Effects of Oleo Gum Resin of Ferula assa-foetida L. on Senescence in Human Dermal Fibroblasts: - Asafoetida reverses senescence in fibroblasts -

Abstract

Objectives
Based on data from Chinese and Indian traditional herbal medicines, gum resin of Ferula assa-foetida (sometimes referred to asafetida or asafoetida) has several therapeutic applications. The authors of various studies have claimed that asafetida has cytotoxic, antiulcer, anti-neoplasm, anti-cancer, and anti-oxidative effects. In present study, the anti-aging effect of asafetida on senescent human dermal fibroblasts was evaluated.

Methods
Senescence was induced in in vitro cultured human dermal fibroblasts (HDFs) through exposure to H2O2, and the incidence of senescence was recognized by using cytochemical staining for the activity of β-galactosidase. Then, treatment with oleo gum resin of asafetida was started to evaluate its rejuvenating effect. The survival rate of fibroblasts was evaluated by using methyl tetrazolium bromide (MTT) assays. Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blot assays were performed to evaluate the expressions of apoptotic and anti-apoptotic markers.

Results
Our experiments show that asafetida in concentrations ranging from 5 × 10⁻⁸ to 10⁻⁷ g/mL has revitalizing effects on senescent fibroblasts and significantly reduces the β-galactosidase activity in these cells (P < 0.05). Likewise, treatment at these concentrations increases the proliferation rate of normal fibroblasts (P < 0.05). However, at concentrations higher than 5 × 10⁻⁷ g/mL, asafetida is toxic for cells and induces cell death.

Conclusion
The results of this study indicate that asafetida at low concentrations has a rejuvenating effect on senescent fibroblasts whereas at higher concentrations, it has the opposite effect of facilitating cellular apoptosis and death.

Full text

Effects of Oleo Gum Resin of
Ferula assa-foetida
L. on Senescence in Human Dermal Fibroblasts
- Asafoetida reverses senescence in fibroblasts -
Farshad Homayouni Moghadam1, 3*, Mehrnaz Mesbah-Ardakani2, 3, Mohammad
Hossein Nasr-Esfahani1
Abstract
Objectives: Based on data from Chinese and Indian tra-
ditional herbal medicines, gum resin of Ferula assa-foet-
ida (sometimes referred to asafetida or asafoetida) has
several therapeutic applications. e authors of various
studies have claimed that asafetida has cytotoxic, anti-
ulcer, anti-neoplasm, anti-cancer, and anti-oxidative ef-
fects. In present study, the anti-aging eect of asafetida
on senescent human dermal broblasts was evaluated.
Methods: Senescence was induced in in vitro cultured
human dermal broblasts (HDFs) through exposure
to H2O2, and the incidence of senescence was recog-
nized by using cytochemical staining for the activity of
β
-galactosidase. en, treatment with oleo gum resin of
asafetida was started to evaluate its rejuvenating eect.
e survival rate of broblasts was evaluated by using
methyl tetrazolium bromide (MTT) assays. Real-time
quantitative reverse transcription-polymerase chain
reaction (qRT-PCR) and western blot assays were per-
formed to evaluate the expressions of apoptotic and
anti-apoptotic markers.
Results: Our experiments show that asafetida in con-
centrations ranging from 5 × 10-8 to 10-7 g/mL has
revitalizing eects on senescent broblasts and sig-
nicantly reduces the
β
-galactosidase activity in these
cells (P < 0.05). Likewise, treatment at these concentra-
tions increases the proliferation rate of normal brob-
lasts (P < 0.05). However, at concentrations higher than
5 × 10-7 g/mL, asafetida is toxic for cells and induces
cell death.
Conclusion: e results of this study indicate that asa-
fetida at low concentrations has a rejuvenating eect
on senescent broblasts whereas at higher concentra-
tions, it has the opposite eect of facilitating cellular
apoptosis and death.
1. Introduction
Consumption of medicinal herbs is growing and peo-
ple want to reduce the practice of using chemically
synthesized drugs [1, 2]. Despite this growing interest
for herbal medicine, our knowledge of their possible
benets or adverse side eects is not sucient [3]. Part
of this lack of information arises from the complexity
and the diversity of each plant's constituents, and the
other part is the fact that each constituent can exert
various eects on the body’s organs [2]. One such me-
dicinal herb is Ferula assa-foetida, which belongs to
the umbelliferae family of plants; several therapeutic
applications, such as anti-diabetic, anti-ulcer, aphro-
Original Article
Key Words
antioxidants, cell senescence, broblasts, oxidative
stress, rejuvenation
ISSN 2093-6966 [Print], ISSN 2234-6856 [Online]
Journal of Pharmacopuncture 2017;20[3]:213-219
DOI: https://doi.org/10.3831/KPI.2017.20.025
This is an Open-Access article distributed under the terms of the Creative Commons
Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/)
which permits unrestricted noncommercial use, distribution, and reproduction in any
medium, provided the original work is properly cited.
