ArticlePDF Available

Abstract and Figures

Background The bacteria of the genus Bartonella are obligate parasites of vertebrates. Their distribution range covers almost the entire world from America, Europe, Asia to Africa and Australia. Some species of Bartonella are pathogenic for humans. Their main vectors are blood-sucking arthropods such as fleas, ticks and blood-feeding flies. One such dipteran able to transfer vector-borne pathogens is the deer ked (Lipoptena cervi) of the family Hippoboscidae. This species acts as a transmitter of Bartonella spp. in cervid hosts in Europe. Methods In the present study, 217 specimens of deer ked (Lipoptena cervi) were collected from 26 red deer (Cervus elaphus) hunted in January 2014. A short fragment (333 bp) of the rpoB gene was used as a marker to identify Bartonella spp. in deer ked tissue by PCR test. A longer fragment (850 bp) of the rpoB gene was amplified from 21 of the positive samples, sequenced and used for phylogenetic analysis. Results The overall prevalence of Lipoptena cervi infection with Bartonella spp. was 75.12% (163/217); 86.67% (104/120) of females and 60.82% (59/97) of males collected from red deer hunted in the Strzałowo Forest District in Poland (53°45′57.03″N, 21°25′17.79″E) were infected. The nucleotide sequences from 14 isolates (Bartonella sp. 1) showed close similarity to Bartonella schoenbuchensis isolated from moose blood from Sweden (GenBank: KB915628) and human blood from France (GenBank: HG977196); Bartonella sp. 2 (5 isolates) and Bartonella sp. 3 (one isolate) were similar to Bartonella sp. from Japanese sika deer (GenBank: AB703149), and Bartonella sp. 4 (one isolate) was almost identical to Bartonella sp. isolated from Japanese sika deer from Japan (GenBank: AB703146). Conclusions To the best of our knowledge, this is the first report to confirm the presence of Bartonella spp. in deer keds (Lipoptena cervi) in Poland by molecular methods. Bartonella sp. 1 isolates were most closely related to B. schoenbuchensis isolated from moose from Sweden and human blood from France. The rest of our isolates (Bartonella spp. 2–4) were similar to Bartonella spp. isolated from Japanese sika deer from Japan. Electronic supplementary material The online version of this article (10.1186/s13071-017-2413-0) contains supplementary material, which is available to authorized users.
Content may be subject to copyright.
R E S E A R C H Open Access
Molecular detection of Bartonella spp. in
deer ked (Lipoptena cervi) in Poland
Tomasz Szewczyk
*
, Joanna Werszko, Żaneta Steiner-Bogdaszewska, Witold Jeżewski, Zdzisław Laskowski
and Grzegorz Karbowiak
Abstract
Background: The bacteria of the genus Bartonella are obligate parasites of vertebrates. Their distribution range
covers almost the entire world from America, Europe, Asia to Africa and Australia. Some species of Bartonella are
pathogenic for humans. Their main vectors are blood-sucking arthropods such as fleas, ticks and blood-feeding flies.
One such dipteran able to transfer vector-borne pathogens is the deer ked (Lipoptena cervi) of the family
Hippoboscidae. This species acts as a transmitter of Bartonella spp. in cervid hosts in Europe.
Methods: In the present study, 217 specimens of deer ked (Lipoptena cervi) were collected from 26 red deer
(Cervus elaphus) hunted in January 2014. A short fragment (333 bp) of the rpoB gene was used as a marker to
identify Bartonella spp. in deer ked tissue by PCR test. A longer fragment (850 bp) of the rpoB gene was amplified
from 21 of the positive samples, sequenced and used for phylogenetic analysis.
Results: The overall prevalence of Lipoptena cervi infection with Bartonella spp. was 75.12% (163/217); 86.67% (104/
120) of females and 60.82% (59/97) of males collected from red deer hunted in the Strzałowo Forest District in
Poland (53°4557.03N, 21°2517.79E) were infected. The nucleotide sequences from 14 isolates (Bartonella sp. 1)
showed close similarity to Bartonella schoenbuchensis isolated from moose blood from Sweden (GenBank: KB915628)
and human blood from France (GenBank: HG977196); Bartonella sp. 2 (5 isolates) and Bartonella sp. 3 (one isolate) were
similar to Bartonella sp. from Japanese sika deer (GenBank: AB703149), and Bartonella sp. 4 (one isolate) was almost
identical to Bartonella sp. isolated from Japanese sika deer from Japan (GenBank: AB703146).
Conclusions: To the best of our knowledge, this is the first report to confirm the presence of Bartonella spp. in deer keds
(Lipoptena cervi) in Poland by molecular methods. Bartonella sp. 1 isolates were most closely related to B. schoenbuchensis
isolated from moose from Sweden and human blood from France. The rest of our isolates (Bartonella spp. 24) were
similar to Bartonella spp. isolated from Japanese sika deer from Japan.
Keywords: Bartonella spp., Bartonella schoenbuchensis,Lipoptena cervi,Cervus elaphus
Background
The genus Bartonella comprises small, Gram-negative
bacteria which act as obligate intracellular parasites of
vertebrates. About 30 species, as well as three subspe-
cies, have been described [1]. The zoonotic reservoir for
some Bartonella species (B. schoenbuchensis,B.bacili-
formis and B.quintana), is composed of wild mammals,
which usually only possess asymptomatic bacteraemia.
The prevalence of bacteremia in wild animals is often
very high, ranging from 50 to 95% in selected rodent
and ruminant populations [2, 3] and strongly depends
on the season [3]. As the reservoir hosts include a wide
range of wild mammals, including typically ruminants,
rodents and carnivores, the infections are easily spread
and have been noted all over the world [2]. A good ex-
ample is that of ruminant infections: Bartonella infec-
tion has been recorded in cattle in three different
countries (Thailand, Guatemala and Georgia) and in buf-
falo (Bubalus bubalis) from Thailand [4]. The prevalence
of Bartonella infection in these regions varies between
10 and 90%. Similar investigations in Japan found no in-
fection in cattle, but recorded a prevalence of Bartonella
* Correspondence: t.szewczyk86@gmail.com
Witold Stefański Institute of Parasitology, Polish Academy of Sciences, Twarda
51/55, 00-818 Warsaw, Poland
© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Szewczyk et al. Parasites & Vectors (2017) 10:487
DOI 10.1186/s13071-017-2413-0
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
sp., 67.5% in Honshu sika deer (Cervus nippon centralis)
and 50% in Yezo sika deer (Cervus nippon yesoensis) [5].
Many Bartonella species are considered as human
pathogens and causative agents of zoonotic diseases: B.
bacilliformis, the agent of Carrions disease and Verruga
peruna is the chronic delayed stage of infection; B.
quintana, the agent of trench fever and bacillary angio-
matosis; B. henselae, the agent of cat scratch disease and
of bacillary angiomatosis; B. clarridgeiae,B. elizabethae,
B.vinsonii subsp. arupensis,B.vinsonii subsp. berkhoffii,
B. alsatica,B. koehlerae and B. washoensis all cause
endocarditis [68]. The symptoms of human bartonello-
sis vary with regard to the bacterial species and general
condition of the patient; however, Bartonella infection
most often manifests as various cardiovascular, neuro-
logical and rheumatologic conditions [8, 9].
Bartonellosis has been observed in humans throughout
Europe, Asia and North America. One of the most im-
portant species is Bartonella schoenbuchensis, which is
found in cattle, wild animals (such as the cervids) and
humans [1012]. It has been identified in wild living roe
deer (Capreolus capreolus) in Germany [10], in cattle in
France [11] and in humans; B. schoenbuchensis was first
detected in France [12].
Bartonella are transmitted by blood-sucking arthro-
pods, such as lice, flies, fleas and ticks, many of which are
emerging pathogens of humans and animals [2, 1315].
Dehio et al. [16] identified B. schoenbuchensis in Lipoptena
cervi collected from red deer and roe deer. Halos et al.
[14] reported the presence of Bartonella spp. in hippobos-
cide flies, and suggested that flies can be a vector for path-
ogens. Other authors [14, 17] have found Bartonella spp.
in wingless adult deer keds.
