ArticlePDF Available

Effects of Oleo Gum Resin of Ferula assa-foetida L. on Senescence in Human Dermal Fibroblasts: - Asafoetida reverses senescence in fibroblasts -

Authors:

Abstract and Figures

Objectives Based on data from Chinese and Indian traditional herbal medicines, gum resin of Ferula assa-foetida (sometimes referred to asafetida or asafoetida) has several therapeutic applications. The authors of various studies have claimed that asafetida has cytotoxic, antiulcer, anti-neoplasm, anti-cancer, and anti-oxidative effects. In present study, the anti-aging effect of asafetida on senescent human dermal fibroblasts was evaluated. Methods Senescence was induced in in vitro cultured human dermal fibroblasts (HDFs) through exposure to H2O2, and the incidence of senescence was recognized by using cytochemical staining for the activity of β-galactosidase. Then, treatment with oleo gum resin of asafetida was started to evaluate its rejuvenating effect. The survival rate of fibroblasts was evaluated by using methyl tetrazolium bromide (MTT) assays. Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blot assays were performed to evaluate the expressions of apoptotic and anti-apoptotic markers. Results Our experiments show that asafetida in concentrations ranging from 5 × 10⁻⁸ to 10⁻⁷ g/mL has revitalizing effects on senescent fibroblasts and significantly reduces the β-galactosidase activity in these cells (P < 0.05). Likewise, treatment at these concentrations increases the proliferation rate of normal fibroblasts (P < 0.05). However, at concentrations higher than 5 × 10⁻⁷ g/mL, asafetida is toxic for cells and induces cell death. Conclusion The results of this study indicate that asafetida at low concentrations has a rejuvenating effect on senescent fibroblasts whereas at higher concentrations, it has the opposite effect of facilitating cellular apoptosis and death.
Content may be subject to copyright.
Effects of Oleo Gum Resin of
Ferula assa-foetida
L. on Senescence in Human Dermal Fibroblasts
- Asafoetida reverses senescence in fibroblasts -
Farshad Homayouni Moghadam1, 3*, Mehrnaz Mesbah-Ardakani2, 3, Mohammad
Hossein Nasr-Esfahani1
Abstract
Objectives: Based on data from Chinese and Indian tra-
ditional herbal medicines, gum resin of Ferula assa-foet-
ida (sometimes referred to asafetida or asafoetida) has
several therapeutic applications. e authors of various
studies have claimed that asafetida has cytotoxic, anti-
ulcer, anti-neoplasm, anti-cancer, and anti-oxidative ef-
fects. In present study, the anti-aging eect of asafetida
on senescent human dermal broblasts was evaluated.
Methods: Senescence was induced in in vitro cultured
human dermal broblasts (HDFs) through exposure
to H2O2, and the incidence of senescence was recog-
nized by using cytochemical staining for the activity of
β
-galactosidase. en, treatment with oleo gum resin of
asafetida was started to evaluate its rejuvenating eect.
e survival rate of broblasts was evaluated by using
methyl tetrazolium bromide (MTT) assays. Real-time
quantitative reverse transcription-polymerase chain
reaction (qRT-PCR) and western blot assays were per-
formed to evaluate the expressions of apoptotic and
anti-apoptotic markers.
Results: Our experiments show that asafetida in con-
centrations ranging from 5 × 10-8 to 10-7 g/mL has
revitalizing eects on senescent broblasts and sig-
nicantly reduces the
β
-galactosidase activity in these
cells (P < 0.05). Likewise, treatment at these concentra-
tions increases the proliferation rate of normal brob-
lasts (P < 0.05). However, at concentrations higher than
5 × 10-7 g/mL, asafetida is toxic for cells and induces
cell death.
Conclusion: e results of this study indicate that asa-
fetida at low concentrations has a rejuvenating eect
on senescent broblasts whereas at higher concentra-
tions, it has the opposite eect of facilitating cellular
apoptosis and death.
1. Introduction
Consumption of medicinal herbs is growing and peo-
ple want to reduce the practice of using chemically
synthesized drugs [1, 2]. Despite this growing interest
for herbal medicine, our knowledge of their possible
benets or adverse side eects is not sucient [3]. Part
of this lack of information arises from the complexity
and the diversity of each plant's constituents, and the
other part is the fact that each constituent can exert
various eects on the body’s organs [2]. One such me-
dicinal herb is Ferula assa-foetida, which belongs to
the umbelliferae family of plants; several therapeutic
applications, such as anti-diabetic, anti-ulcer, aphro-
Original Article
Key Words
antioxidants, cell senescence, broblasts, oxidative
stress, rejuvenation
ISSN 2093-6966 [Print], ISSN 2234-6856 [Online]
Journal of Pharmacopuncture 2017;20[3]:213-219
DOI: https://doi.org/10.3831/KPI.2017.20.025
This is an Open-Access article distributed under the terms of the Creative Commons
Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/)
which permits unrestricted noncommercial use, distribution, and reproduction in any
medium, provided the original work is properly cited.
This paper meets the requirements of KS X ISO 9706, ISO 9706-1994 and ANSI/NISO
Z39.48-1992 (Permanence of Paper).
*Corresponding Author
Farshad Homayouni Moghadam. Department of Cellular Biotechnology at Cell Science
Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran & Neurobio-
medical Research Center, Shahid Sadoughi Yazd University of Medical Science, Yazd,
Iran.
Tel: +98-31-9501-5680 Fax: +98-31-9501-5687
E-mail: fhomayouni@royaninstitute.org
2017 Korean Pharmacopuncture Institute http://www.journal.ac
Received: Jul 30, 2017 Reviewed: Aug 28, 2017 Accepted: Sep 07, 2017
1 
DepartmentofCellularBiotechnologyatCellScienceResearchCenter,RoyanInstituteforBiotechnology,ACECR,Isfahan,Iran
2ImamHosseinHospitalofSepidan,ShirazUniversityofMedicalSciences,Shiraz,Iran
3NeurobiomedicalResearchCenter,ShahidSadoughiYazdUniversityofMedicalScience,Yazd,Iran
http://www.journal.ac
214
disiac, antiepileptic, anthelmintic, and antispasmodic ap-
plications, have been proposed for this herb [4]. e oleo-
gum-resin of Ferula assa-foetida is sometimes referred to
as asafetida or asafoetida, but for consistency asafetida will
be used throughout this paper.
A review of the compounds in asafetida shows that
some skin-friendly compounds, as well as some irritant
substances, are contained in its gum resin. One of these
skin-friendly compounds which has a known antioxida-
tive eect is ferulic acid (FA) [5]. Several reports about the
biological roles of FA have been published, and most are
about its antioxidative properties [6]. FA protects skin from
UV radiation by forming a resonance-stabilized phenoxy
radical and by preventing the activation of caspase in der-
mal broblasts [7-9]. It is a potent antioxidant and syner-
gizes the eects of ascorbic acid [10]; it also protects cells
from oxidative damage by neutralizing dierent species of
free radicals, such as hydroxyls, alkoxyls, peroxyls, nitric
oxide, peroxynitrites, and superoxides [10-17]. In addition
to these reported properties, some evidence exists regard-
ing the anti-mutagenicity of FA, indicating that it protects
cells from menadione-induced oxidative DNA damage;
its anti-carcinogenic eects have also been demonstrated
in animal models of pulmonary and colon cancers [18-
23]. In experiments regarding its dermal application, FA
decreased UVB-induced erythema, 12-O-tetradecanoyl-
phorbol-13-acetate (TPA)-induced ornithine decarboxyla-
se activity, and TPA-induced skin tumor formation [24, 25].
