Molecular detection of Bartonella spp. in deer ked (Lipoptena cervi) in Poland

Abstract

Background
The bacteria of the genus Bartonella are obligate parasites of vertebrates. Their distribution range covers almost the entire world from America, Europe, Asia to Africa and Australia. Some species of Bartonella are pathogenic for humans. Their main vectors are blood-sucking arthropods such as fleas, ticks and blood-feeding flies. One such dipteran able to transfer vector-borne pathogens is the deer ked (Lipoptena cervi) of the family Hippoboscidae. This species acts as a transmitter of Bartonella spp. in cervid hosts in Europe.

Methods
In the present study, 217 specimens of deer ked (Lipoptena cervi) were collected from 26 red deer (Cervus elaphus) hunted in January 2014. A short fragment (333 bp) of the rpoB gene was used as a marker to identify Bartonella spp. in deer ked tissue by PCR test. A longer fragment (850 bp) of the rpoB gene was amplified from 21 of the positive samples, sequenced and used for phylogenetic analysis.

Results
The overall prevalence of Lipoptena cervi infection with Bartonella spp. was 75.12% (163/217); 86.67% (104/120) of females and 60.82% (59/97) of males collected from red deer hunted in the Strzałowo Forest District in Poland (53°45′57.03″N, 21°25′17.79″E) were infected. The nucleotide sequences from 14 isolates (Bartonella sp. 1) showed close similarity to Bartonella schoenbuchensis isolated from moose blood from Sweden (GenBank: KB915628) and human blood from France (GenBank: HG977196); Bartonella sp. 2 (5 isolates) and Bartonella sp. 3 (one isolate) were similar to Bartonella sp. from Japanese sika deer (GenBank: AB703149), and Bartonella sp. 4 (one isolate) was almost identical to Bartonella sp. isolated from Japanese sika deer from Japan (GenBank: AB703146).

Conclusions
To the best of our knowledge, this is the first report to confirm the presence of Bartonella spp. in deer keds (Lipoptena cervi) in Poland by molecular methods. Bartonella sp. 1 isolates were most closely related to B. schoenbuchensis isolated from moose from Sweden and human blood from France. The rest of our isolates (Bartonella spp. 2–4) were similar to Bartonella spp. isolated from Japanese sika deer from Japan.

Electronic supplementary material
The online version of this article (10.1186/s13071-017-2413-0) contains supplementary material, which is available to authorized users.

Full text

R E S E A R C H Open Access
Molecular detection of Bartonella spp. in
deer ked (Lipoptena cervi) in Poland
Tomasz Szewczyk
*
, Joanna Werszko, Żaneta Steiner-Bogdaszewska, Witold Jeżewski, Zdzisław Laskowski
and Grzegorz Karbowiak
Abstract
Background: The bacteria of the genus Bartonella are obligate parasites of vertebrates. Their distribution range
covers almost the entire world from America, Europe, Asia to Africa and Australia. Some species of Bartonella are
pathogenic for humans. Their main vectors are blood-sucking arthropods such as fleas, ticks and blood-feeding flies.
One such dipteran able to transfer vector-borne pathogens is the deer ked (Lipoptena cervi) of the family
Hippoboscidae. This species acts as a transmitter of Bartonella spp. in cervid hosts in Europe.
Methods: In the present study, 217 specimens of deer ked (Lipoptena cervi) were collected from 26 red deer
(Cervus elaphus) hunted in January 2014. A short fragment (333 bp) of the rpoB gene was used as a marker to
identify Bartonella spp. in deer ked tissue by PCR test. A longer fragment (850 bp) of the rpoB gene was amplified
from 21 of the positive samples, sequenced and used for phylogenetic analysis.
Results: The overall prevalence of Lipoptena cervi infection with Bartonella spp. was 75.12% (163/217); 86.67% (104/
120) of females and 60.82% (59/97) of males collected from red deer hunted in the Strzałowo Forest District in
Poland (53°45′57.03″N, 21°25′17.79″E) were infected. The nucleotide sequences from 14 isolates (Bartonella sp. 1)
showed close similarity to Bartonella schoenbuchensis isolated from moose blood from Sweden (GenBank: KB915628)
and human blood from France (GenBank: HG977196); Bartonella sp. 2 (5 isolates) and Bartonella sp. 3 (one isolate) were
similar to Bartonella sp. from Japanese sika deer (GenBank: AB703149), and Bartonella sp. 4 (one isolate) was almost
identical to Bartonella sp. isolated from Japanese sika deer from Japan (GenBank: AB703146).
Conclusions: To the best of our knowledge, this is the first report to confirm the presence of Bartonella spp. in deer keds
(Lipoptena cervi) in Poland by molecular methods. Bartonella sp. 1 isolates were most closely related to B. schoenbuchensis
isolated from moose from Sweden and human blood from France. The rest of our isolates (Bartonella spp. 2–4) were
similar to Bartonella spp. isolated from Japanese sika deer from Japan.
