA barcodes.
Proceedings of the Royal Society B, 270, 313–321.
http://dx.doi /10.1098/rspb.2002.2218
Hurley, M.M. (2001) Multi–taxa biotic Inventories of three unprotected forested ecosystems in Vietnam. Retrieved 28 April
2017 from: the Center for Biodiversity and Conservation at the American Museum of Natural History, New York, USA.
http://www.amnh.org/our-research/center-for-biodiversity-conservation/research-and-conservation/biodiversity-exploratio
n-and-monitoring/past-projects/mainland-southeast-asia (Accessed 27 Nov. 2017)
Ishizuka, K. (2006) A new species of Catocala Schrank, 1802 from northern Sichuan, China (Lepidoptera Noctuidae) Tinea, 19
(2), 126–128.
Ishizuka, K. (2009) Records of four species of Catocala Schrank, 1802 (Lepidoptera, Noctuidae) including a new species from
Burma. Gekkan–Mushi, 461, 53–55.
Kons Jr., H.L. & Borth, R.J. (2015) A new species of Catocala (Lepidoptera: Noctuidae) from the southeastern United States.
Bulletin of the Peabody Museum of Natural History, 56 (1), 55–65.
Leech, J.H. (1900) Lepidoptera Heterocera from Northern China, Japan, and Corea. Transactions of The Royal Entomological
Society of London, (48) 534.
https://doi.org/10.1111/j.1365-2311.1900.tb02720.x
Madison, W. & Madison, D. (2011) Mesquite: a modular system for evolutionary analysis. Version 2.75. Available from: http:/
/mesquiteproject.org
Mell, R. (1931) Zur Kenntnis südchinesischer Catocalinen (s. str.) (Lep.). Mitteilungen der Deutschen Entomologischen
Gesellschaft, 2, 85–91.
https://doi.org/10.1002/mmnd.4820020605
Mell, R. (1936) Beiträge zur Fauna sinica XI. Zur Biologie und Systematik der chinesischen Catocala (Lep. Heter.). Dt. ent. Z.
Iris, 50, 49–90. [pl. 3.]
Mitter, C. (1987) Taxonomic potential of some internal reproductive structures in Catocala (Lepidoptera: Noctuidae) and
related genera. Annals of the Entomological Society of America, 81, 10–18.
https://doi.org/10.1093/aesa/81.1.10
Monastyrski, A.L. & Holloway, J.D. (2013) The Biogeography of the Butterfly Fauna of Vietnam with a Focus on the Endemic
Species (Lepidoptera). Chapter 5 of Biochemistry, Genetics and Molecular Biology “Current Progress in Biological
Research.”
Nixon, K. (2002) WinClada Software. Published by the author, Ithaca, New York. Available from: http://www.cladistics.com/
aboutWinc.htm (Accessed 27 Nov. 2017)
Okano, M. (1958) New or little known moths from Formosa (1). Ann. Rep. Gakugei Fac. Iwate Univ., 13(2): 51-56, pls. 1-2.
Sugi, S. (1965) New and unrecorded species of Catocala Ochs. from Japan and Formosa (Lepidoptera, Noctuidae). Tin ea, 7,
84–93.

KONS ET AL.
106
·
Zootaxa 4358 (1) © 2017 Magnolia Press
Sugi, S. (1965) New and unrecorded species of Catocala OCHS. from Japan and Formosa (Lepidoptera, Noctuidae). Tinea, 7, 84–
93. [pl. 17.]
Sugi, S. (1982) Illustrations of the Taiwanese Catocala, with descriptions of two new species, Noctuidae of Taiwan 1
(Lepidoptera). Tyo to Ga, 32 (3–4), 147–159.
Sviridov, A.V. (1996) A new species of the genus Catocala (Lepidoptera, Noctuidae) from southern China. Journal of the Ukraine
Entomological Society, 2 (3–4), 23–26.
Sviridov, A.V. (1997) A new species of the genus Catocala (Lepidoptera, Noctuidae) from North Vietnam. Russian Journal of
Zoology, 76 (6), 763–765.
Sviridov, A.V. & Korb, S.K. (2010) An illustrated catalogue of primary type specimens of the Lepidoptera in collection of the
Zoological Museum of Moscow State University described in the second half of XXth century. Eversmannia, 21–22, 6–27.