No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Risk-assessment of isolated isoflavones intake on human health
Abstract
Background:
Isoflavones are naturally occurring flavonoids, commonly found in the food consumed for centuries in the East-Asian population, characterized by a structure able to exert nonsteroidal estrogen-like activity on human cells. They have attracted researcher interest all around the word, following the results obtained in epidemiological and clinical studies. The involvement of isoflavones and their metabolites in various biological processes suggests that they can influence several metabolic pathways and can influence the gene expression at epigenetic level, involving effects that probably are due to early life exposure. They show positive health effects on several diseases, especially in the prevention of coronary heart and neurological diseases, hormone-related cancers, osteoporosis, and postmenopausal symptoms.
Methods:
We have performed a critical evaluation of available literature trough a structured search of bibliographic databases about isoflavones health promoting properties, risk assessment and mechanisms of action. In addition, we supplied useful information on their biochemical properties, sources and bioavailability.
Results:
Although these molecules have been the subjects of numerous researches, their role for the wellness of the human organism remains controversial. Moreover, there are substantial inconsistencies between the results obtained by epidemiologic studies conducted on Eastern population, which found high health promoting properties, and Western clinical trials, which found much less positive effects.
Conclusion:
Further epidemiologic studies and well-designed prospective human studies are to determine the beneficial effects of isoflavones exposure, as well as establishing its safe therapeutic.
... Dietary supplements containing phytoestrogens have been available since the 1990s and have been promoted mainly as natural alternatives to menopausal hormone therapy (MHT), the most effective treatment for symptoms due to estrogen deprivation such as hot flushes, night sweats, or vaginal dryness. Most of these supplements contain soy extracts rich in phytoestrogens, called isoflavones, which can exert estrogenlike effects (1). Although there is no conclusive evidence that phytoestrogen supplements effectively reduce menopausal symptoms (2,3), soy supplement sales likely benefited from the reporting in 2002-2003 that MHT increased cardiovascular and breast cancer risk (4,5). ...
... No current use in Q2000 1 Neither current nor past use Neither current nor past use Neither current nor past use 1 Values are as n (%) or means ± SDs; n = 76,442. At the end of follow-up, 247 women were in the "unknown exposure" category (not shown). ...
... Classification of exposure to dietary supplements in soy isoflavones during follow-up (E3N cohort, 2000-2011). The arrow shows the followup cycles (start date-end date) during which the exposure definitions (below the arrow) apply.1 Reasonable assumption since, in France, the soy supplement market expanded only from 1998(6). ...
Objectifs : Les compléments alimentaires à base d’isoflavones de soja sont présentés comme une alternative naturelle au traitement hormonal de la ménopause. Leur effet potentiel sur le risque de cancer du sein, jusqu’à présent rarement évalué « en vie réelle », est controversé. Nous avons donc étudié l’association entre la consommation de ces compléments alimentaires et le risque de cancer du sein de manière prospective dans une cohorte de femmes âgées de plus de 50 ans.
Méthode : Au total, 76 442 femmes de la cohorte E3 N, nées entre 1925 et1950, ont été suivies entre les années 2000 et 2011 (11,2 années en moyenne) durant lesquelles 3608 cas incidents de cancers du sein sont survenus. Des informations sur leur consommation de compléments alimentaires à base de soja ont été recueillies tous les deux à trois ans. Des modèles de Cox multivariés nous ont permis d’estimer les risques relatifs (RR) de cancer du sein associés à une consommation en cours ou passée de compléments alimentaires à base de soja,ainsi que leurs intervalles de confiance (IC) à 95 %.
Résultats La prise de compléments au soja était associée à des RR égaux à0,92 (IC 95 % = 0,76–1,11) pour les cancers du sein tous types confondus, 0,78 (IC 95 % = 0,60–0,99) pour les cancers de statut positif des récepteurs aux estrogènes (RE + ) et 2,01 (IC 95 % = 1,41–2,86) pour les cancers de statut négatif (RE–), pour une utilisation en cours en comparaison avec le fait de n’en avoir jamais consommé. Nous n’avons pas observé d’association entre la consommation passée de compléments au soja et le risque de cancer du sein. Nous avons mis en évidence un effet modificateur des antécédents familiaux de cancer du sein (p interaction = 0,03) et du statut ménopausique (p interaction = 0,04) : les RR associés à une utilisation en cours étaient égaux à 1,36 (IC 95 % = 0,95–1,93) parmi les femmes ayant un antécédent familial de cancer du sein chez une parente de premier degré et à 0,82 (IC 95 % = 0,65–1,02) parmi les femmes sans antécédent familial ; les RR étaient égaux à 1,06 (IC 95 % = 0,87–1,30) parmi les femmes ménopausées depuis plus de cinq ans et à 0,50 (IC 95 % = 0,31–0,81) parmi les femmes en périménopause ou ménopausées depuis moins de cinq ans.
Conclusion: Notre étude a mis en évidence des associations opposées entre la consommation de compléments alimentaires à base d’isoflavones de soja et les risques de cancers du sein selon le statut des récepteurs aux estrogènes. Elle suggère également qu’ils devraient être utilisés avec prudence par les femmes ayant un antécédent familial de cancer du sein. Enfin, nos résultats devraient encourager la mise en œuvre de nouvelles études chez des femmes non ménopausées ou ménopausées depuis peu de temps afin de vérifier si le profil de risque de ces compléments pourrait être plus favorable parmi celles-ci.
... Dietary supplements containing phytoestrogens have been available since the 1990s and have been promoted mainly as natural alternatives to menopausal hormone therapy (MHT), the most effective treatment for symptoms due to estrogen deprivation such as hot flushes, night sweats, or vaginal dryness. Most of these supplements contain soy extracts rich in phytoestrogens, called isoflavones, which can exert estrogenlike effects (1). Although there is no conclusive evidence that phytoestrogen supplements effectively reduce menopausal symptoms (2,3), soy supplement sales likely benefited from the reporting in 2002-2003 that MHT increased cardiovascular and breast cancer risk (4,5). ...