This paper meets the requirements of KS X ISO 9706, ISO 9706-1994 and ANSI/NISO
Z39.48-1992 (Permanence of Paper).
*Corresponding Author
Farshad Homayouni Moghadam. Department of Cellular Biotechnology at Cell Science
Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran & Neurobio-
medical Research Center, Shahid Sadoughi Yazd University of Medical Science, Yazd,
Iran.
Tel: +98-31-9501-5680 Fax: +98-31-9501-5687
E-mail: fhomayouni@royaninstitute.org
ⓒ 2017 Korean Pharmacopuncture Institute http://www.journal.ac
Received: Jul 30, 2017 Reviewed: Aug 28, 2017 Accepted: Sep 07, 2017
1 
DepartmentofCellularBiotechnologyatCellScienceResearchCenter,RoyanInstituteforBiotechnology,ACECR,Isfahan,Iran
2ImamHosseinHospitalofSepidan,ShirazUniversityofMedicalSciences,Shiraz,Iran
3NeurobiomedicalResearchCenter,ShahidSadoughiYazdUniversityofMedicalScience,Yazd,Iran

http://www.journal.ac
214
disiac, antiepileptic, anthelmintic, and antispasmodic ap-
plications, have been proposed for this herb [4]. e oleo-
gum-resin of Ferula assa-foetida is sometimes referred to
as asafetida or asafoetida, but for consistency asafetida will
be used throughout this paper.
A review of the compounds in asafetida shows that
some skin-friendly compounds, as well as some irritant
substances, are contained in its gum resin. One of these
skin-friendly compounds which has a known antioxida-
tive eect is ferulic acid (FA) [5]. Several reports about the
biological roles of FA have been published, and most are
about its antioxidative properties [6]. FA protects skin from
UV radiation by forming a resonance-stabilized phenoxy
radical and by preventing the activation of caspase in der-
mal broblasts [7-9]. It is a potent antioxidant and syner-
gizes the eects of ascorbic acid [10]; it also protects cells
from oxidative damage by neutralizing dierent species of
free radicals, such as hydroxyls, alkoxyls, peroxyls, nitric
oxide, peroxynitrites, and superoxides [10-17]. In addition
to these reported properties, some evidence exists regard-
ing the anti-mutagenicity of FA, indicating that it protects
cells from menadione-induced oxidative DNA damage;
its anti-carcinogenic eects have also been demonstrated
in animal models of pulmonary and colon cancers [18-
23]. In experiments regarding its dermal application, FA
decreased UVB-induced erythema, 12-O-tetradecanoyl-
phorbol-13-acetate (TPA)-induced ornithine decarboxyla-
se activity, and TPA-induced skin tumor formation [24, 25].
Apart from FA, some researchers have found that asafet-
ida contains some other ingredients that can cause or in-
hibit skin irritation. For example, it contains alpha pinene
with its reported anti-inammatory and analgesic eects
[26] and alpha terpineol with its reported anti-inamma-
tory and skin-irritating eects [27]. It also contains other
compounds, such as diallyl disulde, luteolin, and iso-
pimpinellin with their conrmed capabilities for the pre-
vention of chemically-induced skin tumor development
in mice [28-31], as well as Azulene [4], which is benecial
for the prevention of skin irritation and skin damage and is
widely used in cosmetic products [32].
Based on the above data, asafetida contains many com-
pounds that can aect skin cells, and most of them have
or may have therapeutic applications for skin problems
such as aging. Until now, to the best of our knowledge, no
report on the eect of asafetida extract on skin cells has
been reported. For that reason, we designed this study to
evaluate the eect of asafetida on normal and senescent
human dermal broblasts (HDFs). To evaluate the eect
of asafetida on HDFs, we used a reactive oxygen species
(ROS)-mediated model of senescence; consequently, we
selected, some important regulators of the ROS-mediated
apoptosis pathway, which are listed in Table 1, for further
analysis. BCL2, BAD and BAX are apoptosis regulators act-
ing on the mitochondrial membrane [33, 34], and p21 is
the main downstream regulator of p53-dependent cell cy-
cle arrest and senescence in response to DNA damage [35].
