Genetic relationships and evolution of old Chinese garden roses based on SSRs and chromosome diversity

Abstract

Old Chinese garden roses are the foundation of the modern rose, which is one of the best-selling ornamental plants. However, the horticultural grouping and evolution of old Chinese garden roses are unclear. Simple sequence repeat (SSR) markers were employed to survey genetic diversity in old Chinese garden roses and genetic differentiation was estimated among different rose groups. Fluorescence in situ hybridization was used to study the physical localization of 5 S rDNA genes and a karyotype analysis was performed. The SSR data suggest that old Chinese garden roses could be divided into Old Blush group, Odorata group and Ancient hybrid China group. The Old Blush group had the most primitive karyotype. The Ancient hybrid China group and modern rose had the most evolved karyotypes and the highest genetic diversity. During the evolution of rose cultivars, 5 S rDNA increased in number, partially weakened in signal intensity and exhibited variation in distance from the centromere. In conclusion, rose cultivars evolved from the Old Blush Group to the Odorata group, the Ancient Hybrid China group and the modern rose. This work provides a basis for the collection, identification, conservation and innovation of rose germplasm resources.

Full text

1
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
www.nature.com/scientificreports
Genetic relationships and evolution
of old Chinese garden roses based
on SSRs and chromosome diversity
Jiongrui Tan, Jing Wang, Le Luo, Chao Yu, Tingliang Xu, Yuying Wu, Tangren Cheng, Jia Wang,
Huitang Pan & Qixiang Zhang
Old Chinese garden roses are the foundation of the modern rose, which is one of the best-selling
ornamental plants. However, the horticultural grouping and evolution of old Chinese garden roses are
unclear. Simple sequence repeat (SSR) markers were employed to survey genetic diversity in old Chinese
garden roses and genetic dierentiation was estimated among dierent rose groups. Fluorescence in
situ hybridization was used to study the physical localization of 5 S rDNA genes and a karyotype analysis
was performed. The SSR data suggest that old Chinese garden roses could be divided into Old Blush
group, Odorata group and Ancient hybrid China group. The Old Blush group had the most primitive
karyotype. The Ancient hybrid China group and modern rose had the most evolved karyotypes and the
highest genetic diversity. During the evolution of rose cultivars, 5 S rDNA increased in number, partially
weakened in signal intensity and exhibited variation in distance from the centromere. In conclusion,
rose cultivars evolved from the Old Blush Group to the Odorata group, the Ancient Hybrid China group
and the modern rose. This work provides a basis for the collection, identication, conservation and
innovation of rose germplasm resources.
Plant breeding aims to combine traits of interest with existing traits. e conservation and innovation of ger-
mplasm resources are the foundation of breeding programs. ere are more than 24000 rose cultivars, and these
are among most popular ornamental plants1. e cultivation of roses has a long history and can be traced back
to Roman antiquity and even 3000 BC in China2,3. China is the distribution centre of the genus Rosa. Since early
19th century, continuous-owering, tea-scented and crimson old Chinese garden roses were successively intro-
duced into Europe, triggering a new era of modern roses4. Old Chinese garden roses were of great importance in
the background of modern roses owing to the specic traits they contributed3,5. Old Chinese garden roses were
bred and cultivated since the Song Dynasty (960–1279 BC)6; they experienced a variety of natural disasters and
wars, and survived for the past one thousand years. Old Chinese garden roses and wild species are the basis for a
breeding approach to improve adaptability and disease resistance and to enrich the narrow gene pool of modern
roses7.
Cultivated roses are mostly horticulturally classied into three groups based on phenotypic characters: (i) wild
species or botanical roses, (ii) old garden roses that existed prior to 1867 and (iii) modern roses8. ere are two
subdivisions of old garden roses from China (China roses and Tea roses) and several subdivisions of old garden
roses with a genetic background inuenced by China roses, such as Bourbon, Noisette and Hybrid Perpetual9.
e present classication is used as a reference, but requires continuous evaluation9. China roses, as a subdivision
of old garden roses, refer to the group that includes Rosa chinensis in sect. Chinenses as well as its horticultural
varieties, and early Hybrid China roses are characterized by a moderate fragrance, continuous-owering, and
have been introduced to western Europe since the 18th century8,10. Tea roses (i.e. Tea-scented China roses) are
continuous-owering roses, named for their scent, which resembles that of Chinese black tea; they have individ-
ual owers with petals that tend to roll back at the edge8.
Both China roses and Tea roses are everblooming erect shrubs belonging to old Chinese garden roses, but they
do not represent all of the old Chinese garden rose germplasm. ere are many cultivars with diverse phenotypic
Beijing Key Laboratory of Ornamental Plants Germplasm Innovation & Molecular Breeding, National Engineering
Research Center for Floriculture, Beijing Laboratory of Urban and Rural Ecological Environment, Key Laboratory
of Genetics and Breeding in Forest Trees and Ornamental Plants of Ministry of Education and College of Landscape
Architecture, Beijing Forestry University, Beijing, 100083, China. Correspondence and requests for materials should
be addressed to H.P. (email: htpan@bjfu.edu.cn)
Received: 9 May 2017
Accepted: 2 November 2017
Published: xx xx xxxx
OPEN
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
2
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
characteristics within old Chinese garden roses, including once blooming and climbing characteristics. For rose
germplasm innovation, it is crucial to clarify the grouping, genetic relationships, and early breeding process of
old Chinese garden roses. However, the horticultural grouping and evolution of old Chinese garden roses are
unclear. Li et al. reported that old Chinese garden roses could be clustered into six groups based on morphological
characteristics11. e Old Blush group and Rosa odorata group have been identied when classifying old Chinese
garden roses based on morphological characteristics12. Soules found eight synonyms or sports of ‘Old Blush’
among China roses based on identical simple sequence repeat (SSR) proles and named them the Old Blush
group10. In order to improve the grouping of old Chinese garden roses, additional cytogenetic and molecular
analyses are needed.
Molecular marker technologies have been used to study the genetic relationships among groups of roses5,8,10,13–16.
Cytogenetic analyses have also been used for taxonomic, evolution and speciation analyses of the genus Rosa17–21.
Despite rDNA-FlSH (uorescence in situ hybridization) analyses of the genetic relationships among several culti-
vars and species in the subgenus Rosa22–30, the physical positions of rDNA have rarely been used in studies of the
evolutionary relationships among rose cultivars31. Molecular markers and FISH have been combined to analyse
the genetic variability of rose cultivars and species32. However, few studies have combined cytogenetic techniques
and molecular biology techniques to analyse the genetic relationships and evolution of old Chinese garden roses.
As an important germplasm resource of modern roses, further studies of old Chinese garden roses can not
only improve our understanding of the genetic background of modern roses, but can also contribute to the identi-
cation, collection, preservation and innovation of rose germplasm resources. erefore, we combined SSR mark-
ers and FISH to analyse the genetic relationships and evolution of old Chinese garden roses. For the purposes of
this study, old Chinese garden roses can be divided into three groups: Old Blush group (varieties and cultivars of
R. chinensis var. chinensis), Odorata group (varieties and cultivars of R. odorata) and Ancient Hybrid China group
(cultivars of R. chinensis). e goal was to test the following hypotheses: (i) the Old Blush group is genetically dis-
tinct from other ever-blooming old Chinese garden roses; (ii) the Ancient hybrid China group is derived from the
Old Blush group, Odorata group and species; and (iii) the physical locations of 5 S rDNA genes on chromosomes
are related to the genetic relationships and karyotype evolution of rose cultivars.