... No current use in Q2000 1 Neither current nor past use Neither current nor past use Neither current nor past use 1 Values are as n (%) or means ± SDs; n = 76,442. At the end of follow-up, 247 women were in the "unknown exposure" category (not shown). ...
... Classification of exposure to dietary supplements in soy isoflavones during follow-up (E3N cohort, 2000-2011). The arrow shows the followup cycles (start date-end date) during which the exposure definitions (below the arrow) apply.1 Reasonable assumption since, in France, the soy supplement market expanded only from 1998(6). ...
Background:
Soy-based dietary supplements have been promoted as natural alternatives to menopausal hormone therapy, but their potential effect on breast cancer development is controversial.
Objectives:
We examined the relation between the consumption of soy supplements and the risk of breast cancer, overall and by tumor hormone receptor status, among women aged >50 y.
Methods:
In total, 76,442 women from the Etude Epidemiologique aupres de Femmes de la Mutuelle Generale de l'Education Nationale (E3N) cohort, born between 1925 and 1950, were followed from 2000 to 2011 (11.2 y on average, starting at a mean age of 59.5 y; 3608 incident breast cancers), with soy supplement use assessed every 2-3 y. HRs of breast cancer were estimated with the use of multivariable Cox models.
Results:
Compared with never using soy supplements, the HRs associated with current use of soy supplements were 0.92 (95% CI: 0.76, 1.11) for all, 0.78 (95% CI: 0.60, 0.99) for estrogen receptor (ER)-positive, and 2.01 (95% CI: 1.41, 2.86) for ER-negative breast cancers. There was no association between past use of soy supplements and breast cancer. HRs for current use were 1.36 (95% CI: 0.95, 1.93) and 0.82 (95% CI: 0.65, 1.02) among women with and without a family history of breast cancer, respectively (P-interaction = 0.03) and 1.06 (95% CI: 0.87, 1.30) ≥5 y after menopause compared with 0.50 (95% CI: 0.31, 0.81) in premenopause or ≤5 y postmenopause (P-interaction = 0.04).
Conclusions:
In this cohort of women aged >50 y, we report opposing associations of soy supplements with ER-positive and ER-negative breast cancer risk. Our results also caution against the use of these supplements in women with a family history of breast cancer. Whether the risk profile of soy supplements could be more favorable among premenopausal or recently postmenopausal women deserves further investigation.
This study was to conducted to investigate the effect of red clover isoflavones on the health indicated by immune status and blood biochemistry in dairy cows. Sixty-eight healthy Holstein lactating cows were randomly divided into four treatments (n = 17 per treatment) from 5 blocks according to milk yield using a randomized complete block design. No initial differences in parity (2.13 ± 1.21), days in milk (165 ± 21 d), and milk yield (33.93 ± 3.81 kg/d) between groups. Cows were fed the basal diet supplemented with 0, 2, 4, or 8 g/kg red clover extract (RCE) in diet (dry matter based). Feeding, refusal feed weights, and milk yield were recorded three consecutive days in weeks 0, 4, 8, and 12. Blood was collected from the tail vein of the cows on the last day of weeks 4, 8 and 12, 1 h after the morning feeding, and analyzed for hormones, immunoglobulins, inflammatory markers, and markers of liver and kidney activities. The dry matter intake was significantly decreased by 3.7% in the 8 g/kg group (P < 0.05). The fat-corrected milk yield was significantly higher in both of the 2 and 4 g/kg groups (P < 0.01). Plasma estradiol and prolactin showed a quadratic effect with increasing RCE levels, with the highest in the 4 g/kg group (P < 0.05). Plasma tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-1β levels decreased linearly with increasing dietary RCE levels. Plasma IL-18 levels showed a quadratic effect with increasing dietary RCE levels, with significantly lower levels in both of the 2 and 4 g/kg groups (P < 0.05). Plasma immunoglobulin A and D-lactic acid levels showed a quadratic effect with increasing dietary RCE levels, with significantly higher level in the 4 g/kg group (P < 0.05). The liver function and kidney activity makers were similar (P > 0.05). These results recommend the supplementation of RCE at a level from 2 to 4 g/kg DM.
Genistein, a commonly occurring isoflavone, has recently gained popularity owing to its ever-expanding spectrum of pharmacological benefits. In addition to health benefits such as improved bone health and reduced postmenopausal complications owing to its phytoestrogen properties, it has been widely evaluated for its anti-cancer potential. Several studies have established the potential for its usage in the management of breast, lung, and prostate cancers, and its usage has significantly evolved from early applications in traditional systems of medicine. This review offers an insight into its current status of usage, the chemistry, and pharmacokinetics of the molecule, an exploration of its apoptotic mechanisms in cancer management, and opportunities for synergism to improve therapeutic outcomes. In addition to this, the authors have presented an overview of recent clinical trials, to offer an understanding of contemporary studies and explore prospects for a greater number of focused trials, moving forward. Advancements in the application of nanotechnology as a strategy to improve safety and efficacy have also been highlighted, with a brief discussion of results from safety and toxicology studies.
The risk of inadequate management of agro-waste is an emerging challenge. However,
the economic relevance of agro-waste valorization is one of the key strategies to
ensure sustainable development. Among the agro-waste, oilseed waste and its byproducts are usually seen as mass waste after the extraction of oils. Oilseed byproducts especially oilseed cakes are a potential source of protein, fiber, minerals,
and antioxidants. Oilseed cakes contain high value-added bioactive compounds which
have great significance among researchers to develop novel foods having therapeutic
applications. Moreover, these oilseed cakes might be employed in the pharmaceutical
and cosmetic industries. Thus, as a result of having desirable characteristics, oilseed
by-products can be more valuable in wide application in the food business along with
the preparation of supplements. The current review highlights that plentiful wastes
or by-products from oilseeds are wasted if these underutilized materials are not properly valorized or effectively utilized. Hence, promising utilization of oilseeds and their
wastes not only assists to overcome environmental concerns and protein insecurity
but also helps to achieve the goals of zero waste and sustainability. Furthermore,
the article also covers the production and industrial applications of oilseeds and byproducts along with the potential role of oilseed cakes and phytochemicals in the
treatment of chronic diseases.
