ArticlePDF Available

Abstract and Figures

Poxviruses continue to cause serious diseases even after eradication of the historically deadly infectious human disease, smallpox. Poxviruses are currently being developed as vaccine vectors and cancer therapeutic agents. Resveratrol is a natural polyphenol stilbenoid found in plants that has been shown to inhibit or enhance replication of a number of viruses, but the effect of resveratrol on poxvirus replication is unknown. In the present study, we found that resveratrol dramatically suppressed the replication of vaccinia virus (VACV), the prototypic member of poxviruses, in various cell types. Resveratrol also significantly reduced the replication of monkeypox virus, a zoonotic virus that is endemic in Western and Central Africa and causes human mortality. The inhibitory effect of resveratrol on poxviruses is independent of VACV N1 protein, a potential resveratrol binding target. Further experiments demonstrated that resveratrol had little effect on VACV early gene expression, while it suppressed VACV DNA synthesis, and subsequently post-replicative gene expression.
Content may be subject to copyright.
fmicb-08-02196 November 8, 2017 Time: 11:39 # 1
ORIGINAL RESEARCH
published: 17 November 2017
doi: 10.3389/fmicb.2017.02196
Edited by:
Jonatas Abrahao,
Universidade Federal de Minas
Gerais, Brazil
Reviewed by:
Danilo Oliveira,
Universidade Federal dos Vales do
Jequitinhonha e Mucuri, Brazil
Iara Apolinario Borges,
Universidade Federal de Minas
Gerais, Brazil
*Correspondence:
Zhilong Yang
zyang@ksu.edu
Specialty section:
This article was submitted to
Virology,
a section of the journal
Frontiers in Microbiology
Received: 31 August 2017
Accepted: 26 October 2017
Published: 17 November 2017
Citation:
Cao S, Realegeno S, Pant A,
Satheshkumar PS and Yang Z (2017)
Suppression of Poxvirus Replication
by Resveratrol.
Front. Microbiol. 8:2196.
doi: 10.3389/fmicb.2017.02196
Suppression of Poxvirus Replication
by Resveratrol
Shuai Cao1, Susan Realegeno2, Anil Pant1, Panayampalli S. Satheshkumar2and
Zhilong Yang1*
1Division of Biology, Kansas State University, Manhattan, KS, United States, 2Poxvirus and Rabies Branch, Division of
High-Consequence Pathogens and Pathology, National Center for Emerging and Zoonotic Infectious Diseases, Centers for
Disease Control and Prevention, Atlanta, GA, United States
Poxviruses continue to cause serious diseases even after eradication of the historically
deadly infectious human disease, smallpox. Poxviruses are currently being developed
as vaccine vectors and cancer therapeutic agents. Resveratrol is a natural polyphenol
stilbenoid found in plants that has been shown to inhibit or enhance replication of a
number of viruses, but the effect of resveratrol on poxvirus replication is unknown. In
the present study, we found that resveratrol dramatically suppressed the replication
of vaccinia virus (VACV), the prototypic member of poxviruses, in various cell types.
Resveratrol also significantly reduced the replication of monkeypox virus, a zoonotic
virus that is endemic in Western and Central Africa and causes human mortality. The
inhibitory effect of resveratrol on poxviruses is independent of VACV N1 protein, a
potential resveratrol binding target. Further experiments demonstrated that resveratrol
had little effect on VACV early gene expression, while it suppressed VACV DNA
synthesis, and subsequently post-replicative gene expression.
Keywords: poxvirus, vaccinia virus, monkeypox, resveratrol, DNA synthesis, gene expression, antiviral
INTRODUCTION
Smallpox is a deadly disease, responsible for approximately 300 million human deaths in the 20th
century alone. Smallpox is caused by the variola virus, the most notorious member of the family
Poxviridae (Miller et al., 2001). Despite the eradication of smallpox 37 years ago, poxviruses are
of renewed interest due to their continuous impact on public health. Specifically, many poxviruses
cause other human and animal diseases. For example, monkeypox, a zoonotic disease endemic
in Central and Western Africa, caused an outbreak in humans in the United States (US) in 2003
(Reed et al., 2004;Bayer-Garner, 2005). Molluscum contagiosum accounts for 1 in 500 outpatient
visits per year in the United States (Reynolds et al., 2009). Additionally, there is a concern that
variola virus, the causative agent of smallpox, can potentially be used as a biological weapon from
unsecured stocks or genetic engineering. Humans are particularly vulnerable to smallpox in the
post-smallpox immunization era due to the absence of routine vaccination, waning immunity, and
lower proportion of vaccinated individuals in the current population. In fact, between 1980 and
2010, the monkeypox incidence in Central Africa has increased 20 times after the discontinuation
of smallpox immunization (Rimoin et al., 2010). In addition, poxviruses are developed as vectors
for vaccine development against infectious diseases and as anti-cancer agents (Rerks-Ngarm et al.,
2009;Draper and Heeney, 2010;Breitbach et al., 2011;Altenburg et al., 2014;Izzi et al., 2014).
There are no FDA-approved drugs for poxvirus-infection treatment. Cidofovir, a drug for human
cytomegalovirus infection, is an off-label drug to treat poxvirus infection (Robbins et al., 2005;
Frontiers in Microbiology | www.frontiersin.org 1November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 2
Cao et al. Suppression of Poxvirus Replication by Resveratrol
Lu et al., 2011;Dower et al., 2012). There were also a number
of small-molecule inhibitors of poxviruses identified in the
past years, for example, CMX001, Tecovirimat (ST-246), and
CMLDBU6128 (Quenelle et al., 2007;Huggins et al., 2009;Jordan
et al., 2009). However, resistant viruses to the compounds were
isolated in cell culture, including CMX001 and ST-246 (Yang
et al., 2005;Andrei et al., 2006;Farlow et al., 2010). A combination
therapy may be required to treat infected individuals, which
demands the identification and characterization of additional
poxvirus inhibitors.
Resveratrol is a natural polyphenol stilbenoid found in grapes,
berries, and a number of other plants. Extensive studies have
been carried out to investigate its functions in modulating
lifespan, metabolism, cancer, and other diseases (Fremont, 2000).
Resveratrol inhibits replication of a number of viruses, such
as influenza virus, herpes simplex virus, enterovirus, hepatitis
C virus, respiratory syncytial virus, human immunodeficiency
virus, varicella zoster virus, Epstein-Barr virus, African swine
fever virus, and duck enteritis virus (Docherty et al., 1999, 2006;
Palamara et al., 2005;Nakamura et al., 2010;Galindo et al.,
2011;Espinoza et al., 2012;Xie et al., 2012;Xu et al., 2013;
Abba et al., 2015;Zhang et al., 2015). The antiviral mechanisms
of resveratrol against these viral infections are diverse and
include inhibition of viral protein synthesis, DNA synthesis,
and modulation of host functions important for viral infection
(Abba et al., 2015). In contrast to the above-mentioned viruses,
resveratrol facilitates Kaposi’s-sarcoma associated herpesvirus
(KSHV) reactivation from latency in several cell lines through
enhancing mitochondrial function of infected cells (Yogev
et al., 2014). Nevertheless, the effect of resveratrol on poxvirus
replication has not been examined. A previous study showed
that several polyphenols, including resveratrol, directly bind to
and may inhibit vaccinia virus (VACV, the prototypic member
of poxviruses)-encoded N1 protein, a cellular apoptotic regulator
(Cheltsov et al., 2010). However, N1L is a non-essential gene
and deletion of N1L from VACV genome does not affect VACV
infection in cultured cells (Bartlett et al., 2002). Therefore, it is
unlikely that resveratrol can prevent VACV infection through N1
protein in cell culture.
Here, we demonstrated that resveratrol could strongly
suppress VACV replication in multiple cell types. We also
showed that resveratrol directly targeted VACV DNA synthesis
step and the suppression was independent of the viral N1
protein. Resveratrol also suppressed monkeypox virus (MPXV)
replication.
MATERIALS AND METHODS
Cell Culture
BS-C-1 cells (ATCC-CCL26) were cultured in Eagle’s Minimum
Essential Medium (EMEM). HeLa cells (ATCC-CCL2) were
cultured in Dulbecco’s Modified Eagle Medium (DMEM).
Normal human dermal fibroblasts (NHDFs, ATCC PCS-201-010)
and human foreskin fibroblasts (HFFs, kindly provided by Dr.
Bernard Moss) were also cultured in DMEM. The EMEM and
DMEM were supplemented with 10% fetal bovine serum (FBS),
L-glutamine (2 mM), streptomycin (100 µg/mL), and penicillin
(100 units/mL). Cells were cultured in an incubator with 5% CO2
at 37C.