Lipoptena cervi are blood-sucking parasites which
belong to a highly specialized family of louse flies
(Diptera: Hippoboscidae) [18, 19]. This species has a
Palaearctic distribution and occurs in Europe, Asia
and North America; it is known to be present in
many countries, including Sweden, Norway, Japan, the
USA and Finland [20, 21]. In America, it is regarded
as an invasive species, believed to have been
transported with deer from Europe in the 1800s. This
species was identified in the USA for the first time
during the Second World War [18]. In Europe, the
most common blood-sucking ectoparasites of
mammals belonging to this family are louse fly (Hip-
pobosca equina), parasitizing cows and horses, deer
keds (Lipoptena cervi and Lipoptena fortisetosa), para-
sitizing cervids, and sheep ked (Melophagus ovinus),
which ectoparasites of sheep [22, 23]. Lipoptena forti-
setosa in Europe could be introduced with Japanese
sika deer (Cervus nippon). This cervids were intro-
duced to England in 1860, and their number and
range have since increased [24]. From England, the
Japanese sika deer were late introduced to Poland,
where two species of Lipoptena have been identified:
L. cervi and L. fortisetosa [25, 26].
Although the dominant hosts for two species of Lipop-
tena (L. cervi and L.fortisetosa) are cervids (Alces alces,
Cervus elaphus,Cervus elaphus maral,Cervus nippon,
Dama dama,Capreolus capreolus and Rangifer tarandus),
the insects can attack a wide range of animals, including
bovids (Ovis aries musimon,Bison bonasus,cattle,Capra
aegagrus hircus and Ovis aries), carnivores (domestic dogs,
Vulpes vulpes and Meles meles) and suids (Sus scrofa)
[27]. The most important hosts of Lipoptena cervi in
Europe are red deer (Cervus elaphus), roe deer (Capreolus
capreolus), moose (Alces alces) and sika deer (Cervus
nippon), while Japanese sika deer (Cervus nippon) are the
predominate host in Japan, and white-tailed deer (Odocoi-
leus virginianus), moose (Alces alces) and cattle (Bos
taurus) in North America [21, 28, 29].
Generally, Lipoptena cervi is found swarming in large
numbers on the host. Deer keds most frequently bite
animal hosts; they can land on humans, but rarely bite
in this case. Nevertheless, some authors have reported
ked bites on humans [30, 31].
The life-cycle of Lipoptena cervi begins with free-
ranging, winged adult deer keds that search for a
suitable host (cervids). The winged deer keds usually
suck blood from the host and mate; however, after
landing on a host, they can crawl into the fur, shed
their wings and become permanently associated with
thehost.Thelarvaedevelopuptostage3(L3)in
the oviduct and are then deposited in the cervid fur
as a white prepupa, which immediately starts to pupate.
The fully developed pupa drops to the ground and re-
mains there until August-September, when a new gener-
ation of winged adult deer keds can appear [29, 32, 33].
The female can produce to 2025 larvae per year. Lipop-
tena cervi can overwinter on the host, and most deer keds
can live to one year [34].
The winged adult Lipoptena cervi are attracted to large
moving dark-colored objects when actively searching for
a host [35]. Lipoptena cervi only fly for short distances
and frequently attack accidental hosts such as humans
or dogs [32].
Lipoptena cervi is a potential vector for other zoonotic
pathogens, such as Anaplasma,Borrelia and Rickettsia
species [36]. Korhonen et al. [37] showed for the first time
transstadial transmission of Bartonella spp. in all develop-
ment stages of deer ked (pupa, unfed adult winged deer
ked). These data show vector competence for transmis-
sion of Bartonella spp. by Lipoptena cervi. In America,
Bartonella sp. has been reported in Lipoptena cervi from
white-tailed deer in Massachusetts [28], and in Lipoptena
mazamae from white-tailed deer (Odocoileus virginianus)
in Georgia and South Carolina (USA) [21]. Additionaly, it
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 2 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
has also been suggested that wingless adults of L. maza-
mae, could be transmitted mechanically from female
white-tailed deer to their offsprings [38]. Bartonella sp.
has also been found in ticks (Ixodes ricinus) parasitizing
roe deer in Poland [39].
The main goal of the study was detection of Bartonella
spp. DNA in Lipoptena cervi by PCR test and verifica-
tion of prevalence of this infection in adult wingless
males and females. Molecular characterization of speci-
mens of Bartonella spp. was done by analysis of partial
(850 bp) rpoB gene sequences.
Methods
Sample collection
Living deer keds (Lipoptena cervi) were collected from 26
red deer (Cervus elaphus) hunted in January 2014 in the
Strzałowo Forest District (53°4557.03N, 21°2517.79E).
After collection, all insects were preserved in 70% ethanol
for further morphological and molecular processing. Identi-
fication of deer ked (L. cervi) species and sex were con-
ducted using appropriate identification key [34] and
molecular methods to confirm vector species.
PCR and sequence analyses
In the laboratory, the flies were removed from 70% alcohol
and air-dried. The DNA was isolated from whole insect
body using the AX Tissue Mini kit (A&A Biotechnology,
Gdynia, Poland) according to the manufacturers protocol.
For PCR test the primers rpoR and rpoF were used.
These primers amplify a 333 bp fragment of the rpoB
gene of Bartonella spp. PCR reactions were conducted
according to Paziewska et al. [40]. 21 of 163 positive
samples were used to obtain a longer (850 bp) fragment
of the rpoB gene with second set of primers (1400F and
2300R) [41] (Table 1).
PCR reactions were conducted in a 50 μl reaction mixture
containing 2 μl of DNA template, 0.5 U (0.1 μl) of RUN Taq
polymerase (A&A Biotechnology, Gdynia, Poland), 1 μlof
dNTPs (10 mM), 0.5 μl of each primer (20 mM), and 5 μlof
10× Taq DNA polymerase buffer (pH 8.6, 25 mM MgCl
2
).
In the negative control, nuclease-free water was added to
the PCR mix instead of the tested DNA.
DNA amplification (1400F/2300R) was performed
using the DNA Engine PTC-200 Thermal Cycler
(BioRad, Hercules, USA) using the following program:
initial denaturation was performed at 94 °C for 5 min,
followed by 35 cycles of denaturation at 95 °C for 10 s,
annealing at 60 °C for 10 s and extension at 72 °C for
60 s. The final extension was performed at 72 °C for
7 min and then kept at 10 °C in a thermocycler.
The PCR products were visualized on a 1.0% agarose
gel stained with ethidium bromide. Visualization was
performed using ChemiDoc, MP Lab software (Imagine,
BioRad, Hercules, USA). The resulting product was
compared using the Nova 100 bp DNA Ladder Novazym
(Poznań, Poland). The PCR amplicons were purified
using a QIAEX II Gel Extraction Kit (Qiagen, Hilden,
Germany), sequenced in both directions by Genomed
(Poland) and contiguous sequences assembled using
ContigExpress, Vector NTI Advance 11.0 (Invitrogen
Life Technologies, New York, USA). The derived se-
quences were submitted to the GenBank database under
the accession numbers MF580655MF580675.
To confirm the morphological species determination of
Lipoptena cervi, DNA from four specimens (positive in
Bartonella spp. test and used in Bartonella isolate ana-
lysis), L700F and L1213R primers were used to amplify
and sequence 412 bp fragments of 16S rDNA (Table 1).
In order to perform PCR amplification, the following
mixture reaction was used: 4 μl of DNA extract was
added to 46 μl of reaction mixture consisting of 0.1 μlof
Allegro Taq Polymerase DNA (5 U/μl) (Poznań, Poland),
0.5 μl dNTPs (10 mM), 1 μl of each primer (20 mM),
5μl of 10× Taq DNA polymerase buffer (pH 8.6, 25 mM
MgCl
2
), and 38.4 μl of deionized water.
DNA amplification (L700F/L1213R) was performed
using the DNA Engine PTC-200 Thermal Cycler
(BioRad, Hercules, USA) using the following program:an
initial denaturation was performed at 92 °C for 3 min,
followed by 35 cycles of denaturation at 95 °C for 10 s,
annealing at 60 °C for 10 s and extension at 72 °C for
30 s. The final extension was performed at 72 °C for
5 min and then kept at 12 °C in a thermocycler.