The pathophysiology of diabetes has been studied extensively in various countries, but effective prevention and treatment methods are still insufficient. In recent years, epigenetics has received increasing attention from researchers in exploring the etiology and treatment of diabetes. DNA methylation, histone modifications, and non-coding RNAs play critical roles in the occurrence, maintenance, and progression of diabetes and its complications. Therefore, preventing or reversing the epigenetic alterations that occur during the development of diabetes may reduce the individual and societal burden of the disease. Dietary flavonoids serve as natural epigenetic modulators for the discovery of biomarkers for diabetes prevention and the development of alternative therapies. However, there is limited knowledge about the potential beneficial effects of flavonoids on the epigenetics of diabetes. In this review, the multidimensional epigenetic effects of different flavonoid subtypes in diabetes were summarized. Furthermore, it was discussed that parental flavonoid diets might reduce diabetes incidence in offspring, which represent a promising opportunity to prevent diabetes in the future. Future work will depend on exploring anti-diabetic effects of different flavonoids with different epigenetic regulation mechanisms and clinical trials.
• Highlights
• • “Epigenetic therapy” could reduce the burden of diabetic patients
• • “Epigenetic diet” ameliorates diabetes
• • Targeting epigenetic regulations by dietary flavonoids in the diabetes prevention
• • Dietary flavonoids prevent diabetes via transgenerational epigenetic inheritance
Germination is a common practice for nutrition improvement in many crops. In soybean, the nutrient value and genome-wide gene expression pattern of whole seeds germinated for short-time has not been fully investigated. In this study, protein content (PC), water soluble protein content (WSPC), isoflavone compositions were evaluated at 0 and 36 h after germination (HAG), respectively. The results showed that at 36HAG, PC was slightly decreased ( P > 0.05) in ZD41, J58 and JHD, WSPC and free isoflavone (aglycones: daidzein, genistein, and glycitein) were significantly increased (P < 0.05), while total isoflavone content was unchanged. Transcriptomic analysis identified 5240, 6840 and 15,766 DEGs in different time point comparisons, respectively. GO and KEGG analysis showed that photosynthesis process was significantly activated from 18HAG, and alternative splicing might play an important role during germination in a complex manner. Response to hydrogen peroxide (H 2 O 2 ) was found to be down regulated significantly from 18 to 36HAG, suggesting that H 2 O 2 might play an important role in germination. Expression pattern analysis showed the synthesis of storage proteins was slowing down, while the genes coding for protein degradation (peptidase and protease) were up regulated as time went by during germination. For genes involved in isoflavone metabolism pathway, UGT (7-O-glucosyltransferase) coding genes were significantly up regulated (40 up-DEGs vs 27 down-DEGs), while MAT (7-O-glucoside-6′′-O-malonyltransferase) coding genes were down regulated, which might explain the increase of aglycones after germination. This study provided a universal transcriptomic atlas for whole soybean seeds germination in terms of nutrition and gene regulation mechanism.
Palmatine is a naturally occurring isoquinoline alkaloid that has been reported to display neuroprotective effects against amyloid-β- (Aβ-) induced neurotoxicity. However, the mechanisms underlying the neuroprotective activities of palmatine remain poorly characterized in vivo. We employed transgenic Caenorhabditis elegans models containing human Aβ1-42 to investigate the effects and possible mechanisms of palmatine-mediated neuroprotection. Treatment with palmatine significantly delayed the paralytic process and reduced the elevated reactive oxygen species levels in Aβ-transgenic C. elegans. In addition, it increased oxidative stress resistance without affecting the lifespan of wild-type C. elegans. Pathway analysis suggested that the differentially expressed genes were related mainly to aging, detoxification, and lipid metabolism. Real-time PCR indicated that resistance-related genes such as sod-3 and shsp were significantly upregulated, while the lipid metabolism-related gene fat-5 was downregulated. Further studies demonstrated that the inhibitory effects of palmatine on Aβ toxicity were attributable to the free radical-scavenging capacity and that the upregulated expression of resistance-related genes, especially shsp, whose expression was regulated by HSF-1, played crucial roles in protecting cells from Aβ-induced toxicity. The research showed that there were significantly fewer Aβ deposits in transgenic CL2006 nematodes treated with palmatine than in control nematodes. In addition, our study found that Aβ-induced toxicity was accompanied by dysregulation of lipid metabolism, leading to excessive fat accumulation in Aβ-transgenic CL4176 nematodes. The alleviation of lipid disorder by palmatine should be attributed not only to the reduction in fat synthesis but also to the inhibition of Aβ aggregation and toxicity, which jointly maintained metabolic homeostasis. This study provides new insights into the in vivo neuroprotective effects of palmatine against Aβ aggregation and toxicity and provides valuable targets for the prevention and treatment of AD.