Cell Viability Assay and Calculation of
50% Cytotoxicity Concentration (CC50)
HeLa cells and HFFs were cultured in 12-well plates. The
cells were treated with DMSO or resveratrol at a series
of concentrations. Cell viability was measured using trypan-
blue exclusion test (Strober, 2015). After 24 h of treatment,
cells in each well were treated with 300 µL of trypsin and
resuspended with 500 µL of DMEM by pipetting. Twenty
microliters of cell suspension was gently mixed with 20 µL
of 4% trypan blue. The numbers of cells were measured
with a hemocytometer. The CC50 was calculated using relative
cell viability at different resveratrol concentrations by linear
regression analysis.
Viruses, Viral Infection, and Titration
Vaccinia virus Western Reserve (WR, ATCC VR-1354) strain was
amplified and purified as described previously (Earl et al., 2001a).
Recombinant N1L-deleted VACV was generated by homologous
recombination and the N1L gene was replaced with a green
fluorescent protein (GFP) gene. Briefly, PCR product of GFP
coding sequence under a late P11 promoter flanked by 500-
bp homologous sequences upstream and downstream N1L gene
was transfected into VACV-infected HeLa cells. The transfected
cells were collected at 24 h post-infection (hpi). Recombinant
viruses expressing GFP were clonally purified by multiple rounds
of plaque isolation (Earl et al., 2001b). Recombinant VACV
with the correct insertion or deletion was verified by PCR.
The recombinant VACV that expresses GFP under a synthetic
early/late VACV promoter (Chakrabarti et al., 1997) and dsRED
under P11 VACV promoter was generated using a similar
procedure. Recombinant virus vP11-Fluc that expresses firefly
luciferase gene under the late VACV P11 promoter was described
elsewhere (Bengali et al., 2011). MPXV MPXV-WA 2003-044
and MPXV-ROC 2003-358 clades were utilized in this study.
Preparation, infection, and titration of VACV and MPXV were
carried out as described previously (Earl et al., 2001a). For
infection, cells were incubated with desired amount of viruses
in DMEM (containing 2.5% FBS). After 1 h of incubation at
37C in 5% CO2, virus-containing DMEM was replaced with
fresh DMEM (containing 2.5% FBS) and further incubated for
desired amount of time. For titration, BS-C-1 cells cultured in
6- or 12-well plates were infected with serial diluted viral samples
and incubated in DMEM (containing 2.5% FBS and 0.5% methyl
cellulose) for 48 h. The cells were stained with 0.1% crystal violet
for 5 min and washed with water before counting the number of
plaques.
Measurement and Calculation of 50%
Inhibiting Concentration (IC50)
HeLa cells or HFFs were cultured in 12-well plates. The cells
were infected with VACV at a multiplicity of infection (MOI)
of 1 in the presence of DMSO or resveratrol at a series of
Frontiers in Microbiology | www.frontiersin.org 2November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 3
Cao et al. Suppression of Poxvirus Replication by Resveratrol
concentrations. After 24 hpi, virus titers were measured by a
plaque assay. The IC50 was calculated using virus inhibitory
efficiency at different resveratrol concentrations by linear
regression analysis.
Antibodies and Chemical Inhibitors
Antibodies against VACV L2 protein, P4a (A10) protein,
and whole VACV viral particle were kindly provided by Dr.
Bernard Moss. Antibody against human GAPDH was purchased
from Abcam (Cambridge, MA, United States). Chemicals
cytosine-1-β-D-arabinofuranoside (AraC), resveratrol, and
hydroxyurea were purchased from Sigma (St. Louis, MO,
United States).
Western Blotting Analysis
Cells were collected and lysed in NP-40 cell lysis buffer (150 mM
NaCl, 1% NP-40, 50 mM Tris–Cl, pH 8.0). Cell lysates were
reduced by 100 mM DTT and denatured by sodium dodecyl
sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) loading
buffer and boiling for 3 min before SDS–PAGE, followed
by transferring to a polyvinylidene difluoride membrane. The
membrane was then blocked in TBS-Tween (TBST) [50 mM
Tris–HCl (pH 7.5), 200 mM NaCl, 0.05% Tween 20] containing
5% skim milk and 1% bovine serum albumin for 1 h, incubated
with primary antibody in the same TBST-milk buffer for 1 h,
washed with TBST three times for 10 min each time, incubated
with horseradish peroxidase-conjugated secondary antibody for
1 h, washed three times with TBST, and developed with
chemiluminescent substrate (National Diagnostics, Atlanta, GA,
United States). The whole procedure was carried out at room
temperature. Antibodies were stripped from the membrane by
Restore (Thermo Fisher Scientific, Waltham, MA, United States)
for western blot analysis using another antibody.
Luciferase Assay
Firefly luciferase activities were measured by an ENSPIRE plate
reader (PerkinElmer, Waltham, MA, United States) using the
Luciferase Assay System (Promega, Madison, WI, United States)
according to manufacturer’s instructions.
Plasmid Replication in VACV-Infected
Cells
Total DNA was isolated using E.Z.N.A.R
Blood DNA Kit (Omega
Bio-Tek, Inc., Norcross, GA, United States). One microgram
of DNA was treated with a DpnI enzyme to digest originally
transfected input plasmid DNA (amplified from Escherichia coli,
with methylation on DpnI recognition site) but not the plasmid
DNA amplified in mammalian cells (no methylation in DpnI
site). The plasmid DNA amounts were then measured using
qPCR using a pair of primers that amplify a fragment containing
a DpnI site.
Quantitative Real-Time PCR
Total DNA was extracted from mock- or VACV-infected cells at
indicated time points using E.Z.N.A. R
Blood DNA Kit. Relative
viral DNA levels were quantified by CFX96 real-time PCR
instrument (Bio-Rad, Hercules, CA, United States) with All-in-
oneTM 2×qPCR mix (GeneCopoeia) and primers specific for
VACV and human genomes, respectively. The qPCR program
was started with initial denaturation step at 95C for 3 min,
followed by 40 cycles of denaturation at 95C for 10 s, annealing
and reading fluorescence at 52C for 30 s, and extension at 72C
for 30 s. The primers used in this study are:
C11pF: AAACACACACTGAGAAACAGCATAAA;
C11pR: ACTATCGGCGAATGATCTGATTATC;
GAPDH-F: ACATCAAGAAGGTGGTGAAGCA;
GAPDH-R: CTTGACAAAGTGGTCGTTGAGG.
The primers used for recombinant N1L-deletion VACV
characterization are:
N1-F: TTATTTTTCACCATATAGATCAATCATTAGA
TCAT.
N1-R: ATGAGGACTCTACTTATTAGATATATTCTTT
GGAG.
Puc19-F: TGCGCGTAATCTGCTGCTTG.
Puc19-R: CGAGGTATGTAGGCGGTGCT.
Statistical Analysis
All titration data were represented as the means of at least three
independent experiments. One-tailed paired T-test was used to
access for significant difference between two means with P<0.05.
RESULTS
Resveratrol Suppresses VACV
Replication in Immortal and Primary
Human Cells
To test the effect of resveratrol on the viability, HeLa cells,
an immortal cervical cancer cell line (Scherer et al., 1953),
were treated at a series of concentrations. Cell viability assay
showed that resveratrol caused 50% HeLa cell death (CC50)
at the concentrations of 157.75 µMin24h(Figure 1A and
Table 1). Consistent with the result, no significant morphological
change was observed for HeLa cells at the concentration of
50 µM (Figure 1B). We then examined the effect of resveratrol
on VACV replication. HeLa cells were infected with VACV at
an MOI of 1 in the presence of a series of concentrations
of resveratrol and the viral titers were measured 24 hpi. The
concentration of resveratrol that resulted in 50% inhibition (IC50)
of VACV replication was 4.72 µM (Figure 1C and Table 1).
Resveratrol reduced virus yield by more than 120-fold at the
concentration of 50 µM (Figure 1C). The inhibitory effect
of VACV replication by resveratrol is comparable to a well-
characterized VACV inhibitor, hydroxyurea, which is known
to prevent VACV DNA synthesis and decreased virus yield by
approximately 200-fold at the concentration of 10 mM under the
same infection conditions (Figure 1D). We examined the effect of
resveratrol on multiple rounds of VACV replication by infecting
HeLa cells at a low MOI of 0.01 and measuring the viral yield
at different times post VACV infection. We observed significant
reduction of viral titers in resveratrol-treated cells started from
8 hpi (Figure 1E), again demonstrating that resveratrol severely
Frontiers in Microbiology | www.frontiersin.org 3November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 4
Cao et al. Suppression of Poxvirus Replication by Resveratrol
FIGURE 1 | Resveratrol suppresses VACV replication in HeLa cells. (A) HeLa cells were treated with DMSO or resveratrol at the indicated concentrations for 24 h.