Results
Microsatellite marker analysis. Twenty-two SSRs (see Supplementary TableS2) were used to identify 81
genotypes (see Supplementary TableS1); these SSRs were highly polymorphic, with 4 to 19 alleles per marker and
a total of 227 alleles over 22 primer pairs. All markers used in the study have been mapped in the nal integrated
map for ‘Yunzheng Xiawei’ and ‘Sun City’ (LG2-LG7) and preliminary linkage groups of ‘Yunzheng Xiawei’ (Y4,
Y12)33. Am ranged from 1.3 alleles for 464 to 2.2 alleles for Rw22A3. Ae ranged from 0.9 for Rw22A3 to 1.9 for 397.
Gene diversity (He) ranged from 0.281 to 0.865. Generally, markers with fewer alleles had lower He values, except
637 and 327, which had 5 and 8 alleles, respectively, but He values of 0.735 and 0.798. An exception was marker
509, which had 13 alleles, but a relatively low He value (He = 0.442) and Ae value (Ae = 1.3). is indicates that
marker 509 had a high proportion of low frequency alleles.
Cluster analysis using molecular markers. As shown in the dendrogram in Fig.1, the cultivars and
species of sect. Chinenses were separated from other sections of the subgenus Rosa with a similarity coecient
of approximately 0.34 and formed well-dened groups at a similarity of approximately 0.42. e dendrogram
clusters generally conformed to the current classication. e genetic diversity for all accessions was high, with
similarity coecients for non-identical samples ranging from ~0.22–0.99.
e rst group in the dendrogram is the Old Blush group. ey are contained within the largest cluster, which
also contains sub-clusters of the Ancient Hybrid China group and the Odorata group. Based on the similarity
coecients, the accessions in the Old Blush group are closely related, and the genetic diversity is lower for these
accessions, which are cultivars of R. chinensis var. chinensis. R. lucidissima (L) clustered in the Old Blush group. R.
lucidissima clustered with ‘Zhaiye Tengben Yuejihua’ and ‘Teng Yueyue Hong’ (OB15 and OB5) with a similarity
coecient of 0.63; they are all climbing shrubs. e top six accessions of the Old Blush group clustered together
with a similarity coecient of greater than 0.90. e genetic diversity of this group was very low. ‘Viridiora’
(AC19) and ‘Yueyue Fen’ (OB12) had identical SSR proles.
e largest cluster within this dendrogram separated into two groups at a similarity of approximately 0.42. e
deeper part of the largest cluster generally included climbing shrubs classied as R. odorata varieties, including
their wild ancestor R. odorata var. gigantea (OG). e genetic diversity of this cluster was lower than those of the
Old Blush group and Ancient Hybrid China group, with similarity coecients of ~0.46–0.64. ‘Siji Danhuang
Xiangshui Yueji’ (O3) and ‘Siji Fenhong Xiangshui Yueji’ (O4) were not observed in the Odorata group; O3,
namely ‘Parks’ Yellow Tea-Scented China’, and O4 are ever blooming Tea roses and have a high heterozygosity.
ere was a cluster of cultivars between the Old Blush group and Odorata group, most of which were ancient
hybrid China rose cultivars. e common characteristics of these Ancient Hybrid China roses are erect shrubs
and recurrent blooming. According to the similarity coecient between samples within groups, the Ancient
Hybrid China group has greater levels of genetic diversity than those of other groups. e range of similarity coef-
cients for this cluster (about 0.54–0.90) was intermediate to those of the Old Blush group (about 0.60–0.99) and
Odorata group (about 0.46–0.64). Seven modern roses belonged to this group as well, including Hybrid Tea and
Floribunda. e cluster adjacent to sect. Chinenses contained all accessions of sect. Cinnamomeae and a cultivar
of R. rugosa, ‘Dahong Zizhi’ (HR), which is the progeny of interspecic hybridization in sect. Cinnamomeae, R.
rugosa × R. davurica. Sect. Synstylae taxa clustered together, except R. multiora var. carnea (S5), which is sep-
arated by R. chinensis var. spontanea (CS1 and CS2). e last two clear clusters were sect. Banksianae and sect.
Pimpinellifoliae.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
3
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
Genetic differentiation among groups. Genetic differentiation between the Old Blush group and
Odorata group and between the Old Blush group and Ancient Hybrid China group was moderate (FST = 0.10,
0.11) (Table1), indicating that the Old Blush group is distinct from other recurrent blooming Ancient Hybrid
China roses and cultivars of the Odorata group. e Old Blush group and species in sect. Chinenses had high
genetic dierentiation (FST = 0.15) and the Old Blush group and sect. Synstylae, Old Blush group and sect.
Cinnamomeae, and Old Blush group and other sections exhibited very high genetic dierentiation (FST = 0.26,
0.34 and 0.31, respectively), indicating that the Old Blush group is genetically more closely related to species in
sect. Chinenses than sect. Synstylae, sect. Cinnamomeae and other sections of the subgenus Rosa.
e FST values for the Ancient Hybrid China group and Old Blush group, Ancient Hybrid China group and
Odorata group, Ancient Hybrid China group and species in sect. Chinenses, Ancient Hybrid China group and
sect. Synstylae, and Ancient Hybrid China group and other sections all indicated moderate genetic dierentiation
(Table1). Accordingly, the breeding process of the Ancient Hybrid China group may involve the Old Blush group,
Odorata group, species in sect. Chinenses, sect. Synstylae and other sections of the subgenus Rosa. e genetic dis-
tance between the Ancient Hybrid China group and modern roses was the lowest (FST = 0.01) (Table1), suggesting
that they share a similar genetic background. ese ndings are consistent with the dendrogram, indicating that the
Ancient Hybrid China group and modern roses are not two genetically independent groups. FST values for compari-
sons between species of roses not in sect. Chinenses (sect. Synstylae, sect. Cinnamomeae and Other sections) and each
horticultural rose group were as follows: Old Blush group > Odorata group > Ancient Hybrid China group > modern
roses (Table1). e degree of heterozygosity increased from the Old Blush group to Odorata group, Ancient Hybrid
China group and modern roses, and this order may reect the evolution of these groups, to some extent.
Figure 1. UPGMA dendrogram obtained from a cluster analysis of 81 rose accessions based on 22 SSRs. Note:
is dendrogram was produced using the Unweighted Pair Group Method with Arithmetic Mean clustering
from the Dice similarities of the SSR data. e main groups of interest are indicated near the top node of the
cluster.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
4
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
Karyotype analysis. e metaphase chromosome karyotypes were obtained by uorescence in situ hybrid-
ization. Ploidy levels ranged from 2x to 4x, with a basic chromosome number of x = 7 (Table2). No aneuploidy
was observed in the tested materials. e chromosomes are compiled in Table2. Cultivars of the Old Blush
Group and R. odorata were all diploid, and some members of the Ancient Hybrid China group were also diploid.