Apart from FA, some researchers have found that asafet-
ida contains some other ingredients that can cause or in-
hibit skin irritation. For example, it contains alpha pinene
with its reported anti-inammatory and analgesic eects
[26] and alpha terpineol with its reported anti-inamma-
tory and skin-irritating eects [27]. It also contains other
compounds, such as diallyl disulde, luteolin, and iso-
pimpinellin with their conrmed capabilities for the pre-
vention of chemically-induced skin tumor development
in mice [28-31], as well as Azulene [4], which is benecial
for the prevention of skin irritation and skin damage and is
widely used in cosmetic products [32].
Based on the above data, asafetida contains many com-
pounds that can aect skin cells, and most of them have
or may have therapeutic applications for skin problems
such as aging. Until now, to the best of our knowledge, no
report on the eect of asafetida extract on skin cells has
been reported. For that reason, we designed this study to
evaluate the eect of asafetida on normal and senescent
human dermal broblasts (HDFs). To evaluate the eect
of asafetida on HDFs, we used a reactive oxygen species
(ROS)-mediated model of senescence; consequently, we
selected, some important regulators of the ROS-mediated
apoptosis pathway, which are listed in Table 1, for further
analysis. BCL2, BAD and BAX are apoptosis regulators act-
ing on the mitochondrial membrane [33, 34], and p21 is
the main downstream regulator of p53-dependent cell cy-
cle arrest and senescence in response to DNA damage [35].
CASP3 was selected because its activation could be trig-
gered by both extrinsic (death ligand) and intrinsic (mito-
chondrial) pathways [36]. ALOX5 was selected so that we
could evaluate the inammatory responses of senescent
HDFs after treatment with asafetida [37].
Journal of Pharmacopuncture 2017;20(3):213-219
Table 1 List of the primers used for the real-time qRT-PCR assay
qRT-PCR, quantitative reverse transcription-polymerase chain reaction.
Gene Primer sequences GenBank
ACTB F: AGTTGCGTTACACCCTTTCTT NM_001101.3
R: CACCTTCACCGTTCCAGTTT
p21 F: GGTGTGTGCTGCGTTCA NM_001220778.1
R: AAGTTCCATCGCTCACGG
BAX F: CAGGGTGGTTGGGTGAGAC NM_001291430.1
R: TGAAGATGGGGAGAGGGCA
BAD F: CTCCACATCCCGAAACTCCA NM_032989.2
R: GTCAGCCCTCCCTCCAAAG
BCL2 F: TGTGTGGAGAGCGTCAACC NM_000633.2
R: CTTCAGAGACAGCCAGGAGAA
CASP3 F: GCCTGTAACTTGAGAGTAGATGGT NM_032991
R: TGCGTATGGAGAAATGGGCT
ALOX5 F: GACCTGACCTATGCCTCCCT NM_000698.3
R: GTCCTGATGGCTTCCCACAC
http://www.journal.ac 215
Journal of Pharmacopuncture 2017;20(3):213-219
2. Materials and Methods
Oleo-gum resin of Ferula assa-foetida L. (asafetida) was
prepared based on our previous study [38]. In our experi-
ments, we used a special, pure type of asafetida (Ashki
asafetida in local dialect) that, based on high perform-
ance liquid chromatography (HPLC) assays, has a higher
concentration of FA [38]. Briey, Oleo-gum resin was
collected in June from Ferula assa-foetida L. (Herbarium
code: P1006636, IBRC, Tehran, Iran) by making some
small incisions (1 - 5 cm) on its stem near to its roots, from
which high-quality oleo-gum resin (asafetida) could be
obtained. e collected asafetida was cut into small pieces
and placed under a hood until it had dried. For prepara-
tion of the asafetida solution, a specied amount (10 mg)
of dried asafetida was dissolved in 10 mL of distilled water
and ltered by using 0.02-um lters. Dierent volumes of
this asafetida solution were added to the culture media of
cells to obtain the nal treatment concentrations.
A HDF cell line (NCBI Code: C646, Pasteur Institute, Te-
hran, Iran), cell passage numbers 5 - 8, was used for cell as-
sessments. According to the manufacturer’s data, this cell
line was derived from the dermis of normal human neona-
tal foreskin and cryopreserved at the end of primary cul-
ture; a cell passage number less than 10 is safe and cytoge-
netically stable. Cells were cultured in DMEM medium
containing 10% FBS (2 × 104 cells/well of 24-well plates for
MTT and staining assays and 106 cells/well of 6-well plates
for real time qRT-PCR assays). e eects of asafetida on
normal and senescent HDFs were evaluated after 10 days
of treatment with dierent doses of asafetida (10-8, 5 × 10-8,
10-7, 5 × 10-7 and 10-6 g/mL).
ROS-mediated senescence was induced on HDFs by us-
ing hydrogen peroxide [39]. For this purpose, passage-four
HDFs were cultured in 24-well culture plates at a density of
2 × 104/well. e following day, the medium was replaced
with a medium containing 600-µM H2O2 (hydrogen perox-
ide), after which the plates were placed in a CO2 incubator
for 2 hours. Next, the medium was replaced with a normal
broblast medium (DMEM + 10% FBS). After the cells had
been incubated in the CO2 incubator for 24 hours, they
were exposed for the second time to 600-µM H2O2. Two
hours later, the medium was replaced with normal brob-
last medium containing dierent concentrations of asafet-
ida extract. e culture medium was changed every 3 days
while fresh asafetida was added to the medium daily for
10 days. e nal concentrations of asafetida were 0 (non-
treated, control), 10-8, 5 × 10-8, 10-7, 5 × 10-7, and 10-6 g/mL
of gum resin of asafetida dissolved in the culture medium.
Each treatment was repeated in four replicates.
After 10 days of treatment with asafetida, the density of
senescent cells was measured by staining the senescent
cells. Cell staining was performed by using Senescence
Cells Histochemical Staining Kits (Sigma, CS0030). e
assay is based on a cytochemical stain for
β
-galactosidase
activity at pH 6. After staining, 20 images with 40 x mag-
nication were captured from each treated group, and the
numbers of senescent cells were counted in each image.
Cell viability was measured using the 3-(4, 5-dimethyl-
2thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide (MTT,
Sigma) assay. is method is based on the mitochondrial
dehydrogenase activity of vivid cells in the culture dish.
For this purpose, cells belonging to each treatment group
were cultured in one 24-well culture dish; then, two days
after initiation of asafetida treatment, 50 µL of MTT (5 mg/
mL) were added to the culture medium, and the cells were
incubated for 4 hours. After that, the culture medium was
removed completely and replaced with 250 µL of DMSO.
e absorbance of each well was measured at 560 nm by
using a spectrophotometer, and the results were shown as
the percent of each group compared to the control group.