Phylogenetic analyses
We used Bayesian inference (BI) analysis with MrBayes
version 3.2 [42]. Analysis of partial rpoB gene sequence
data was based on an alignment of 804 bp (268 amino
acids) using the GTR + I + G model. The GTR models
were chosen on the basis of jModelTest version 2.1.4
[43, 44] using the Akaike information criterion.
Results
In total, 217 deer keds were collected from 26 red deer
(Cervus elaphus). All insects were identified as Lipop-
tena cervi using morphological features [34]. The preva-
lence of Bartonella spp. infection was 75.12% (163/217)
by PCR test. In the tested group of L. cervi, a greater
Table 1 List of primers sequences used in this study
Primer Sequence (5-3) Reference
L700F AAAGTTTAACCTGCCCACTGAT This study
L1213R CTGAACTCAGATCACGTAAGAAT This study
rpoR CGCATTATGGTCGTATTTGTCC Paziewska et al. [40]
rpoF GCACGATTYGCATCATCATTTTCC Paziewska et al. [40]
1400F CGCATTGGCTTACTTCGTATG Renesto et al. [41]
2300R GTAGACTGATTAGAACGCTG Renesto et al. [41]
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 3 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
proportion of females (86.67%) was found to be positive
for Bartonella spp. than males (60.82%).
PCR, sequence and molecular analyses
Fourteen sequences (Bartonella sp. 1: MF580662
MF580675) obtained in this study share over 99% similarity
with B. schoenbuchensis isolated from moose blood from
Sweden (GenBank: KB915628) and from human blood
from France (GenBank: HG977196). Five sequences Barto-
nella sp. 2 (MF580657MF580661) showed 94.6% similar-
ity with Bartonella sp. 3, and 94.4% with Bartonella sp.
from Japanese sika deer from Japan (AB703149). Bartonella
sp. 3 (MF580656) showed 99.7% similarity with another
samples isolated from Japanese sika deer from Wakayama
Prefecture Japan (AB703149). Bartonella sp. 4 (MF580655)
was 99,7% similar with Bartonella sp. isolated from
Japanese sika deer (Cervus nippon centralis)fromNaraPre-
fecture Japan (AB703146). These results are summarized in
Table 2 and Additional file 1: Table S1.
Four 16S rDNA sequences of deer ked were obtained,
which were identical with Lipoptena cervi collected in the
Czech Republic (AF322437). The sequences derived dur-
ing this study were submitted to the GenBank database
under the accession numbers MF541726MF541729.
Discussion
Our findings indicate the presence of Bartonella species
in deer keds (Lipoptena cervi) obtained from red deer
(Cervus elaphus). Dehio et al. [16] noted that L. cervi
appears to be a natural reservoir supporting the trans-
mission of Bartonella schoenbuchensis. The largest group
of isolates (Bartonella sp. 1) showed closed similarity
with Bartonella schoenbuchensis. Our data indicate a
high prevalence of Bartonella spp. A prevalence of
75.12% was recorded in the whole tested group, a result
similar to global data; however, higher values were
observed in Finland (90%) and France (94%) [14, 37].
Table 2 Bartonella spp. used in the phylogenetic analysis
Isolate/sequence ID Species Host Source Country of isolation
MF580662MF580675 Bartonella sp. 1 Lipoptena cervi whole body Poland
MF580657MF580661 Bartonella sp. 2 Lipoptena cervi whole body Poland
MF580656 Bartonella sp. 3 Lipoptena cervi whole body Poland
MF580655 Bartonella sp. 4 Lipoptena cervi whole body Poland
DQ356077 Bartonella bovis bovine blood Italy
EF432062 B. bovis cow valve (heart) France
KR733195 B. bovis cattle blood Malaysia
KR733194 B. bovis cattle blood Malaysia
KF218224 B. bovis water buffalo blood Thailand
KF218220 B. bovis cattle blood Thailand
KF218218 B. bovis cattle blood Guatemala
KF218217 B. bovis cattle blood France
HM167505 Bartonella capreoli moose blood USA
AB703143 B. capreoli Japanese sika deer blood Japan
AB703142 B. capreoli Japanese sika deer blood Japan
AB703149 Bartonella sp. Japanese sika deer blood Japan
AB703146 Bartonella sp. Japanese sika deer blood Japan
AB703145 Bartonella sp. Japanese sika deer blood Japan
KB915628 Bartonella schoenbuchensis moose blood Sweden
KM215709 Bartonella chomelii cattle blood Spain
KM215710 Bartonella chomelii cattle blood Spain
JN646664 Bartonella chomelii cattle blood New Caledonia
KJ909808 Bartonella bovis cattle blood Israel
AB703148 Bartonella sp. Japanese sika deer blood Japan
AB703144 Bartonella sp. Japanese sika deer blood Japan
HG977196 Bartonella schoenbuchensis human blood France
CP019789 Bartonella schoenbuchensis European roe deer blood Germany
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 4 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
To the best of our knowledge, the present paper is the
first report in Poland to identify differences in the preva-
lence of Bartonella spp. infection in male and female
deer keds. Females were more frequently infected than
males; 86.67% of wingless females were infected by
Bartonella, similar to a study from Hungary (76.0%),
while only 60.82% of wingless males were infected, also
similar to a result in Hungary (58%) [45].
Thereasonforsuchadifferenceininfectionpreva-
lence is not clear; however, it might be associated
with the multiple bites needed for larvae production
(2025 larvae per year) [34]. De Bruin et al. [45]
suggested that Bartonella species are able to colonize
or survive more efficiently as females than males, but
the molecular mechanism for this remains unknown.
The same authors [45] suggested that Bartonella spp.
infection in female deer keds might lead to more
female offspring than uninfected females, possibly
resulting in the observed asymmetry in the female:-
male ratio of infected individuals.
By transmitting pathogens, Lipoptena cervi can be po-
tentially dangerous for animals and humans. A study
Fig. 1 Phylogenetic tree of Bartonella spp., constructed by Bayesian inference (BI) analysis using MrBayes version 3.2. For BI codon analysis
(nucmodel = codon), the GTR + I + G model was chosen based on jModelTest version 2.1.4 [43, 44] using Akaike Information Criterion. Analysis
was run for 8,000,000 generations, with 2,000,000 generations discarded as burn-in. Hosts, country and GenBank accession numbers of origin are
shown. Nodal support is indicated as Bayesian posterior probabilities. Sequence from Brucella melitensis (AY562179) was used as outgroup.
Sequences generated in this study are shown in bold
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 5 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
conducted in Finland found that L. cervi can transmit
some pathogens by biting, and this is associated with
hair-loss epizootics in moose [17]. Since the 1970s, in
Finland an increasing number of cases of recurrent, and
occasionally long-lasting, dermatitis associated with deer
keds bites has been observed [46].
Fourteen of the sequences (Bartonella sp.1,seeTable2.)
isolated from deer keds demonstrated 99.2% homology with
aBartonella schoenbuchensis sample isolated from moose
in Sweden (KB915628). Bartonella schoenbuchensis could
be found in vectors, such as L. cervi or L. mazamae,orin
definitive hosts like cattle, wild ruminants and humans [10,
11, 16]. It is difficult to see how the relationship between B.
schoenbuchensis and deer ectoparasites may relate to simi-
lar cases in humans. Lipoptena cervi has fed on humans
under experimental conditions and in the natural environ-
ment [18, 47]. As humans may be infected with B. schoen-
buchensis during occasional biting by L. cervi, hunters,
forestry workers and cross-country runners, among others,
are at increased risk of infection [16]. Although L. cervi has
not yet been definitively demonstrated to transmit B.
schoenbuchensis through bites, it is possible that hunters
are at risk to infection of Bartonella schoenbuchensis or
Anaplasma phagocytophilum following exposure to deer
blood [48].
In Massachusetts, a Bartonella sp. similar to B. schoen-
buchensis has been found in Lipoptena mazamae [21],
which suggests that Lipoptena species can extend the
range of B. schoenbuchensis. Our phylogenetic analysis of
the partial rpoB gene sequences found that our samples
were in the same clade as other B. schoenbuchensis isolates
from moose (KB915628) and human (HG977196). Barto-
nella schoenbuchensis (strain closely related to B. schoen-
buchensis strain R186.6%, gltA gene) was previously
reported from roe deer (C. capreolus) in Poland [49].