Triploids and tetraploids exist in the Ancient Hybrid China group and Modern Roses as a result of articial
domestication and distant hybridization. e polyploidy in the Ancient Hybrid China group and modern roses
indicates a higher level of evolution than that of the Old Blush Group and R. odorata.
Four karyotypes were observed in the tested rose materials: 1 A, 2 A, 1B and 2B (Table2). Rose karyotypes of
the Old Blush group and R. odorata were mainly 1 A and 2 A, while the karyotypes of Ancient Hybrid China roses
and modern roses were mainly 1B and 2B. According to the classication standard of plant karyotype symmetry,
karyotype asymmetry is high when the asymmetrical karyotype index is greater than 60%, and a karyotype is
more primitive when the karyotype asymmetry coecient is closer to 50%34. Only two asymmetrical karyotype
indexes were less than 60%, i.e. ‘Yueyue Fen’ and ‘Yueyue Hong’ (Table2), indicating that they are the most prim-
itive roses among all tested materials.
Only the m and sm chromosome types were detected in the tested materials (Table2). To visually compare
the karyotype asymmetry between dierent roses, a scatter plot of the average arm ratio on the X-axis against the
longest and the shortest chromosome ratio on the Y-axis was obtained (Fig.2). e relative position of the coor-
dinate points in the scatter plot reect the asymmetry, the degree of evolution and the relationships among rose
cultivars. For points close to the upper righthand corner, the karyotype is more asymmetrical, and the degree of
cultivar evolution is high. In the opposite region, the degree of evolution of cultivars is lower. As shown in Fig.2,
‘Yueyue Fen’ (OB12) in the lower le-hand corner is the most primitive cultivar.
Points in the lower part of the plot represent diploid cultivars (Lt/St < 1.9) with karyotype 1 A or 2 A (Fig.2),
indicating that they are more primitive with respect to the chromosome ratio. However, the evolution of these
cultivars was essentially synchronous with respect to the chromosome ratio and the average arm ratio. ‘Viridiora’
(AC19) and ‘Zhaiye Tengben Yuejihua’ (OB15) were more highly evolved than ‘Yueyue Fen’ (OB12) and ‘Yueyue
Hong’ (OB13). ‘Danhuang Xiangshui Yueji’(O2) was more highly evolved than R. odorata var. odorata (OO). e
upper part of the plot (Lt/St > 1.9) included triploids, tetraploids, and a few of diploids (most with B karyotype)
(Fig.2). eir evolution was more rapid in the direction of the chromosome ratio. e most highly evolved cul-
tivars were ‘Huzhong Yue’ (AC6) and ‘Goldmarie’ (M3). ‘Betty Prior’ (M1), ‘Bao Xiang’ (AC1), and others were
more primitive. e karyotype evolution of these four modern rose cultivars did not exceed the range of Ancient
Hybrid China roses. e karyotype analysis result is in good agreement with the SSR data.
FISH with 5 S rDNA probes. Using digoxin-labelled 5 S rDNA as a probe, 15 old Chinese garden rose cul-
tivars and 4 modern rose cultivars were used for uorescence in situ hybridization, and the metaphase chromo-
some karyotype and in situ hybridization signals were obtained (Fig.3). e FISH karyotype ideogram provides
a clear visual representation (see Supplementary Fig.S1). 5 S rDNA sites are oen located near the centromere
of the long arm of the chromosome. ere were some dierences in the intensity and distribution of signal loci
among cultivars.
ere were only two 5 S rDNA signals in cultivars of the Old Blush Group and ‘Viridiora’(AC19), which are
all diploid accessions (Fig.3). Compared to ‘Yueyue Fen’ (OB12) and ‘Yueyue Hong’ (OB13), the distance between
5 S rDNA signals and the centromere was longer in ‘Zhaiye Tengben Yuejihua’ (OB15) and ‘Viridiora’ (AC19) (see
Supplementary Fig.S1). ere were still some diploid materials, such as varieties of R. odorata, ‘Huzhong Yue’ (AC6),
and ‘Si Chun’ (AC18), with four 5 S rDNA signals on two pairs of chromosomes (Fig.3). e distance between 5 S
rDNA signals and the centromere was longer than that of the Old Blush group (see Supplementary Fig.S1). e
numbers of 5 S rDNA signals in triploid roses were usually 6 (multiples of three, 3n) or 5 (3n-1); only ‘Betty Prior’
(M2) had 9 (3n). e numbers of 5 S rDNA signals in tetraploid roses were usually 4, 8 (multiples of four, 4n), or 7
(4n-1). eir distances between 5 S rDNA signals and centromeres varied (see Supplementary Fig.S1). e 5 S rDNA
signal number increases multiply as the ploidy level increases, but one signal is occasionally lost.
OB OAC M SSC S C OS
OB
O 0.10
AC 0.11 0.05
M 0.20 0.08 0.01
SSC 0.15 0.05 0.06 0.07
S 0.26 0.15 0.10 0.07 0.04
C 0.34 0.23 0.15 0.12 0.13 0.13
OS 0.31 0.16 0.14 0.11 0.13 0.10 0.07
Table 1. Genetic dierentiation (FST) among rose types of 81 rose accessions based on 22 SSRs. OB, Old Blush
group; O, Odorata group, AC, Ancient Hybrid China group; M, modern roses; SSC, Species roses in sect.
Chinenses; S, sect. Synstylae; SC, sect. Cinnamomeae; OS, Other sections. e shading varies from white to dark
grey according to the height of the FST value. A high FST means a high distance between groups. 0.0 < FST < 0.05:
little genetic dierentiation; 0.05 < FST < 0.15: moderate genetic dierentiation; 0.15 < FST < 0.25: high genetic
dierentiation; FST > 0.25: very high genetic dieretiation64.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
5
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
As shown in Supplementary Fig.S1, the 5 S rDNA signal strengths for ‘Yueyue Fen’ (OB12) and ‘Yueyue Hong’
(OB13) were both relatively strong. In other diploid roses, the 5 S rDNA signals were partial and relatively weak.
Triploid accessions usually had weak or very weak signals, except for ‘Bao Xiang’ (AC1) and ‘Zixiang Rong’ (AC24),
for which a portion of signals was relatively strong. All of the signals were relatively weak or very weak in tetraploids.
e 5 S rDNA signal intensity partially and gradually weakened as the ploidy level increased and the karyotype
diverged. In sum, the intensity, number and position of 5 S rDNA signals are related to karyotype evolution.