Keywords: Bartonella spp., Bartonella schoenbuchensis,Lipoptena cervi,Cervus elaphus
Background
The genus Bartonella comprises small, Gram-negative
bacteria which act as obligate intracellular parasites of
vertebrates. About 30 species, as well as three subspe-
cies, have been described [1]. The zoonotic reservoir for
some Bartonella species (B. schoenbuchensis,B.bacili-
formis and B.quintana), is composed of wild mammals,
which usually only possess asymptomatic bacteraemia.
The prevalence of bacteremia in wild animals is often
very high, ranging from 50 to 95% in selected rodent
and ruminant populations [2, 3] and strongly depends
on the season [3]. As the reservoir hosts include a wide
range of wild mammals, including typically ruminants,
rodents and carnivores, the infections are easily spread
and have been noted all over the world [2]. A good ex-
ample is that of ruminant infections: Bartonella infec-
tion has been recorded in cattle in three different
countries (Thailand, Guatemala and Georgia) and in buf-
falo (Bubalus bubalis) from Thailand [4]. The prevalence
of Bartonella infection in these regions varies between
10 and 90%. Similar investigations in Japan found no in-
fection in cattle, but recorded a prevalence of Bartonella
* Correspondence: t.szewczyk86@gmail.com
Witold Stefański Institute of Parasitology, Polish Academy of Sciences, Twarda
51/55, 00-818 Warsaw, Poland
© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Szewczyk et al. Parasites & Vectors (2017) 10:487
DOI 10.1186/s13071-017-2413-0
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

sp., 67.5% in Honshu sika deer (Cervus nippon centralis)
and 50% in Yezo sika deer (Cervus nippon yesoensis) [5].
Many Bartonella species are considered as human
pathogens and causative agents of zoonotic diseases: B.
bacilliformis, the agent of Carrion’s disease and Verruga
peruna is the chronic delayed stage of infection; B.
quintana, the agent of trench fever and bacillary angio-
matosis; B. henselae, the agent of cat scratch disease and
of bacillary angiomatosis; B. clarridgeiae,B. elizabethae,
B.vinsonii subsp. arupensis,B.vinsonii subsp. berkhoffii,
B. alsatica,B. koehlerae and B. washoensis all cause
endocarditis [6–8]. The symptoms of human bartonello-
sis vary with regard to the bacterial species and general
condition of the patient; however, Bartonella infection
most often manifests as various cardiovascular, neuro-
logical and rheumatologic conditions [8, 9].
Bartonellosis has been observed in humans throughout
Europe, Asia and North America. One of the most im-
portant species is Bartonella schoenbuchensis, which is
found in cattle, wild animals (such as the cervids) and
humans [10–12]. It has been identified in wild living roe
deer (Capreolus capreolus) in Germany [10], in cattle in
France [11] and in humans; B. schoenbuchensis was first
detected in France [12].
Bartonella are transmitted by blood-sucking arthro-
pods, such as lice, flies, fleas and ticks, many of which are
emerging pathogens of humans and animals [2, 13–15].
Dehio et al. [16] identified B. schoenbuchensis in Lipoptena
cervi collected from red deer and roe deer. Halos et al.
[14] reported the presence of Bartonella spp. in hippobos-
cide flies, and suggested that flies can be a vector for path-
ogens. Other authors [14, 17] have found Bartonella spp.
in wingless adult deer keds.
Lipoptena cervi are blood-sucking parasites which
belong to a highly specialized family of louse flies
(Diptera: Hippoboscidae) [18, 19]. This species has a
Palaearctic distribution and occurs in Europe, Asia
and North America; it is known to be present in
many countries, including Sweden, Norway, Japan, the
USA and Finland [20, 21]. In America, it is regarded
as an invasive species, believed to have been
transported with deer from Europe in the 1800s. This
species was identified in the USA for the first time
during the Second World War [18]. In Europe, the
most common blood-sucking ectoparasites of
mammals belonging to this family are louse fly (Hip-
pobosca equina), parasitizing cows and horses, deer
keds (Lipoptena cervi and Lipoptena fortisetosa), para-
sitizing cervids, and sheep ked (Melophagus ovinus),
which ectoparasites of sheep [22, 23]. Lipoptena forti-
setosa in Europe could be introduced with Japanese
sika deer (Cervus nippon). This cervids were intro-
duced to England in 1860, and their number and
range have since increased [24]. From England, the
Japanese sika deer were late introduced to Poland,
where two species of Lipoptena have been identified:
L. cervi and L. fortisetosa [25, 26].
Although the dominant hosts for two species of Lipop-
tena (L. cervi and L.fortisetosa) are cervids (Alces alces,
Cervus elaphus,Cervus elaphus maral,Cervus nippon,
Dama dama,Capreolus capreolus and Rangifer tarandus),
the insects can attack a wide range of animals, including
bovids (Ovis aries musimon,Bison bonasus,cattle,Capra
aegagrus hircus and Ovis aries), carnivores (domestic dogs,
Vulpes vulpes and Meles meles) and suids (Sus scrofa)
[27]. The most important hosts of Lipoptena cervi in
Europe are red deer (Cervus elaphus), roe deer (Capreolus
capreolus), moose (Alces alces) and sika deer (Cervus
nippon), while Japanese sika deer (Cervus nippon) are the
predominate host in Japan, and white-tailed deer (Odocoi-
leus virginianus), moose (Alces alces) and cattle (Bos
taurus) in North America [21, 28, 29].