Real time PCR was performed on senescent HDFs to
measure the expression rates of the apoptotic markers
p21, BAX, BAD, and caspase 3 (CASP3), the antiapop-
totic marker BCL2, and an inammatory marker ALOX5
(Arachidonate 5-lipoxygenase).
β
-actin mRNA (ACTB)
was used as a housekeeping gene. e list of primers se-
quences is presented in Table 1. After isolation of total RNA
(Vivantis RNA isolation Kit), CDNAs were synthesized us-
ing MMLV Reverse Transcriptase and Oligo (dT) Primers
according to the manufacturer’s instructions (Vivantis,
Easy cDNA reverse transcription kit). For gene expression
analysis, relative quantitation PCR (qPCR) was performed
using SYBR-Green master mix (Qiagen) in a Qiagen Ro-
tor Gene 6000 system and software. e qPCR conditions
were 1 cycle of incubation in 94ºC for 10 min for denatura-
tion, and then DNA amplication was performed in 40 cy-
cles using 1 min in 53°C for annealing, 20 seconds in 72°C
for elongation, and 15 seconds in 95°C for denaturation.
e expression levels of these target genes in each sam-
ple were calculated by using the comparative Ct method
(2-ΔΔCt formula), after having been normalized by the Ct
value of the housekeeping gene in each group. All experi-
ments were repeated three times for each group.
For the Western blot analyses, cells were lysed on ice in
a lysis buer containing 20-mM Tris-HCl (pH 7.5), 150-
mM NaCl, 10-mM EDTA (pH 7.5), 1% Triton X-100, and
1% deoxycholate. en, the cell extracts were claried by
centrifugation, resolved on SDS-PAGE, and transferred
onto PVDF membranes (Millipore, USA). After having
been blocked with 5% BSA overnight at 4°C, the mem-
branes were incubated for 1.5 h at room temperature with
rabbit primary anti-BCL-2 antibody (Abcam, ab59348, 1
500) and mouse primary anti-GAPDH antibody (Abcam,
ab8245, 1 : 1000). Following three rinses (15 min each)
with PBS-Tween20 (0.05%), incubation with the peroxi-
dase (HRP)-conjugated goat anti-rabbit IgG H&L (Ab-
cam, ab205718, 1:2000) and goat anti mouse secondary
antibody (Abcam, ab97240, 12000) was performed for 2
hours at RT. After three washes with TBST, western blot-
ting chemiluminescence reagent (ermo Scientic, USA)
was used for protein detection. e relative intensities of
western blot bands were semi-quantied by using Image J
software. e relative band intensity for each protein was
normalized to glyceraldehyde 3-phosphate dehydroge-
nase (GAPDH).
Statistical analyses were performed using SPSS software.
Each experiment was repeated a minimum of three times,
and the data were expressed as means ± standard errors
of the mean (SEMs). Statistical dierences between the
groups were assessed by using the one-way analysis of
variance (ANOVA) followed by Tukey’s test. Statistical sig-
http://www.journal.ac
216
nicance was established at P < 0.05.
3. Results
e results of the MTT assays showed that treatments
with asafetida at concentrations of 5 × 10-8 and 10-7 g/mL
could increase the survival rates of normal and senescent
HDFs compared with the other groups (P < 0.05, Fig. 1A).
To evaluate the anti-aging eect of asafetida, we treated se-
nescent cells with dierent concentrations of asafetida for
10 days and then measured the density of senescent cells
by using
β
-galactosidase staining. e mean percentage of
senescent cells per total number of cells showed that the
numbers of senescent cells in the groups treated at con-
centration of 5 × 10-8 and 10-7 g/mL were signicantly low-
er than the numbers of such cells in the other groups (P <
0.05, Fig. 1). Our data also showed that asafetida was toxic
at higher concentrations (10-6 g/mL) and that it signi-
cantly reduced the survival rate of HDFs and subsequently
increased the number of senescent cells (P < 0.05, Fig. 1).
As shown in Fig. 2A, gene expression assays revealed
that treatments with 5 × 10-8 and 10-7 g/mL of asafetida in-
Figure 1 (A) MTT assay results in normal and senescent broblasts (*P < 0.05). (B) Eect of treatment with asafetida on human senes-
cent broblasts in percent of senescent cells/total number of cells counted in the images from each group (*P < 0.05). (C) Images of cells
after staining for
β
-galactosidase activity, with the blue color representing senescent cells: (a) control, (b) 10-8, (c) 5 × 10-8, (d) 10-7, (e) 5 ×
10-7, and (f) 10-6 g/mL of asafetida. Data are presented as means ± SEMs, and scale bars represent 100 µm.
MTT, methyl tetrazolium bromide; SEMs, standard errors of the mean.
Journal of Pharmacopuncture 2017;20(3):213-219
http://www.journal.ac 217
creased the expression of BCL2 (P < 0.01), but decreased
the expressions of p21, CASP3, BAX and BAD as compared
with the control group (P < 0.01 for p21 and CASP3; P <
0.05 for BAD and BAX). e expression level of ALOX5
revealed no change at these concentrations as compared
with the control group. Otherwise, for doses above 10-7 g/
mL, asafetida prompted apoptotic function, and the ex-
pression rate of anti-apoptotic BCL2 was signicantly de-
creased to very low levels as compared with the control
group (P < 0.05); however, the expressions of the apoptotic
inducer factors BAX, BAD, CASP3 and p21 were increased
(P < 0.05). e expression of ALOX5 was also increased, as
compared with the control group, in the groups that were
treated with higher doses of asafetida (P < 0.01). Results
of western blot analyses also conrmed an approximately
threefold increase in BCL2 protein expression in groups
treated at asafetida concentrations of 5 × 10-8 and 10-7 g/
mL as compared with the other groups (P < 0.01, Fig. 2B).
4. Discussion
In present study, we measured the eects of water solu-
ble parts of asafetida (gum resin of Ferula assa-foetida) on
human dermal broblasts. Asafetida has multiple compo-
nents, and among them, FA is a well-known compound
because of its anti-apoptotic eects. Plants of the ferula
species also have high amounts of sulde compounds and
rare concentrations of sesquiterpene coumarins and ter-
penes with anti-inammatory eects [40-42]. e results
of MTT and
β
-galactosidase staining assays showed that
treatments with low concentrations of asafetida could pro-
tect senescent HDFs from apoptosis. To evaluate this eect
at a molecular level, we performed real-time qRT-PCR and
western blot assays, and the results showed that treatment
with asafetida altered the expression rates of apoptotic
and anti-apoptotic markers in broblasts. Reductions in
the expressions of p21 (anti-proliferative and senescence-
inducing factor) [43], CASP3, BAX, and BAD (mediators of
programmed cell death), as well as surges in the expres-
sion of BCL2 (anti-apoptotic marker) [44], revealed that
asafetida had a potent anti-apoptotic eect. Furthermore,
the results of cell staining for beta-galactosidase activity
conrmed that these reductions of BAX and BAD (as posi-
tive regulators of cell apoptosis) and the increase in BCL2
eectively rejuvenated senescent broblasts.