Cell viability was measured using trypan blue exclusion test. (B) HeLa cells were imaged under the bright field of a microscope after DMSO or resveratrol (50 µM)
treatment for 24 h. (C) HeLa cells were infected with VACV at an MOI of 1 in the presence of resveratrol at the indicated concentrations. Virus yield at 24 hpi were
determined by a plaque assay. (D) HeLa cells were infected with VACV at an MOI of 1 in the presence of DMSO, hydroxyurea (10 mM), or resveratrol (50 µM). Virus
yield at 24 hpi were determined by a plaque assay. (E) HeLa cells were infected with VACV at an MOI of 0.01 in the presence of DMSO or 50 µM resveratrol. Virus
titers were determined by a plaque assay at the indicated time points. (F) HeLa cells were infected with VACV at an MOI of 0.001 treated with DMSO or 50 µM
resveratrol at 24 hpi. Virus titers were determined by a plaque assay at 72 hpi. The asterisk indicates significant difference (P<0.05) and the ns indicates no
significant difference between DMSO-treated cells and resveratrol- or hydroxyurea-treated cells. The error bar indicates standard deviation.
impaired the replication of VACV in HeLa cells. Moreover, the
addition of resveratrol at 24 hpi still reduced VACV replication
by 250-fold when the initial MOI is low (0.001) (Figure 1F),
suggesting a possible use of resveratrol to prevent viral spreading
post infection.
The effect of resveratrol on VACV replication in primary
human cells such as HFFs was also tested. The CC50
concentration of resveratrol on HFF was 176.88 µM (Figure 2A
and Table 1). In fact, at the concentration of up to 100 µM,
resveratrol did not affect the morphology of HFFs (Figure 2B).
The IC50 concentration of resveratrol in HFFs was 3.51 µM
and the virus yield of VACV from 50 µM resveratrol-treated
HFFs was reduced by approximately 200-fold at an MOI of 1
(Figure 2C and Table 1). Moreover, treatment of HFFs with
100 µM of resveratrol protected the HFFs from VACV infection-
induced cytopathic effects of the cells (Figure 2D). In addition,
resveratrol also reduced the replication of VACV in another
primary human cell type, NHDF (not shown). Taken together,
our results demonstrate that resveratrol dramatically reduces
VACV replication in different human cell types.
Resveratrol Suppresses MPXV
Replication
We examined the effect of resveratrol on MPXV replication.
HeLa cells were infected with MPXV-WA and MPXV-ROC,
respectively, at an MOI of 1 in the presence of a series of
concentrations of resveratrol and the viral titers were measured
24 hpi. As shown in Figures 3A,B, 50 µM resveratrol reduced
the virus yield of MPXV-WA and MPXV-ROC clades by 195- and
38-fold, respectively. The IC50 was 12.41 µM for WA strain and
15.23 µM for ROC strain (Table 2). The inhibitory effect of
MPXV replication by resveratrol was comparable to the well-
characterized orthopoxvirus (OPXV) inhibitor, AraC, in the
corresponding parallel experiments (Figure 3).
Resveratrol Suppresses N1L-Deleted
VACV Replication
N1L encodes a viral virulence factor that is expressed at early
stage of VACV gene expression and regulates host cell apoptosis
(Bartlett et al., 2002;Yang et al., 2010). It has been reported that
some polyphenols, including resveratrol, could directly bind to
and may inhibit the function of N1 protein (Cheltsov et al., 2010).
The authors further speculated that resveratrol might inhibit
VACV replication by targeting the N1 protein. However, the
effect of resveratrol on VACV replication was not tested in the
aforementioned study. Moreover, the N1L is not an essential
VACV gene and the deletion of N1L from VACV genome was
TABLE 1 | Inhibitory effect of resveratrol on VACV replication and cytotoxicity.
Cells IC50 (µM)aCC50 (µM)b
HFF 3.51 ±1.22 176.88 ±17.44
HeLa 4.72 ±2.34 157.75 ±23.66
aThe concentration of resveratrol that reduces the yield of VACV by 50%. bThe
concentration of resveratrol that causes 50% cell death.
Frontiers in Microbiology | www.frontiersin.org 4November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 5
Cao et al. Suppression of Poxvirus Replication by Resveratrol
FIGURE 2 | Resveratrol suppresses VACV replication in HFFs. (A) HFFs were treated with DMSO or resveratrol at the indicated concentrations for 24 h. Cell viability
was measured using trypan blue exclusion test. (B) DMSO- or resveratrol-treated cells were imaged under the bright field of a microscope. (C) HFFs were infected
with VACV at an MOI of 1 in the presence of resveratrol at the indicated concentrations. Virus yield at 24 hpi was determined by a plaque assay. (D) HFFs were
infected with VACV at an MOI of 0.01 in the presence of resveratrol at the indicated concentrations. At 72 hpi, cells were imaged under the bright field of a
microscope. The asterisk indicates significant difference (P<0.05) and the ns indicates no significant difference between DMSO-treated cells and resveratrol-treated
cells. The error bar indicates standard deviation.
not shown to affect VACV replication in cultured cells (Bartlett
et al., 2002). Based on these facts, we reasoned that prevention of
VACV replication by resveratrol is not through the N1 protein.
To test it, we replaced the N1L gene with a GFP gene in the
VACV genome through homologous recombination (Figure 4A).
Consistent with a previous observation (Bartlett et al., 2002), the
deletion of N1L did not affect VACV replication and viral yields
(Figure 4B). As expected, resveratrol similarly suppressed VACV-
Del-N1L virus (Figure 4C), indicating that inhibitory effect is not
mediated through the N1 protein.
Resveratrol Suppresses VACV Late, But
Not Early Gene Expression
To investigate the stage of viral life cycle targeted by resveratrol,
we examined the effect of resveratrol treatment on VACV protein
expression by Western blot analysis (Figure 5A). Anti-VACV
serum was derived from rabbits immunized with purified VACV
particles that comprise mostly viral structural proteins expressed
at the late stage of VACV gene expression. P4a is a major
viral core protein encoded by the VACV late gene A10L (Yang
et al., 2011). L2 protein is involved in VACV morphogenesis
and is expressed at the early stage of VACV gene expression
(Yang et al., 2010;Maruri-Avidal et al., 2011a,b). DNA synthesis
inhibitor AraC was used as a positive control. Western blots with
anti-VACV serum and P4a antibodies demonstrated dramatic
reduction in protein levels in the presence of resveratrol and
at levels comparable to the AraC treatment. In contrast, both
resveratrol and AraC treatments did not affect the expression
level of the viral early protein L2 (Figure 5A). We also used
a recombinant VACV that expressed GFP under an early/late
VACV promoter and dsRED under a late VACV promoter to
confirm suppression of late protein synthesis by resveratrol. HeLa
cells infected with recombinant VACV expressing fluorescent
proteins at an MOI of 1 in the presence of resveratrol, AraC,
or vehicle control DMSO were observed under a fluorescent
microscope. The results clearly showed that both resveratrol and
AraC completely blocked dsRED expression that was expressed
at the late stage of gene expression, while they only partially
suppressed GFP expression at similar levels that could also be
expressed at the early stage of VACV replication (Figure 5B).
These results indicate that resveratrol has little or only moderate
effect on VACV replication prior to viral early gene expression
but affects a replication step between the early and late stages of
gene expression.
The third approach we employed to examine the effect
of resveratrol on VACV late gene expression was using a
combination of hydroxyurea and resveratrol. Hydroxyurea
blocks VACV DNA synthesis but not early gene expression
(Katz et al., 1974). In the control experiment, hydroxyurea
and resveratrol were confirmed for their inhibitory effects on
expression of VACV late promoter-controlled firefly luciferase
gene of vP11-Fluc in HeLa cells (Figure 5C). In the parallel
experiment, HeLa cells were infected with vP11-Fluc for 3 h in the
Frontiers in Microbiology | www.frontiersin.org 5November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 6
Cao et al. Suppression of Poxvirus Replication by Resveratrol
FIGURE 3 | Resveratrol suppresses monkeypox infection. HeLa cells were
infected with MPXV-WA (A) or MPXV-ROC (B) at an MOI of 1 in the presence
of resveratrol at the indicated concentrations or AraC (40 µg/mL). Virus yield
at 24 hpi was determined by a plaque assay. The asterisk indicates significant
difference (P<0.05) between DMSO-treated cells and resveratrol- or
AraC-treated cells. The error bar indicates standard deviation.
presence of hydroxyurea, which allowed early gene expression.
The hydroxyurea was washed away and DMSO or resveratrol
was added and incubated for an additional 3 h. As can be seen,
resveratrol still reduced luciferase activity while DMSO could not
(Figure 5C).
Together, these results indicated that resveratrol affected a
post-replication step after VACV early gene expression.