CASP3 was selected because its activation could be trig-
gered by both extrinsic (death ligand) and intrinsic (mito-
chondrial) pathways [36]. ALOX5 was selected so that we
could evaluate the inammatory responses of senescent
HDFs after treatment with asafetida [37].
Journal of Pharmacopuncture 2017;20(3):213-219
Table 1 List of the primers used for the real-time qRT-PCR assay
qRT-PCR, quantitative reverse transcription-polymerase chain reaction.
Gene Primer sequences GenBank
ACTB F: AGTTGCGTTACACCCTTTCTT NM_001101.3
R: CACCTTCACCGTTCCAGTTT
p21 F: GGTGTGTGCTGCGTTCA NM_001220778.1
R: AAGTTCCATCGCTCACGG
BAX F: CAGGGTGGTTGGGTGAGAC NM_001291430.1
R: TGAAGATGGGGAGAGGGCA
BAD F: CTCCACATCCCGAAACTCCA NM_032989.2
R: GTCAGCCCTCCCTCCAAAG
BCL2 F: TGTGTGGAGAGCGTCAACC NM_000633.2
R: CTTCAGAGACAGCCAGGAGAA
CASP3 F: GCCTGTAACTTGAGAGTAGATGGT NM_032991
R: TGCGTATGGAGAAATGGGCT
ALOX5 F: GACCTGACCTATGCCTCCCT NM_000698.3
R: GTCCTGATGGCTTCCCACAC

http://www.journal.ac 215
Journal of Pharmacopuncture 2017;20(3):213-219
2. Materials and Methods
Oleo-gum resin of Ferula assa-foetida L. (asafetida) was
prepared based on our previous study [38]. In our experi-
ments, we used a special, pure type of asafetida (Ashki
asafetida in local dialect) that, based on high perform-
ance liquid chromatography (HPLC) assays, has a higher
concentration of FA [38]. Briey, Oleo-gum resin was
collected in June from Ferula assa-foetida L. (Herbarium
code: P1006636, IBRC, Tehran, Iran) by making some
small incisions (1 - 5 cm) on its stem near to its roots, from
which high-quality oleo-gum resin (asafetida) could be
obtained. e collected asafetida was cut into small pieces
and placed under a hood until it had dried. For prepara-
tion of the asafetida solution, a specied amount (10 mg)
of dried asafetida was dissolved in 10 mL of distilled water
and ltered by using 0.02-um lters. Dierent volumes of
this asafetida solution were added to the culture media of
cells to obtain the nal treatment concentrations.
A HDF cell line (NCBI Code: C646, Pasteur Institute, Te-
hran, Iran), cell passage numbers 5 - 8, was used for cell as-
sessments. According to the manufacturer’s data, this cell
line was derived from the dermis of normal human neona-
tal foreskin and cryopreserved at the end of primary cul-
ture; a cell passage number less than 10 is safe and cytoge-
netically stable. Cells were cultured in DMEM medium
containing 10% FBS (2 × 104 cells/well of 24-well plates for
MTT and staining assays and 106 cells/well of 6-well plates
for real time qRT-PCR assays). e eects of asafetida on
normal and senescent HDFs were evaluated after 10 days
of treatment with dierent doses of asafetida (10-8, 5 × 10-8,
10-7, 5 × 10-7 and 10-6 g/mL).
ROS-mediated senescence was induced on HDFs by us-
ing hydrogen peroxide [39]. For this purpose, passage-four
HDFs were cultured in 24-well culture plates at a density of
2 × 104/well. e following day, the medium was replaced
with a medium containing 600-µM H2O2 (hydrogen perox-
ide), after which the plates were placed in a CO2 incubator
for 2 hours. Next, the medium was replaced with a normal
broblast medium (DMEM + 10% FBS). After the cells had
been incubated in the CO2 incubator for 24 hours, they
were exposed for the second time to 600-µM H2O2. Two
hours later, the medium was replaced with normal brob-
last medium containing dierent concentrations of asafet-
ida extract. e culture medium was changed every 3 days
while fresh asafetida was added to the medium daily for
10 days. e nal concentrations of asafetida were 0 (non-
treated, control), 10-8, 5 × 10-8, 10-7, 5 × 10-7, and 10-6 g/mL
of gum resin of asafetida dissolved in the culture medium.
Each treatment was repeated in four replicates.