Sample
number Cultivar or species Arm ratio Lt/St Relative length of
chromosome Formula of karyotype Karyotype Asymmetrical
karyotypeindex
OB12 ‘Yueyue Fen’ 1.02 ± 0.05~2.30 ± 0.03 1.40 ± 0.005 2 n = 8 M1 + 6 M2 2 n = 2 x = 14 = 12 m + 2 sm 2 A 56.70 ± 0.13%
OB13 ‘Yueyue Hong’ 1.26 ± 0.02~1.90 ± 0.06 1.47 ± 0.009 2 n = 8 M1 + 6 M2 2 n = 2 x = 14 = 12 m + 2 sm 1 A 59.47 ± 0.16%
OB15 ‘ZhaiyeTengbenYuejihua’ 1.40 ± 0.01~2.51 ± 0.02 1.76 ± 0.012 2 n = 8 M1 + 4 M2 + 2 L 2 n = 2 x = 14 = 10 m + 4 sm 2 A 63.42 ± 0.11%
O2 ‘Danhuang Xiangshui Yueji’ 1.51 ± 0.03~2.10 ± 0.06 1.61 ± 0.016 2 n = 8 M1 + 4 M2 + 2 L 2 n = 2 x = 14 = 4 m + 10 sm 2 A 64.56 ± 0.12%
OO R. odorata var. odorata 1.47 ± 0.03~2.45 ± 0.05 1.86 ± 0.018 2 n = 4 S + 2 M1 + 6 M2 + 2 L 2 n = 2 x = 14 = 4 m + 10 sm 2 A 65.95 ± 0.15%
AC1 ‘Bao Xiang’ 1.43 ± 0.04~2.39 ± 0.02 2.06 ± 0.017 2 n = 3 S + 6 M1 + 9 M2 + 3 L 2 n = 3 x = 21 = 15 m + 6 sm 2B 63.28 ± 0.15%
AC6 ‘Huzhong Yue’ 1.31 ± 0.01~1.84 ± 0.03 3.10 ± 0.010 2 n = 4 S + 4 M1 + 4 M2 + 2 L 2 n = 2 x = 14 = 12 m + 2 sm 1B 60.04 ± 0.18%
AC7 ‘Jinfen Lian’ 1.19 ± 0.03~1.84 ± 0.01 1.99 ± 0.012 2 n = 4 S + 8 M1 + 12 M2 + 4 L 2 n = 4 x = 28 = 24 m + 4 sm 1 A 60.24 ± 0.17%
AC11 ‘Mutabilis’ 1.35 ± 0.03~1.96 ± 0.03 2.01 ± 0.007 2 n = 2 S + 4 M1 + 6 M2 + 2 L 2 n = 2 x = 14 = 10 m + 4 sm 1B 61.89 ± 0.21%
AC16 ‘Sai Zhaojun’ 1.23 ± 0.01~2.00 ± 0.03 1.66 ± 0.013 2 n = 2 S + 6M1 + 6M2 2 n = 2 x = 14 = 8 m + 6 sm 1 A 61.35 ± 0.08%
AC18 ‘Si Chun’ 1.31 ± 0.05~2.46 ± 0.04 2.46 ± 0.020 2 n = 2 S + 6 M1 + 4 M2 + 2 L 2 n = 2 x = 14 = 6 m + 8 sm 2B 64.64 ± 0.19%
AC19 ‘Viridiora’ 1.13 ± 0.04~2.13 ± 0.03 1.87 ± 0.013 2 n = 2 S + 6 M1 + 4 M2 + 2 L 2 n = 2 x = 14 = 10 m + 4 sm 2 A 62.16 ± 0.13%
AC20 ‘Yingri Hehua’ 1.39 ± 0.02~2.17 ± 0.02 2.30 ± 0.013 2 n = 3 S + 9 M1 + 6 M2 + 3 L 2 n = 3 x = 21 = 12 m + 9 sm 2B 63.11 ± 0.17%
AC21 ‘Yu Linglong’ 1.31 ± 0.05~1.96 ± 0.03 2.48 ± 0.020 2 n = 2 S + 6 M1 + 4 M2 + 2 L 2 n = 2 x = 14 = 8 m + 6 sm 1B 62.85 ± 0.12%
AC24 ‘Zi Xiang Rong’ 1.21 ± 0.03~2.26 ± 0.02 2.04 ± 0.015 2 n = 6 S + 6 M1 + 6 M2 + 3 L 2 n = 3 x = 21 = 9 m + 12 sm 2B 64.34 ± 0.13%
M1 ‘Betty Prior’ 1.48 ± 0.03~2.30 ± 0.04 1.90 ± 0.006 2 n = 6 S + 6 M1 + 3 M2 + 6 L 2 n = 3 x = 21 = 6 m + 15 sm 2 A 64.94 ± 0.14%
M3 ‘Goldmarie’ 1.45 ± 0.01~1.98 ± 0.03 3.01 ± 0.015 2 n = 4 S + 8 M1 + 12 M2 + 4 L 2 n = 4 x = 28 = 24 m + 4 sm 1B 62.20 ± 0.15%
M4 ‘Honglian Wu’ 1.33 ± 0.02~1.99 ± 0.04 2.12 ± 0.010 2 n = 3 S + 12 M1 + 3 M2 + 3 L 2 n = 3 x = 21 = 15 m + 6 sm 1B 60.88 ± 0.16%
M7 ‘Princesse de Monaco’ 1.48 ± 0.04~2.22 ± 0.05 2.27 ± 0.023 2 n = 4 S + 12 M1 + 8 M2 + 4 L 2 n = 4 x = 28 = 16 m + 12
sm 2B 64.24 ± 0.18%
Table 2. Karyotype parameters for 19 rose cultivars.
Figure 2. Scatter diagram of 19 rose cultivars based on the degree of karyotype asymmetry. e triangles
represent diploid rose cultivars (Lt/St < 1.9).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
6
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
Discussion
e rst goal of this study was to determine whether the Old Blush group is genetically distinct from other
ever-blooming China roses. Cultivars of the Old Blush group were clearly separated from other old Chinese gar-
den roses in a dendrogram. Genetic dierentiation between the Old Blush group and other old Chinese garden
roses was moderate (FST = 0.10). e results show that Old Blush group is distinct from other recurrent blooming
old Chinese garden roses. Cultivars in Old Blush group were closely related to each other not only at the pheno-
typic level, but also at the molecular level. e Old Blush group should have an independent classication status
among China roses. Soules named eight accessions (e.g. ‘Climbing Old Blush’, ‘Viridiora’ and ‘Single Pink’) in
the Old Blush group based on their SSR proles, which were identical to that of ‘Old Blush’10. Climbing-type and
single ower-type Old Blush roses were also examined in this study, but only ‘Viridiora’ (AC19) had an identical
SSR prole to that of ‘Old Blush’ (OB12). is dierence may be explained by the dierent accessions and SSR
makers. As the type specimen, ‘Yueyue Fen’ was named R. chinensis var. chinensis, and is a cultivar, not a wild
specimen5. ‘Yueyue Fen’ has diverse horticultural cultivars, and these are the most common ancient roses with the
longest history (from the Song dynasty, 960–1279 DC) of cultivation in China6,35. e Old Blush group is gener-
ally considered the oldest and most common type of ever-blooming ancient China rose.