Resveratrol Interferes VACV DNA
Synthesis
The effect of resveratrol on VACV DNA synthesis was
investigated since it is essential for post-replicative gene
expression (intermediate and late protein synthesis). VACV DNA
synthesis starts between 2 and 4 hpi in infected HeLa cells
under the conditions used in this study (Yang et al., 2010). We
examined VACV DNA amounts in VACV-infected HeLa cells at
1 and 24 hpi using quantitative real-time PCR (AraC was used as
positive control). Our results indicated that resveratrol treatment
significantly reduced VACV DNA amount at 24 hpi (Figure 6A).
The VACV DNA was 237-fold higher in DMSO-treated cells,
while the viral DNA amounts only increased 35- and 6-fold in
resveratrol- and AraC-treated cells, respectively (Figure 6A).
We tested the direct inhibitory effect on DNA synthesis by
resveratrol through examining plasmid DNA synthesis in VACV-
infected cells as circular DNA can be replicated in VACV-infected
cells that require all known viral proteins needed for VACV DNA
synthesis (DeLange and McFadden, 1986;De Silva and Moss,
2005). We transfected pUC19 plasmid into HeLa cells for 12 h
and then infected with VACV or mock-infected in the presence
or absence of resveratrol and AraC. Total DNA was isolated from
cells at 24 hpi and treated with DpnI that only digests methylated
input DNA. The DNA was then measured using specific primers
amplifying a pUC19 fragment containing the DpnI digestion
site. Dpn-resistant plasmid DNA increased 12-fold in VACV-
infected cells compared to DMSO treatment. However, there was
only a 2- to 3-fold increase of DpnI-resistant plasmid DNA in
VACV-infected cells treated with resveratrol or AraC treatment
(Figure 6B). This result indicated that resveratrol could interfere
viral DNA synthesis directly in VACV-infected cells.
DISCUSSION
Our study, for the first time, demonstrated a strong suppressive
effect of resveratrol on poxvirus replication. Similar to other
viruses, VACV replication is generally divided into entry, gene
expression, genome replication, viral particle assembly, and exit
steps. VACV gene expression is programmed as a cascade to
express viral genes at early, intermediate, and late stages (Moss,
2013a). The early gene expression starts immediately after VACV
enters into the infected cells, as the viral infectious particles
package all the factors and enzymes needed for early viral mRNA
synthesis. The viral early gene products include those necessary
factors for viral DNA synthesis. The VACV DNA synthesis
is required for viral intermediate, and subsequently, late gene
expression. The intermediate and late gene products comprise
most of the structural proteins to build infectious viral particles
(Moss, 2013a). Our study indicates that the resveratrol directly
targets viral DNA synthesis step to prevent VACV replication.
Genome uncoating is a step needed to expose encapsidated viral
DNA as a template for DNA synthesis. Because resveratrol does
not block synthesis of viral early proteins and the viral genome
uncoating factor D5 is an early protein (Kilcher et al., 2014),
TABLE 2 | Inhibitory effect of resveratrol on MPXV replication in HeLa cells.
MPXV strains IC50 (µM)a
WA 12.41 ±3.28
ROC 15.23 ±2.71
aThe concentration of resveratrol that reduces the yield of MPXV by 50%.
Frontiers in Microbiology | www.frontiersin.org 6November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 7
Cao et al. Suppression of Poxvirus Replication by Resveratrol
FIGURE 4 | Resveratrol suppresses N1L-deleted VACV replication. (A) Deletion of N1L gene from recombinant virus was confirmed by PCR with two pairs of primer
specific for C11R gene (positive control) and N1L gene, respectively. (B) HeLa cells were infected with wild type and N1L-deleted VACV at an MOI of 1. Virus growth
was determined by a plaque assay. (C) HeLa cells were infected with N1L-deleted VACV at an MOI of 1 in the presence or absence of resveratrol (50 µM). Virus
titers were determined by a plaque assay at 24 hpi. The asterisk indicates significant difference (P<0.05). The error bar indicates standard deviation.
FIGURE 5 | Resveratrol suppresses VACV late, but not early gene expression. (A) HeLa cells were infected with VACV at an MOI of 1 in the presence of DMSO,
AraC (40 µg/mL), or resveratrol (50 µM). At 24 hpi, the expression of viral proteins in infected cells was detected by western blotting using the indicated antibodies.
(B) HeLa cells were infected with a recombinant VACV carrying a GFP gene under an early/late VACV promoter and a dsRED gene under a late VACV promoter at an
MOI of 1 in the presence of DMSO, AraC (40 µg/mL), or resveratrol (50 µM). The expression of GFP and dsRED was observed and imaged using a fluorescent
microscope. (C) HeLa cells were infected with VACV-P11-Fluc at an MOI of 1 and treated with hydroxyurea (HU, 10 mM) from 0 to 3 hpi. Then
hydroxyurea-containing medium was washed away and replaced with cell culture medium containing DMSO or resveratrol (50 µM), and further incubated for
another 3 h until luciferase activity in the infected cell lysates was measured. Luciferase activities from infected cells treated with only DMSO, hydroxyurea, or
resveratrol through 0–6 hpi were also measured. The asterisk indicates significant difference (P<0.05) between control and treated cells. The ns indicates no
significant difference. The error bar indicates standard deviation.
FIGURE 6 | Resveratrol suppresses VACV DNA synthesis. (A) HeLa cells were infected with VACV at an MOI of 1 in the presence of DMSO, AraC (40 µg/mL), or
resveratrol (50 µM). Relative viral DNA levels in infected cells were determined by real-time PCR at 1 and 24 hpi. The viral DNA level at 24 hpi was determined as the
fold to the viral DNA level at 1 hpi. (B) HeLa cells were transfected with 200 ng of pUC19 plasmid and incubated overnight. The cells were then infected with VACV
at an MOI of 5 or mock-infected in the presence of AraC, resveratrol, or DMSO. Total DNA was extracted from the cells at 24 hpi and 1 µg of total DNA was
digested with DpnI at 37C for 2 h followed by real-time qPCR using primers amplifying pUC19 fragment containing DpnI digestion site. The asterisk indicates
significant difference (P<0.05) and the ns indicates no significant difference between 1 and 24 hpi. The error bar indicates standard deviation.
Frontiers in Microbiology | www.frontiersin.org 7November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 8
Cao et al. Suppression of Poxvirus Replication by Resveratrol
it is unlikely that resveratrol can prevent poxvirus genome
uncoating. However, we do not completely rule out the possibility
that resveratrol interferes poxvirus genome uncoating to some
extent. Interestingly, the effect is independent of the non-essential
viral N1L gene, albeit resveratrol has been suggested to be an
inhibitor of the VACV N1 protein (Cheltsov et al., 2010).
As the prototypic member of poxvirus family, VACV
has a linear, double-stranded DNA genome that replicates
entirely in the cytoplasm (Moss, 2013a). The size of the
genome is approximately 200 kbp. Although the molecular
mechanism involved in VACV DNA synthesis is not fully
understood, it is known that the VACV genome encodes
most proteins required for replicating its DNA genome (Moss,
2013b). These proteins include a DNA polymerase encoded
by E9L gene (Jones and Moss, 1984;Traktman et al., 1984),
a helicase–primase encoded by D5R (Roseman and Hruby,
1987), a processivity factor encoded by A20R (McDonald
et al., 1997), a uracil DNA glycosylase encoded by D4R
(Upton et al., 1993), and a few other proteins bearing
different roles in copying the viral DNA (Moss, 2013b). It
has been shown that resveratrol inhibits multiple mammalian
DNA polymerases including polymerase alpha through its 4-
hydroxystyryl moiety, subsequently suppressing active DNA
synthesis (Locatelli et al., 2005). As VACV DNA polymerase
has considerable similarity to human polymerase alpha (Wang
et al., 1989), it is highly possible that resveratrol interferes
with VACV DNA polymerase activity directly. Resveratrol
also modulates numerous cellular functions (Fremont, 2000);
therefore, it is possible that resveratrol affects a cellular function
that is important for VACV genome replication. However, the
role of cellular functions in VACV DNA synthesis is poorly
understood; thus, it is difficult to have an educated prediction
of a specific cellular function that may be involved in this
process.
All steps of VACV replication, from viral entry and exit,
may be targeted for antiviral drug development. For example,
mitoxantrone blocks VACV replication by targeting the virion
assembly step (Deng et al., 2007). However, the viral DNA
synthesis is one of the major targets for anti-poxvirus drug
development. Several compounds that are used to treat poxvirus
infection target the viral DNA synthesis step. Cidofovir, an
acyclic nucleoside that is approved to treat cytomegalovirus
infection in AIDS patients also exhibits anti-poxvirus activity
by targeting DNA synthesis (Andrei and Snoeck, 2010). The
widely used poxvirus inhibitors, AraC, hydroxyurea, and a
recently identified inhibitor, CMX001, also target VACV DNA
synthesis (Quenelle et al., 2007). The identification of resveratrol
as a VACV DNA synthesis inhibitor may allow for developing
alternative or compensative strategies to better manage current
and re-emergent poxvirus infections and complications caused
by poxviruses-based therapeutics.