After 10 days of treatment with asafetida, the density of
senescent cells was measured by staining the senescent
cells. Cell staining was performed by using Senescence
Cells Histochemical Staining Kits (Sigma, CS0030). e
assay is based on a cytochemical stain for
β
-galactosidase
activity at pH 6. After staining, 20 images with 40 x mag-
nication were captured from each treated group, and the
numbers of senescent cells were counted in each image.
Cell viability was measured using the 3-(4, 5-dimethyl-
2thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide (MTT,
Sigma) assay. is method is based on the mitochondrial
dehydrogenase activity of vivid cells in the culture dish.
For this purpose, cells belonging to each treatment group
were cultured in one 24-well culture dish; then, two days
after initiation of asafetida treatment, 50 µL of MTT (5 mg/
mL) were added to the culture medium, and the cells were
incubated for 4 hours. After that, the culture medium was
removed completely and replaced with 250 µL of DMSO.
e absorbance of each well was measured at 560 nm by
using a spectrophotometer, and the results were shown as
the percent of each group compared to the control group.
Real time PCR was performed on senescent HDFs to
measure the expression rates of the apoptotic markers
p21, BAX, BAD, and caspase 3 (CASP3), the antiapop-
totic marker BCL2, and an inammatory marker ALOX5
(Arachidonate 5-lipoxygenase).
β
-actin mRNA (ACTB)
was used as a housekeeping gene. e list of primers se-
quences is presented in Table 1. After isolation of total RNA
(Vivantis RNA isolation Kit), CDNAs were synthesized us-
ing MMLV Reverse Transcriptase and Oligo (dT) Primers
according to the manufacturer’s instructions (Vivantis,
Easy cDNA reverse transcription kit). For gene expression
analysis, relative quantitation PCR (qPCR) was performed
using SYBR-Green master mix (Qiagen) in a Qiagen Ro-
tor Gene 6000 system and software. e qPCR conditions
were 1 cycle of incubation in 94ºC for 10 min for denatura-
tion, and then DNA amplication was performed in 40 cy-
cles using 1 min in 53°C for annealing, 20 seconds in 72°C
for elongation, and 15 seconds in 95°C for denaturation.
e expression levels of these target genes in each sam-
ple were calculated by using the comparative Ct method
(2-ΔΔCt formula), after having been normalized by the Ct
value of the housekeeping gene in each group. All experi-
ments were repeated three times for each group.
For the Western blot analyses, cells were lysed on ice in
a lysis buer containing 20-mM Tris-HCl (pH 7.5), 150-
mM NaCl, 10-mM EDTA (pH 7.5), 1% Triton X-100, and
1% deoxycholate. en, the cell extracts were claried by
centrifugation, resolved on SDS-PAGE, and transferred
onto PVDF membranes (Millipore, USA). After having
been blocked with 5% BSA overnight at 4°C, the mem-
branes were incubated for 1.5 h at room temperature with
rabbit primary anti-BCL-2 antibody (Abcam, ab59348, 1 ∶
500) and mouse primary anti-GAPDH antibody (Abcam,
ab8245, 1 : 1000). Following three rinses (15 min each)
with PBS-Tween20 (0.05%), incubation with the peroxi-
dase (HRP)-conjugated goat anti-rabbit IgG H&L (Ab-
cam, ab205718, 1:2000) and goat anti mouse secondary
antibody (Abcam, ab97240, 1∶2000) was performed for 2
hours at RT. After three washes with TBST, western blot-
ting chemiluminescence reagent (ermo Scientic, USA)
was used for protein detection. e relative intensities of
western blot bands were semi-quantied by using Image J
software. e relative band intensity for each protein was
normalized to glyceraldehyde 3-phosphate dehydroge-
nase (GAPDH).
Statistical analyses were performed using SPSS software.
Each experiment was repeated a minimum of three times,
and the data were expressed as means ± standard errors
of the mean (SEMs). Statistical dierences between the
groups were assessed by using the one-way analysis of
variance (ANOVA) followed by Tukey’s test. Statistical sig-

http://www.journal.ac
216
nicance was established at P < 0.05.
3. Results
e results of the MTT assays showed that treatments
with asafetida at concentrations of 5 × 10-8 and 10-7 g/mL
could increase the survival rates of normal and senescent
HDFs compared with the other groups (P < 0.05, Fig. 1A).