R. chinensis var. spontanea is commonly considered one of the wild ancestors of ‘Old Blush’ based on morpho-
logical characters35,36 and chloroplast sequence haplotypes10,12. R. chinensis var. spontanea (CS1, CS2) clustered
with sect. Synstylae and most of the species were separated from rose cultivars (Fig.1), conrming previous
results obtained by Soules10 and Qiu et al.37. According to Qiu et al., wild roses are separated from old garden
roses and modern roses37,38. Compared to other accessions, R. lucidissima (L.) is relatively genetically more closely
related to the Old Blush group (Fig.1). is result supports the hypothesis that R. lucidissima is involved in the
breeding process for R. chinensis var. chinensis ‘Old Blush’35. e chloroplast data showed that R. chinensis var.
spontanea is a maternal ancestor of the China Roses10. As a maternal ancestor, the genetic material in the nucleus
of R. chinensis var. spontanea may be diluted by multiple hybridization events. is may explain why R. chinensis
var. spontanea was not closely related to the Old Blush group based on SSR data.
e dierence in karyotypes among cultivars within the same species seems to arise from divergence between
parental accessions and ospring in phyletic evolution39. ‘Viridiora’ had been speculated to be a sport of ‘Old
Figure 3. Fluorescence in situ hybridization (FISH) analysis using 5 S rDNA (red uorescence) probes at the
metaphase stage of 19 rose cultivars. DAPI (blue).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
7
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
Blush;’ they were genetically identical in this study and in several previous studies7,10,15. However, ‘Viridiora’
(AC19) was more highly evolved than ‘Yueyue Fen’ (OB12) (Fig.2), implying that ‘Viridiora’ is a sport of ‘Old
Blush; the latter has 12 m (metacentric chromosomes) and 2 sm (submedian metacentric chromosomes), while
‘Viridiora’ has 10 m and 4 sm (Table2). If ‘Viridiora’ is indeed a sport of ‘Old Blush’, structural variation
occurred in two chromosomes. ‘Zhaiye Tengben Yuejihua’ (double ower, once owering climbing shrub) was
presumed to be an intermediate between the wild ancestor R. chinensis var. spontanea and ‘Old Blush’12. A kar-
yotype analysis showed that ‘Zhaiye Tengben Yuejihua’ (OB15) is more highly evolved than ‘Yueyue Hong’ and
‘Yueyue Fen’ (Fig.2). is result suggests that ‘Zhaiye Tengben Yuejihua’ is derived from ‘Old Blush’.
e second goal of this study was to determine whether the Ancient Hybrid China group was bred on the basis
of Old Blush group, Odorata group and species. SSR data revealed that roses of the Ancient Hybrid China group
were located midway between the Old Blush group, Odorata group and species, probably as a consequence of their
hybridization history (Fig.1). From the perspective of ploidy levels, triploid roses in the Ancient Hybrid China
group appear to be the result of hybridization between diploid roses (Old Blush group and Odorata group) and tetra-
ploid roses (some species roses). Previous studies have also reported that triploid roses are midway between diploids
roses and tetraploids roses based on principal component analyses, possibly as a consequence of their hybridiza-
tion5. ere are also diploids and tetraploids in the Ancient Hybrid China group, as well as tetraploid modern roses,
which are probably the products of dierent ploidy combinations. Unreduced gametes produced by triploids may
have formed tetraploid roses40. From the perspective of genetic dierentiation, the genetic distances to species roses
become smaller from the Old Blush group to the Odorata group, then to the Ancient Hybrid China group and mod-
ern roses. Accordingly, the Ancient Hybrid China group and modern roses might be the result of the continuous
hybridization of the Old Blush group, Odorata group and wild species. e genetic background of modern roses is
similar to that of the Ancient hybrid China group, as evidenced by the low dierentiation (FST = 0.01).
From the perspective of karyotype evolution, the karyotype of Old Blush roses and R. odorata (mainly 1 A
and 2 A) were more primitive than those of Ancient Hybrid China roses and modern roses (mainly 1B and 2B).
Plants are more evolved when their karyotype asymmetry is higher41–43. A scatter diagram of rose cultivars based
on average arm ratio and length ratio (Lt/St) suggest that polyploid Ancient Hybrid China roses and modern
roses evolved more rapidly along the direction of chromosome length ratio. e Old Blush group and Odorata
group are more primitive than the Ancient Hybrid China group and modern roses along the direction of chromo-
some length ratio. Dierences in chromosome length ratio are caused by variation in chromosome structure (i.e.,
deletion, duplication and translocation events). erefore, changes in chromosome structure may explain the
formation of Ancient Hybrid China roses and modern roses. e hybridization between diploid roses (Old Blush
group and Odorata group) and tetraploid roses (some species) may promote variation in chromosome structure.
ese results were consistent with those of Jian et al.31, who showed that compared to R. chinensis var. chinensis
and R. odorata, other old Chinese garden roses and modern roses have more variation in chromosome structure
and number. R. odorata var. odorata (OO) and ‘Danhuang Xiangshui Yueji’ (O2) are more highly evolved than
‘Yueyue Fen’ (OB12) and ‘Yueyue Hong’ (OB13) with respect to both chromosome length ratio and arm ratio,
indicating that the Odorata group is more highly evolved than the Old Blush group. ‘Yueyue Fen’ (OB12) is the
most primitive cultivar among all accessions (Fig.2). e evolutionary relationships among groups conrmed
that the Ancient Hybrid China group may have been bred on the basis of the Old Blush group and Odorata group.
e third aim of this study was to determine whether the physical localization of 5 S rDNA genes was related
to the genetic relationships and karyotype evolution of rose cultivars. e location and number of rDNA loci on
chromosomes can eectively reect the degree of dierentiation among species44–48. When the genetic relation-
ship between plant materials is closer, the evolutionary distance is smaller and the distribution of rDNA is more
similar49. Moreover, unlike 45 S rDNA, which is closely associated with nucleolar organizer regions, the location
of the 5 S gene in rDNA regions is more diverse50. In the process of polyploidization, for each additional set of
chromosomes, one rDNA locus is added, where one set of chromosomes corresponds to one rDNA locus22. e
number of 5 S rDNA signals in this study showed that one set of chromosomes corresponded to one, two or three
rDNA loci, and sometimes one signal was lost. Mishima et al. also found that diploid rose (R. multiora) had four
5 S rDNA sites51. Chromosome rearrangements, including duplication and translocation, may lead to 5 S rDNA
signal increases in multiples. e loss of one signal could be due to the loss of a chromosome fragment by unequal
crossing over52 and transposition53 in the process of polyploidization. In addition, Fernández-Romero et al. sug-
gested that it may be due to the allopolyploid nature of accessions32. Because a higher ploidy level indicates a more
evolved karyotype (Table2), the increase of 5 S rDNA sites implies more highly evolved rose cultivars.
Based on a karyotype analysis and uorescence in situ hybridization, when an accession (Old blush group and
Odorata group) had a more primitive karyotype, it had fewer 5 S rDNA signals, stronger signal intensities and sig-
nals closer to the centromere. During the evolution of the karyotype (the Ancient Hybrid China group and modern
roses), 5 S rDNA signals increased in number, decreased in intensity, and exhibited variation in the distance from the
centromere. ese patterns are consistent with those reported by Jian et al.31, who found that compared to R. chin-
ensis var. chinensis and R. odorata, other old Chinese garden roses and modern roses are more diverse with respect
to the number and intensity of 4 5 S rDNA signals. FISH is a semi-quantitative technique; and the actual number of
gene copies cannot be directly determined, but the size and strength of the hybrid signal indirectly reects the num-
ber of gene copies54. e 5 S rDNA signal intensity decreased during evolution, and this may be due to the decrease
in 5 S rDNA copy number during the process of rose crossbreeding. Chromosome variation, including chromosome
inversions and translocations, may lead to 5 S rDNA sites that are further away from the centromere.