CONCLUSION
We showed that resveratrol, a member of natural plant
polyphenols that is under extensive investigation of its effects
on many biological processes, dramatically reduced VACV and
MPXV replication. The suppression appears to affect the viral
DNA synthesis step. The results will prompt further investigation
of its effect on other poxvirus replication steps as well as the
mechanism to inhibit VACV replication.
AUTHOR CONTRIBUTIONS
ZY, PS, and SC contributed to the conception of the study. SC,
SR, and AP performed the experiments. SC and SR analyzed the
data. ZY, SC, and PS wrote the manuscript.
FUNDING
This work was supported, in part by grants from the National
Institutes of Health (P20GM113117, project 3) to ZY. AP was
also supported by the Johnson Cancer Research Center at Kansas
States University.
ACKNOWLEDGMENTS
The authors wish to thank Dr. Bernard Moss at the NIH for
providing VACV WR strain, cells, and reagents. The authors
also wish to thank other members in the Yang laboratory for
helpful discussion. The findings and conclusions in this report are
those of the authors and do not necessarily represent the official
position of the Centers for Disease Control and Prevention,
Atlanta, GA, United States, and Kansas State University.
REFERENCES
Abba, Y., Hassim, H., Hamzah, H., and Noordin, M. M. (2015). Antiviral activity
of resveratrol against human and animal viruses. Adv. Virol. 2015:184241.
doi: 10.1155/2015/184241
Altenburg, A. F., Kreijtz, J. H., de Vries, R. D., Song, F., Fux, R., Rimmelzwaan,
G. F., et al. (2014). Modified Vaccinia virus ankara (MVA) as production
platform for vaccines against influenza and other viral respiratory diseases.
Viruses 6, 2735–2761. doi: 10.3390/v6072735
Andrei, G., Gammon, D. B., Fiten, P., De Clercq, E., Opdenakker, G., Snoeck, R.,
et al. (2006). Cidofovir resistance in Vaccinia virus is linked to diminished
virulence in mice. J. Virol. 80, 9391–9401. doi: 10.1128/JVI.00605-06
Andrei, G., and Snoeck, R. (2010). Cidofovir activity against poxvirus infections.
Viruses 2, 2803–2830. doi: 10.3390/v2122803
Bartlett, N., Symons, J. A., Tscharke, D. C., and Smith, G. L. (2002). The Vaccinia
virus N1L protein is an intracellular homodimer that promotes virulence.
J. Gen. Virol. 83(Pt 8), 1965–1976. doi: 10.1099/0022-1317-83-8-1965
Bayer-Garner, I. B. (2005). Monkeypox virus: histologic, immunohistochemical
and electron-microscopic findings. J. Cutan. Pathol. 32, 28–34. doi: 10.1111/j.
0303-6987.2005.00254.x
Bengali, Z., Satheshkumar, P. S., Yang, Z., Weisberg, A. S., Paran, N., and
Moss, B. (2011). Drosophila S2 cells are non-permissive for Vaccinia virus
DNA replication following entry via low pH-dependent endocytosis and early
transcription. PLOS ONE 6:e17248. doi: 10.1371/journal.pone.0017248
Frontiers in Microbiology | www.frontiersin.org 8November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 9
Cao et al. Suppression of Poxvirus Replication by Resveratrol
Breitbach, C. J., Burke, J., Jonker, D., Stephenson, J., Haas, A. R., Chow, L. Q., et al.
(2011). Intravenous delivery of a multi-mechanistic cancer-targeted oncolytic
poxvirus in humans. Nature 477, 99–102. doi: 10.1038/nature10358
Chakrabarti, S., Sisler, J. R., and Moss, B. (1997). Compact, synthetic, Vaccinia virus
early/late promoter for protein expression. Biotechniques 23, 1094–1097.
Cheltsov, A. V., Aoyagi, M., Aleshin, A., Yu, E. C., Gilliland, T., Zhai, D., et al.
(2010). Vaccinia virus virulence factor N1L is a novel promising target for
antiviral therapeutic intervention. J. Med. Chem. 53, 3899–3906. doi: 10.1021/
jm901446n
De Silva, F. S., and Moss, B. (2005). Origin-independent plasmid replication occurs
in Vaccinia virus cytoplasmic factories and requires all five known poxvirus
replication factors. Virol. J. 2:23.
DeLange, A. M., and McFadden, G. (1986). Sequence-nonspecific replication of
transfected plasmid DNA in poxvirus-infected cells. Proc. Natl. Acad. Sci. USA.
83, 614–618. doi: 10.1073/pnas.83.3.614
Deng, L., Dai, P., Ciro, A., Smee, D. F., Djaballah, H., and Shuman, S. (2007).
Identification of novel antipoxviral agents: mitoxantrone inhibits Vacciniav irus
replication by blocking virion assembly. J. Virol. 81, 13392–13402. doi: 10.1128/
JVI.00770-07
Docherty, J. J., Fu, M. M., Stiffler, B. S., Limperos, R. J., Pokabla, C. M., and DeLucia,
A. L. (1999). Resveratrol inhibition of herpes simplex virus replication. Antiviral
Res. 43, 145–155. doi: 10.1016/S0166-3542(99)00042- X
Docherty, J. J., Sweet, T. J., Bailey, E., Faith, S. A., and Booth, T. (2006). Resveratrol
inhibition of varicella-zoster virus replication in vitro. Antiviral Res. 72,
171–177. doi: 10.1016/j.antiviral.2006.07.004
Dower, K., Filone, C. M., Hodges, E. N., Bjornson, Z. B., Rubins, K. H.,
Brown, L. E., et al. (2012). Identification of a pyridopyrimidinone inhibitor
of orthopoxviruses from a diversity-oriented synthesis library. J. Virol. 86,
2632–2640. doi: 10.1128/JVI.05416-11
Draper, S. J., and Heeney, J. L. (2010). Viruses as vaccine vectors for infectious
diseases and cancer. Nat. Rev. Microbiol. 8, 62–73. doi: 10.1038/nrmicro2240
Earl, P. L., Cooper, N., Wyatt, L. S., Moss, B., and Carroll, M. W. (2001a).
Preparation of cell cultures and Vaccinia virus stocks. Curr. Protoc. Mol. Biol.
16, 16.16.1–16.16.18.
Earl, P. L., Moss, B., Wyatt, L. S., and Carroll, M. W. (2001b). Generation of
recombinant vaccinia viruses. Curr. Protoc. Mol. Biol. 43, 16.17.1–16.17.19.
Espinoza, J. L., Takami, A., Trung, L. Q., Kato, S., and Nakao, S. (2012). Resveratrol
prevents EBV transformation and inhibits the outgrowth of EBV-immortalized
human B cells. PLOS ONE 7:e51306. doi: 10.1371/journal.pone.0051306
Farlow, J., Ichou, M. A., Huggins, J., and Ibrahim, S. (2010). Comparative
whole genome sequence analysis of wild-type and cidofovir-resistant
monkeypoxvirus. Virol. J. 7:110. doi: 10.1186/1743-422X-7- 110
Fremont, L. (2000). Biological effects of resveratrol. Life Sci. 66, 663–673.
doi: 10.1016/S0024-3205(99)00410- 5
Galindo, I., Hernaez, B., Berna, J., Fenoll, J., Cenis, J. L., Escribano, J. M.,
et al. (2011). Comparative inhibitory activity of the stilbenes resveratrol and
oxyresveratrol on African swine fever virus replication. Antiviral Res. 91, 57–63.
doi: 10.1016/j.antiviral.2011.04.013
Huggins, J., Goff, A., Hensley, L., Mucker, E., Shamblin, J., Wlazlowski, C., et al.
(2009). Nonhuman primates are protected from smallpox virus or monkeypox
virus challenges by the antiviral drug ST-246. Antimicrob. Agents Chemother.
53, 2620–2625. doi: 10.1128/AAC.00021-09
Izzi, V., Buler, M., Masuelli, L., Giganti, M. G., Modesti, A., and Bei, R.
(2014). Poxvirus-based vaccines for cancer immunotherapy: new
insights from combined cytokines/co-stimulatory molecules delivery
and “uncommon” strains. Anticancer Agents Med. Chem. 14, 183–189.
doi: 10.2174/18715206113136660376
Jones, E. V., and Moss, B. (1984). Mapping of the Vaccinia virus DNA polymerase
gene by marker rescue and cell-free translation of selected RNA. J. Virol. 49,
72–77.