To evaluate the anti-aging eect of asafetida, we treated se-
nescent cells with dierent concentrations of asafetida for
10 days and then measured the density of senescent cells
by using
β
-galactosidase staining. e mean percentage of
senescent cells per total number of cells showed that the
numbers of senescent cells in the groups treated at con-
centration of 5 × 10-8 and 10-7 g/mL were signicantly low-
er than the numbers of such cells in the other groups (P <
0.05, Fig. 1). Our data also showed that asafetida was toxic
at higher concentrations (10-6 g/mL) and that it signi-
cantly reduced the survival rate of HDFs and subsequently
increased the number of senescent cells (P < 0.05, Fig. 1).
As shown in Fig. 2A, gene expression assays revealed
that treatments with 5 × 10-8 and 10-7 g/mL of asafetida in-
Figure 1 (A) MTT assay results in normal and senescent broblasts (*P < 0.05). (B) Eect of treatment with asafetida on human senes-
cent broblasts in percent of senescent cells/total number of cells counted in the images from each group (*P < 0.05). (C) Images of cells
after staining for
β
-galactosidase activity, with the blue color representing senescent cells: (a) control, (b) 10-8, (c) 5 × 10-8, (d) 10-7, (e) 5 ×
10-7, and (f) 10-6 g/mL of asafetida. Data are presented as means ± SEMs, and scale bars represent 100 µm.
MTT, methyl tetrazolium bromide; SEMs, standard errors of the mean.
Journal of Pharmacopuncture 2017;20(3):213-219

http://www.journal.ac 217
creased the expression of BCL2 (P < 0.01), but decreased
the expressions of p21, CASP3, BAX and BAD as compared
with the control group (P < 0.01 for p21 and CASP3; P <
0.05 for BAD and BAX). e expression level of ALOX5
revealed no change at these concentrations as compared
with the control group. Otherwise, for doses above 10-7 g/
mL, asafetida prompted apoptotic function, and the ex-
pression rate of anti-apoptotic BCL2 was signicantly de-
creased to very low levels as compared with the control
group (P < 0.05); however, the expressions of the apoptotic
inducer factors BAX, BAD, CASP3 and p21 were increased
(P < 0.05). e expression of ALOX5 was also increased, as
compared with the control group, in the groups that were
treated with higher doses of asafetida (P < 0.01). Results
of western blot analyses also conrmed an approximately
threefold increase in BCL2 protein expression in groups
treated at asafetida concentrations of 5 × 10-8 and 10-7 g/
mL as compared with the other groups (P < 0.01, Fig. 2B).
4. Discussion
In present study, we measured the eects of water solu-
ble parts of asafetida (gum resin of Ferula assa-foetida) on
human dermal broblasts. Asafetida has multiple compo-
nents, and among them, FA is a well-known compound
because of its anti-apoptotic eects. Plants of the ferula
species also have high amounts of sulde compounds and
rare concentrations of sesquiterpene coumarins and ter-
penes with anti-inammatory eects [40-42]. e results
of MTT and
β
-galactosidase staining assays showed that
treatments with low concentrations of asafetida could pro-
tect senescent HDFs from apoptosis. To evaluate this eect
at a molecular level, we performed real-time qRT-PCR and
western blot assays, and the results showed that treatment
with asafetida altered the expression rates of apoptotic
and anti-apoptotic markers in broblasts. Reductions in
the expressions of p21 (anti-proliferative and senescence-
inducing factor) [43], CASP3, BAX, and BAD (mediators of
programmed cell death), as well as surges in the expres-
sion of BCL2 (anti-apoptotic marker) [44], revealed that
asafetida had a potent anti-apoptotic eect. Furthermore,
the results of cell staining for beta-galactosidase activity
conrmed that these reductions of BAX and BAD (as posi-
tive regulators of cell apoptosis) and the increase in BCL2
eectively rejuvenated senescent broblasts.
Based on the recent ndings about the roles of 5-lipoxige-
nase (ALOX5, 5-LO) in the activation of pro-inammatory
pathways [37], we also evaluated the expression of ALOX5
in our experiments. When the treatment dosage of asa-
fetida was increased above 10-7 g/mL, the expression level
of ALOX5 was increased in cells, which revealed that asa-
fetida could activate pro-inammatory signals. In conr-
mation, one report indicated that topical administration
of asafetida could cause contact dermatitis in infants [45].
is skin-irritating eect of asafetida might be due to its
disulde-containing compounds [46]. us, this pro-in-
ammatory side eect of asafetida should be diminished
by reducing the concentration of its sulde compounds
through chemical processing or by combining it with
ALOX-5 inhibitory herbal supplements, such as an extract
of Tripterygium wilfordii [47].
e results of the present study demonstrate that asafetida
has both apoptotic and anti-apoptotic eects. In optimal
doses, it reverses senescence, but has the opposite eect at
higher concentrations. Moreover, toxic concentrations of
asafetida can be useful for skin exfoliation. Nevertheless,
further studies are needed to identify its ecacy in vivo.