Based on the recent ndings about the roles of 5-lipoxige-
nase (ALOX5, 5-LO) in the activation of pro-inammatory
pathways [37], we also evaluated the expression of ALOX5
in our experiments. When the treatment dosage of asa-
fetida was increased above 10-7 g/mL, the expression level
of ALOX5 was increased in cells, which revealed that asa-
fetida could activate pro-inammatory signals. In conr-
mation, one report indicated that topical administration
of asafetida could cause contact dermatitis in infants [45].
is skin-irritating eect of asafetida might be due to its
disulde-containing compounds [46]. us, this pro-in-
ammatory side eect of asafetida should be diminished
by reducing the concentration of its sulde compounds
through chemical processing or by combining it with
ALOX-5 inhibitory herbal supplements, such as an extract
of Tripterygium wilfordii [47].
e results of the present study demonstrate that asafetida
has both apoptotic and anti-apoptotic eects. In optimal
doses, it reverses senescence, but has the opposite eect at
higher concentrations. Moreover, toxic concentrations of
asafetida can be useful for skin exfoliation. Nevertheless,
further studies are needed to identify its ecacy in vivo.
5. Conclusion
e results of the present study revealed that asafetida
in low concentrations had an anti-senescence eect on
human dermal broblasts. is eect was due to its role
on enhancing the expression of the anti-apoptotic factor
BCL2.
Figure 2 (A) Expression levels of apoptotic and anti-apoptotic
mRNAs in asafetida-treated senescent cells. e expression of
BCL2 was increased in the groups treated with 5 × 10-8 and 10-7 g/
mL of asafetida compared with the control group (P < 0.01). Also,
in those groups, the expression rates of apoptotic markers were
signicantly reduced as compared with the control group while
in the groups treated with 5 × 10-7 and 10-6 g/mL of asafetida, the
expression rates of apoptotic markers were increased. (B) West-
ern blot assay for BCL2 protein in dierent groups (*P < 0.05 and
$P < 0.01, compared with the control group).
Journal of Pharmacopuncture 2017;20(3):213-219
http://www.journal.ac
218
Acknowledgment
is study was equally supported by the Neurobiomedi-
cal Research Center (NRC), Yazd, Iran, and Royan Insti-
tute, Tehran, Iran.
Conflict of interest
e authors declare that they have no conicts of interest.
ORCID
Farshad Homayouni Moghadam. http://orcid.org/0000-
0003-1748-9407.
References
Ekor M. e growing use of herbal medicines: issues re-
lating to adverse reactions and challenges in monitor-
ing safety. Front Pharmacol. 2013;4:177.
Pan SY, Litscher G, Gao SH, Zhou SF, Yu ZL, Chen HQ,
et al. Historical perspective of traditional indigenous
medical practices: the current renaissance and conser-
vation of herbal resources. Evid Based Complement Al-
ternat Med. 2014;2014:DOI: 10.1155/2014/525340.
Di Lorenzo C, Ceschi A, Kupferschmidt H, Lüde S, De
Souza Nascimento E, Dos Santos A, et al. Adverse ef-
fects of plant food supplements and botanical prepa-
rations: a systematic review with critical evaluation of
causality. Br J Clin Pharmacol. 2015;79(4):578-92.
Mahendra P, Bisht S. Ferula asafoetida: traditional
uses and pharmacological activity. Pharmacogn Rev.
2012;6(12):141-6.
Kareparamban JA, Nikam PH, Jadhav AP, Kadam VJ.
A validated high-performance liquid chromatog-
rahy method for estimation of ferulic acid in asafoet-
ida and polyherbal preparation. Indian J Pharm Sci.
2013;75(4):493-5.
Qiao Y, He H, Zhang Z, Liao Z, Yin D, Liu D, et al. Long-
term sodium ferulate supplementation scavenges oxy-
gen radicals and reverses liver damage induced by iron
overloading. Molecules. 2016;21(9):E1219.
Hahn HJ, Kim KB, Bae S, Choi BG, An S, Ahn KJ, et al.
Pretreatment of ferulic acid protects human dermal -
broblasts against ultraviolet a irradiation. Ann Derma-
tol. 2016;28(6):740-8.
Ouimet MA, Faig JJ, Yu W, Uhrich KE. Ferulic acid-
based polymers with glycol functionality as a versatile
platform for topical applications. Biomacromolecules.
2015;16(9):2911-9.
Graf E. Antioxidant potential of ferulic acid. Free Radic
Biol Med. 1992;13(4):435-48.
Trombino S, Serini S, Di Nicuolo F, Celleno L, Ando S,
Picci N, et al. Antioxidant eect of ferulic acid in isolat-
ed membranes and intact cells: synergistic interactions
with alpha-tocopherol, beta-carotene, and ascorbic
acid. J Agric Food Chem. 2004;52(8):2411-20.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Kikuzaki H, Hisamoto M, Hirose K, Akiyama K,
Taniguchi H. Antioxidant properties of ferulic acid
and its related compounds. J Agric Food Chem.
2002;50(7):2161-8.
Kaul A, Khanduja KL. Polyphenols inhibit promotional
phase of tumorigenesis: relevance of superoxide radi-
cals. Nutr Cancer.1998;32(2):81-5.
Hynes MJ, O'Coinceanainn M. e kinetics and mech-
anisms of reactions of iron(III) with caeic acid, chlo-
rogenic acid, sinapic acid, ferulic acid and naringin. J
Inorg Biochem. 2004;98(8):1457-64.
Wenk GL, McGann-Gramling K, Hauss-Wegrzyniak
B, Ronchetti D, Maucci R, Rosi S, et al. Attenuation of
chronic neuroinammation by a nitric oxide-releasing
derivative of the antioxidant ferulic acid. J Neurochem.
2004;89(2):484-93.
Ogiwara T, Satoh K, Kadoma Y, Murakami Y, Unten S,
Atsumi T, et al. Radical scavenging activity and cytotox-
icity of ferulic acid. Anticancer Res. 2002;22(5):2711-7.
Pannala AS, Razaq R, Halliwell B, Singh S, Rice-Evans
CA. Inhibition of peroxynitrite dependent tyrosine ni-
tration by hydroxycinnamates: nitration or electron do-
nation?. Free Radic Biol Med. 1998;24(4):594-606.
Dinis TC, Santosa CL, Almeida LM. e apoprotein is
the preferential target for peroxynitrite-induced LDL
damage protection by dietary phenolic acids. Free
Radic Res. 2002;36(5):531-43.
Yamada J, Tomita Y. Antimutagenic activity of caeic
acid and related compounds. Biosci Biotechnol Bio-
chem. 1996;60(2):328-9.
Ferguson LR, Lim IF, Pearson AE, Ralph J, Harris PJ.
Bacterial antimutagenesis by hydroxycinnamic acids
from plant cell walls. Mutat Res. 2003;542(1-2):49-58.
Lesca P. Protective eects of ellagic acid and other
plant phenols on benzo[a]pyrene-induced neoplasia
in mice. Carcinogenesis. 1983;4(12):1651-3.
Burdette JE, Chen SN, Lu ZZ, Xu H, White BE, Fabri-
cant DS, et al. Black cohosh (Cimicifuga racemosa L.)
protects against menadione-induced DNA damage
through scavenging of reactive oxygen species: bio-
assay-directed isolation and characterization of active
principles. J Agric Food Chem. 2002;50(24):7022-8.