Bartonella sp. 2 (5 isolates) and Bartonella sp. 3
(MF580656) demonstrated high similarity to sequences
obtained from Japanese sika deer from Japan
(AB703149, 94.6% and 99.7% similarity, respectively.
These Bartonella isolates are related with the B. bovis
clade in our phylogenetic analysis (Fig. 1).
Bartonella sp. 4 (MF580655) is very similar (99.7%) to
Bartonella sp. isolates collected from Japanese sika deer
(AB703146, see Fig. 1) and in our phylogenetic analyses
these isolates are associated with other Bartonella sp.
isolates from Japanese sika deer and formed a distinct
clade with Bartonella spp. isolated from Japanese sika
deer. Probably japaneseBartonella isolates were intro-
ducted to Poland. This observation suggests that the
strain of Bartonella sp. bacteria identified in the present
study is derived from Japanese sika deer introduced to
Europe by vectors to environment, indicating that this
Asian strains could be spread by L. cervi to European
red deer (Cervus elaphus).
Some Japanese Bartonella sp. samples, isolated from
different prefectures, comprise a group distinct from
other samples of Bartonella on GenBank; however, fur-
ther testing is required utilizing other genes, including
gltA and ftsZ, to confirm whether they could be regarded
as a distinct species.
Conclusions
Our data confirm that Bartonella spp. can be transmitted
by deer ked in central Europe, and the prevalence of this
pathogen is very high. In this area, Lipoptena cervi are
infected by various species of the genus Bartonella.
Additional files
Additional file 1: Table S1. Pairwise comparison of partial (804 bp)
mitochondrial gene rpoB DNA and amino acid sequences variability
among species/sequences of Bartonella used in phylogenetical analysis.
Above diagonal: number of variable sites in the 268 amino acid gene
rpoB sequences. Below diagonal: number of variable sites in the
nucleotides gene rpoB sequences. The percentage of variable sites for
each gene fragment between 2 species/sequences is given in
parenthesis. Each species isolates/sequence information are provided in
Table 2. (DOCX 23 kb)
Acknowledgements
The authors would like to express their gratitude to Marek Bogdaszewski,
Head of the Research Station in Kosewo Górne (W. Stefański Institute of
Parasitology), for enabling us to collect the samples from red deer.
Funding
No funding was received.
Availability of data and materials
The data supporting the conclusions of this article are included within the
article and its additional file. The sequences were submitted to the GenBank
database under the accession numbers MF580655MF580675 (Uncultured
Bartonella sp.) and MF541726MF541729 (Lipoptena cervi).
Authorscontributions
TS planned and organized the study. JW and ŻSB collected samples. TS and
JW extracted DNA. ZL performed PCR, sequencing and analyzed sequence
data. TS, WJ and ZL drafted the manuscript, and wrote the final version
together with GK. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
PublishersNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Received: 21 April 2017 Accepted: 29 September 2017
References
1. Bai Y, Kandaurov A, Imnadze P, Kosoy M. Molecular survey of bacterial
zoonotic agents in bats from the country of Georgia (Caucasus). PLoS One.
2017;12(1):e0171175.
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 6 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
2. Breitschwerdt EB, Kordick DL. Bartonella infection in animals: carriership,
reservoir potential, pathogenicity, and zoonotic potential for human
infection. Clin Microbiol Rev. 2000;13:42838.
3. Karbowiak G, Rychlik L, Nowakowski W, Wita I. Natural infections of small
mammals with blood parasites on the borderland of boreal and temperate
forest zones. Acta Theriol. 2005;50:3142.
4. Bai Y, Malania L, Alvarez Castillo D, Moran D, Boonmar S, Chanlun A, et al.
Global distribution of Bartonella infection in domestic bovine and
characterization of Bartonella bovis strain using multi-locus sequence typing.
PLoS One. 2013;8(11):e80894.
5. Sato S, Kabeya H, Yamazaki M, Takeno S, Suzuki K, Kobayashi S, et al.
Prevalence and genetic diversity of Bartonella species in sika deer (Cervus
nippon) in Japan. Comp Immunol Microbiol Infect Dis. 2012;35(6):57581.
6. Boulouis HJ, Piemont Y. Bartonella birtlesii sp. nov., isolated from small
mammals (Apodemus spp.). Int J Syst Evol Microbiol. 2000;50:19739.
7. Chomel B. Emerging bacterial zoonoses. Point Veterinaire. 2000;31:1522.
8. Breitschwerdt EB, Maggi RG, Chomel BB, Lapin MR. Bartonellosis: an
emerging infectious diseases of zoonotic importance to animal and
humans being. J Vet Emerg Crit Care (San Antonio). 2010;20:830.
9. Maggi RG, Mozayeni BR, Pultorak EL, Hegarty BC, Bradley JM, Correa M,
Breitschwerdt EB. Bartonella spp. bacteremia and rheumatic symptoms in
patient from Lyme disease-endemic region. Emerg Infect Dis. 2012;18:78391.
10. Dehio C, Lanz C, Pohl R, Behrens P, Bermond D, Piemont Y, Pelz K, Sander
A. Bartonella schoenbuchii sp. nov., isolated from the blood of wild roe deer.
Int J Syst Evol Microbiol. 2001;51:155765.
11. Rolain JM, Rousset E, La Scola B, Duquesnel R, Raoult D. Bartonella
schoenbuchensis isolated from the blood of a French cow. Ann NY Acad Sci.
2003;990:2368.
12. Vayssier-Taussat M, Moutailler S, Fèmènia F, Raymond P, Croce O, La Scola B,
et al. Identification of novel zoonotic activity of Bartonella spp., France.
Emerg Infect Dis. 2016;22:45762.
13. Müller A, Reiter M, Schötta AM, Stockinger H, Stanek G. Detection of
Bartonella spp. in Ixodes ricinus ticks and Bartonella seroprevalence in
human population. Ticks Tick Borne Dis. 2016;7:7637.
14. Halos L, Jamal T, Maillard R, Girard B, Guillot J, Chomel B, et al. Role of
Hippoboscidae flies as potential vector of Bartonella spp. infecting wild
domestic ruminants. Appl Environ Microbiol. 2004;70(10):63025.
15. Sytykiewicz H, Karbowiak G, Werszko J, Czerniewicz P, Sprawka I, Mitrus J.
Molecular screening for Bartonella henselae and Borrelia burgdorferi sensu
lato co-existence within Ixodes ricinus populations in central and eastern
parts of Poland. Ann Agric Environ Med. 2012;19(3):4516.
16. Dehio C, Sauder U, Hiestand R. Isolation of Bartonella schoenbuchensis in
Lipoptena cervi, a blood-sucking arthropod causing deer ked dermatitis. J
Clin Microbiol. 2004;42(11):53203.
17. Madslien K, Ytrehus B, Vikøren T, Malmsten J, Isaksen K, Hygen HO, Solberg
EJ. Hair-loss epizootic in moose (Alces alces) associated with massive deer
ked (Lipoptena cervi) infestation. J Wild Dis. 2011;47(4):893906.
18. Bequaert JC. Monograph of the Melophaginae of ked-flies of sheep, goats, deer
and antelopes (Diptera, Hippoboscidae). Bull Brooklyn Ent Soc. 1942;22:1220.
19. Maa TCA. synopsis of the Lipopteninae (Diptera: Hippoboscidae). J Med
Entomol. 1965;2:23348.
20. Valimaki P, Madslien K, Malmsten J, Harkonen I, Harkonen S, Kaitala A, et al.
Fennoscandian distribution of an important parasite of cervids, the deer ked
(Lipoptena cervi), revisted. Parasitol Res. 2010;107:11725.
21. Reeves WK, Nelder MP, Cobb KD, Dasch GA. Bartonella spp. in deer keds,
Lipoptena mazamae (Diptera: Hippoboscidae), from Georgia and South
Carolina, USA. J Wildl Dis. 2006;42(2):3916.