Jordan, R., Goff, A., Frimm, A., Corrado, M. L., Hensley, L. E., Byrd, C. M., et al.
(2009). ST-246 antiviral efficacy in a nonhuman primate monkeypox model:
determination of the minimal effective dose and human dose justification.
Antimicrob. Agents Chemother. 53, 1817–1822. doi: 10.1128/AAC.01596-08
Katz, E., Margalith, E., and Winer, B. (1974). Synthesis of Vaccinia virus
polypeptides in the presence of hydroxyurea. Antimicrob. Agents Chemother.
6, 647–650. doi: 10.1128/AAC.6.5.647
Kilcher, S., Schmidt, F. I., Schneider, C., Kopf, M., Helenius, A., and Mercer, J.
(2014). siRNA screen of early poxvirus genes identifies the AAA+ATPase
D5 as the virus genome-uncoating factor. Cell Host Microbe 15, 103–112.
doi: 10.1016/j.chom.2013.12.008
Locatelli, G. A., Savio, M., Forti, L., Shevelev, I., Ramadan, K., Stivala, L. A., et al.
(2005). Inhibition of mammalian DNA polymerases by resveratrol: mechanism
and structural determinants. Biochem. J. 389(Pt 2), 259–268. doi: 10.1042/
BJ20050094
Lu, Y. C., Fan, H. C., Wang, C. C., and Cheng, S. N. (2011). Concomitant use of
acyclovir and intravenous immunoglobulin rescues an immunocompromised
child with disseminated varicella caused multiple organ failure. J. Pediatr.
Hematol. Oncol. 33, e350–e351. doi: 10.1097/MPH.0b013e3181ec0efb
Maruri-Avidal, L., Domi, A., Weisberg, A. S., and Moss, B. (2011a). Participation of
Vacciniav irus l2 protein in the formation of crescent membranes and immature
virions. J. Virol. 85, 2504–2511. doi: 10.1128/JVI.02505-10
Maruri-Avidal, L., Weisberg, A. S., and Moss, B. (2011b). Vaccinia virus L2 protein
associates with the endoplasmic reticulum near the growing edge of crescent
precursors of immature virions and stabilizes a subset of viral membrane
proteins. J. Virol. 85, 12431–12441. doi: 10.1128/JVI.05573-11
McDonald, W. F., Klemperer, N., and Traktman, P. (1997). Characterization of a
processive form of the Vaccinia virus DNA polymerase. Virology 234, 168–175.
doi: 10.1006/viro.1997.8639
Miller, J., Engelberg, S., and Broad, W. J. (2001). Germs: The Ultimate Weapon.
New York, NY: Simon & Schuster Ltd.
Moss, B. (2013a). “Poxviridae: the viruses and their replication,” in Fields Virology,
Vol. 2, eds D. M. Knipe and P. M. Howley (Philadelphia: PA: Wolters
Kluwer/Lippincott Williams & Wilkins), 2129–2159.
Moss, B. (2013b). Poxvirus DNA replication. Cold Spring Harb. Perspect. Biol. 5,
a010199. doi: 10.1101/cshperspect.a010199
Nakamura, M., Saito, H., Ikeda, M., Hokari, R., Kato, N., Hibi, T., et al. (2010). An
antioxidant resveratrol significantly enhanced replication of hepatitis C virus.
World J. Gastroenterol. 16, 184–192. doi: 10.3748/wjg.v16.i2.184
Palamara, A. T., Nencioni, L., Aquilano, K., De Chiara, G., Hernandez, L.,
Cozzolino, F., et al. (2005). Inhibition of influenza A virus replication by
resveratrol. J. Infect. Dis. 191, 1719–1729. doi: 10.1086/429694
Quenelle, D. C., Prichard, M. N., Keith, K. A., Hruby, D. E., Jordan, R.,
Painter, G. R., et al. (2007). Synergistic efficacy of the combination of ST-
246 with CMX001 against orthopoxviruses. Antimicrob. Agents Chemother. 51,
4118–4124. doi: 10.1128/AAC.00762-07
Reed, K. D., Melski, J. W., Graham, M. B., Regnery, R. L., Sotir, M. J., Wegner,
M. V., et al. (2004). The detection of monkeypox in humans in the Western
Hemisphere. N. Engl. J. Med. 350, 342–350. doi: 10.1056/NEJMoa032299
Rerks-Ngarm, S., Pitisuttithum, P., Nitayaphan, S., Kaewkungwal, J., Chiu, J.,
Paris, R., et al. (2009). Vaccination with ALVAC and AIDSVAX to prevent
HIV-1 infection in Thailand. N. Engl. J. Med. 361, 2209–2220. doi: 10.1056/
NEJMoa0908492
Reynolds, M. G., Holman, R. C., Yorita Christensen, K. L., Cheek, J. E., and Damon,
I. K. (2009). The Incidence of Molluscum contagiosum among American
Indians and Alaska Natives. PLOS ONE 4:e5255. doi: 10.1371/journal.pone.
0005255
Rimoin, A. W., Mulembakani, P. M., Johnston, S. C., Lloyd Smith, J. O.,
Kisalu, N. K., Kinkela, T. L., et al. (2010). Major increase in human
monkeypox incidence 30 years after smallpox vaccination campaigns cease
in the Democratic Republic of Congo. Proc. Natl. Acad. Sci. U.S.A. 107,
16262–16267. doi: 10.1073/pnas.1005769107
Robbins, S. J., Jackson, R. J., Fenner, F., Beaton, S., Medveczky, J., Ramshaw,
I. A., et al. (2005). The efficacy of cidofovir treatment of mice infected with
ectromelia (mousepox) virus encoding interleukin-4. Antiviral Res. 66, 1–7.
doi: 10.1016/j.antiviral.2004.12.003
Roseman, N. A., and Hruby, D. E. (1987). Nucleotide sequence and transcript
organization of a region of the Vaccinia virus genome which encodes a
constitutively expressed gene required for DNA replication. J. Virol. 61,
1398–1406.
Scherer, W. F., Syverton, J. T., and Gey, G. O. (1953). Studies on the propagation
in vitro of poliomyelitis viruses. IV. Viral multiplication in a stable strain of
human malignant epithelial cells (strain HeLa) derived from an epidermoid
carcinoma of the cervix. J. Exp. Med. 97, 695–710. doi: 10.1084/jem.97.5.695
Frontiers in Microbiology | www.frontiersin.org 9November 2017 | Volume 8 | Article 2196
fmicb-08-02196 November 8, 2017 Time: 11:39 # 10
Cao et al. Suppression of Poxvirus Replication by Resveratrol
Strober, W. (2015). Trypan blue exclusion test of cell viability. Curr. Protoc.
Immunol. 111, A.3B.1–A.3B.3. doi: 10.1002/0471142735.ima03bs111
Traktman, P., Sridhar, P., Condit, R. C., and Roberts, B. E. (1984). Transcriptional
mapping of the DNA polymerase gene of Vaccinia virus.J. Virol. 49, 125–131.
Upton, C., Stuart, D. T., and McFadden, G. (1993). Identification of a poxvirus gene
encoding a uracil DNA glycosylase. Proc. Natl. Acad. Sci. U.S.A. 90, 4518–4522.
doi: 10.1073/pnas.90.10.4518
Wang, T. S., Wong, S. W., and Korn, D. (1989). Human DNA polymerase alpha:
predicted functional domains and relationships with viral DNA polymerases.
FASEB J. 3, 14–21.
Xie, X. H., Zang, N., Li, S. M., Wang, L. J., Deng, Y., He, Y., et al. (2012). Resveratrol
Inhibits respiratory syncytial virus-induced IL-6 production, decreases viral
replication, and downregulates TRIF expression in airway epithelial cells.
Inflammation 35, 1392–1401. doi: 10.1007/s10753-012-9452-7
Xu, J., Yin, Z., Li, L., Cheng, A., Jia, R., Song, X., et al. (2013). Inhibitory
effect of resveratrol against duck enteritis virus in vitro. PLOS ONE 8:e65213.
doi: 10.1371/journal.pone.0065213
Yang, G., Pevear, D. C., Davies, M. H., Collett, M. S., Bailey, T., Rippen, S.,
et al. (2005). An orally bioavailable antipoxvirus compound (ST-246) inhibits
extracellular virus formation and protects mice from lethal orthopoxvirus
Challenge. J. Virol. 79, 13139–13149. doi: 10.1128/JVI.79.20.13139-13149.2005
Yang, Z., Bruno, D. P., Martens, C. A., Porcella, S. F., and Moss, B.