Generally, Lipoptena cervi is found swarming in large
numbers on the host. Deer keds most frequently bite
animal hosts; they can land on humans, but rarely bite
in this case. Nevertheless, some authors have reported
ked bites on humans [30, 31].
The life-cycle of Lipoptena cervi begins with free-
ranging, winged adult deer keds that search for a
suitable host (cervids). The winged deer keds usually
suck blood from the host and mate; however, after
landing on a host, they can crawl into the fur, shed
their wings and become permanently associated with
thehost.Thelarvaedevelopuptostage3(L3)in
the oviduct and are then deposited in the cervid fur
as a white prepupa, which immediately starts to pupate.
The fully developed pupa drops to the ground and re-
mains there until August-September, when a new gener-
ation of winged adult deer keds can appear [29, 32, 33].
The female can produce to 20–25 larvae per year. Lipop-
tena cervi can overwinter on the host, and most deer keds
can live to one year [34].
The winged adult Lipoptena cervi are attracted to large
moving dark-colored objects when actively searching for
a host [35]. Lipoptena cervi only fly for short distances
and frequently attack accidental hosts such as humans
or dogs [32].
Lipoptena cervi is a potential vector for other zoonotic
pathogens, such as Anaplasma,Borrelia and Rickettsia
species [36]. Korhonen et al. [37] showed for the first time
transstadial transmission of Bartonella spp. in all develop-
ment stages of deer ked (pupa, unfed adult winged deer
ked). These data show vector competence for transmis-
sion of Bartonella spp. by Lipoptena cervi. In America,
Bartonella sp. has been reported in Lipoptena cervi from
white-tailed deer in Massachusetts [28], and in Lipoptena
mazamae from white-tailed deer (Odocoileus virginianus)
in Georgia and South Carolina (USA) [21]. Additionaly, it
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 2 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

has also been suggested that wingless adults of L. maza-
mae, could be transmitted mechanically from female
white-tailed deer to their offsprings [38]. Bartonella sp.
has also been found in ticks (Ixodes ricinus) parasitizing
roe deer in Poland [39].
The main goal of the study was detection of Bartonella
spp. DNA in Lipoptena cervi by PCR test and verifica-
tion of prevalence of this infection in adult wingless
males and females. Molecular characterization of speci-
mens of Bartonella spp. was done by analysis of partial
(850 bp) rpoB gene sequences.
Methods
Sample collection
Living deer keds (Lipoptena cervi) were collected from 26
red deer (Cervus elaphus) hunted in January 2014 in the
Strzałowo Forest District (53°45′57.03″N, 21°25′17.79″E).
After collection, all insects were preserved in 70% ethanol
for further morphological and molecular processing. Identi-
fication of deer ked (L. cervi) species and sex were con-
ducted using appropriate identification key [34] and
molecular methods to confirm vector species.
PCR and sequence analyses
In the laboratory, the flies were removed from 70% alcohol
and air-dried. The DNA was isolated from whole insect
body using the AX Tissue Mini kit (A&A Biotechnology,
Gdynia, Poland) according to the manufacturer’s protocol.
For PCR test the primers rpoR and rpoF were used.
These primers amplify a 333 bp fragment of the rpoB
gene of Bartonella spp. PCR reactions were conducted
according to Paziewska et al. [40]. 21 of 163 positive
samples were used to obtain a longer (850 bp) fragment
of the rpoB gene with second set of primers (1400F and
2300R) [41] (Table 1).
PCR reactions were conducted in a 50 μl reaction mixture
containing 2 μl of DNA template, 0.5 U (0.1 μl) of RUN Taq
polymerase (A&A Biotechnology, Gdynia, Poland), 1 μlof
dNTPs (10 mM), 0.5 μl of each primer (20 mM), and 5 μlof
10× Taq DNA polymerase buffer (pH 8.6, 25 mM MgCl
2
).
In the negative control, nuclease-free water was added to
the PCR mix instead of the tested DNA.
DNA amplification (1400F/2300R) was performed
using the DNA Engine PTC-200 Thermal Cycler
(BioRad, Hercules, USA) using the following program:
initial denaturation was performed at 94 °C for 5 min,
followed by 35 cycles of denaturation at 95 °C for 10 s,
annealing at 60 °C for 10 s and extension at 72 °C for
60 s. The final extension was performed at 72 °C for
7 min and then kept at 10 °C in a thermocycler.