1. Introduction
Once there is an imbalance between the production and clearance of amyloid-β peptide (Aβ), the accumulation of Aβ initiates self-assembly and the self-assembled Aβ then turns into toxic oligomers, large Aβ fibrils, and plaques associated with the onset and progression of Alzheimer’s disease (AD) [1, 2]. Considerable research evidence suggests that oxidative stress is an early event in the development of AD, preceding the classic formation of fibrils that are eventually deposited as insoluble Aβ plaques and neurofibrillary tangles [3, 4]. Meanwhile, the aggregation and deposition of Aβ further increase oxidative stress and aggravate the inflammatory response, thereby causing progressive damage to neurons [5]. Therefore, the complex pathological mechanisms of AD include the aggregation of monomeric Aβ into oligomers or fibrils and Aβ-mediated oxidative stress. Prevention of these processes requires the regulation of signaling pathways to inhibit Aβ aggregation and excessive free radical release in order to maintain cellular homeostasis. Heat shock factor 1 (HSF-1) is an essential regulator of both proteotoxicity and aging [6]. Small heat shock proteins (sHSP), which constitute one type of HSP regulated by HSF-1, act as the front line of defense for preventing or reversing abnormal protein aggregation [7, 8]. More importantly, some of them have been found to exert neuroprotective functions. Specifically, they interact with misfolded and damaging protein aggregates, such as Aβ, in AD to reduce the accumulation of misfolded proteins, block oxidative stress, and attenuate neuroinflammation and neuronal apoptosis; thus, they hold great potential as promising therapeutic agents in neurodegenerative diseases [9, 10]. Oxidative damage is a common and prominent feature of various neurodegenerative diseases and is implicated in the pathogenesis of AD [11]. Studies have shown that AD and other neurodegenerative diseases are associated with elevated levels of oxidative stress biomarkers and impaired antioxidant defense systems in the brain and peripheral tissues [12]. Active compounds with antioxidant properties exert neuroprotective effects by augmenting antioxidant defense and inhibiting Aβ-induced toxicity, which can normalize biomarkers related to oxidant/antioxidant imbalance [13–15].
Although organisms can respond to endogenous and exogenous stressors continuously and attempt to maintain homeostasis, they need externally supplied active substances, particularly when they are facing persistent and overwhelming stress, to adjust the molecular network in order to rebuild a steady state [16]. Otherwise, diseases can occur. Natural products, such as alkaloids, polyphenols, and saponins, have a variety of pharmacological activities [17, 18]. The neuroprotective activity of natural products that can inhibit Aβ aggregation and toxicity by inducing antioxidant and anti-inflammatory responses, regulating stress-related signaling, and modulating Aβ production and clearance has been extensively studied and used in the prevention and treatment of AD [19]. Alkaloids, which form a class of natural nitrogen-containing secondary metabolites, are important active components in Chinese Herbal Medicines. These compounds exert neuroprotective effects through suppression of oxidative stress, neuroinflammation, and apoptosis; reduction of Aβ aggregation; and enhancement of Aβ clearance. Through these effects, the compounds improve functional outcomes in AD [20–23]. Thus, they have great application value for the development of therapeutic agents for the treatment of AD. Although studies have confirmed that many alkaloids potentially exhibit anti-AD effects in vitro and in vivo, the molecular mechanisms responsible for these effects still need further study.
Palmatine, an isoquinoline alkaloid, has been reported to possess extensive biological functions, such as antioxidant, anti-inflammatory, neuroprotective, and blood lipid-regulating functions [21, 24]. In particular, studies have shown that palmatine might display anti-AD effects by inhibiting the activity of cholinesterase, decreasing Aβ aggregation, reducing the generation of high levels of reactive oxygen species (ROS), and attenuating oxidative damage [24–27]. Nevertheless, little is known about the inhibitory effects of palmatine on Aβ aggregation and toxicity in vivo and the signaling pathways that exert the neuroprotective effects of palmatine are also not well understood. Due to advantageous features such as a short lifespan, rapid generation time, tractable genetic manipulation, and fully sequenced genome [28], the model species Caenorhabditis elegans has been widely used to study aging and aging-related neurodegenerative diseases and was therefore employed to investigate the action mechanisms of palmatine-mediated neuroprotective effects. The experiments indicated that palmatine inhibits Aβ aggregation and toxicity by enhancing antioxidant defense and sHSP expression to maintain homeostasis in C. elegans. This study provides insights into the neuroprotective effects of palmatine in vivo and provides valuable targets for the prevention and treatment of AD.
2. Materials and Methods
2.1. Chemical and Materials
The isopropyl-beta-d-thiogalactopyranoside (IPTG), 2,7-dichlorofluorescein diacetate (DCFH-DA), 5-fluoro-2-deoxyuridine (FUDR), cholesterol, and 1,1-dimethyl-4,4-bipyridinium dichloride (Paraquat or PQ) were purchased from Sigma Chemical Corp. (St. Louis, MO, USA). The detection assay kits of SOD and CAT enzyme activity and protein quantification (Bicinchoninic acid (BCA)) were acquired from Beyotime (Shanghai, China). The palmatine, Oil red O, Sudan black B, and Thioflavin S (ThS) were obtained from Aladdin (Shanghai, China). We bought the RNA extraction reagent (TRIzol) from Invitrogen (Carlsbad, CA, USA). The DNase I, restriction enzymes XbaI and KpnI, plasmid preparation, reverse transcription, and real-time PCR kits were provided by TaKaRa (Dalian, China). Other chemical reagents used in this study were supplied by Tianjin Damao Chemical Reagent Factory (Tianjin, China).
2.2. C. elegans and Culture
There are several worm strains involved in our work: the wild-type N2, the Aβ-transgenic CL2006 {dvIs2 [pCL12(unc-54/human Abeta(1-42) minigene) + rol-6(su1006)]} and CL4176 {dvIs27 [myo-3p::Abeta(1-42)::let-851 3UTR) + rol-6(su1006)]}, the transgenic CF1553 containing sod-3p::GFP {muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]}, and CL2070 containing hsp-16.2p::GFP {dvIs70 [hsp-16.2p::GFP + rol-6(su1006)]}. This work was approved by the experimental animal ethics committee of Guangdong Pharmaceutical University with the approval number gdpulac2019015. Escherichia coli, such as OP50, NA22, and HT115 strains, were selected to feed worms based on different experimental conditions. All C. elegans were provided by the Caenorhabditis Genetics Center. The Aβ-transgenic CL2006 and CL4176 worms and the wild-type N2, CF1553, and CL2070 worms were cultured and maintained on nematode-growing medium (NGM) plates at 15°C and 20°C, respectively. The synchronous population was prepared by treatment of gravid adults with alkaline hypochlorite and hatched overnight.