(2010). Simultaneous high-resolution analysis of Vaccinia virus and host cell
transcriptomes by deep RNA sequencing. Proc. Natl. Acad. Sci. USA. 107,
11513–11518. doi: 10.1073/pnas.1006594107
Yang, Z., Reynolds, S. E., Martens, C. A., Bruno, D. P., Porcella, S. F., and Moss, B.
(2011). Expression profiling of the intermediate and late stages of poxvirus
replication. J. Virol. 85, 9899–9908. doi: 10.1128/JVI.05446-11
Yogev, O., Lagos, D., Enver, T., and Boshoff, C. (2014). Kaposi’s
sarcoma herpesvirus microRNAs induce metabolic transformation of
infected cells. PLOS Pathog. 10:e1004400. doi: 10.1371/journal.ppat.
1004400
Zhang, L., Li, Y., Gu, Z., Wang, Y., Shi, M., Ji, Y., et al. (2015). Resveratrol
inhibits enterovirus 71 replication and pro-inflammatory cytokine secretion
in rhabdosarcoma cells through blocking IKKs/NF-kappaB signaling pathway.
PLOS ONE 10:e0116879. doi: 10.1371/journal.pone.0116879
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
The reviewer IAB and handling Editor declared their shared affiliation.
Copyright © 2017 Cao, Realegeno, Pant, Satheshkumar and Yang. This is an open-
access article distributed under the terms of the Creative Commons Attribution
License (CC BY). The use, distribution or reproduction in other forums is permitted,
provided the original author(s) or licensor are credited and that the original
publication in this journal is cited, in accordance with accepted academic practice.
No use, distribution or reproduction is permitted which does not comply with these
terms.
Frontiers in Microbiology | www.frontiersin.org 10 November 2017 | Volume 8 | Article 2196
... Resveratrol showed a potential as an anti-viral agent against some RNA and DNA viruses. Possible target RNA viruses include influenza virus 24 , Zika virus 25 , rhinovirus 26 , rotavirus 27 and MERS-CoV 28 , and DNA viruses including poxvirus 29 and polyomavirus 30 . ...
Article
Full-text available
A novel coronavirus, SARS-CoV-2, emerged in China at the end of 2019 causing a large global outbreak. As treatments are of the utmost importance, drugs with broad anti-coronavirus activity embody a rich and rapid drug discovery landscape, where candidate drug compounds could be identified and optimized. To this end, we tested ten small-molecules with chemical structures close to ferulic acid derivatives (FADs) (n = 8), caffeic acid derivatives (CAFDs) (n = 1) and carboxamide derivatives (CAMDs) (n = 1) for their ability to reduce HCoV-229E replication, another member of the coronavirus family. Among these ten drugs tested, five of them namely MBA112, MBA33, MBA27-1, OS4-1 and MBA108-1 were highly cytotoxic and did not warrant further testing. In contrast, we observed a moderate cytotoxicity for two of them, MBA152 and 5c. Three drugs, namely MBA140, LIJ2P40, and MBA28 showed lower cytotoxicity. These candidates were then tested for their antiviral propreties against HCoV-229E and SARS-CoV2 replication. We first observed encouraging results in HCoV-229E. We then measured a reduction of the viral SARS-CoV2 replication by 46% with MBA28 (EC50 > 200 µM), by 58% with MBA140 (EC50 = 176 µM), and by 82% with LIJ2P40 (EC50 = 66.5 µM). Overall, the FAD LIJ2P40 showed a reduction of the viral titer on SARS-CoV-2 up to two logs with moderate cytotoxicity which opens the door to further evaluation to fight Covid-19.
... Resveratrol (RV) is a natural polyphenol nonflavonoid compound found in grapes, berries, and several other plants. RV is accepted as one of the powerful polyphenols with many positive effects on metabolism and health and significantly reduces the replication of MPXV (46,47). No studies reveal the antioxidant's impact on the MPXV infection in humans since monkeypox is an emerging disease worldwide. ...
... To overcome the potential development of resistance against available antivirals, Priyamvada et al., demonstrated that PAV-164, a derivate of methylene blue, is a potent inhibitor of MPX viral replication (Priyamvada et al., 2021). Resveratrol, a natural polyphenol found in grapes, berries, etc., has also been shown in vitro to significantly reduce hMPXV replication (both clades) by suppressing DNA synthesis and associated downstream gene expression (Cao et al., 2017). Another candidate antiviral is based on NIOCH-14, a derivative of tricyclodicarboxylic acid, which causes a significant reduction in hMPXV viral production in the lungs of mice and marmots challenged with the virus (Mazurkov et al., 2016). ...
Article
Full-text available
First described in 1958, the human monkeypox virus (hMPXV) is a neglected zoonotic pathogen closely associated with the smallpox virus. The virus usually spreads via close contact with the infected animal or human and has been endemic mostly in parts of the African continent. However, with the recent increase in trade, tourism, and travel, the virus has caused outbreaks in countries outside Africa. The recent outbreak in 2022 has been puzzling given the lack of epidemiological connection and the possible sexual transmission of the virus. Furthermore, there is limited understanding of the structural and pathogenetic mechanisms that are employed by the virus to invade the host cells. Henceforth, it is critical to understand the working apparatus governing the viral-immune interactions to develop effective therapeutical and prophylactic modalities. Hence, in the present short communication, we summarize the previously reported research findings regarding the virology of the human monkeypox virus.
... To overcome the potential development of resistance against available antivirals, Priyamvada et al., demonstrated that PAV-164, a derivate of methylene blue, is a potent inhibitor of MPX viral replication [56]. Resveratrol, a natural polyphenol found in grapes, berries etc., has also been shown in vitro to significantly reduce hMPXV replication (both strains) by suppressing DNA synthesis and associated downstream gene expression [57]. Another candidate antiviral is based on NIOCH-14, a derivative of tricyclodicarboxylic acid, which causes significant reduction in hMPXV viral production in the lungs of mice and marmots challenged with the virus [58]. ...
Preprint
Full-text available
First described in 1958, the human monkeypox virus (hMPXV) is a neglected zoonotic pathogen closely associated with the smallpox virus. The virus usually spreads via close contact with the infected animal or human and has been endemic mostly to the African continent. However, with the recent increase in trade, tourism, and travel, the virus has caused outbreaks in countries outside Africa. The recent outbreak in 2022 has been puzzling given the lack of epidemiological connection and the possible sexual transmission of the virus. Furthermore, there is a lack of understanding on the exact structure and pathogenetic mechanisms employed by the virus to invade the host cells. It is critical to understand the working apparatus governing the immune-viral interactions to develop effective therapeutical and prophylactic modalities. Hence, in the present review, we summarize the previously reported research findings regarding the virology of the human monkeypox virus.
... Resveratrol showed a potential as an anti-viral agent against some RNA and DNA viruses. Possible target RNA viruses include influenza virus [344], Zika virus [345], rhinovirus [346], rotavirus [347] and MERS-CoV [348], and DNA viruses such as poxvirus [349] and polyomavirus [350]. ...
Thesis
Les virus sont des pathogènes cellulaires, responsables de maladies chez différentes espèces animales, incluant l’Homme. La transmission d’un virus pathogène d’un animal à l’Homme entraine l’émergence de zoonoses, maladies infectieuses régulièrement responsables de pandémies. Parmi les virus responsables de pandémies, le VIH continue, par l’absence de traitement curatif, de constituer une menace globale pour la santé humaine. Plus récemment, l’émergence de pandémies liées à différents coronavirus a montré que cette famille de virus présente un risque pour l’homme. La recherche de nouveaux traitements antiviraux est nécessaire pour faire face à l’émergence de ces pathogènes viraux.Nos travaux se concentrent sur le ciblage de la latence du VIH-1, et sur le ciblage de la réplication des coronavirus HCoV-229E et SARS-CoV-2.Dans le cadre du ciblage de la latence et réactivation du VIH-1, nous avons quantifié la présence du provirus dans les cellules T CD4+ et dans les monocytes de patients sous traitement antirétroviraux combinés. Nous avons évalué l’effet des différentes classes de traitements sur la taille des réservoirs de latence et sur la réactivation. Nous avons également testé l’effet de la protéine virale Nef sur la réactivation, ainsi que l’impact de la voie de signalisation Akt dans la réactivation virale.Nous avons montré que les inhibiteurs de protéases permettent une réduction de la taille des réservoirs de latence du VIH, dans les lymphocytes T CD4+ et dans les monocytes/macrophages. La réactivation du provirus latent est également inhibée par l’action des inhibiteurs de protéases. La réactivation induite par la protéine virale Nef est également bloquée par ces traitements. Les cellules infectées de manière latente présentent également une augmentation de l’activation de la voie de signalisation Akt. La protéine virale Nef induit également une augmentation de l’activation d’Akt. Cette activation d’Akt est réduite lors du traitement par les inhibiteurs de protéase.Dans le cadre du ciblage de la réplication des coronavirus, nous avons testé plusieurs traitements (n=7) utilisés pour d’autres pathologies et ayant précédemment montré un possible effet antiviral. Nous avons également testé de nouvelles molécules (n=10), principalement dérivées de l’acide férulique, dont la structure est proche de molécules ayant montré un effet antiviral sur les coronavirus.Nous avons montré que le resveratrol inhibe la réplication du HCoV-229E et du SARS-CoV-2. Nous avons montré que des dérivés de l’acide férulique inhibent la réplication du HCoV-229E et du SARS-CoV-2.La recherche de nouveaux traitements contre ces virus doit continuer pour permettre leur éradication, mais cela nécessite également une connaissance approfondie des mécanismes moléculaires du cycle de réplication virale afin de pouvoir les cibler plus efficacement.