The PCR products were visualized on a 1.0% agarose
gel stained with ethidium bromide. Visualization was
performed using ChemiDoc, MP Lab software (Imagine,
BioRad, Hercules, USA). The resulting product was
compared using the Nova 100 bp DNA Ladder Novazym
(Poznań, Poland). The PCR amplicons were purified
using a QIAEX II Gel Extraction Kit (Qiagen, Hilden,
Germany), sequenced in both directions by Genomed
(Poland) and contiguous sequences assembled using
ContigExpress, Vector NTI Advance 11.0 (Invitrogen
Life Technologies, New York, USA). The derived se-
quences were submitted to the GenBank database under
the accession numbers MF580655–MF580675.
To confirm the morphological species determination of
Lipoptena cervi, DNA from four specimens (positive in
Bartonella spp. test and used in Bartonella isolate ana-
lysis), L700F and L1213R primers were used to amplify
and sequence 412 bp fragments of 16S rDNA (Table 1).
In order to perform PCR amplification, the following
mixture reaction was used: 4 μl of DNA extract was
added to 46 μl of reaction mixture consisting of 0.1 μlof
Allegro Taq Polymerase DNA (5 U/μl) (Poznań, Poland),
0.5 μl dNTPs (10 mM), 1 μl of each primer (20 mM),
5μl of 10× Taq DNA polymerase buffer (pH 8.6, 25 mM
MgCl
2
), and 38.4 μl of deionized water.
DNA amplification (L700F/L1213R) was performed
using the DNA Engine PTC-200 Thermal Cycler
(BioRad, Hercules, USA) using the following program:an
initial denaturation was performed at 92 °C for 3 min,
followed by 35 cycles of denaturation at 95 °C for 10 s,
annealing at 60 °C for 10 s and extension at 72 °C for
30 s. The final extension was performed at 72 °C for
5 min and then kept at 12 °C in a thermocycler.
Phylogenetic analyses
We used Bayesian inference (BI) analysis with MrBayes
version 3.2 [42]. Analysis of partial rpoB gene sequence
data was based on an alignment of 804 bp (268 amino
acids) using the GTR + I + G model. The GTR models
were chosen on the basis of jModelTest version 2.1.4
[43, 44] using the Akaike information criterion.
Results
In total, 217 deer keds were collected from 26 red deer
(Cervus elaphus). All insects were identified as Lipop-
tena cervi using morphological features [34]. The preva-
lence of Bartonella spp. infection was 75.12% (163/217)
by PCR test. In the tested group of L. cervi, a greater
Table 1 List of primers sequences used in this study
Primer Sequence (5′-3′) Reference
L700F AAAGTTTAACCTGCCCACTGAT This study
L1213R CTGAACTCAGATCACGTAAGAAT This study
rpoR CGCATTATGGTCGTATTTGTCC Paziewska et al. [40]
rpoF GCACGATTYGCATCATCATTTTCC Paziewska et al. [40]
1400F CGCATTGGCTTACTTCGTATG Renesto et al. [41]
2300R GTAGACTGATTAGAACGCTG Renesto et al. [41]
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 3 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

proportion of females (86.67%) was found to be positive
for Bartonella spp. than males (60.82%).
PCR, sequence and molecular analyses
Fourteen sequences (Bartonella sp. 1: MF580662–
MF580675) obtained in this study share over 99% similarity
with B. schoenbuchensis isolated from moose blood from
Sweden (GenBank: KB915628) and from human blood
from France (GenBank: HG977196). Five sequences Barto-
nella sp. 2 (MF580657–MF580661) showed 94.6% similar-
ity with Bartonella sp. 3, and 94.4% with Bartonella sp.
from Japanese sika deer from Japan (AB703149). Bartonella
sp. 3 (MF580656) showed 99.7% similarity with another
samples isolated from Japanese sika deer from Wakayama
Prefecture Japan (AB703149). Bartonella sp. 4 (MF580655)
was 99,7% similar with Bartonella sp. isolated from
Japanese sika deer (Cervus nippon centralis)fromNaraPre-
fecture Japan (AB703146). These results are summarized in
Table 2 and Additional file 1: Table S1.
Four 16S rDNA sequences of deer ked were obtained,
which were identical with Lipoptena cervi collected in the
Czech Republic (AF322437). The sequences derived dur-
ing this study were submitted to the GenBank database
under the accession numbers MF541726–MF541729.