22. Kettle DS. Medical and veterinary entomology. London, UK: Croom Helm.
1984:28592.
23. Haigh JC, Mackintosh C, Griffin F. Viral, parasitic and prion diseases of
farmed deer and bison. Rev Sci Tech (Int Off Epizoot). 2002;21:219.
24. Pérez-Espona S, Pemberton JM, Putman R. Red and sika deer in the British Isles,
current management issues and management policy. Mamm Biol. 2009;74:24762.
25. SokółR, Gałęcki R. Prevalence of keds on city dogs in central Poland. Med
Vet Entomol. 2017;31:1146.
26. Kowal J, Nosal P, Rościszewska M, Matysek M. [New records of Lipoptena
fortisetosa MAA, 1965 (Diptera: Hippoboscidae) in Poland.] Dipteron. 2009;
25:279 (In Polish).
27. Kowal J, Nosal P, KornaśS, Wajdzik M, Matysek M, Basiaga M, Różnorodność
i. znaczenie muchówek z rodziny narzępikowatych - pasożytów
jeleniowatych. Med Weter. 2016;72:7459.
28. Matsumoto K, Berrada ZL, Klinger E, Goethert HK, Telford SR. Molecular
detection of Bartonella schoenbuchensis from ectoparasites of deer in
Massachusetts. Vector Borne Zoonotic Dis. 2008;8(4):54954.
29. Chistyakov AF. Skin lesions in people due to bites of Lipoptena cervi. Vestn
Dermatol Venerol. 1968;42:5962.
30. Rantanen T, Reuanala T, Vuojolahti P, Hackman W. Presistent pruritic papules
from deer ked bites. Acta Derm Venereol. 1982;62:30711.
31. Haarlov N. Life cycle and distribution pattern of Lipoptena cervi (L.) (Dipt.
Hippobosc.) on Danish deer. Oikos. 1964;15:93129.
32. Madslien K, Ytrehus B, Vilijugrein H, Solberg EJ, Braten KR, Mysterud AA.
factors affecting deer ked (Lipoptena cervi) prevalence and intensity in
moose (Alces alces) in Norway. Parasit Vectors. 2012;5:251.
33. Mysterud A, Madslien K, Herland A, Viljugrein H, Ytrehus B. Phenology of
deer ked (Lipoptena cervi) host-seeking flight activity and its relationship
with prevailing autumn weather. Parasit Vectors. 2016;9:95.
34. Borowiec L. [Wpleszczowate Hippoboscidae. Klucze do oznaczania owadów
Polski.] Część XXVIII/77 77. Wrocław 1984 (In Polish).
35. Kortet R, Härkönen L, Hokkanen P, Härkönen S, Kaitala A, Kaunisto S, et al.
Experiments on the ectoparasitic deer ked that often attacks humans;
preferences for body parts, colo ur and temp erature. Bull Entomol Res.
2010;100:27985.
36. Buss M, Case L, Kearney B, Coleman C, Henning JD. Detection of Lyme
disease and anaplasmosis pathogens via PCR in Pennsylvania deer ked. J
Vector Ecol. 2016;41:2924.
37. Korhonen EM, Pèrez Vera C, Pulliainen AT, Sironen T, Aaltonen K, Kortet R, et
al. Molecular detection of Bartonella spp. in deer ked pupae, adult keds and
moose blood in Finland. Epidemiol Infect. 2014;143:57885.
38. Samuel W, Trainer D. Lipoptena mazamae Rondani, 1878 (Diptera:
Hippoboscidae) on white-tailed deer in southern Texas. J Med Entomol.
1972;9:1046.
39. Adamska M. Infestation of game animals from north-western Poland by
common tick (Ixodes ricinus). Wiadi Parazytol. 2008;54:316.
40. Paziewska A, Harris PD, Zwolińska L, Bajer A, Siński E. Recombination within
and between species of the alpha proteobacterium Bartonella infecting
rodents. Microb Ecol. 2011;61:13445.
41. Renesto P, Gouvernet J, Drancourt M, Roux V, Raoult D. Use of rpoB analysis
for detection and identification of Bartonella species. J Clin Microbiol. 2001;
3(2):4307.
42. Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic
trees. Bioinformatics. 2001;17:7545.
43. Guindon S, Gascuel OA. simple, fast, and accurate algorithm to estimate
large phylogenies by maximum likelihood. Syst Biol. 2003;52:696704.
44. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models,
new heuristics and paralel computing. Nat Methods. 2012;9(8):772.
45. de Bruin A, van Leeuwen AD, Jahfari S, Takken W, Földvári M, Dremmel L, et
al. Vertical transmission of Bartonella schoenbuchensis in Lipoptena cervi.
Parasit Vectors. 2015;8:176.
46. Härkönen S, Laine M, Vornanen M, Reunala T. Deer ked (Lipoptena cervi )
dermatitis in humans - an increasing nuisance in Finland. Alces. 2009;45:739.
47. Starzyk J. Strzyżak sarni, Lipoptena cervi (L.) (Diptera, Hippoboscidae) -
pasożyt zewnętrzny parzystokopytnych. Prz. Zool. 1975;17:4468.
48. Telford SR III, Bakken JS, Dumler JS. Risk for acquiring huma n
granulocytic ehrlichiosis: exposure to deer blood or deer ticks? Clin
Infect Dis. 1997;24:5313.
49. Welc-Falęciak R, Werszko J, Cydzik K, Bajer A, Michalik J, Behnke JM. Co-
infection and genetic diversity of tick-borne pathogens in roe deer from
Poland. Vector Borne Zoonotic Dis. 2013;13:27788.
Szewczyk et al. Parasites & Vectors (2017) 10:487 Page 7 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
... This fact contributed to the increased interest in the potential involvement of these arthropods in maintenance of foci of zoonotic diseases. In north-eastern Poland, researchers detected in L. cervi sequences of Bartonella sp. with 99% similarity with B. schoenbuchensis [44]. The presence of Bartonella sp. was also noted in L. fortisetosa sampled from cervids and from the environment in the northern and western parts of the country [23]. ...
... For instance, Bartonella DNA was detected in 85% of wingless adults of L. cervi collected from free-ranging cervids in Norway [64], and even in 94% of these deer keds collected from roe deer in France [35]. In Mazury forests (northern part of Poland), Szewczyk et al. showed the prevalence of Bartonella sp. in these insects at the level of 75.12% [44]. The latest data from northern and western Poland indicate the presence of Bartonella sp. in 49.4% of L. fortisetosa adults [23]. ...
... obtained by Szewczyk et al. showed 94.4% similarity with Bartonella sp. from Japanese sika deer (GenBank accession no. AB703149) [44]. In turn, the two other sequences showed 99.7% similarity with Bartonella sp. ...
Article
Full-text available
Simple Summary: Lipoptena fortisetosa is a hematophagous ectoparasite of game animals feeding accidentally on companion animals and humans. Since the presence of numerous pathogenic microorganisms has been described in this species, monitoring its geographic distribution is of great epidemiological importance. To the best of our knowledge, we present two new haplotypes of Bar-tonella sp. isolated from L. fortisetosa in southeastern Poland and confirm the presence of this inva-sive species in Lublin Voivodeship since 2013. Abstract: Insects of the genus Lipoptena are parasitic arthropods with a broad host range. Due to the type of parasitism (hematophagy), their potential role as vectors of pathogens, i.e., Bartonella sp., Anaplasma phagocytophilum, Rickettsia spp., and Borrelia burgdorferi is considered. As the range of their occurrence has been changing dynamically in recent years and infestations of humans have increasingly been reported, these organisms are now the subject of numerous studies. Our research aimed to present the molecular characteristics of Bartonella sp. detected in Lipoptena fortisetosa para-sitizing wild cervids in southeastern Poland. Adults of Lipoptena spp. were collected from carcasses of roe deer and red deer between spring and autumn in 2013. The PCR method was used to detect Bartonella sp. in the insects. We report two new haplotypes of the rpoB gene of Bartonella sp. isolated from L. fortisetosa feeding on wild cervids in southeastern Poland and the presence of this invasive ectoparasitic species in the studied area since 2013. Phylogenetic analyses of newly obtained Bar-tonella sp. haplotypes confirmed their unique position on the constructed tree and network topol-ogy. The rpoB gene sequences found belonging to lineage B support the view that this phylogenetic lineage represents a novel Bartonella species.