5. Conclusion
e results of the present study revealed that asafetida
in low concentrations had an anti-senescence eect on
human dermal broblasts. is eect was due to its role
on enhancing the expression of the anti-apoptotic factor
BCL2.
Figure 2 (A) Expression levels of apoptotic and anti-apoptotic
mRNAs in asafetida-treated senescent cells. e expression of
BCL2 was increased in the groups treated with 5 × 10-8 and 10-7 g/
mL of asafetida compared with the control group (P < 0.01). Also,
in those groups, the expression rates of apoptotic markers were
signicantly reduced as compared with the control group while
in the groups treated with 5 × 10-7 and 10-6 g/mL of asafetida, the
expression rates of apoptotic markers were increased. (B) West-
ern blot assay for BCL2 protein in dierent groups (*P < 0.05 and
$P < 0.01, compared with the control group).
Journal of Pharmacopuncture 2017;20(3):213-219

http://www.journal.ac
218
Acknowledgment
is study was equally supported by the Neurobiomedi-
cal Research Center (NRC), Yazd, Iran, and Royan Insti-
tute, Tehran, Iran.
Conflict of interest
e authors declare that they have no conicts of interest.
ORCID
Farshad Homayouni Moghadam. http://orcid.org/0000-
0003-1748-9407.
References
Ekor M. e growing use of herbal medicines: issues re-
lating to adverse reactions and challenges in monitor-
ing safety. Front Pharmacol. 2013;4:177.
Pan SY, Litscher G, Gao SH, Zhou SF, Yu ZL, Chen HQ,
et al. Historical perspective of traditional indigenous
medical practices: the current renaissance and conser-
vation of herbal resources. Evid Based Complement Al-
ternat Med. 2014;2014:DOI: 10.1155/2014/525340.
Di Lorenzo C, Ceschi A, Kupferschmidt H, Lüde S, De
Souza Nascimento E, Dos Santos A, et al. Adverse ef-
fects of plant food supplements and botanical prepa-
rations: a systematic review with critical evaluation of
causality. Br J Clin Pharmacol. 2015;79(4):578-92.
Mahendra P, Bisht S. Ferula asafoetida: traditional
uses and pharmacological activity. Pharmacogn Rev.
2012;6(12):141-6.
Kareparamban JA, Nikam PH, Jadhav AP, Kadam VJ.
A validated high-performance liquid chromatog-
rahy method for estimation of ferulic acid in asafoet-
ida and polyherbal preparation. Indian J Pharm Sci.
2013;75(4):493-5.
Qiao Y, He H, Zhang Z, Liao Z, Yin D, Liu D, et al. Long-
term sodium ferulate supplementation scavenges oxy-
gen radicals and reverses liver damage induced by iron
overloading. Molecules. 2016;21(9):E1219.
Hahn HJ, Kim KB, Bae S, Choi BG, An S, Ahn KJ, et al.
Pretreatment of ferulic acid protects human dermal -
broblasts against ultraviolet a irradiation. Ann Derma-
tol. 2016;28(6):740-8.
Ouimet MA, Faig JJ, Yu W, Uhrich KE. Ferulic acid-
based polymers with glycol functionality as a versatile
platform for topical applications. Biomacromolecules.
2015;16(9):2911-9.
Graf E. Antioxidant potential of ferulic acid. Free Radic
Biol Med. 1992;13(4):435-48.
Trombino S, Serini S, Di Nicuolo F, Celleno L, Ando S,
Picci N, et al. Antioxidant eect of ferulic acid in isolat-
ed membranes and intact cells: synergistic interactions
with alpha-tocopherol, beta-carotene, and ascorbic
acid. J Agric Food Chem. 2004;52(8):2411-20.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Kikuzaki H, Hisamoto M, Hirose K, Akiyama K,
Taniguchi H. Antioxidant properties of ferulic acid
and its related compounds. J Agric Food Chem.
2002;50(7):2161-8.
Kaul A, Khanduja KL. Polyphenols inhibit promotional
phase of tumorigenesis: relevance of superoxide radi-
cals. Nutr Cancer.1998;32(2):81-5.