Discussion
Our findings indicate the presence of Bartonella species
in deer keds (Lipoptena cervi) obtained from red deer
(Cervus elaphus). Dehio et al. [16] noted that L. cervi
appears to be a natural reservoir supporting the trans-
mission of Bartonella schoenbuchensis. The largest group
of isolates (Bartonella sp. 1) showed closed similarity
with Bartonella schoenbuchensis. Our data indicate a
high prevalence of Bartonella spp. A prevalence of
75.12% was recorded in the whole tested group, a result
similar to global data; however, higher values were
observed in Finland (90%) and France (94%) [14, 37].
Table 2 Bartonella spp. used in the phylogenetic analysis
Isolate/sequence ID Species Host Source Country of isolation
MF580662–MF580675 Bartonella sp. 1 Lipoptena cervi whole body Poland
MF580657–MF580661 Bartonella sp. 2 Lipoptena cervi whole body Poland
MF580656 Bartonella sp. 3 Lipoptena cervi whole body Poland
MF580655 Bartonella sp. 4 Lipoptena cervi whole body Poland
DQ356077 Bartonella bovis bovine blood Italy
EF432062 B. bovis cow valve (heart) France
KR733195 B. bovis cattle blood Malaysia
KR733194 B. bovis cattle blood Malaysia
KF218224 B. bovis water buffalo blood Thailand
KF218220 B. bovis cattle blood Thailand
KF218218 B. bovis cattle blood Guatemala
KF218217 B. bovis cattle blood France
HM167505 Bartonella capreoli moose blood USA
AB703143 B. capreoli Japanese sika deer blood Japan
AB703142 B. capreoli Japanese sika deer blood Japan
AB703149 Bartonella sp. Japanese sika deer blood Japan
AB703146 Bartonella sp. Japanese sika deer blood Japan
AB703145 Bartonella sp. Japanese sika deer blood Japan
KB915628 Bartonella schoenbuchensis moose blood Sweden
KM215709 Bartonella chomelii cattle blood Spain
KM215710 Bartonella chomelii cattle blood Spain
JN646664 Bartonella chomelii cattle blood New Caledonia
KJ909808 Bartonella bovis cattle blood Israel
AB703148 Bartonella sp. Japanese sika deer blood Japan
AB703144 Bartonella sp. Japanese sika deer blood Japan
HG977196 Bartonella schoenbuchensis human blood France
CP019789 Bartonella schoenbuchensis European roe deer blood Germany
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 4 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

To the best of our knowledge, the present paper is the
first report in Poland to identify differences in the preva-
lence of Bartonella spp. infection in male and female
deer keds. Females were more frequently infected than
males; 86.67% of wingless females were infected by
Bartonella, similar to a study from Hungary (76.0%),
while only 60.82% of wingless males were infected, also
similar to a result in Hungary (58%) [45].
Thereasonforsuchadifferenceininfectionpreva-
lence is not clear; however, it might be associated
with the multiple bites needed for larvae production
(20–25 larvae per year) [34]. De Bruin et al. [45]
suggested that Bartonella species are able to colonize
or survive more efficiently as females than males, but
the molecular mechanism for this remains unknown.
The same authors [45] suggested that Bartonella spp.
infection in female deer keds might lead to more
female offspring than uninfected females, possibly
resulting in the observed asymmetry in the female:-
male ratio of infected individuals.
By transmitting pathogens, Lipoptena cervi can be po-
tentially dangerous for animals and humans. A study
Fig. 1 Phylogenetic tree of Bartonella spp., constructed by Bayesian inference (BI) analysis using MrBayes version 3.2. For BI codon analysis
(nucmodel = codon), the GTR + I + G model was chosen based on jModelTest version 2.1.4 [43, 44] using Akaike Information Criterion. Analysis
was run for 8,000,000 generations, with 2,000,000 generations discarded as ‘burn-in’. Hosts, country and GenBank accession numbers of origin are
shown. Nodal support is indicated as Bayesian posterior probabilities. Sequence from Brucella melitensis (AY562179) was used as outgroup.
Sequences generated in this study are shown in bold
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 5 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

conducted in Finland found that L. cervi can transmit
some pathogens by biting, and this is associated with
hair-loss epizootics in moose [17]. Since the 1970s, in
Finland an increasing number of cases of recurrent, and
occasionally long-lasting, dermatitis associated with deer
keds bites has been observed [46].
Fourteen of the sequences (Bartonella sp.1,seeTable2.)
isolated from deer keds demonstrated 99.2% homology with
aBartonella schoenbuchensis sample isolated from moose
in Sweden (KB915628). Bartonella schoenbuchensis could
be found in vectors, such as L. cervi or L. mazamae,orin
definitive hosts like cattle, wild ruminants and humans [10,
11, 16]. It is difficult to see how the relationship between B.
schoenbuchensis and deer ectoparasites may relate to simi-
lar cases in humans. Lipoptena cervi has fed on humans
under experimental conditions and in the natural environ-
ment [18, 47]. As humans may be infected with B. schoen-
buchensis during occasional biting by L. cervi, hunters,
forestry workers and cross-country runners, among others,
are at increased risk of infection [16]. Although L. cervi has
not yet been definitively demonstrated to transmit B.
schoenbuchensis through bites, it is possible that hunters
are at risk to infection of Bartonella schoenbuchensis or
Anaplasma phagocytophilum following exposure to deer
blood [48].