Kawabata K, Yamamoto T, Hara A, Shimizu M, Yamada
Y, Matsunaga K, et al. Modifying eects of ferulic acid
on azoxymethane-induced colon carcinogenesis in
F344 rats. Cancer Lett. 2000;157(1):15-21.
Wargovich MJ, Jimenez A, McKee K, Steele VE, Velasco
M, Woods J, et al. Ecacy of potential chemopreventive
agents on rat colon aberrant crypt formation and pro-
gression. Carcinogenesis. 2000;21(6):1149-55.
Saija A, Tomaino A, Trombetta D, De Pasquale A, Uc-
cella N, Barbuzzi T, et al. In vitro and in vivo evaluation
of caeic and ferulic acids as topical photoprotective
agents. Int J Pharm. 2000;199(1):39-47.
Huang MT, Smart RC, Wong CQ, Conney AH. Inhibi-
tory eect of curcumin, chlorogenic acid, caeic acid,
and ferulic acid on tumor promotion in mouse skin by
12-O-tetradecanoylphorbol-13-acetate. Cancer Res.
1988;48(21):5941-6.
Gardin C, Piattelli A, Zavan B. Graphene in regenera-
tive medicine: focus on stem cells and neuronal dier-
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Journal of Pharmacopuncture 2017;20(3):213-219
http://www.journal.ac 219
entiation. Trends Biotechnol. 2016;34(6):435-7.
Mercier B, Prost J, Prost M. e essential oil of turpen-
tine and its major volatile fraction (alpha- and beta-
pinenes): a review. Int J Occup Med Environ Health.
2009;22(4):331-42.
Shan Y, Wei Z, Tao L, Wang S, Zhang F, Shen C, et al.
Prophylaxis of diallyl disulde on skin carcinogenic
model via p21-dependent Nrf2 stabilization. Sci Rep.
2016;6:35676.
Wang HC, Yang JH, Hsieh SC, Sheen LY. Allyl suldes
inhibit cell growth of skin cancer cells through induc-
tion of DNA damage mediated G2/M arrest and apop-
tosis. J Agric Food Chem. 2010;58(11):7096-103.
Palombo R, Savini I, Avigliano L, Madonna S, Cavani A,
Albanesi C, et al. Luteolin-7-glucoside inhibits IL-22/
STAT3 pathway, reducing proliferation, acanthosis, and
inammation in keratinocytes and in mouse psoriatic
model. Cell Death Dis. 2016;7(8):e2344.
Kleiner HE, Vulimiri SV, Starost MF, Reed MJ, DiGio-
vanni J. Oral administration of the citrus coumarin,
isopimpinellin, blocks DNA adduct formation and skin
tumor initiation by 7,12-dimethylbenz[a]anthracene in
SENCAR mice. Carcinogenesis. 2002;23(10):1667-75.
Ueki JI, Sakagami H, Wakabayashi H. Anti-UV activity
of newly-synthesized water-soluble azulenes. In vivo.
2013;27(1):119-26.
Hardwick JM, Soane L. Multiple functions of BCL-
2 family proteins. Cold Spring Harb Perspect Biol.
2013;5(2):DOI: 10.1101/cshperspect.a008722.
Chen L, Willis SN, Wei A, Smith BJ, Fletcher JI, Hinds
MG, et al. Dierential targeting of prosurvival Bcl-2
proteins by their BH3-only ligands allows complemen-
tary apoptotic function. Mol Cell. 2005;17(3):393-403.
Li T, Kon N, Jiang L, Tan M, Ludwig T, Zhao Y, et al.
Tumor suppression in the absence of p53-mediated
cell cycle arrest, apoptosis, and senescence. Cell.
2012;149(6):1269-83.
Salvesen GS. Caspases: opening the boxes and inter-
preting the arrows. Cell Death Dier. 2002;9(1):3-5.
Brogliato AR, Moor AN, Kesl SL, Guilherme RF, Georgii
JL, Peters-Golden M, et al. Critical role of 5-lipoxygen-
ase and heme oxygenase-1 in wound healing. J Invest
Dermatol. 2014;134(5):1436-45.
Homayouni Moghadam F, Dehghan M, Zarepur E,
Dehlavi R, Ghaseminia F, Ehsani S, et al. Oleo gum res-
in of Ferula assa-foetida L. ameliorates peripheral neu-
ropathy in mice. J Ethnopharmacol. 2014;154(1):183-9.
Chen JH, Stoeber K, Kingsbury S, Ozanne SE, Williams
GH, Hales CN. Loss of proliferative capacity and in-
duction of senescence in oxidatively stressed human
broblasts. J Biol Chem. 2004;279(47):49439-46.
Xing Y, Li N, Zhou D, Chen G, Jiao K, Wang W, et al. Ses-
quiterpene coumarins from ferula sinkiangensis act as
neuroinammation inhibitors. Planta Med. 2017;83(1-
02):135-42.
Asghari J, Atabaki V, Baher E, Mazaheritehrani M. Iden-
tication of sesquiterpene coumarins of oleo-gum res-
in of Ferula assa-foetida L. from the Yasuj region. Nat
Prod Res. 2016;30(3):350-3.
Znati M, Filali I, Jabrane A, Casanova J, Bouajila J, Ben
Jannet H. Chemical composition and in vitro evalu-
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
ation of antimicrobial, antioxidant and antigermina-
tive properties of the seed oil from the tunisian en-
demic ferula tunetana pomel ex batt. Chem Biodivers.
2017;14(1):DOI: 10.1002/cbdv.201600116.
Munoz-Espin D, Serrano M. Cellular senescence:
from physiology to pathology. Nat Rev Mol Cell Biol.
2014;15(7):482-96.
Wang LY, Tang ZJ, Han YZ. Neuroprotective eects of
caeic acid phenethyl ester against sevouranein-
duced neuronal degeneration in the hippocampus of
neonatal rats involve MAPK and PI3K/Akt signaling
pathways. Mol Med Rep. 2016;14(4):3403-12.
Tempark T, Chatproedprai S, Wananukul S. Localized
contact dermatitis from Ferula assa-foetida oleo-gum-
resin essential oil, a traditional topical preparation for
stomach ache and atulence. Indian J Dermatol Vener-
eol Leprol. 2016;82(4):467.
Hadavand Mirzaei H, Hasanloo T. Assessment of
chemical composition of essential oil of Ferula assa-
foetida oleo-gum-resin from two dierent sites of Yazd
province in center of Iran. Research Journal of Pharma-
cognosy. 2014;1(2):51-4.
Li RW, David Lin G, Myers SP, Leach DN. Anti-inam-
matory activity of Chinese medicinal vine plants. J Eth-
nopharmacol. 2003;85(1):61-7.
43.
44.
45.
46.
47.
Journal of Pharmacopuncture 2017;20(3):213-219
... Based on previous results, it seems that this inhibitory effect results from apoptosis initiation by Ferula assa-foetida's extract. Gene expression analysis on normal fibroblast has revealed Ferula assa-foetida's extract at high concentrations reduces Bcl-2 while upregulates the expression of Bax and Caspase-3 [31]. Our data also partially reflected the matter of concentration, as we observed a higher inhibitory effect at higher concentrations of Ferula assa-foetida's extract on MCF7 and PC12 cells which may be due to hormesis [32]. ...