2.3. Food Clearance and Body Length Assays
To select the suitable concentration range of palmatine, the wild-type nematodes were used to conduct food clearance and body length assays. In food clearance, 20 μL of S medium containing approximately 20 L1-stage worms was put into 80 μL of S medium including NA22 and palmatine with indicated concentration (0.05, 0.1, 0.2, and 0.4 mM) in a 96-well microplate and cultured at 20°C. Absorbance value (570 nm) was measured every 24 h and continued for six days. For the body length, L1-stage worms were placed on a NGM plate fed with OP50 containing different concentrations of palmatine (0.05, 0.1, 0.2, and 0.4 mM) and cultured at 20°C for two days. The worm images (approximately 100 per group) were acquired and analyzed using a Mshot MF52 inverted microscope (Mingmei, Guangzhou, China) with digital software.
2.4. Paralytic Assays
Using Aβ-transgenic CL2006 and CL4176 strains, we preliminarily detected the effect of palmatine for inhibiting Aβ-toxicity according to previously described [29]. The L1-stage CL2006 worms were fed on NGM solid plates including OP50 and different concentrations of palmatine (0.1 and 0.2 mM), which were placed at 15°C for 45 h and shifted to the new NGM solid plates (approximately 100 per group) containing OP50 with FUDR (75 μg/mL) and different concentrations of palmatine (0.1 and 0.2 mM) at 20°C for inducing Aβ peptide expression. Paralyzed worms were counted every day until all were palsied. For the CL4176 strain, the L1-stage worms were cultured at 15°C for 36 h on NGM plates containing different concentrations of palmatine (0.1 and 0.2 mM) and shifted to 23°C for inducing Aβ peptide expression. The amount of paralyzed worms was counted every 2 h until all palsied.
2.5. Measurement of the ROS Level
The ROS level in worms was evaluated through the DCFH-DA method as described previously [30]. L1-stage CL4176 worms were cultured at 15°C for 36 h on a NGM solid plate with or without palmatine (0.2 mM) and shifted to 23°C for another 36 h. Approximately 2000 worms in each group were lysed in PBST buffer (PBS containing 0.1% Tween 20) and used to collect the supernatant by centrifugation at 10000 g for 5 min. The protein content was determined by a BCA protein assay kit. A total volume of 50 μL DCFH-DA (100 mM) was placed into a black 96-well microplate containing 50 μL supernatant. The intensity of DCF was calculated with the Synergy H1 Microplate Reader (BioTek, Dallas, TX, USA) at 488 nm of excitation and 525 nm of emission.
2.6. Oxidative Survival and Lifespan Assays
Oxidative stress caused by paraquat was performed with the wild-type worms as reported previously [31]. L1-stage worms were incubated in S medium fed with NA22 at 20°C until the L4 stage and put into a 96-well microplate containing NA22, ampicillin (100 μg/mL), and FUDR (75 μg/mL). The worms were further cultured with or without palmatine (0.2 mM) for one day at 20°C and then exposed to paraquat (75 mM). The survival was counted every 12 h until all were dead (approximately 100 worms per group). For the lifespan assay, L4-stage wild-type worms were put into a 96-well microplate at the density of 15–20 individuals per well in 100 μL of culture medium (approximately 100 worms per group) and treated with or without palmatine (0.2 mM). The part of worms alive was counted every two days until all were dead.
2.7. Transcriptome Analysis and Real-Time PCR Verification
L1-stage wild-type worms were cultured on NGM plates fed OP50 with or without palmatine (0.2 mM) for two days at 20°C, and then, the worms were collected. Total RNA was prepared from the worms by using TRIzol, and further purified mRNA was used for Illumina sequencing at Shanghai Majorbio Bio-pharm Technology Co. Ltd. (China). A threshold false discovery rate (FDR) (≤ 0.05) and fold change (≥2.0) were used as criteria to screen differentially expressed genes (DEGs), which were categorized on the basis of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. At the same time, samples were prepared for real-time PCR detection as described above and the primer sequences are listed in Table 1.
Gene
Forward primer (5 to 3)
Reverse primer (5 to 3)
Application
β-Actin
CCACGAGACTTCTTACAACTCCATC
CTTCATGGTTGATGGGGCAAGAG
Real-time PCR
sod-3
GAGCTGATGGACACTATTAAGCG
GCACAGGTGGCGATCTTCAAG
Real-time PCR
hsp-16.11
CTCCATCTGAATCTTCTGAGATTG
CTTCGGGTAGAAGAATAACACGAG
Real-time PCR
hsp-16.2
CTCCATCTGAGTCTTCTGAGATTGT
CTCCTTGGATTGATAGCGTACGA
Real-time PCR
hsp-16.49
TCCGACAATATTGGAGAGATTG
GATCGTTTCGAGTATCCATGCT
Real-time PCR
fat-5
GTGCTGATGTTCCAGAGGAAGAAC
ATGTAGCGTGGAGGGTGAAGCA
Real-time PCR
Fat-7
CCAGAGAAAGCACTATTTCCCAC
CACCAAGTGGCGTGAAGTGT
Real-time PCR
hsf-1a
TGCTCTAGACTGTCCCAAGGTGGTCTAACTC
CGGGGTACCTCCCGAATAGTCTTGTTGC
RNAi
Underlines indicate the restriction sites of XbaI (TCTAGA) and KpnI (GGTACC).
Genistein is an isoflavone first isolated from the brooming plant Dyer’s Genista tinctoria L. and is widely distributed in the Fabaceae family. As an isoflavone, mammalian genistein exerts estrogen-like functions. Several biological effects of genistein have been
reported in preclinical studies, such as the antioxidant, anti-inflammatory, antibacterial, and antiviral activities, the effects of angiogenesis and estrogen, and the pharmacological activities on diabetes and lipid metabolism. The purpose of this review is to
provide up-to-date evidence of preclinical pharmacological activities with mechanisms of action, bioavailability, and clinical evidence of genistein. The literature was researched using the most important keyword “genistein” from the PubMed, Science, and Google Scholar databases, and the taxonomy was validated using The Plant List. Data were also collected from specialized books and other online resources. The main positive effects of genistein refer to the protection against cardiovascular diseases and to the decrease of the incidence of some types of cancer, especially breast cancer. Although the mechanism of protection
against cancer involves several aspects of genistein metabolism, the researchers attribute this effect to the similarity between the
structure of soy genistein and that of estrogen. This structural similarity allows genistein to displace estrogen from cellular
receptors, thus blocking their hormonal activity. The pharmacological activities resulting from the experimental studies of this
review support the traditional uses of genistein, but in the future, further investigations are needed on the efficacy, safety, and
use of nanotechnologies to increase bioavailability and therapeutic efficacy.