In Massachusetts, a Bartonella sp. similar to B. schoen-
buchensis has been found in Lipoptena mazamae [21],
which suggests that Lipoptena species can extend the
range of B. schoenbuchensis. Our phylogenetic analysis of
the partial rpoB gene sequences found that our samples
were in the same clade as other B. schoenbuchensis isolates
from moose (KB915628) and human (HG977196). Barto-
nella schoenbuchensis (strain closely related to B. schoen-
buchensis strain R1–86.6%, gltA gene) was previously
reported from roe deer (C. capreolus) in Poland [49].
Bartonella sp. 2 (5 isolates) and Bartonella sp. 3
(MF580656) demonstrated high similarity to sequences
obtained from Japanese sika deer from Japan
(AB703149, 94.6% and 99.7% similarity, respectively.
These Bartonella isolates are related with the B. bovis
clade in our phylogenetic analysis (Fig. 1).
Bartonella sp. 4 (MF580655) is very similar (99.7%) to
Bartonella sp. isolates collected from Japanese sika deer
(AB703146, see Fig. 1) and in our phylogenetic analyses
these isolates are associated with other Bartonella sp.
isolates from Japanese sika deer and formed a distinct
clade with Bartonella spp. isolated from Japanese sika
deer. Probably “japanese”Bartonella isolates were intro-
ducted to Poland. This observation suggests that the
strain of Bartonella sp. bacteria identified in the present
study is derived from Japanese sika deer introduced to
Europe by vectors to environment, indicating that this
Asian strains could be spread by L. cervi to European
red deer (Cervus elaphus).
Some Japanese Bartonella sp. samples, isolated from
different prefectures, comprise a group distinct from
other samples of Bartonella on GenBank; however, fur-
ther testing is required utilizing other genes, including
gltA and ftsZ, to confirm whether they could be regarded
as a distinct species.
Conclusions
Our data confirm that Bartonella spp. can be transmitted
by deer ked in central Europe, and the prevalence of this
pathogen is very high. In this area, Lipoptena cervi are
infected by various species of the genus Bartonella.
Additional files
Additional file 1: Table S1. Pairwise comparison of partial (804 bp)
mitochondrial gene rpoB DNA and amino acid sequences variability
among species/sequences of Bartonella used in phylogenetical analysis.
Above diagonal: number of variable sites in the 268 amino acid gene
rpoB sequences. Below diagonal: number of variable sites in the
nucleotides gene rpoB sequences. The percentage of variable sites for
each gene fragment between 2 species/sequences is given in
parenthesis. Each species isolates/sequence information are provided in
Table 2. (DOCX 23 kb)
Acknowledgements
The authors would like to express their gratitude to Marek Bogdaszewski,
Head of the Research Station in Kosewo Górne (W. Stefański Institute of
Parasitology), for enabling us to collect the samples from red deer.
Funding
No funding was received.
Availability of data and materials
The data supporting the conclusions of this article are included within the
article and its additional file. The sequences were submitted to the GenBank
database under the accession numbers MF580655–MF580675 (Uncultured
Bartonella sp.) and MF541726–MF541729 (Lipoptena cervi).
Authors’contributions
TS planned and organized the study. JW and ŻSB collected samples. TS and
JW extracted DNA. ZL performed PCR, sequencing and analyzed sequence
data. TS, WJ and ZL drafted the manuscript, and wrote the final version
together with GK. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Received: 21 April 2017 Accepted: 29 September 2017
References
1. Bai Y, Kandaurov A, Imnadze P, Kosoy M. Molecular survey of bacterial
zoonotic agents in bats from the country of Georgia (Caucasus). PLoS One.
2017;12(1):e0171175.
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 6 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

2. Breitschwerdt EB, Kordick DL. Bartonella infection in animals: carriership,
reservoir potential, pathogenicity, and zoonotic potential for human
infection. Clin Microbiol Rev. 2000;13:428–38.
3. Karbowiak G, Rychlik L, Nowakowski W, Wita I. Natural infections of small
mammals with blood parasites on the borderland of boreal and temperate
forest zones. Acta Theriol. 2005;50:31–42.
4. Bai Y, Malania L, Alvarez Castillo D, Moran D, Boonmar S, Chanlun A, et al.
Global distribution of Bartonella infection in domestic bovine and
characterization of Bartonella bovis strain using multi-locus sequence typing.
PLoS One. 2013;8(11):e80894.
5. Sato S, Kabeya H, Yamazaki M, Takeno S, Suzuki K, Kobayashi S, et al.
Prevalence and genetic diversity of Bartonella species in sika deer (Cervus
nippon) in Japan. Comp Immunol Microbiol Infect Dis. 2012;35(6):575–81.