In analyses of plant evolution, it may be more eective to combine molecular marker techniques and uores-
cence in situ hybridization. Han et al.55 used FISH and random amplied polymorphic DNA (RAPD) to analyse
the evolution of Vicia ramuliora at the diploid and tetraploid stages. In this study, the number, intensity and
distribution of 5 S rDNA signals were related to the karyotype evolution of rose groups, which were classied
according to SSR data. e Old Blush group is the most primitive rose group; roses in this group had the fewest
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
8
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
5 S rDNA sites, the strongest signal intensity and the smallest distances from 5 s rDNA sites to the centromere.
e Odorata group is more highly evolved than the Old Blush group with respect to both chromosome length
ratio and arm ratio; roses in this group had more 5 S rDNA sites, weaker signal intensities and greater distances
from the centromere. e Ancient Hybrid China group and modern roses evolved from the Old Blush group
and Odorata group, mainly in the direction of chromosome length ratio. ey had the most 5 S rDNA sites, the
weakest signal intensity and uneven distances from the centromere.
Methods
Plant materials and DNA extraction. In total, 81 accessions were chosen, including 46 old Chinese gar-
den roses. For comparison, we also selected 7 modern rose cultivars, 1 R. rugosa cultivar and 27 wild roses from
7 sections in subgenera Rosa (see Supplementary TableS1). e healthy fresh young leaves of each accession were
harvested, deep frozen in liquid nitrogen and stored at −80 °C in a freezer. Total genomic DNA was extracted using
the Fast DNA Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. e ploidy of 19
accessions (Table2) was obtained by uorescence in situ hybridization, and young, fresh leaves of other accessions
(see Supplementary TableS1) were measured by ow cytometry. ‘Yueyue Fen’ (for which ploidy was obtained by
uorescence in situ hybridization) was used as an internal reference standard. A 1-cm2 piece of each material was
chopped up in 500 μL of cell lysis buer in a Petri dish. en, 1.5 mL of cell lysis buer mixed with DAPI was added.
A 30-μm nylon mesh was used to lter the suspension. A Partec PA II ow cytometer (Partec GmbH, Münster,
Germany), equipped with a mercury arc lamp (HBO/100), was used to analyse uorescence.
Microsatellite marker genotyping. Twenty-two markers (see Supplementary TableS3) were selected
from 42 published genome-wide SSR markers45 by polymorphism analyses in a subset of ten accessions. e for-
ward primers for the 22 markers were labelled with FAM, HEX, TAMRA, and ROX uorescent dyes. Twenty-two
SSR markers amplied successfully across all 81 accessions and showed high polymorphism by capillary electro-
phoresis. Genotyping was executed on an ABI 3730 DNA analyser (Applied Biosystems, Foster City, CA, USA).
Amplication reactions for ABI were performed in 10 μL containing 8 ng of DNA, 5 μL of multiplex master mix
kit (QIAGEN, Hilden, Germany), 4 pmol each forward (labelled) and reverse primer. e PCR procedure was as
follows: 5 min at 95 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 56 °C and 30 s at 72 °C and 10 min at 72 °C for
a nal extension. en, 1 μL of 100× diluted PCR product was mixed with the GeneScan-500 LIZ size standard
(Applied Biosystems) and Hi-Di formamide (Applied Biosystems) and then run on an ABI 3730DNA analyser.
Genemapper 4.0 (Applied Biosystems) was used to analyse the output from the ABI platform.
Genetic diversity and distance. The “allelic phenotype” was determined for each locus using data
recorded in a binary data matrix (1 for present and 0 for absent)8,56,57. To assess diversity, the number of observed
alleles (Ao), the mean number of alleles per individual (Am)6 and the eective number of alleles (Ae)58 were cal-
culated for each SSR locus. NTSYS version 2.10 was used to implement unweighted pair-group method with
arithmetic means (UPGMA) clustering in order to assess and visualize genetic relationships among genotypes.
We used the xation index (FST) and expected heterozygosity (He) to estimate diversity. Genetic distance was
measured by FST based on allele frequency dierences among accessions59. He refers to the probability that two
randomly chosen alleles at a specic locus within a set of genotypes will be dierent under Hardy–Weinberg
equilibrium (i.e., assuming random mating). e genetic dierentiation (FST) and expected heterozygosity (He)
were calculated using SPAGeDi 1.3, which analyses ploidy level data60.
Chromosome preparation. Nineteen typical cultivars were chosen from the 81 accessions to represent
each horticultural group of old Chinese garden roses and modern roses. ere were 3 cultivars from Old Blush
group, 2 cultivars from the Odorata group, 10 cultivars from the Ancient Hybrid China group and 4 cultivars
from modern roses (Table4). Somatic metaphase chromosome spreads were prepared from fresh shoot apical
meristems of 19 accessions and pretreated according to the methods of Ding et al.30. Briey, fresh young shoot
apical meristems were treated with 0.002 M 8-oxyquinoline for 4 h in dark conditions at room temperature, then
xed in freshly prepared ethanol: acetic acid (3: 1, v/v) for 24 h. e shoot apical meristem was isolated, washed
3–5 times with distilled water and enzymatically digested in 2% pectinase plus 4% cellulose at 37 °C for 2–3 h.
Subsequently, the samples were squashed with 1–2 drops of 45% acetic acid aer 30 min of immersion in distilled
water. e samples were frozen in liquid nitrogen for 5 min, and the slides were air dried and stored at −20 °C.
Probe DNA preparation. 5 S rDNA was amplied from total genomic DNA of R. multiora . Amplication was
carried out with a pair of 5 S rDNA-specic primers: forward (5′ → 3′)GAGAGTAGTACTAGGATGGGTGACC,
reverse (5′ → 3′) CTCTCGCCCAAGAACGCTTAACTGC. e 25-μL reaction mix contained 0.6 μL of template
DNA, 12.5 μL of 2 × Taq PCR Master Mix and 0.5 μL of forward and reverse primers. Amplication cycles were
performed as follows: 94 °C, 5 min; (94 °C, 30 s; 53.5 °C, 30 s; 72 °C, 1 min) × 30; 72 °C, 5 min.
Fluorescence in situ hybridization analysis. Fluorescence in situ hybridization was performed according
to the methods described by Ding et al.30. Briey, the slides were pretreated with RNase A for 1 h in a constant
temperature humidity chamber at 37 °C, washed in 2 × SSC for 10 min, xed in 4% paraformaldehyde solution for
10 min and then dehydrated in a −20 °C pre-cooled ethanol series. e hybridization mixture, containing 20 × SSC
(Saline Sodium Citrate), 50% deionized formamide (v/v), 50% dextran sulphate (w/v) and 3 μL of 5 S rDNA probe,
was denatured at 80 °C for 10 min and then incubated at 37 °C overnight (14–18 h) in constant temperature humidity
chamber. Aer hybridization, the slides were washed in 2 × SSC at 42 °C for 10 min and then digoxygenin-labelled
probes were detected using FITC-conjugated anti-digoxygenin antibodies (Roche, Mannheim, Germany).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
9
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
Chromosome observation. e chromosomes were counterstained with DAPI using Vectashield (Vector
Laboratories, Inc., Burlingame, CA, USA) and evaluated under the Olympus BX-51 uorescence microscope.