... Lipoptena fortisetosa is a potential vector of infectious diseases. Deer keds can act as carriers of Bartonella spp., and the vertical transmission of this pathogen poses a particularly serious problem [22][23][24]. In recent research, Bartonella spp. of Japanese origin were isolated from L. cervi in the region of Warmia and Mazury in Poland [22]. ...
... Deer keds can act as carriers of Bartonella spp., and the vertical transmission of this pathogen poses a particularly serious problem [22][23][24]. In recent research, Bartonella spp. of Japanese origin were isolated from L. cervi in the region of Warmia and Mazury in Poland [22]. According to Szewczyk et al. [22], the isolated Bartonella spp. ...
... In recent research, Bartonella spp. of Japanese origin were isolated from L. cervi in the region of Warmia and Mazury in Poland [22]. According to Szewczyk et al. [22], the isolated Bartonella spp. strain had originated from Japanese sika deer that were introduced to Europe, and it was transmitted to the local environment by various vectors. ...
Article
Full-text available
Recent years have witnessed an increase in the population of Lipoptenafortisetosa in Central Europe. The genetic profile of this ectoparasite has not been studied in Poland to date. The aim of the present study was to confirm the presence of L.fortisetosa in north-eastern Poland and to characterize the examined population with the use of molecular methods. Deer keds were collected between June and July 2019 in six natural, mixed forests. A fragment of the rRNA 16S gene was used as a marker to identify L.fortisetosa by polymerase chain reaction (PCR). DNA samples were sequenced in the last step. Six new locations of L. fortisetosa were confirmed. No significant differences were observed in the sex ratios of L. cervi and L. fortisetosa (L. cervi p-value = 0.74; L. fortisetosa p-value = 0.65). Significant differences were noted between the total size of L. cervi and L. fortisetosa populations (p-value < 0.001). The similarity to GenBank sequences ranged from 95.56% to 100%. The obtained nucleotide sequences were very closely related to L. fortisetosa sequences from Lithuania, the Czech Republic, and Japan. Molecular analyses revealed considerable genetic diversity, which could indicate that various ectoparasite lineages have spread throughout Europe.
... It is possible that with the introduction of this species to Poland, the pathogen expanded in the population of native cervids. The possible presence of another pathogen of Japanese origin (Bartonella spp.) was also suggested in other studies [43]. ...
... [35]. Currently, Bartonella spp. is the most comprehensively studied pathogen carried by Lipoptena spp., which appears to pose the greatest risk in infestation with these ectoparasites [40][41][42][43]. ...
Article
Full-text available
Deer keds are obligatory hematophagous ectoparasites of birds and mammals. Cervids serve as specific hosts for these insects. However, ked infestations have been observed in non-specific hosts, including humans, companion animals, and livestock. Lipoptena fortisetosa is a weakly studied ectoparasite, but there is evidence to indicate that it continues to spread across Europe. The existing knowledge on deer keds’ impact on wildlife is superficial, and their veterinary importance is enigmatic. Lipoptena fortisetosa is a species with vectorial capacity, but potential pathogen transmission has not been assessed. The objective of this study was to evaluate the prevalence of selected pathogens in L. fortisetosa collected from cervids and host-seeking individuals in the environment. Out of 500 acquired samples, 307 (61.4%) had genetic material from at least one tested pathogen. Our research suggests that L. fortisetosa may be a potential vector of several pathogens, including A. phagocytophilum, Babesia spp., Bartonella spp., Borellia spp., Coxiella-like endosymbionts, Francisiella tularensis, Mycoplasma spp., Rickettsia spp., and Theileria spp.; however, further, more extensive investigations are required to confirm this. The results of the study indicate that keds can be used as biological markers for investigating the prevalence of vector-borne diseases in the population of free-ranging cervids.
... Moreover, they can play an important role as carriers of pathogens, mainly Anaplasma spp., Bartonella spp., Borrelia spp., Coxiella spp., Theileria spp., and Trypanosoma spp. [11][12][13][14][15][16][17]. Recently, the Asian species L. fortisetosa has colonized most European countries, including Italy, where it is competing with L. cervi for territories and host microniches [18]. ...
Article
Full-text available
Lipoptena cervi (Linnaeus), Lipoptena fortisetosa Maa, Hippobosca equina Linnaeus, and Pseudolynchia canariensis (Macquart) are hematophagous ectoparasites that infest different animal species and occasionally bite humans. Hosts are located by a complex process involving different kinds of stimuli perceived mainly by specific sensory structures on the antennae, which are the essential olfactory organs. General antennal morphology, together with distribution and ultrastructure of sensilla, have been studied in detail with scanning and transmission electron microscopy approaches. Observations have revealed some common features among the four studied hippoboscids: (a) typical concealment of the flagellum inside the other two segments; (b) characteristic trabecular surface of the flagellum; (c) peculiar external microtrichia; (d) presence on the flagellum of basiconic sensilla and grooved peg coeloconic sensilla; (e) unarticulated arista. The ultrastructure of L. fortisetosa revealed that microtrichia and the flagellar reticulated cuticle are not innervated. Different roles have been hypothesized for the described antennal structures. Microtrichia and the reticulated cuticle could convey volatile compounds towards the flagellar sensory area. Peculiar sensory neurons characterize the unarticulated arista which could be able to detect temperature variations. Coeloconic sensilla could be involved in thermoreception, hygroreception, and carbon dioxide reception at long distances, while the poorly porous basiconic sensilla could play a role in the host odour perception at medium–short distances.
... [21][22][23][24][25][26], Bartonella spp. [23,[27][28][29][30][31][32][33][34], Borrelia spp. [24,35], Ehrlichia spp. ...
Article
Full-text available
Background White-tailed deer ( Odocoileus virginianus ) host numerous ectoparasitic species in the eastern USA, most notably various species of ticks and two species of deer keds. Several pathogens transmitted by ticks to humans and other animal hosts have also been found in deer keds. Little is known about the acquisition and potential for transmission of these pathogens by deer keds; however, tick-deer ked co-feeding transmission is one possible scenario. On-host localization of ticks and deer keds on white-tailed deer was evaluated across several geographical regions of the eastern US to define tick-deer ked spatial relationships on host deer, which may impact the vector-borne disease ecology of these ectoparasites. Methods Ticks and deer keds were collected from hunter-harvested white-tailed deer from six states in the eastern US. Each deer was divided into three body sections, and each section was checked for 4 person-minutes. Differences in ectoparasite counts across body sections and/or states were evaluated using a Bayesian generalized mixed model. Results A total of 168 white-tailed deer were inspected for ticks and deer keds across the study sites. Ticks ( n = 1636) were collected from all surveyed states, with Ixodes scapularis ( n = 1427) being the predominant species. Counts of I. scapularis from the head and front sections were greater than from the rear section. Neotropical deer keds ( Lipoptena mazamae ) from Alabama and Tennessee ( n = 247) were more often found on the rear body section. European deer keds from Pennsylvania (all Lipoptena cervi , n = 314) were found on all body sections of deer. Conclusions The distributions of ticks and deer keds on white-tailed deer were significantly different from each other, providing the first evidence of possible on-host niche partitioning of ticks and two geographically distinct deer ked species ( L. cervi in the northeast and L. mazamae in the southeast). These differences in spatial distributions may have implications for acquisition and/or transmission of vector-borne pathogens and therefore warrant further study over a wider geographic range and longer time frame. Graphical Abstract
... Halos et al. [11] first demonstrated that Bartonella bacteria were present at a high rate (93.8%) in wingless L. cervi collected from French roe deer. Since then, it has been reported that Bartonella bacteria are prevalent also in the keds collected from red deer and roe deer in Hungary [14] and Poland [27] and from moose in Norway [28]. Likewise, Bartonella DNAs were detected from both wingless L. cervi (83.3%) [13] and wingless L. mazamae (28.9%) collected from white-tailed deer in the USA [29], and from 100% of wingless L. mazamae collected from gray brocket deer in Brazil [30]. ...