Article
A large number of monkeypox cases have been reported in many countries in 2022, and a Public Health Emergency of International Concern has been declared by the World Health Organisation. In this perspective, we review the structure, life cycle, and genetics of the monkeypox virus. We also discuss current treatment options and vaccination against monkeypox. In particular, we highlight the unique features of this unprecedented monkeypox outbreak, and present an analysis of the clinical symptoms recorded from infected individuals from the current outbreak, and compared these to those from previous outbreaks. We find that the clinical signs and symptoms appear to be milder and less remarkable. Importantly, the number of monkeypox lesions appear to be drastically reduced. It is possible that a less florid disease, together with the potential of asymptomatic spread, contributed to the extraordinary numbers of cases in this outbreak. Our analysis of the monkeypox clinical symptoms reported in cases from the 2022 outbreak compared with those identified before 2022 revealed a milder and less florid presentation. This may be one of the factors driving the large number of cases in the 2022 outbreak.
Article
As of 11 September 2022, 57,669 reports of monkeypox infection raised global concern. Previous vaccinia virus vaccination can protect from monkeypox. However, after smallpox eradication, immunization against that was stopped. Indeed, therapeutic options following the disease onset are of great value. This study aimed to review the available evidence on virology and treatment approaches for monkeypox and provide guidance for patient care and future studies. Since no randomized clinical trials were ever performed, we reviewed monkeypox animal model studies and clinical trials on the safety and pharmacokinetics of available medications. Brincidofovir and tecovirimat were the most studied medications that got approval for smallpox treatment according to the Animal Rule. Due to the conserved virology among orthopoxviruses, available medications might also be effective against monkeypox. However, tecovirimat has the strongest evidence to be effective and safe for monkeypox treatment, and if there is a choice between the two drugs, tecovirimat has shown more promise so far. The risk of resistance should be considered in patients who failed to respond to tecovirimat. Hence, the target-based design of novel antivirals will enhance the availability and spectrum of effective anti-orthopoxvirus agents. This article is protected by copyright. All rights reserved.
Article
Full-text available
Monkeypox is an orthopoxvirus-based zoonotic illness that causes symptoms similar to smallpox in humans. Health care workers around the world are making it a priority to educate themselves on the many clinical manifestations and treatment options for this virus as public health agencies strive to stop the current outbreak. The infected do not have access to any treatment at this time. However, information obtained from the smallpox pandemic has led researchers to examine vaccinia immune globulin (IVG), tecovirimat, and cidofovir as viable treatments for monkeypox. Moreover, medication like tecovirimat may be given in extreme circumstances, and supportive therapy can help with symptom relief. The European Medicines Agency (EMA) certified tecovirimat as safe and effective against monkeypox in 2022, per the World Health Organization (WHO). As there are now no established guidelines for alleviating these symptoms, the efficacy of these treatments is highly questionable. Some high-profile cases in recent years have cast doubt on the long-held belief that this illness is rare and always resolves itself without treatment. We aimed to conduct this review to get a deeper comprehension of the evolving epidemiology of monkeypox by analysing such factors as the number of confirmed, probable, and potential cases, the median age at presentation, the mortality rate, and the geographic distribution of the disease. This study offers an updated review of monkeypox and the clinical treatments that are currently available as a result of the worldwide epidemics.
Article
The 2022 monkeypox outbreak, caused by the zoonotic monkeypox virus, has spread across six WHO regions (the Americas, Africa, Europe, Eastern Mediterranean, Western Pacific and South-East Asia) and was declared a public health emergency of international concern on July 23, 2022. The global situation is especially concerning, given the atypically high rate of person-to-person transmission, suggesting viral evolution to an established human pathogen. Pregnant women are at heightened risk of vertical transmission of the monkeypox virus due to immune vulnerability, natural depletion of population immunity to smallpox among reproductive-age women, and because orthopoxviral cell entry mechanisms can overcome the typically viral-resistant syncytiotrophoblast barrier within the placenta. Pregnancy outcomes following monkeypox infection are scarce but include reports of miscarriage, intrauterine demise, preterm birth and congenital infection. This article aims to forecast the issues maternity units might face and propose management guidelines to protect the health of pregnant women and their fetuses. We review the pathophysiology and clinical features of monkeypox infection and discuss the implications of the unusually high prevalence of anogenital lesions. We describe the use of real-time polymerase chain reaction tests from mucocutaneous and oropharyngeal sites to confirm infection and share an algorithm for the antenatal management of pregnant women with monkeypox virus exposure. Based on the best available knowledge from prenatal orthopoxvirus infections, we discuss the sonographic features of congenital monkeypox and the role of invasive testing in establishing fetal infection. We suggest a protocol for cesarean delivery to avoid the horizontal transmission of the monkeypox virus at birth and address the controversy of mother-infant separation in the postpartum period. Obstetric concerns relating to antiviral therapy with tecovirimat and vaccinia immune globulin, including the risks of QTc prolongation, erroneous blood glucose monitoring and venous thromboembolism, are highlighted. Finally, we discuss the possibility of monkeypox vaccine hesitancy during pregnancy, offer strategies to mitigate these risks and propose research priorities to address knowledge gaps about the impact of monkeypox infection on maternal, fetal, and neonatal health.
Article
Full-text available
Resveratrol is a potent polyphenolic compound that is being extensively studied in the amelioration of viral infections both in vitro and in vivo . Its antioxidant effect is mainly elicited through inhibition of important gene pathways like the NF- κβ pathway, while its antiviral effects are associated with inhibitions of viral replication, protein synthesis, gene expression, and nucleic acid synthesis. Although the beneficial roles of resveratrol in several viral diseases have been well documented, a few adverse effects have been reported as well. This review highlights the antiviral mechanisms of resveratrol in human and animal viral infections and how some of these effects are associated with the antioxidant properties of the compound.
Chapter
This unit describes how to infect cells with vaccinia virus and then transfect them with a plasmid-transfer vector or PCR fragment to generate a recombinant virus. Selection and screening methods used to isolate recombinant viruses and a method for the amplification of recombinant viruses are described. Finally, a method for live immunostaining that has been used primarily for detection of recombinant modified vaccinia virus Ankara (MVA) is presented.
Chapter
The culturing of cell lines used with vaccinia virus, both as monolayer and in suspension, is described. The preparation of chick embryo fibroblasts (CEF) is presented for use in the production of the highly attenuated and host range-restricted modified vaccinia virus Ankara (MVA) strain of vaccinia virus. Protocols for the preparation, titration, and trypsinization of vaccinia virus stocks, as well as viral DNA preparation and virus purification methods are also included.
Article
This unit first describes how to infect cells with vaccinia virus and then transfect them with a plasmid-transfer vector to generate a recombinant virus. Methods are also presented for purifying vaccinia virus and for isolating viral DNA, which can be used during transfection. Also presented are selection and screening methods used to isolate recombinant viruses and a method for the amplification of recombinant viruses. Finally, a method for live immunostaining that has been used primarily for detection of recombinant modified vaccinia virus Ankara (MVA) is presented.
Article
The cells of a human epithelial cancer cultivated en masse have been shown to support the multiplication of all three types of poliomyelitis virus. These cells (strain HeLa of Gey) have been maintained in vitro since their derivation from an epidermoid carcinoma of the cervix in February, 1951. As the virus multiplied it caused in from 12 to 96 hours degeneration and destruction of the cancer cells. The specific destructive effect of the virus was prevented by adding homotypic antibody to the cultures but not by adding heterotypic antibodies. Methods for the preparation of large numbers of replicate cultures with suspensions of strain HeLa cells were described. The cells in suspension were readily quantitated by direct counts in a hemocytometer. A synthetic solution that maintains cellular viability was employed for viral propagation. The experimental results demonstrate the usefulness of strain HeLa cells for (a) the quantitation of poliomyelitis virus, (b) the measurement of poliomyelitis antibodies, and (c) the production of virus.