Images were captured using Cytovision and then processed with Photoshop soware (Adobe Systems Soware
Ireland Ltd., version 13.0.0.0). e nomenclature for chromosome morphology, arm ratio, karyotype and karyo-
type formula are described by Levan61 and Stebbins42. e asymmetrical karyotype index was calculated following
the methods of Arano41. e relative length of chromosomes was determined by the method of Kuo et al.62. An
increase in karyotype asymmetry can reect unequal lengths of chromosome arms or sizes of dierent chromo-
somes in the same nucleus43. e former is referred to as the average arm ratio, and the latter is referred to as the
length ratio (Lt/St). With the average arm ratio as the abscissa and the chromosome length ratio as the ordinate,
plant materials in the Cartesian coordinate system were plotted to evaluate their relative evolutionary positions63.
Consequently, the evolution of plant karyotypes showed a bidirectional trend (chromosome length ratio and arm
ratio)44. e average arm ratio was plotted against the chromosome length ratio using Excel (Fig.2).
Data availability statement. All data generated or analysed during this study are included in this pub-
lished article (and its Supplementary Information les).
References
1. oberts, A., Deb ener T. & Gudin S. Encyclopedia of ose Science (ed. oberts, A.) 267–285 (Elsevier Academic Press, 2003).
2. Touw, M. oses in the middle ages. Econ. Bot. 36, 71–83 (1982).
3. Wang, G. A study on the history of Chinese roses from ancient wors and images. Acta Hort. 751, 347–356 (2005).
4. Marriott, M. History of oses in Cultivation/Modern (post-1800) (ed. oberts, A., Debener, T. & Gudin, S.) 402–409 (Elsevier
Academic Press, 2003).
5. Liorzou, D. et al. Nineteenth century French rose (osa sp.) germplasm shows a shi over time from a European to an Asian genetic
bacground. J. Exp. Bot. 67, 4711–4725 (2016).
6. Chen, J. e history of the Chinese rose. Worl d A gr. 8, 51–53 (1986).
7. Martin, M., Piola, F., Chessel, D., Jay, M. & Heizmann, P. e domestication process of the Modern ose: genetic structure and allelic
composition of the rose complex. eor. Appl. Genet. 102, 398–404 (2001).
8. Vuosavljev, M. et al. Genetic diversity and dierentiation in roses: a garden rose perspective. Sci. Hortic-Amsterdam. 162, 320–332 (2013).
9. oberts, A., Deb ener T. & Gudin S. Encyclopedia of ose Science (ed. oberts, A.) 117–124 (Elsevier Academic Press, 2003).
10. Soules, V. A. Analysis of genetic diversity and relationships in the China ose group. Hortscience. 45, 1178–1178 (2011).
11. Li, M. L., Cui, J. P., Zhao, S. W. & Liu, Q. L. Cultivar identication through morphological cluster in old China oses. Acta Hort.
1035, 239–246 (2014).
12. Wang, G. L. Old oses in China (ed. Wang, G. L.) 213–220 (Science press, 2015)
13. Wu, S., Ueda, Y., He, H., Nishihara, S. & Matsumoto, S. Phylogenetic analysis of Japanese osa species using mat sequences.
Breeding Sci. 50, 275–282 (2000).
14. Martin, M., Piola, F., Chessel, D., Jay, M. & Heizmann, P. e domestication process of the modern rose: genetic structure and allelic
composition of the rose complex. eor. Appl. Genet. 102, 398–404 (2001).
15. Scariot, V., Aa, A. & Botta, . Characterization and genetic relationships of wild species and old garden roses based on
microsatellite analysis. J. Am. Soc. Hortic. Sci. 131, 66–73 (2006).
16. Babaei, A. et al. Microsatellite analysis of Damas rose (osa damascena Mill.) accessions from various regions in Iran reveals
multiple genotypes. BMC Plant Biol. 7, 12 (2007).
17. Yu, C. et al. aryotype analysis of wild rosa species in Xinjiang, northwestern China. J. Am. Soc. Hortic. Sci. 139, 39–47 (2014).
18. Jian, H. Decaploidy in osa praelucens Byhouwer (osaceae) endemic to Zhongdian plateau, Yunnan, China. Caryologia. 63,
162–167 (2010).
19. Jian, H. Y. et al. aryotype Analysis of Dierent Varieties on osa odorata Swee t. J. of Plant. Genet. esources. 11, 457–461 (2010).
20. Luo, L. et al. aryotype analysis of sixteen Chinese traditional rose cultivars. J. of Beijing For. Univ. 31, 90-95 (2009).
21. Wang, J. et al. aryotype analysis of osa laxa, modern rose and their interspecic hybrids. Acta Botanica Boreali-Occidentalia
Sinica. 34, 0488–0494 (2014).
22. Ma, Y. et al. In s itu hybridization of ribosomal DNA to rose chromosomes. J. Hered. 88, 158–161 (1997).
23. Fernández-omero, M. D., Torres, A. M., Millán, T., Cubero, J. I. & Cabrera, A. Physical mapping of ribosomal DNA on several
species of the subgenus. osa. eor. Appl. Genet. 103, 835–838 (2001).
24. Aasaa, M., Ueda, Y. & oba, T. aryotype analyses of five wild rose species belonging to septet A by fluorescence in situ
hybridization. Chromosome Sci. 6, 17–26 (2002).
25. Aasaa, M., Ueda, Y. & oba, T. aryotype analysis of wild rose species belonging to Septets B, C and D by molecular cytogenetic
method. Breeding Sci. 53, 177–182 (2003).
26. Tian, M., Zhang, T., Tang, . X., Zhang, H. & Wang, Q. G. FISH analysis of 45S rDNA on the chromosomes of Chinese old garden
roses. Yunnan Agr. Univ. 28, 380–385 (2013).
27. Tian, M., Jian, H. Y., Jia, Y. X., Zhang, T. & Wang, Q. G. FISH analysis of 45S rDNA on modern roses. Southwest China Agr. Sci. 25,
2263-2266 (2013).
28. irov, I. et al. Anchoring linage groups of the osa genetic map to physical chromosomes with tyramide-FISH and EST-SNP
marers. PLoS One. 9, 95793, https://doi.org/10.1371/journal.pone.0095793 (2014).
29. irov, I. V., Laere, . V., oy, N. V. & hrustaleva, L. Towards a FISH-based aryotype of osa L. (osaceae). Comp. Cytogenet. 10,
543–554 (2016).
30. Ding, X. et al. Distribution of 45S rDNA in modern rose cultivars (osa hybrida), osa rugosa, and their interspecic hybrids
revealed by uorescence in situ hybridization. Cytogenet. Genome es. 149, 226 (2016).
31. Jian, H. Y. et al. Chromosome variation from Sect. Chinenses (osa L.) through Chinese old garden roses to modern rose cultivars.
Acta Hort. 977, 157–166 (2013).
32. Fernández-omero, M. D. et al. Cytological and molecular characterization of a collection of wild and cultivated roses. In: Zlesa
DC (Ed.) oses. Floriculture and Ornam. Biotechnol. 3, 28–39 (2009).
33. Yu, C. et al. Filling gaps with construction of a genetic linage map in tetraploid roses. Front. Plant Sci. 5, 796 (2015).