... It was shown that lower concentrations of Oleo-gum resin from Ferula assa-foetida attenuated cellular senescence in normal human dermal fibroblasts while higher concentrations associated with the apoptosis initiation [31]. Also, Ferula assa-foetida extract increased the viability of cerebellar granule neurons of rats in lower concentrations [33]. ...
Article
Full-text available
Background: Ferula assa-foetida is a herbaceous plant of the Umbelliferae family having a broad spectrum of biological activities such as antiseptic, antibacterial, anti-inflammation, and, anti-tumor activity against a wide range of cancers. Among these features, antitumor activity has become more important in recent years and it still demands more investigations to address the underlying mechanisms. Purpose: This current study was conducted to evaluate the anti-proliferative effect of Ferula assa-foetida on PC12 and MCF7 cells as well as examining its mechanisms. Materials and Methods: Cells were cultured in DMEM medium with 10% fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. Cells incubated with different concentrations of the ethanolic extract of Ferula assa-foetida. Notably, cytotoxicity and apoptosis assay were measured by MTT and PI staining, respectively. Results: The MTT results showed that the ethanolic extract of Ferula assa-foetida in concentrations of 10, 7, 5, and 2.5 µM on both PC12 and MCF7 cells had a significant effect in cell viability and apoptosis induction in comparison to control group. Conclusion: In this study, it was determined that Ferula assa-fetida through the induction of apoptosis prevented the growth of PC12 and MCF7 cells and made a reduction in cell viability with different concentrations in a time-and dose-dependent manner. However, more studies are needed to reveal the mechanisms of Ferula assa-foetida's extract in apoptosis induction.
... Plant specimens with images of the type and collected herbarium specimens existing in the virtual herbaria like Edinburgh, Berlin, Kew, Vienna, etc. were compared; also scientific names of the identified species were conformed to IPNI (2012). Medicinal properties and bioactive compounds of plant species were indicated based on the literature review of 639 published papers (Al-Fattly, 2016;Azadmehr et al., 2014;Zargari, 1989Zargari, -1991Naghibi et al., 2005;Yazdanparast et al., 2008;Lakić et al., 2010;Pourmotabbed et al., 2010;Ibraheim et al., 2011;Bahrami et al., 2013;Raei et al., 2014;Hamzeloo-Moghadam et al., 2015;Moghadam et al., 2017;Wang et al., 2017;Bardaweel et al., 2018;Kadam et al., 2018;Kalantari et al., 2018;Jafarinia and Jafarinia, 2019). In the phytochemical papers, a variety of techniques were used for the extraction, isolation, and identification of chemical compounds such as Hydrodistillation (HD), Steam distillation (SD), and Solvent-free microwave extraction (SFME) methods, TLC chromatography, HPLC chromatography, Gas chromatography-mass spectrometry (GC-MS) and NMR spectroscopy. ...
Article
Full-text available
In the field of ethnopharmacology, precise identification of collected medicinal plants plays an important role to take a plant-derived compound from local traditional healers to the pharmacy. Therefore, this study is concerned with botanical research on medicinal plants of Semnan province (Iran). According to 379 collected herbarium specimens, 244 medicinal species belonging to 66 plant families and 102 genera were identified. The largest families were Lamiaceae (29 species), Asteraceae (27 species), and Fabaceae (19 species). The most frequently used plant organs were leaves and aerial parts. The most treated used category was the digestive system, followed by the metabolic and immune system, urological problems, respiratory system, gynecology, and dermatological problems. The outstanding therapeutic effects of some less widely known species which traditionally are used among indigenous people were reviewed. The fundamental role of botanists in pharmacological research and the disadvantages of wrong identifications in this field were highlighted.
... The oleo-gum-resin of F. assafoetida, as well as methanol extracts of different Ferula species, showed dose-dependent cytotoxic effects (25). Also, the cytotoxic function of gum resin of F. assafoetida on senescent fibroblasts, at concentrations above 5×10 -7 g/ ml, led to cell death, while at concentrations between 5×10 -8 and 10 -7 g/ml it showed revitalizing effects (26). ...
Article
Full-text available
Objective(s): Ferula is a genus of the family Apiaceae and it includes around 170 species of flowering plants mostly native to the Mediterranean region and eastern to central Asia. In Iran, Ferula spp. are widely used in cuisine and traditional medicine. This review discusses the anti-inflammatory, anti-oxidant, and immunomodulatory activities of different species of Ferula. Materials and Methods: To prepare the present review, Scopus, Google Scholar, PubMed, and Web of Science scientific databases were searched to retrieve relevant articles published from 1985 until December 2020. Results: Based on our literature review, Ferula plants and their derivatives decrease the levels of inflammatory mediators and exert anti-apoptotic effects. Under oxidative stress conditions, these plants and their constituents were shown to decrease oxidative markers such as malondialdehyde, reactive oxygen species, and nitric oxide but increase superoxide dismutase, glutathione peroxidase, catalase activity, and glutathione level. Ferula plants and their constituents also showed immunomodulatory effects by affecting various cytokines. Besides, in vivo and in vitro studies showed hypotensive, neuroprotective, memory-enhancing, anti-oxidant, hepatoprotective, antimicrobial, anticarcinogenic, anticytotoxic, antiobesity, and anthelmintic effects for various species of Ferula and their constituents. These plants also showed a healing effect on gynecological issues such as miscarriage, unusual pain, difficult menstruation, and leukorrhea. All these beneficial effects could have resulted from the anti-inflammatory, anti-oxidant, and immunomodulatory effects of these plants and their constituents. Conclusion: Based on the available literature, members of the genus Ferula can be regarded as potential therapeutics against inflammatory conditions, oxidative stress, and immune dysregulation.
... Another study, suggested that at low concentrations, Ferula assa-foetida has a rejuvenation effect in fibroblasts, while in higher concentrations, it facilitates cell apoptosis 12) . These findings indicate the dose-dependent effect of this medicinal herb on cellular functioning. ...
Article
Full-text available
Introduction: Previous studies have demonstrated cytotoxic effects of Ferula assa-foetida. In the present study, the anti-proliferative effect of this plant on two species of cancer cells related to pancreatic cancer (MIA PaCa-2) and ovarian cancer (SKOV-3) was investigated. Materials and Methods: 100 grams of powdered herb dissolved in 500 milliliter of methanol was placed in Soxhlet extractor for 72 hours. After adding trypsin to the medium, cells were cultured in serum containing medium. A serial dilution of extract was created with 25, 50, 100, 200 and 400 microgram per milliliter concentrations. Plates were fed with 200 microliters of new mediums at the end of their growth and 50 microliters of MTT were added to all wells of 1 to 11 columns. After incubation, mediums and MTT were removed from the wells and remaining crystals were resolved by adding DMSO. After adding glycine buffer (25 μl per well), we immediately read the results at wavelength of 570 nanometer using an ELISA reader. Results: Concentrations of 25, 50, 100, 200 and 400 micrograms per milliliter of methanolic extract of Ferula asa-foetida had significant cytotoxic effect on SKOV-3 and MIA PaCa-2 cancer cells with a P-Value of <0.05. These changes were time-dependent. Discussion and Conclusion: Besides their several medical uses, medicinal herbs have recently turned out to have antineoplastic effects. One of these herbs is Ferula assa-foetida. In the present study, we evaluated the anti-proliferative effects of this plant on ovarian and pancreatic cancer cells.