Hynes MJ, O'Coinceanainn M. e kinetics and mech-
anisms of reactions of iron(III) with caeic acid, chlo-
rogenic acid, sinapic acid, ferulic acid and naringin. J
Inorg Biochem. 2004;98(8):1457-64.
Wenk GL, McGann-Gramling K, Hauss-Wegrzyniak
B, Ronchetti D, Maucci R, Rosi S, et al. Attenuation of
chronic neuroinammation by a nitric oxide-releasing
derivative of the antioxidant ferulic acid. J Neurochem.
2004;89(2):484-93.
Ogiwara T, Satoh K, Kadoma Y, Murakami Y, Unten S,
Atsumi T, et al. Radical scavenging activity and cytotox-
icity of ferulic acid. Anticancer Res. 2002;22(5):2711-7.
Pannala AS, Razaq R, Halliwell B, Singh S, Rice-Evans
CA. Inhibition of peroxynitrite dependent tyrosine ni-
tration by hydroxycinnamates: nitration or electron do-
nation?. Free Radic Biol Med. 1998;24(4):594-606.
Dinis TC, Santosa CL, Almeida LM. e apoprotein is
the preferential target for peroxynitrite-induced LDL
damage protection by dietary phenolic acids. Free
Radic Res. 2002;36(5):531-43.
Yamada J, Tomita Y. Antimutagenic activity of caeic
acid and related compounds. Biosci Biotechnol Bio-
chem. 1996;60(2):328-9.
Ferguson LR, Lim IF, Pearson AE, Ralph J, Harris PJ.
Bacterial antimutagenesis by hydroxycinnamic acids
from plant cell walls. Mutat Res. 2003;542(1-2):49-58.
Lesca P. Protective eects of ellagic acid and other
plant phenols on benzo[a]pyrene-induced neoplasia
in mice. Carcinogenesis. 1983;4(12):1651-3.
Burdette JE, Chen SN, Lu ZZ, Xu H, White BE, Fabri-
cant DS, et al. Black cohosh (Cimicifuga racemosa L.)
protects against menadione-induced DNA damage
through scavenging of reactive oxygen species: bio-
assay-directed isolation and characterization of active
principles. J Agric Food Chem. 2002;50(24):7022-8.
Kawabata K, Yamamoto T, Hara A, Shimizu M, Yamada
Y, Matsunaga K, et al. Modifying eects of ferulic acid
on azoxymethane-induced colon carcinogenesis in
F344 rats. Cancer Lett. 2000;157(1):15-21.
Wargovich MJ, Jimenez A, McKee K, Steele VE, Velasco
M, Woods J, et al. Ecacy of potential chemopreventive
agents on rat colon aberrant crypt formation and pro-
gression. Carcinogenesis. 2000;21(6):1149-55.
Saija A, Tomaino A, Trombetta D, De Pasquale A, Uc-
cella N, Barbuzzi T, et al. In vitro and in vivo evaluation
of caeic and ferulic acids as topical photoprotective
agents. Int J Pharm. 2000;199(1):39-47.
Huang MT, Smart RC, Wong CQ, Conney AH. Inhibi-
tory eect of curcumin, chlorogenic acid, caeic acid,
and ferulic acid on tumor promotion in mouse skin by
12-O-tetradecanoylphorbol-13-acetate. Cancer Res.
1988;48(21):5941-6.
Gardin C, Piattelli A, Zavan B. Graphene in regenera-
tive medicine: focus on stem cells and neuronal dier-
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Journal of Pharmacopuncture 2017;20(3):213-219

http://www.journal.ac 219
entiation. Trends Biotechnol. 2016;34(6):435-7.
Mercier B, Prost J, Prost M. e essential oil of turpen-
tine and its major volatile fraction (alpha- and beta-
pinenes): a review. Int J Occup Med Environ Health.
2009;22(4):331-42.
Shan Y, Wei Z, Tao L, Wang S, Zhang F, Shen C, et al.
Prophylaxis of diallyl disulde on skin carcinogenic
model via p21-dependent Nrf2 stabilization. Sci Rep.
2016;6:35676.
Wang HC, Yang JH, Hsieh SC, Sheen LY. Allyl suldes
inhibit cell growth of skin cancer cells through induc-
tion of DNA damage mediated G2/M arrest and apop-
tosis. J Agric Food Chem. 2010;58(11):7096-103.
Palombo R, Savini I, Avigliano L, Madonna S, Cavani A,
Albanesi C, et al. Luteolin-7-glucoside inhibits IL-22/
STAT3 pathway, reducing proliferation, acanthosis, and
inammation in keratinocytes and in mouse psoriatic
model. Cell Death Dis. 2016;7(8):e2344.