34. Jiang, J. M. & Gill, B. S. New 18S-26S ribosomal NA gene loci chromosomal landmars for the evolution of polyploidy wheat.
Chromosoma. 103, 179–185 (1994).
35. Chinese academy of sciences China ora editorial board. Flora epublicae Popularis Sinicae 37, 422–426 (Beijing: Science Press, 1985).
36. ix, M. osa chinensis f. spontanea. Curtis’s Botanical Mag. 22, 214–219 (2005).
37. Qiu, X. Q. et al. Genetic relationships of wild roses, old garden roses, and modern roses based on internal transcribed spacers and
mat sequences. Hortscience. 48, 1445–1451 (2013).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

www.nature.com/scientificreports/
10
SCIENTIFIC RePORTS | 7: 15437 | DOI:10.1038/s41598-017-15815-6
38. Liu, C. et al. aryotyping in melon (Cucumis melo L.) by cross-species fosmid uorescence in situ hybridization. Cytogenet. Genome
es. 129, 241–249 (2010).
39. Shulaev, V. et al. e genome of woodland strawberry (Fragaria vesc a). Nat. Genet. 43, 109–118 (2011).
40. Gudin, S. ose: genetics and breeding. Plant Breeding ev. 17, 159–189 (2000).
41. Arano, H. Cytological students in subfamily Carduoideae (Compositae) of Japan. IX. e aryotype analysis and phylogenetic
consideration on Pertya and Ainsliaea. Botanical Mag. (Toyo) 76, 32–39 (1963).
42. Stebbins, G. L. Chromosomal Evolution in Higher Plants 87–89 (Edward Arnold, 1971).
43. Shi, D. X. & Wang, M. L. aryotype morphological studies of 6 species in genus Picea. Acta Bot. Yunnanica. 16, 157-164 (1994).
44. Liu, B. & Wendel, J. F. Epigenetic phenomena and the evolution of Plant allopolyploids. Mol. Phylogenet. Evol. 29, 365–379 (2003).
45. Muai, Y., Endo, T. . & Gill, B. S. Physical mapping of the 18S, 26SrNA multigene family in common wheat: Identication of a
new locus. Chromosoma. 100, 71–78 (1991).
46. Muai, Y. & Gill, B. S. Detection of barley chromatin added to wheat by genomic in situ hybridization. Genome. 34, 448–452 (1991).
47. Muai, Y., Naahara, Y. & Yamamoto, M. Simultaneous discrimination of the three genomes in hexaploid wheat by multicolour
uorescence in situ hybridization using total genomic and highly repeated DNA probes. Genome. 36, 489–494 (1993).
48. omas, H. E. & Danna, G. E. Finely orchestrated movements: Evolution of the ribosomal NA genes. Genetics. 175, 477–485 (2007).
49. Taeta, S., Harrison, G. E. & Heslop-Harrison, J. S. Comparative physical mapping of the 5S and 18S-25S rDNA in nine wild
Hordeum species and cytotypes. eor. Appl. Genet. 98, 1–9 (1999).
50. Mizuochi, H., Marase, A. & Oazai, . Molecular cloning of tulipafosteriana rDNA and subsequent FISH analysis yields
cytogenetic organization of 5S rDNA and 45S rDNA in T. gesneriana and T. fosteriana. Euphytica. 155, 235–248 (2007).
51. Mishima, M., Ohmido, N., Fuui, . & Yahara, T. Trends in site number change of rDNA loci during polyploid evolution in
Sanguisorba (osaceae). Chromosoma. 110, 550–558 (2002).
52. Bass, H. W., Marshall, W. F., Sedat, J. W., Agard, D. A. & Cande, W. Z. Telomeres. Telomeres cluster de novo before the initiation of
synapsis: athree-dimensional spatial analysis of telomere positions before and during meiotic prophase. J. Cell Biol. 137, 5–18 (1997).
53. Dubcovsy, J. & Dvorá, J. ibosomal NA multigene loci: nomads of the Triticeae genomes. Genetics. 140, 1367–1377 (1995).
54. Appels, ., Gerlach, W. L. & Dennis, E. S. Molecular and chromosomal organization of DNA sequences coding for the ribosomal
NAs in cereals. Chromosoma. 78, 293–311 (1980).
55. Han, Y., Liu, Y., Wang, H. Y. & Liu, X. J. e evolution of Vicia ramuliora (Fabaceae) at tetraploid and diploid levels revealed with
FISH and APD. PLoS One. 12, 0170695, https://doi.org/10.1371/journal.pone.0170695 (2017).
56. Esselin, G. D., Smulders, M. J. M. & Vosman, B. Identication of cut rose (osa hybrida) and rootstoc varieties using robust
sequence tagged microsatellite site marers. eor. Appl. Genet. 106, 277–286 (2003).
57. Par, Y. H. et al. ose (osa hybrida L.) EST-derived microsatellite marers and their transferability to strawberry (Fragaria spp.).
Sci. Hortic-Amsterdam. 125, 733–739 (2010).
58. Hamric, J. L. & Godt, M. J. W. Plant Population Genetics, Breeding and Genetic esources (ed. Brown, A. H., Clegg, M. T., ahler, A.
L., & Weir, B. S.) 43–63 (Sunderland, MA: Sinauer Associates Inc., 1990).
59. Holsinger, . E. & Weir, B. S. Genetics in geographically structured populations: dening, estimating and interpreting FST. N at.  ev.
Genet. 10, 639–650 (2009).
60. Hardy, O. J. & Veemans, X. SPAGeDI: a versatile computer program to analyse spatial genetic structure at the individual or
population levels. Mol. Ecol. Notes. 2, 618–620 (2002).
61. Levan, A., Fredga, . & Sandberg, A. A. Nomenclature for centromere position in chromosomes. Hereditas. 52, 201–220 (1964).
62. uo, S. . aryotypc analysis of some formosan gymnosperms. Taiwania. 17, 66–80 (1972).
63. Wang, M. l., Shi, D. X. & Zeng, P. A. e situation of aryotype morphological analysis and biological signication of Picea plants in
China. J. of Sichuan Agr. Univ. 15, 74-81 (1997). (in Chinese).
64. Wright, S. Evolution and the Genetics of Populations (ed. Wright, S.) 2, 469–472 (University of Chicago press, 1978).
Acknowledgements
is work was supported by the Twelh Five-Year Key Programs for Science and Technology Development of
China (grant numbers 2013BAD01B07)and National Natural Science Foundation of China (31600565).
Author Contributions
H.P. contributed to the design of experiments in this work. J.T. and J.W. conducted the experiments. L.L. and C.Y.
helped prepare the experimental materials. J.T. and H.P. analysed the data and prepared the manuscript. T.X.,
Y.W., T.C., J.W., Q.Z. and H.P. revised the manuscript. All authors reviewed and approved the manuscript.
Additional Information
Supplementary information accompanies this paper at https://doi.org/10.1038/s41598-017-15815-6.
Competing Interests: e authors declare that they have no competing interests.
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and
institutional aliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International
License, which permits use, sharing, adaptation, distribution and reproduction in any medium or
format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-
ative Commons license, and indicate if changes were made. e images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons license and your intended use is not per-
mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
© e Author(s) 2017
Content courtesy of Springer Nature, terms of use apply. Rights reserved

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com