6. Boulouis HJ, Piemont Y. Bartonella birtlesii sp. nov., isolated from small
mammals (Apodemus spp.). Int J Syst Evol Microbiol. 2000;50:1973–9.
7. Chomel B. Emerging bacterial zoonoses. Point Veterinaire. 2000;31:15–22.
8. Breitschwerdt EB, Maggi RG, Chomel BB, Lapin MR. Bartonellosis: an
emerging infectious diseases of zoonotic importance to animal and
humans being. J Vet Emerg Crit Care (San Antonio). 2010;20:8–30.
9. Maggi RG, Mozayeni BR, Pultorak EL, Hegarty BC, Bradley JM, Correa M,
Breitschwerdt EB. Bartonella spp. bacteremia and rheumatic symptoms in
patient from Lyme disease-endemic region. Emerg Infect Dis. 2012;18:783–91.
10. Dehio C, Lanz C, Pohl R, Behrens P, Bermond D, Piemont Y, Pelz K, Sander
A. Bartonella schoenbuchii sp. nov., isolated from the blood of wild roe deer.
Int J Syst Evol Microbiol. 2001;51:1557–65.
11. Rolain JM, Rousset E, La Scola B, Duquesnel R, Raoult D. Bartonella
schoenbuchensis isolated from the blood of a French cow. Ann NY Acad Sci.
2003;990:236–8.
12. Vayssier-Taussat M, Moutailler S, Fèmènia F, Raymond P, Croce O, La Scola B,
et al. Identification of novel zoonotic activity of Bartonella spp., France.
Emerg Infect Dis. 2016;22:457–62.
13. Müller A, Reiter M, Schötta AM, Stockinger H, Stanek G. Detection of
Bartonella spp. in Ixodes ricinus ticks and Bartonella seroprevalence in
human population. Ticks Tick Borne Dis. 2016;7:763–7.
14. Halos L, Jamal T, Maillard R, Girard B, Guillot J, Chomel B, et al. Role of
Hippoboscidae flies as potential vector of Bartonella spp. infecting wild
domestic ruminants. Appl Environ Microbiol. 2004;70(10):6302–5.
15. Sytykiewicz H, Karbowiak G, Werszko J, Czerniewicz P, Sprawka I, Mitrus J.
Molecular screening for Bartonella henselae and Borrelia burgdorferi sensu
lato co-existence within Ixodes ricinus populations in central and eastern
parts of Poland. Ann Agric Environ Med. 2012;19(3):451–6.
16. Dehio C, Sauder U, Hiestand R. Isolation of Bartonella schoenbuchensis in
Lipoptena cervi, a blood-sucking arthropod causing deer ked dermatitis. J
Clin Microbiol. 2004;42(11):5320–3.
17. Madslien K, Ytrehus B, Vikøren T, Malmsten J, Isaksen K, Hygen HO, Solberg
EJ. Hair-loss epizootic in moose (Alces alces) associated with massive deer
ked (Lipoptena cervi) infestation. J Wild Dis. 2011;47(4):893–906.
18. Bequaert JC. Monograph of the Melophaginae of ked-flies of sheep, goats, deer
and antelopes (Diptera, Hippoboscidae). Bull Brooklyn Ent Soc. 1942;22:1–220.
19. Maa TCA. synopsis of the Lipopteninae (Diptera: Hippoboscidae). J Med
Entomol. 1965;2:233–48.
20. Valimaki P, Madslien K, Malmsten J, Harkonen I, Harkonen S, Kaitala A, et al.
Fennoscandian distribution of an important parasite of cervids, the deer ked
(Lipoptena cervi), revisted. Parasitol Res. 2010;107:117–25.
21. Reeves WK, Nelder MP, Cobb KD, Dasch GA. Bartonella spp. in deer keds,
Lipoptena mazamae (Diptera: Hippoboscidae), from Georgia and South
Carolina, USA. J Wildl Dis. 2006;42(2):391–6.
22. Kettle DS. Medical and veterinary entomology. London, UK: Croom Helm.
1984:285–92.
23. Haigh JC, Mackintosh C, Griffin F. Viral, parasitic and prion diseases of
farmed deer and bison. Rev Sci Tech (Int Off Epizoot). 2002;21:219.
24. Pérez-Espona S, Pemberton JM, Putman R. Red and sika deer in the British Isles,
current management issues and management policy. Mamm Biol. 2009;74:247–62.
25. SokółR, Gałęcki R. Prevalence of keds on city dogs in central Poland. Med
Vet Entomol. 2017;31:114–6.
26. Kowal J, Nosal P, Rościszewska M, Matysek M. [New records of Lipoptena
fortisetosa MAA, 1965 (Diptera: Hippoboscidae) in Poland.] Dipteron. 2009;
25:27–9 (In Polish).