Article
Full-text available
Background Two species of deer ked ( Lipoptena cervi and L. mazamae ) have been identified as vectors of Bartonella bacteria in cervids in Europe and the USA. In an earlier study we showed that Japanese sika deer ( Cervus nippon ) harbor three Bartonella species, namely B. capreoli (lineage A) and two novel Bartonella species (lineages B and C); however, there is currently no information on the vector of Bartonella bacteria in sika deer. The aim of this study was to clarify potential vectors of Bartonella in Japanese sika deer. Methods Thirty-eight wingless deer keds ( L. fortisetosa ) and 36 ticks ( Haemaphysalis and Ixodes species) were collected from sika deer. The prevalence of Bartonella in the arthropods was evaluated by real-time PCR targeting the 16S−23S internal transcribed spacer (ITS) and by culture of the organisms. The total number of Bartonella bacteria were quantified using real-time PCR. The distribution of Bartonella bacteria in deer ked organs was examined by immunofluorescence analysis. The relationship of Bartonella strains isolated from sika deer and arthropods were examined by a phylogenetic analysis based on concatenated sequences of the gltA , rpoB , ftsZ , and ribC genes, followed by a BLAST search for gltA and rpoB . Results Bartonella prevalence in deer keds was 87.9% by real-time PCR and 51.5% in culture and that in the ticks was 8.3% by real-time PCR and 2.8% in culture. The mean number of Bartonella bacteria per ked was calculated to be 9.2 × 10 ⁵ cells. Bartonella aggregates were localized in the midgut of the keds. The phylogenetic analysis and BLAST search showed that both the host deer and the keds harbored two Bartonella species (lineages B and C), while B. capreoli (lineage A) was not detected in the keds. Two novel Bartonella species (lineages D and E) were isolated from one ked. Conclusions Lipoptena fortisetosa likely serves as a vector of at least two Bartonella species (lineages B and C), whereas ticks do not seem to play a significant role in the transmission of Bartonella between sika deer based on the lower detection rates of Bartonella in ticks compared to keds. Bartonella species in lineages D and E appear to be L. fortisetosa -specific strains.
... Lipoptena cervi has been recorded on Cervus elaphus, Dama dama, Alces alces, Rupicapra rupicapra, Capreolus capreolus, Moschus moschiferus [9] and it has the potential to transmit bacteria e.g., Bartonella spp., Borrelia spp. [12][13][14], Anaplasma spp., Ehrlichia spp., and Rickettsia spp., and protozoans, e.g., Babesia spp., Theileria spp., Hepatozoon spp. [15][16][17]. ...
Article
Full-text available
In Europe, 5 Lipoptena species have been recorded, including Lipoptena fortisetosa . This species, native to Asian countries, was described as a parasite of sika deer and its appearance in Europe dates back to more than 50 years ago. Lipoptena fortisetosa has been recently reported in Italy, sharing its hosts with Lipoptena cervi . A morpho-molecular approach was developed to determine the phylogenetic interrelationship of Italian and Asian CO 1 haplotypes sequenced from Lipoptena fly individuals collected in Italy, and their DNA sequences were compared with conspecifics available in GenBank; morphological key-characters (terminalia) of L. fortisetosa were compared with the original description. Two haplotypes were recorded from Italy and assigned to L. cervi and L. fortisetosa , respectively. The latter was part of the monophyletic clade L. fortisetosa , along with 2 Central European and 2 Korean haplotypes (100% identical with one of the Korean haplotypes); moreover, Italian L. fortisetosa female terminalia were consistent with the original description of Asian individuals. Pending more in-depth investigations, this study provides a first answer to the hypothesis of the recent colonization of Italy by L. fortisetosa from Asia as we did not detect any obvious and stable morphological and molecular differences in specimens from the 2 geographical areas. The presence of the sika deer in Europe was retraced and the possible route traveled by the parasite from Asia and the eco-biological factors that may have enhanced its settlement are discussed.
Article
Full-text available
Background: Livestock are key sources of livelihood among pastoral communities. Livestock productivity is chiefly constrained by pests and diseases. Due to inadequate disease surveillance in northern Kenya, little is known about pathogens circulating within livestock and the role of livestock-associated biting keds (genus Hippobosca ) in disease transmission. We aimed to identify the prevalence of selected hemopathogens in livestock and their associated blood-feeding keds. Methods: We randomly collected 389 blood samples from goats (245), sheep (108), and donkeys (36), as well as 235 keds from both goats and sheep (116), donkeys (11), and dogs (108) in Laisamis, Marsabit County, northern Kenya. We screened all samples for selected hemopathogens by high-resolution melting (HRM) analysis and sequencing of PCR products amplified using primers specific to the genera: Anaplasma, Trypanosoma, Clostridium, Ehrlichia, Brucella, Theileria, and Babesia. Results: In goats, we detected Anaplasma ovis (84.5%), a novel Anaplasma sp. (11.8%), Trypanosoma vivax (7.3%), Ehrlichia canis (66.1%), and Theileria ovis (0.8%). We also detected A. ovis (93.5%), E. canis (22.2%), and T. ovis (38.9%) in sheep. In donkeys, we detected ‘ Candidatus Anaplasma camelii’ (11.1%), T. vivax (22.2%), E. canis (25%), and Theileria equi (13.9%). In addition, keds carried the following pathogens; goat/sheep keds - T. vivax (29.3%) , Trypanosoma evansi (0.86%), Trypanosoma godfreyi (0.86%), and E. canis (51.7%); donkey keds - T. vivax (18.2%) and E. canis (63.6%); and dog keds - T. vivax (15.7%), T. evansi (0.9%), Trypanosoma simiae (0.9%) , E. canis (76%), Clostridium perfringens (46.3%), Bartonella schoenbuchensis (76%), and Brucella abortus (5.6%). Conclusions: We found that livestock and their associated ectoparasitic biting keds carry a number of infectious hemopathogens, including the zoonotic B. abortus . Dog keds harbored the most pathogens, suggesting dogs, which closely interact with livestock and humans, as key reservoirs of diseases in Laisamis. These findings can guide policy makers in disease control.
Article
The deer ked Lipoptena mazamae (Diptera: Hippoboscidae) (Róndani), is a blood‐feeding obligate ectoparasite of several species of deer and brocket. However, at present little information is available about its role as a vector of hemoparasites. Nonetheless, it is considered a competent vector for the transmission of Bartonella species. The aim of this study was performing the morphological and molecular identification of ked flies and to carry out the detection of Bartonella. We collected specimens from Chiná, Campeche, Mexico associated with white‐tailed deer. Using polymerase chain reaction (PCR), of COI, gltA and rpoB genes, we were able to obtain the first barcode for L. mazamae from Mexico and identified a new species of Bartonella which was found with a prevalence of 73%. The data obtained in this study confirmed the presence of L. mazamae associated with white‐tailed deer and its possible role as vector of Candidatus Bartonella odocoilei n. sp. in Mexico and we considered that it may also be present in white‐tailed deer populations in the U.S.A. Additional investigations into Bartonella species associated with deer ked could provide further insight into their pathogenicity and its role as a zoonotic agent. The deer ked Lipoptena mazamae was identified using the COI gene for the first time for Mexico. Bartonella sp. was detected in deer ked in Campeche; using rpoB and gltA genes, we detected a new linage temporarily named as Candidatus Bartonella odocoilei. The role of Lipoptena mazamae in the transmission of Candidatus Bartonella odocoilei, in Campeche is very probable, however, additional entomological surveys are necessary.
Article
Full-text available
Bartonellae are emerging vector‐borne pathogens infecting humans, domestic mammals and wildlife. Ninety‐seven red foxes (Vulpes vulpes), 8 European badgers (Meles meles), 6 Eurasian wolves (Canis lupus), 6 European hedgehogs (Erinaceus europaeus), 3 beech martens (Martes foina) and 2 roe deer (Capreolus capreolus) from Italian Nature Conservatory Parks were investigated for Bartonella infection. Several Bartonella species (9.84%; 95% CI: 4.55–15.12), including zoonotic ones, were molecularly detected among wolves (83.3%; 95% CI: 51–100.00), foxes (4.12%; 95% CI: 0.17–8.08), hedgehogs (33.33%; 95% CI: 0.00–71.05) and a roe deer. Bartonella rochalimae was the most common Bartonella species (i.e. in 4 foxes and 2 wolves) detected. Candidatus B. merieuxii and B. vinsonii subsp. berkhoffii were identified for the first time in wolves. Furthermore, Bartonella schoenbuchensis was identified in a roe deer and a new clone with phylogenetic proximity to B. clarridgeiae was detected in European hedgehogs. Zoonotic and other Bartonella species were significantly more frequent in Eurasian wolves (p < .0001), than in other free‐ranging wild mammals, representing a potential reservoir for infection in humans and domestic animals.