Equol is the isoflavone-derived metabolite with the greatest estrogenic and antioxidant activity. It is produced from daidzein by fastidious and oxygen-susceptible intestinal bacteria, which hinders their use at an industrial scale. Therefore, expressing the equol production machinery into easily-cultivable hosts would expedite the heterologous production of this compound. In this work, four genes (racemase, tdr, ddr and dzr) coding for key enzymes involved in equol production in Adlercreutzia equolifaciens DSM19450T were synthesized and cloned in a pUC-derived vector (pUC57-equol) that was introduced in Escherichia coli. Recombinant clones of E. coli produced equol in cultures supplemented with daidzein (equol precursor) and dihydrodaidzein (intermediate compound). To check whether equol genes were expressed in Gram-positive bacteria, the pUC57-equol construct was cloned into the low-copy-number vector pIL252, and the new construct (pIL252-pUC57-equol) introduced into model strains of Lacticaseibacillus casei and Lactococcus lactis. L. casei clones carrying pIL252-pUC57-equol produced a small amount of equol from dihydrodaidzein but not from daidzein, while L. lactis recombinant clones produced no equol from either of the substrates. This is the first time that A. equolifaciens equol genes have been cloned and expressed in heterologous hosts. E. coli clones harbouring pUC57-equol could be used for biotechnological production of equol.
Isoflavones possess a wide range of physiological effects. However, it is still unclear whether isoflavones can promote milk synthesis in mammary gland. This study aimed to determine the effects of a main soy isoflavone, daidzein, on milk synthesis and proliferation of mammary epithelial cells (MECs) and reveal the underlying molecular mechanism. Primary bovine MECs were treated with different concentrations of daidzein (0, 5, 10, 20, 40, and 80 μM). Daidzein dose-dependently promoted α- and β-casein and lipid synthesis, cell cycle transition, and cell amount, with the best stimulatory effect at 20 μM. Daidzein also stimulated mTOR activation and Cyclin D1 and SREBP-1c expression. Daidzein induced the expression and nuclear localization of estrogen receptor α (ERα), and ERα knockdown blocked the stimulation of daidzein on these above signaling pathways. ERα knockdown also abolished the stimulation of daidzein on NFκB1 expression and phosphorylation, and NFκB1 was required for daidzein to enhance the mTOR, Cyclin D1 and SREBP-1c signaling pathways. In summary, our findings reveal that daidzein stimulates milk synthesis and proliferation of MECs via the ERα-dependent NFκB1 activation.
Total synthesis of caesalpinnone A was achieved in 12 steps starting from resorcinol. Key features of the synthesis include BINOL-phosphoric acid catalyzed [4 + 2] cycloaddition, trans-selective nucleophilic substitution, deallylation/oxa-Michael addition cascade, and late-stage photo-Fries rearrangement.
Objectives: Relapse is a major clinical problem in orthodontic treatment, and long-term observation of treated cases often reveals relapse. Collagen metabolism in the periodontal ligament(PDL)is thought to be involved in relapse. Daidzein stimulates skin collagen synthesis in cultured skin fibroblasts in vitro. We investigated the inhibitory effects of daidzein on relapse after orthodontic tooth movement. Methods: After a force of 10 g induced tooth movement for 14 days, the appliance was removed, and the experimental group was injected with daidzein while the control group was injected with phosphatebuffered saline for 1 week. The distance of relapse was measured by micro-computed tomography. In addition, hematoxylin and eosin staining and the histopathological features were examined by immunohistochemistry using collagen type I (COL-I), matrix metalloproteinase(MMP)1, and proliferating cell nuclear antigen(PCNA). Results: The distances and ratio of relapse in the daidzein group were significantly lower than in the control group. Immunohistochemistry showed marked positive staining of COL-I and MMP1 in the daidzein group. The ratio of PCNA-positive cells in the daidzein group increased at day 7. Conclusion: These results indicated that daidzein activated the collagen metabolism in the stretched PDL and may inhibit relapse after orthodontic treatment.
Flavonoids have been considered powerful anti-inflammatory agents, and their exact immunomodulatory action as therapeutic agents in autoimmune diseases has started to emerge. Their role in the manipulation of immunoregulation is less understood. Several studies attempted to investigate the role of various flavonoids mainly in experimental models of autoimmune diseases, especially in the context of their potential effect on the increase of regulatory T cells (Tregs) and their ability to stimulate an overexpression of anti-inflammatory cytokines, in particular that of IL-10. The emergence of IL-17, a cytokine largely produced by Th17 cells, as a powerful proinflammatory stimulus which attenuates the induction of Tregs has prompted a series of studies investigating the role of flavonoids on Th17 cells in experimental models as well as human autoimmune diseases. This review thoroughly discusses accumulated data on the role of flavonoids on Th17 in rheumatoid arthritis and experimental autoimmune arthritis.
Soyfoods have long been recognized as sources of high-quality protein and healthful fat, but over the past 25 years these foods have been rigorously investigated for their role in chronic disease prevention and treatment. There is evidence, for example, that they reduce risk of coronary heart disease and breast and prostate cancer. In addition, soy alleviates hot flashes and may favorably affect renal function, alleviate depressive symptoms and improve skin health. Much of the focus on soyfoods is because they are uniquely-rich sources of isoflavones. Isoflavones are classified as both phytoestrogens and selective estrogen receptor modulators. Despite the many proposed benefits, the presence of isoflavones has led to concerns that soy may exert untoward effects in some individuals. However, these concerns are based primarily on animal studies, whereas the human research supports the safety and benefits of soyfoods. In support of safety is the recent conclusion of the European Food Safety Authority that isoflavones do not adversely affect the breast, thyroid or uterus of postmenopausal women. This review covers each of the major research areas involving soy focusing primarily on the clinical and epidemiologic research. Background information on Asian soy intake, isoflavones, and nutrient content is also provided.