27. Kowal J, Nosal P, KornaśS, Wajdzik M, Matysek M, Basiaga M, Różnorodność
i. znaczenie muchówek z rodziny narzępikowatych - pasożytów
jeleniowatych. Med Weter. 2016;72:745–9.
28. Matsumoto K, Berrada ZL, Klinger E, Goethert HK, Telford SR. Molecular
detection of Bartonella schoenbuchensis from ectoparasites of deer in
Massachusetts. Vector Borne Zoonotic Dis. 2008;8(4):549–54.
29. Chistyakov AF. Skin lesions in people due to bites of Lipoptena cervi. Vestn
Dermatol Venerol. 1968;42:59–62.
30. Rantanen T, Reuanala T, Vuojolahti P, Hackman W. Presistent pruritic papules
from deer ked bites. Acta Derm Venereol. 1982;62:307–11.
31. Haarlov N. Life cycle and distribution pattern of Lipoptena cervi (L.) (Dipt.
Hippobosc.) on Danish deer. Oikos. 1964;15:93–129.
32. Madslien K, Ytrehus B, Vilijugrein H, Solberg EJ, Braten KR, Mysterud AA.
factors affecting deer ked (Lipoptena cervi) prevalence and intensity in
moose (Alces alces) in Norway. Parasit Vectors. 2012;5:251.
33. Mysterud A, Madslien K, Herland A, Viljugrein H, Ytrehus B. Phenology of
deer ked (Lipoptena cervi) host-seeking flight activity and its relationship
with prevailing autumn weather. Parasit Vectors. 2016;9:95.
34. Borowiec L. [Wpleszczowate Hippoboscidae. Klucze do oznaczania owadów
Polski.] Część XXVIII/77 77. Wrocław 1984 (In Polish).
35. Kortet R, Härkönen L, Hokkanen P, Härkönen S, Kaitala A, Kaunisto S, et al.
Experiments on the ectoparasitic deer ked that often attacks humans;
preferences for body parts, colo ur and temp erature. Bull Entomol Res.
2010;100:279–85.
36. Buss M, Case L, Kearney B, Coleman C, Henning JD. Detection of Lyme
disease and anaplasmosis pathogens via PCR in Pennsylvania deer ked. J
Vector Ecol. 2016;41:292–4.
37. Korhonen EM, Pèrez Vera C, Pulliainen AT, Sironen T, Aaltonen K, Kortet R, et
al. Molecular detection of Bartonella spp. in deer ked pupae, adult keds and
moose blood in Finland. Epidemiol Infect. 2014;143:578–85.
38. Samuel W, Trainer D. Lipoptena mazamae Rondani, 1878 (Diptera:
Hippoboscidae) on white-tailed deer in southern Texas. J Med Entomol.
1972;9:104–6.
39. Adamska M. Infestation of game animals from north-western Poland by
common tick (Ixodes ricinus). Wiadi Parazytol. 2008;54:31–6.
40. Paziewska A, Harris PD, Zwolińska L, Bajer A, Siński E. Recombination within
and between species of the alpha proteobacterium Bartonella infecting
rodents. Microb Ecol. 2011;61:134–45.
41. Renesto P, Gouvernet J, Drancourt M, Roux V, Raoult D. Use of rpoB analysis
for detection and identification of Bartonella species. J Clin Microbiol. 2001;
3(2):430–7.
42. Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic
trees. Bioinformatics. 2001;17:754–5.
43. Guindon S, Gascuel OA. simple, fast, and accurate algorithm to estimate
large phylogenies by maximum likelihood. Syst Biol. 2003;52:696–704.
44. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models,
new heuristics and paralel computing. Nat Methods. 2012;9(8):772.
45. de Bruin A, van Leeuwen AD, Jahfari S, Takken W, Földvári M, Dremmel L, et
al. Vertical transmission of Bartonella schoenbuchensis in Lipoptena cervi.
Parasit Vectors. 2015;8:176.
46. Härkönen S, Laine M, Vornanen M, Reunala T. Deer ked (Lipoptena cervi )
dermatitis in humans - an increasing nuisance in Finland. Alces. 2009;45:73–9.
47. Starzyk J. Strzyżak sarni, Lipoptena cervi (L.) (Diptera, Hippoboscidae) -
pasożyt zewnętrzny parzystokopytnych. Prz. Zool. 1975;17:446–8.
48. Telford SR III, Bakken JS, Dumler JS. Risk for acquiring huma n
granulocytic ehrlichiosis: exposure to deer blood or deer ticks? Clin
Infect Dis. 1997;24:531–3.
49. Welc-Falęciak R, Werszko J, Cydzik K, Bajer A, Michalik J, Behnke JM. Co-
infection and genetic diversity of tick-borne pathogens in roe deer from
Poland. Vector Borne Zoonotic Dis. 2013;13:277–88.
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 7 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com