Article
Full-text available
Bats are important reservoirs for many zoonotic pathogens. However, no surveys of bacterial pathogens in bats have been performed in the Caucasus region. To understand the occurrence and distribution of bacterial infections in these mammals, 218 bats belonging to eight species collected from four regions of Georgia were examined for Bartonella, Brucella, Leptospira, and Yersinia using molecular approaches. Bartonella DNA was detected in 77 (35%) bats from all eight species and was distributed in all four regions. The prevalence ranged 6–50% per bat species. The Bartonella DNA represented 25 unique genetic variants that clustered into 21 lineages. Brucella DNA was detected in two Miniopterus schreibersii bats and in two Myotis blythii bats, all of which were from Imereti (west-central region). Leptospira DNA was detected in 25 (13%) bats that included four M. schreibersii bats and 21 M. blythii bats collected from two regions. The Leptospira sequences represented five genetic variants with one of them being closely related to the zoonotic pathogen L. interrogans (98.6% genetic identity). No Yersinia DNA was detected in the bats. Mixed infections were observed in several cases. One M. blythii bat and one M. schreibersii bat were co-infected with Bartonella, Brucella, and Leptospira; one M. blythii bat and one M. schreibersii bat were co-infected with Bartonella and Brucella; 15 M. blythii bats and three M. schreibersii bats were co-infected with Bartonella and Leptospira. Our results suggest that bats in Georgia are exposed to multiple bacterial infections. Further studies are needed to evaluate pathogenicity of these agents to bats and their zoonotic potential.
Article
Full-text available
Background: The deer ked (Lipoptena cervi) is an ectoparasite on cervids that has invaded large parts of Norway, Sweden and Finland during recent decades. During their host-seeking flight activity, the adult deer keds constitute a considerable nuisance to people and limit human outdoor recreation. The bites of the deer ked can cause long-lasting dermatitis in humans. Determining the pattern of flight activity during autumn is hence important. Methods: Data on flight phenology was gathered by walking along transects in the forest in two counties of Norway during 2009-2013, counting the number of host-seeking keds. We analysed how the flight activity of deer keds varied depending on date and prevailing weather during autumn. Results: The best model of flight activity included both date and temperature, both as nonlinear terms. Host-seeking deer keds were observed from early August to mid-November with a marked peak in late September. Number of host-seeking keds declined with temperatures falling below the mean, but did not increase much at above mean temperatures. The pattern of flight phenology was similar across the two counties and five years. Conclusions: Parasitic arthropods may be strongly affected by prevailing weather during off-host periods. Our study shows an estimated positive effect of temperature on deer ked flight activity mainly for below mean temperatures in late autumn, while the effect of temperature on flight activity in early autumn was weak. The pattern of host-seeking flight activity during late, rather than early autumn, is hence more likely to change with ongoing climate change, with a predicted increase in duration of the host-seeking period.
Article
Full-text available
Certain Bartonella species are known to cause afebrile bacteremia in humans and other mammals, including B. quintana, the agent of trench fever, and B. henselae, the agent of cat scratch disease. Reports have indicated that animal-associated Bartonella species may cause paucisymptomatic bacteremia and endocarditis in humans. We identified potentially zoonotic strains from 6 Bartonella species in samples from patients who had chronic, subjective symptoms and who reported tick bites. Three strains were B. henselae and 3 were from other animal-associated Bartonella spp. (B. doshiae, B. schoenbuchensis, and B. tribocorum). Genomic analysis of the isolated strains revealed differences from previously sequenced Bartonella strains. Our investigation identifed 3 novel Bartonella spp. strains with human pathogenic potential and showed that Bartonella spp. may be the cause of undifferentiated chronic illness in humans who have been bitten by ticks.
Article
Borrelia burgdorferi and Anaplasma phagocytophilum are obligate intracellular parasites that maintain their life cycles in enzoonotic vector-host cycles with Ixodes scapularis as a vector. In addition to ticks, the hosts are commonly infested with insects from the Hippoboscidae family. This study confirms the presence of B. burgdorferi and A. phagocytophilum in deer keds (Lipoptena cervi) removed from white-tailed deer using PCR. Detection of these pathogens in deer ked represents a potential novel susceptibility of wildlife and also suggests the risk of transmission of these pathogens to humans and animals alike through the bite of an infected ectoparasite. This study represents the first instance in the U.S. of detection of tick-borne pathogens in a member of the Hippoboscid family.
Article
The aim of this study was to identify the species of ked infesting dogs in the cities of central Poland. A total of 510 dogs were observed between June and September 2015. The presence of keds was noted in 182 (35.7%) animals. Keds were more prevalent in female (38.0%) than in male (33.2%) dogs, and were more frequently found in animals younger than 1 year (46.2%) and in long-haired dogs (36.6%). The body areas most heavily colonized by keds were the groin (35.4%) and neck (21.4%). A total of 904 keds were isolated from dogs, including Hippobosca equina (Diptera: Hippoboscidae) (17.2%), Lipoptena cervi (Diptera: Hippoboscidae) (32.0%), and two species not previously encountered in Poland: Hippobosca longipennis (45.0%) and Lipoptena fortisetosa (5.9%). Hippoboscidae may act as vectors of pathogens and any shifts in their geographic range may lead to the spread of new diseases affecting animals.
Article
Ticks are vectors for many bacterial, protozoan and viral pathogens and are potential vectors for Bartonella species. Hunters and foresters, therefore, may be regarded as high-risk groups for Bartonella infections. The aims of this study were (i) to identify Bartonella species in questing Ixodes ricinus ticks collected in all provinces of Austria, and (ii) to determine the prevalence of antibodies to Bartonella species in hunters and blood donors in eastern Austria. A total of 515 larval, nymphal and adult I. ricinus, collected throughout Austria in 2005, were selected from the tick library at the Institute for Hygiene and Applied Immunology of the Medical University of Vienna and screened in a specific real-time PCR that targeted a region of the ssrA gene of Bartonella species. The overall Bartonella infection rate was 2.1% (11/515) and the highest rate, 7.5% (4/53), was found in ticks from Vienna. This finding was confirmed by screening a further 60 I. ricinus collected from Vienna in 2013: of these, 6.7% (4/60) were positive for Bartonella spp. The rate of infection was always higher in adult ticks. Sequence analysis in the Bartonella-positive ticks identified several species, including B. henselae, B. doshiae and B. grahamii. To our knowledge this is the first time that these species have been identified in I. ricinus in Austria. Prevalence of IgG antibodies against B. henselae and B. quintana was determined in serum samples from hunters (100) and blood donors (100): in hunters 23% were positive for B. quintana and in 2 samples (2%), antibodies to both B. quintana and B. henselae were detected; in blood donors 22% were positive for B. quintana, 1% for B. henselae and 5% for both. These results indicate that exposure to ticks does not constitutes a relevant risk for Bartonella infection.
Article
Improved epidemiological surveillance and use of new diagnostic techniques has enabled the recent discovery or provided improved information on existing infections of numerous zoonoses of bacterial origin. The main factors causing emergence or re-emergence include changes to the environment, intensive production of food products and growth of international transport of these products, human demography and behaviour, as well as bacterial adaptation to a new environment. An emergence or re-emergence of bacterial zoonoses originating from food (salmonellosis, Escherichia coli infections, etc.). resulting from pets (salmonellosis, plague, Q fever), associated with immunodepression (Rhodococcus equi infection, Bartonella henselae infection, etc.) or due to vectoral transmission (Lyme disease, ehrlichiosis, etc.) has been observed (4 figures, 1 table, 1 box, 43 references).