Background:
Cyclin-dependent kinases (CDKs) comprise an important protein family for development of drugs, mostly aimed for use in treatment of cancer but there is also potential for development of drugs for neurodegenerative diseases and diabetes. Since the early 1990s, structural studies have been carried out on CDKs, in order to determine the structural basis for inhibition of this protein target.
Objective:
Our goal here is to review recent structural studies focused on CDKs. We concentrate on latest developments in the understanding of the structural basis for inhibition of CDKs, relating structures and ligand-binding information.
Method:
Protein crystallography has been successfully applied to elucidate over 400 CDK structures. Most of these structures are complexed with inhibitors. We use this richness of structural information to describe the major structural features determining the inhibition of this enzyme.
Results:
Structures of CDK1, 2, 4-9, 12 13, and 16 have been elucidated. Analysis of these structures in complex with a wide range of different competitive inhibitors, strongly indicate some common features that can be used to guide the development of CDK inhibitors, such as a pattern of hydrogen bonding and the presence of halogen atoms in the ligand structure.
Conclusion:
Nowadays we have structural information for hundreds of CDKs. Combining the structural and functional information we may say that a pattern of intermolecular hydrogen bonds is of pivotal importance for inhibitor specificity. In addition, machine learning techniques have shown improvements in predicting binding affinity for CDKs.
Diabetic retinopathy is one of the serious complications of diabetes and the leading cause of decreased vision and blindness worldwide.
Neurodegeneration has been recognized as initiating factor in causing the retinal damage, which leads to micro-vascular damage in diabetic retinopathy. Diabetes-induced oxidative stress is believed to be the key factor that damages neurons in the diabetic retina. Various therapeutic approaches for effective attenuation of increased oxidative stress by antioxidants have emerged. One such approach is to utilize dietary flavonoids, which have been found to possess powerful antioxidant activity.
Some of the naturally occurring flavones possess anti-diabetic effects by enhancing insulin sensitivity and reducing plasma glucose levels in diabetic animal models. Considering the importance of developing new antioxidant compounds and the relevance of their applications in the treatment of diabetes and its complications, in this review article, we discuss and highlight various neuroprotective mechanisms of flavonoids in the diabetic retina. Dietary supplementation of flavonoids to diabetics may reduce oxidative stress, which in turn might ameliorate apoptosis and the levels of neurotrophic factors in the diabetic retina. This approach will elucidate a novel strategy for preventing and treating diabetic retino-neuropathy the leading cause of low vision and blindness.
Flavonoids are frequently used as dietary supplements in the absence of research evidence regarding health benefits or toxicity. Furthermore, ingested doses could far exceed those received from diet in the course of normal living. Some flavonoids exhibit binding to estrogen receptors (ERs) with consequential vigilance by regulatory authorities at the U.S. EPA and FDA. Regulatory authorities must consider both beneficial claims and potential adverse effects, warranting the increases in research that has spanned almost two decades. Here, we report pathway enrichment of 14 targets from the Comparative Toxicogenomics Database (CTD) and the Herbal Ingredients' Targets (HIT) database for 22 flavonoids that bind ERs. The selected flavonoids are confirmed ER binders from our earlier studies, and were here found in mainly involved in three types of biological processes, ER regulation, estrogen metabolism and synthesis, and apoptosis. Besides cancers, we conjecture that the flavonoids may affect several diseases via apoptosis pathways. Diseases such as amyotrophic lateral sclerosis, viral myocarditis and non-alcoholic fatty liver disease could be implicated. More generally, apoptosis processes may be importantly evolved biological functions of flavonoids that bind ERs and high dose ingestion of those flavonoids could adversely disrupt the cellular apoptosis process.
The aromatase enzyme catalyzes the conversion of androgens to estrogens in many human tissues. Estrogens are known to stimulate cellular proliferation associated with certain cancers and protect against adverse symptoms during the peri- and postmenopausal intervals. Phytoestrogens are a group of plant derived naturally occurring compounds that have chemical structures similar to estrogen. Since phytoestrogens are known to be constituents of animal/human food sources, these compounds have received increased research attention. Phytoestrogens may contribute to decreased cancer risk by the inhibition of aromatase enzyme activity and CYP19 gene expression in human tissues. This review covers (a) the aromatase enzyme (historical descriptions on function, activity, and gene characteristics), (b) phytoestrogens in their classifications and applications to human health, and (c) a chronological coverage of aromatase activity modulated by phytoestrogens from the early 1980s to 2015. In general, phytoestrogens act as aromatase inhibitors by (a) decreasing aromatase gene expression, (b) inhibiting the aromatase enzyme itself, or (c) in some cases acting at both levels of regulation. The findings presented herein are consistent with estrogen’s impact on health and phytoestrogen’s potential as anticancer treatments, but well-controlled, large-scale studies are warranted to determine the effectiveness of phytoestrogens on breast cancer and age-related diseases.