Chapter
Ferula asafoetida is a herbaceous plant that belongs to the Ferula genus of the Umbelliferae family. Plants of this genus are rich sources of natural products possessing multiple biological and pharmacological activities. The oleo-gum-resin asafoetida obtained from the rhizome and root of F. asafoetida is traditionally used as a digestive aid and in treating several diseases, including bronchitis, asthma, neurological disorders, and others. Besides its traditional uses, experiments have shown the antispasmodic, laxative, antioxidant, relaxant, hepatoprotective, neuroprotective, anticancer, and other pharmacological activities of asafoetida. Ferulic acid, coumarins, sesquiterpene coumarins, monosaccharides, polysaccharides, glycoproteins, monoterpenes, and other compounds are the main constituents of asafoetida. The present chapter presents an overview of asafoetida and its pharmacological activities.
Chapter
Herbs, Spices and Their Roles in Nutraceuticals and Functional Foods gives an overview of the many pharmacological activities associated with herbs and spices, including detailed coverage on their mechanisms and formulations for the food industry. Chapters focus on key ingredients such as Curcuma longa, Piper Nigrum and Trigonella foenum-graecum, with contributors across the globe providing the latest research and advances for each. This is an essential read for scientists who want to understand the fundamental mechanisms behind the bioactive compounds within herbs and spices. The numerous phytochemicals present in plant extracts have multiple pharmacological activities so there is extensive research into new bioactive compounds. The pharmacological activities of herbs and spices have been thoroughly investigated, and it is crucial that the latest research is organized into a comprehensive resource.
Article
Ovarian cancer was a common malignant tumor of female genital organs and accounted for 3.5% of new cases of female malignancy. Compared with normal ovarian cancer, β-gal activity in primary ovarian cancer was much higher. Moreover, β-gal played hypostatic roles in maintaining human biological systems. Therefore, it's of great significance to develop efficient detection methods for quantitative determination of β-gal activity. A new-type colorimetric and turn-on fluorescent probe called MC-βGal was designed for the specific detection of β-gal. MC-βGal was constructed based on merocyanine as a chromophore with ICT effect and D-galactose residues as a fluorescence-quenching and enzyme-responsive moiety. MC-βGal had the advantages of high sensitivity, superior selectivity, low limit of detection and a visible color change. In addition, low cytotoxicity and bioimaging experiments had demonstrated that MC-βGal successfully visual detects endogenous and exogenous β-gal in OVCAR-3 cells.
Article
Full-text available
Background Approximately 90%~99% of ultraviolet A (UVA) ray reaches the Earth's surface. The deeply penetrating UVA rays induce the formation of reactive oxygen species (ROS), which results in oxidative stress such as photoproducts, senescence, and cell death. Thus, UVA is considered a primary factor that promotes skin aging. Objective Researchers investigated whether pretreatment with ferulic acid protects human dermal fibroblasts (HDFs) against UVA-induced cell damages. Methods HDF proliferation was analyzed using the water-soluble tetrazolium salt assay. Cell cycle distribution and intracellular ROS levels were assessed by flow cytometric analysis. Senescence was evaluated using a senescence-associated β-galactosidase assay, while Gadd45α promoter activity was analyzed through a luciferase assay. The expression levels of superoxide dismutase 1 (SOD1), catalase (CAT), xeroderma pigmentosum complementation group A and C, matrix metalloproteinase 1 and 3, as well as p21 and p16 were measured using quantitative real-time polymerase chain reaction. Results Inhibition of proliferation and cell cycle arrest were detected in cells that were irradiated with UVA only. Pretreatment with ferulic acid significantly increased the proliferation and cell cycle progression in HDFs. Moreover, ferulic acid pretreatment produced antioxidant effects such as reduced DCF intensity, and affected SOD1 and CAT mRNA expression. These effects were also demonstrated in the analysis of cell senescence, promoter activity, expression of senescent markers, and DNA repair. Conclusion These results demonstrate that ferulic acid exerts protective effects on UVA-induced cell damages via anti-oxidant and stress-inducible cellular mechanisms in HDFs.
Article
Full-text available
Cancer prevention through intake of biologically active natural products appears to be an accessible way to reduce the risk of cancer. Diallyl disulfide (DADS), a major garlic derivative, has exhibited potential role in cancer therapy. The study is aimed to evaluate the prophylactic effect of DADS in chemically induced mouse skin carcinogenesis and investigate the molecular targets mediated by DADS. Two-stage chemically induced carcinogenesis model by cutaneous application of DMBA and subsequent TPA was established to study the prophylactic effect of DADS. As a result, we observed that DADS dose-dependently attenuated skin tumor incidence and multiplicity in the model mice, which was related to the up-regulation of a bunch of antioxidant enzymes activities and the nuclear accumulation of Nrf2. Furthermore, we developed skin carcinogenesis in Nrf2 knockout mice which could reverse the activity of DADS. Finally, we uncovered the underlying mechanism that DADS promoted the endogenous interaction between p21 and Nrf2, which was critical for impairing the Keap1-mediated degradation of Nrf2. Based on the results, we concluded that DADS was a promising cancer chemoprevention agent and suggested a garlic-rich diet might be beneficial to reduce the cancer risk in our daily life.
Article
Full-text available
Ferulic acid is a polyphenolic compound contained in various types of fruits and wheat bran. As a salt of the active ingredient, sodium ferulate (SF) has potent free radical scavenging activity and can effectively scavenge ROS. In this study, we examined the effect of SF on iron-overloaded mice in comparison to a standard antioxidant, taurine (TAU). We determined the protective role of SF against liver injury by examining liver-to-body ratio (%), transaminase and hepatocyte apoptosis in rats supplied with 10% dextrose intraperitoneal injection. In addition, antioxidative enzymes activities, ROS formation, mitochondrial swelling, and mitochondrial membrane potential (MMP) were all evaluated to clarify the mechanism of protective effect of SF associated with oxidative stress. After 15 weeks of SF treatment, we found a significant reduction in liver-to-body weight radio and elevation in both transaminase and hepatocyte apoptosis associated with iron-injected to levels comparable to those achieved with TAU. Both SF and TAU significantly attenuated the impaired liver function associated with iron-overloaded in mice, whereas neither showed any significant effect on the iron uptake. Furthermore, treatment with either SF or TAU in iron-overloaded mice attenuated oxidative stress, associated with elevated oxidant enzymes activities, decreased ROS production, prevented mitochondrial swelling and dissipation of MMP and then inhibited hepatic apoptosis. Taken together, the current study shows that, SF alleviated oxidative stress and liver damage associated with iron-overload conditions compared to the standard ROS scavenger (TAU), and potentially could encourage higher consumption and utilization as healthy and sustainable ingredients by the food and drink.