Kleiner HE, Vulimiri SV, Starost MF, Reed MJ, DiGio-
vanni J. Oral administration of the citrus coumarin,
isopimpinellin, blocks DNA adduct formation and skin
tumor initiation by 7,12-dimethylbenz[a]anthracene in
SENCAR mice. Carcinogenesis. 2002;23(10):1667-75.
Ueki JI, Sakagami H, Wakabayashi H. Anti-UV activity
of newly-synthesized water-soluble azulenes. In vivo.
2013;27(1):119-26.
Hardwick JM, Soane L. Multiple functions of BCL-
2 family proteins. Cold Spring Harb Perspect Biol.
2013;5(2):DOI: 10.1101/cshperspect.a008722.
Chen L, Willis SN, Wei A, Smith BJ, Fletcher JI, Hinds
MG, et al. Dierential targeting of prosurvival Bcl-2
proteins by their BH3-only ligands allows complemen-
tary apoptotic function. Mol Cell. 2005;17(3):393-403.
Li T, Kon N, Jiang L, Tan M, Ludwig T, Zhao Y, et al.
Tumor suppression in the absence of p53-mediated
cell cycle arrest, apoptosis, and senescence. Cell.
2012;149(6):1269-83.
Salvesen GS. Caspases: opening the boxes and inter-
preting the arrows. Cell Death Dier. 2002;9(1):3-5.
Brogliato AR, Moor AN, Kesl SL, Guilherme RF, Georgii
JL, Peters-Golden M, et al. Critical role of 5-lipoxygen-
ase and heme oxygenase-1 in wound healing. J Invest
Dermatol. 2014;134(5):1436-45.
Homayouni Moghadam F, Dehghan M, Zarepur E,
Dehlavi R, Ghaseminia F, Ehsani S, et al. Oleo gum res-
in of Ferula assa-foetida L. ameliorates peripheral neu-
ropathy in mice. J Ethnopharmacol. 2014;154(1):183-9.
Chen JH, Stoeber K, Kingsbury S, Ozanne SE, Williams
GH, Hales CN. Loss of proliferative capacity and in-
duction of senescence in oxidatively stressed human
broblasts. J Biol Chem. 2004;279(47):49439-46.
Xing Y, Li N, Zhou D, Chen G, Jiao K, Wang W, et al. Ses-
quiterpene coumarins from ferula sinkiangensis act as
neuroinammation inhibitors. Planta Med. 2017;83(1-
02):135-42.
Asghari J, Atabaki V, Baher E, Mazaheritehrani M. Iden-
tication of sesquiterpene coumarins of oleo-gum res-
in of Ferula assa-foetida L. from the Yasuj region. Nat
Prod Res. 2016;30(3):350-3.
Znati M, Filali I, Jabrane A, Casanova J, Bouajila J, Ben
Jannet H. Chemical composition and in vitro evalu-
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
ation of antimicrobial, antioxidant and antigermina-
tive properties of the seed oil from the tunisian en-
demic ferula tunetana pomel ex batt. Chem Biodivers.
2017;14(1):DOI: 10.1002/cbdv.201600116.
Munoz-Espin D, Serrano M. Cellular senescence:
from physiology to pathology. Nat Rev Mol Cell Biol.
2014;15(7):482-96.
Wang LY, Tang ZJ, Han YZ. Neuroprotective eects of
caeic acid phenethyl ester against sevouranein-
duced neuronal degeneration in the hippocampus of
neonatal rats involve MAPK and PI3K/Akt signaling
pathways. Mol Med Rep. 2016;14(4):3403-12.
Tempark T, Chatproedprai S, Wananukul S. Localized
contact dermatitis from Ferula assa-foetida oleo-gum-
resin essential oil, a traditional topical preparation for
stomach ache and atulence. Indian J Dermatol Vener-
eol Leprol. 2016;82(4):467.
Hadavand Mirzaei H, Hasanloo T. Assessment of
chemical composition of essential oil of Ferula assa-
foetida oleo-gum-resin from two dierent sites of Yazd
province in center of Iran. Research Journal of Pharma-
cognosy. 2014;1(2):51-4.
Li RW, David Lin G, Myers SP, Leach DN. Anti-inam-
matory activity of Chinese medicinal vine plants. J Eth-
nopharmacol. 2003;85(1):61-7.
43.
44.
45.
46.
47.
Journal of Pharmacopuncture 2017;20(3):213-219