Article
Full-text available
The epidermis is a dynamic tissue in which keratinocytes proliferate in the basal layer and undergo a tightly controlled differentiation while moving into the suprabasal layers. The balance between keratinocyte proliferation, differentiation, and death is essential, and its perturbation can result in pathological changes. Some common skin diseases, such as psoriasis, are characterized by hyperproliferation accompanied by inflammatory reactions, suggesting that molecules with topical anti-inflammatory and ROS scavenging abilities may be useful for their treatment. Here we investigate the potential of the flavone Luteolin-7-glucoside (LUT-7G) as a treatment for psoriasis. We show that LUT-7G leads to a modification of the cell cycle and the induction of keratinocyte differentiation, with modification of energy, fatty acid, and redox metabolism. LUT-7G treatment also neutralizes the proliferative stimulus induced by the proinflammatory cytokines IL-22 and IL-6 in HEKn. Moreover, in the Imiquimod (IMQ) mouse model of psoriasis, topical administration of LUT-7G leads to a marked reduction of acanthosis and re-expression of epidermal differentiation markers. Dissection of the IL-22 signalling pathway, activated by IMQ treatment, demonstrates that LUT-7G impairs the nuclear translocation of phosphorylated (activated) STAT3, blocking the IL-22 signalling cascade. Thus LUT-7G appears to be a promising compound for the treatment of hyperproliferative and inflammatory skin diseases, such as psoriasis.
Article
Cellular senescence can result from short, dysfunctional telomeres, oxidative stress, or oncogene expression, and may contribute to aging. To investigate the role of cellular senescence in aging it is necessary to define the time-dependent molecular events by which it is characterized. Here we investigated changes in levels of key proteins involved in cell cycle regulation, DNA replication, and stress resistance in senescing human fibroblasts following oxidative stress. An immediate response in stressed cells was dephosphorylation of retinoblastoma (Rb) and cessation of DNA synthesis. This was followed by sequential induction of p53, p21, and p16. Increase in hypophosphorylated Rb and induction of p53 and p21 by a single stress treatment was transient, whereas sustained induction or dephosphorylation were achieved by a second stress. Down-regulation of the critical DNA replication initiation factor Cdc6 occurred early after stress concurring with p53 induction, and was followed by a decrease in Mcm2 levels. A late event in the stress-induced molecular sequence was the induction of SOD1, catalase, and HSP27 coinciding with development of the fully senescent phenotype. Our data suggest that loss of proliferative capacity in oxidatively stressed cells is a multistep process regulated by time-dependent molecular events that may play differential roles in induction and maintenance of cellular senescence.
Article
Essential oil of the seeds from the endemic Tunisian plant Ferula tunetana Pomel ex Batt. was analyzed for its chemical composition and screened for its antimicrobial, antioxidant and antigerminative properties. The chemical composition of the isolated oil is reported for the first time. According to the GC/FID, GC-MS and (13) C NMR analysis results; eighteen compounds were identified accounting for 84.6% of the total oil. The chemical composition of this essential oil was characterized by the presence of a high proportion of monoterpene hydrocarbons (77.3%) followed by oxygenated sesquiterpenes (4.1%) and sesquiterpene hydrocarbons (3.2%). α-Pinene (39.8%), β-pinene (11.5%) and (Z)-β-ocimene (7.5%) were the predominant compounds. Moreover, the isolated oil was tested for its antimicrobial activity using the disc-diffusion and the microdilution assays against six Gram-positive and five Gram-negative bacteria as well as towards two Candida species. The isolated oil was tested also for its antioxidant activity against (DPPH, ABTS, O2 (.) and H2 O2 ) and for its antigerminative potential. It was found that it exhibited interesting antimicrobial activity against Salmonella typhimurium LT2 DT104 (IZ= 16.2±1.0mm) and Bacillus cereus ATCC 14579 (IZ= 15.8±1.0 mm). However, it exerted a moderate antioxidant activity against H2 O2 (IC50 =78.2±2.98 μg/mL) and towards O2 (.) (IC50 = 89.2±3.82 μg/mL). The antigerminative effect of this oil was also evaluated in this work. Results showed a toxic effect. This article is protected by copyright. All rights reserved.
Article
Millions of infants and children are exposed to anesthesia every year during medical care. Sevoflurane is a volatile anesthetic that is frequently used for pediatric anesthesia. However, previous reports have suggested that the administration of sevoflurane promotes neurodegeneration, raising concerns regarding the safety of its usage. The present study aimed to investigate caffeic acid phenethyl ester (CAPE) and its protective effect against sevoflurane‑induced neurotoxicity in neonatal rats. Rat pups were administered with CAPE at 10, 20 or 40 mg/kg body weight from postnatal day 1 (P1) to P15. The P7 rats were exposed to sevoflurane (2.9%) for 6 h. Control group rats received no sevoflurane or CAPE. Neuronal apoptosis was determined by terminal deoxynucleotidyl transferase dUTP nick‑end labeling assay. The expression levels of caspases (caspase‑3, ‑8 and ‑9), apoptotic pathway proteins [Bcl‑2‑associated X protein (Bax), B cell CCL/lymphoma 2 (Bcl‑2), Bcl‑2‑like 1 (Bcl‑xL), Bcl‑2‑associated agonist of cell death (Bad) and phosphorylated (p)‑Bad], mitogen‑activated protein kinases (MAPK) signaling pathway proteins [c‑Jun N‑terminal kinase (JNK), p‑JNK, extracellular signal‑regulated kinase (ERK)1/2, p‑ERK1/2, p38, p‑p38 and p‑c‑Jun] and the phosphoinositide 3‑kinase (PI3K)/Akt cascade were evaluated by western blotting following sevoflurane and CAPE treatment. In addition, the expression of cleaved caspase‑3 was analyzed by immunohistochemistry. CAPE significantly reduced sevoflurane‑induced apoptosis, downregulated the expression levels of caspases and pro‑apoptotic proteins (Bax and Bad) and elevated the expression levels of Bcl‑2 and Bcl‑xL when compared with sevoflurane treatment. Furthermore, CAPE appeared to modify the expression levels of MAPKs and activate the PI3K/Akt signaling pathway. Thus, the present study demonstrated that CAPE effectively inhibited sevoflurane‑induced neuroapoptosis by modulating the expression and phosphorylation of apoptotic pathway proteins and MAPKs, and by regulating the PI3K/Akt pathway.
Article
Neuroinflammation mediated by microglia cells plays a critical role in the development of Alzheimer's disease. To identify novel natural neuroinflammation inhibitors, a bioactivity-guided phytochemical research was performed on the traditional Chinese medicine "Awei", that exhibited a significant inhibitory effect on nitric oxide production in over-activated microglia cells. The research identified sixteen bioactive sesquiterpene coumarins (two new and fourteen known ones) in the effective extract of Ferula sinkiangensis. Further, the anti-neuroinflammatory activities in BV-2 microglial cells were evaluated by monitoring LPS-induced nitric oxide production. In conclusion, the major constituent, (3'S, 5'S, 8'R, 9'S, 10'R)-kellerin (1.5 %, w/w), should be responsible for the anti-neuroinflammatory effect exhibited by Awei. Furthermore, it might be a potential natural therapeutic agent for Alzheimer's disease. The research indicated moreover, that its primary mechanism is the inhibition of mRNA expression of the inflammatory cytokines nitric oxide, tumor necrosis factor-α, cyclooxygenase-2, interleukin-6 and interleukin-1β. Georg Thieme Verlag KG Stuttgart · New York.