Objective: To update and expand The North American Menopause Society's evidence-based position on nonhormonal management of menopause-Associated vasomotor symptoms (VMS), previously a portion of the position statement on the management of VMS. Methods: NAMS enlisted clinical and research experts in the field and a reference librarian to identify and review available evidence. Five different electronic search engines were used to cull relevant literature. Using the literature, experts created a document for final approval by the NAMS Board of Trustees. Results: Nonhormonal management of VMS is an important consideration when hormone therapy is not an option, either because of medical contraindications or a woman's personal choice. Nonhormonal therapies include lifestyle changes, mind-body techniques, dietary management and supplements, prescription therapies, and others. The costs, time, and effort involved as well as adverse effects, lack of long-Term studies, and potential interactions with medications all need to be carefully weighed against potential effectiveness during decision making. Conclusions: Clinicians need to be well informed about the level of evidence available for the wide array of nonhormonal management options currently available to midlife women to help prevent underuse of effective therapies or use of inappropriate or ineffective therapies. Recommended: Cognitive-behavioral therapy and, to a lesser extent, clinical hypnosis have been shown to be effective in reducing VMS. Paroxetine salt is the only nonhormonal medication approved by the US Food and Drug Administration for the management ofVMS, although other selective serotonin reuptake/norepinephrine reuptake inhibitors, gabapentinoids, and clonidine show evidence of efficacy. Recommend with caution: Some therapies that may be beneficial for alleviating VMS are weight loss, mindfulness-based stress reduction, the S-equol derivatives of soy isoflavones, and stellate ganglion block, but additional studies of these therapies are warranted. Do not recommend at this time: There are negative, insufficient, or inconclusive data suggesting the following should not be recommended as proven therapies for managing VMS: cooling techniques, avoidance of triggers, exercise, yoga, paced respiration, relaxation, over-The-counter supplements and herbal therapies, acupuncture, calibration of neural oscillations, and chiropractic interventions. Incorporating the available evidence into clinical practice will help ensure that women receive evidence-based recommendations along with appropriate cautions for appropriate and timely management of VMS.
For some classes of dietary polyphenols, there are now sufficient intervention studies to indicate the type and magnitude of effects among humans in vivo, on the basis of short-term changes in biomarkers. Isoflavones (genistein and daidzein, found in soy) have significant effects on bone health among postmenopausal women, together with some weak hormonal effects. Monomeric catechins (found at especially high concentrations in tea) have effects on plasma antioxidant biomarkers and energy metabolism. Procyanidins (oligomeric catechins found at high concentrations in red wine, grapes, cocoa, cranberries, apples, and some supplements such as Pycnogenol) have pronounced effects on the vascular system, including but not limited to plasma antioxidant activity. Quercetin (the main representative of the flavonol class, found at high concentrations in onions, apples, red wine, broccoli, tea, and Ginkgo biloba) influences some carcinogenesis markers and has small effects on plasma antioxidant biomarkers in vivo, although some studies failed to find this effect. Compared with the effects of polyphenols in vitro, the effects in vivo, although significant, are more limited. The reasons for this are 1) lack of validated in vivo biomarkers, especially in the area of carcinogenesis; 2) lack of long-term studies; and 3) lack of understanding or consideration of bioavailability in the in vitro studies, which are subsequently used for the design of in vivo experiments. It is time to rethink the design of in vitro and in vivo studies, so that these issues are carefully considered. The length of human intervention studies should be increased, to more closely reflect the long-term dietary consumption of polyphenols.
Primary prevention through lifestyle interventions is a cost-effective alternative for preventing a large burden of chronic and degenerative diseases, including cancer, which is one of the leading causes of morbidity and mortality worldwide. In the past decade, epidemiologic and preclinical evidence suggested that polyphenolic phytochemicals present in many plant foods possess chemopreventive properties against several cancer forms. Thus, there has been increasing interest in the potential cancer chemopreventive agents obtained from natural sources, such as polyphenols, that may represent a new, affordable approach to curb the increasing burden of cancer throughout the world. Several epidemiologic studies showed a relation between a soy-rich diet and cancer prevention, which was attributed to the presence of a phenolic compound, genistein, present in soy-based foods. Genistein acts as a chemotherapeutic agent against different types of cancer, mainly by altering apoptosis, the cell cycle, and angiogenesis and inhibiting metastasis. Targeting caspases, B cell lymphoma 2 (Bcl-2)-associated X protein (Bax), Bcl-2, kinesin-like protein 20A (KIF20A), extracellular signal-regulated kinase 1/2 (ERK1/2), nuclear transcription factor κB (NF-κB), mitogen-activated protein kinase (MAPK), inhibitor of NF-κB (IκB), Wingless and integration 1 β-catenin (Wnt/β-catenin), and phosphoinositide 3 kinase/Akt (PI3K/Akt) signaling pathways may act as the molecular mechanisms of the anticancer, therapeutic effects of genistein. Genistein also shows synergistic behavior with well-known anticancer drugs, such as adriamycin, docetaxel, and tamoxifen, suggesting a potential role in combination therapy. This review critically analyzes the available literature on the therapeutic role of genistein on different types of cancer, focusing on its chemical features, plant food sources, bioavailability, and safety.
Endocrine disrupting chemicals (EDCs) are found abundantly in the environment, resulting in daily human exposure. This is of concern because many EDCs are known to target the female reproductive system and more specifically, the ovary. In the female, the ovary is a key organ responsible for reproductive and endocrine functions. Exposure to EDCs is known to cause many reproductive health problems such as infertility, premature ovarian failure, and abnormal sex steroid hormone levels. Some EDCs and their effects on adult ovarian function have been studied extensively over the years, while the effects of others remain unclear. This review covers what is currently known about the effects of selected EDCs (bisphenol A, methoxychlor, 2,3,7,8-tetrachlorodibenzo-p-dioxin, phthalates, and genistein) on the adult ovary and the mechanisms by which they act upon the ovary, focusing primarily on their effects on folliculogenesis and steroidogenesis. Further, this review discusses future directions needed to better understand the effects of the EDCs, including the need to examine the effects of multiple and more consistent doses, and studying different mechanisms of action.
Copyright 2015 by The Society for the Study of Reproduction.
Epidemiological studies have revealed that high consumption of soy products is associated with low incidences of hormone-dependent cancers, including breast and prostate cancer. Soybeans contain large amounts of isoflavones, such as the genistein and daidzain. Previously, it has been demonstrated that genistein, one of the predominant soy isoflavones, can inhibit several steps involved in carcinogenesis. It is suggested that genistein possesses pleiotropic molecular mechanisms of action including inhibition of tyrosine kinases, DNA topoisomerase II, 5α-reductase, galectin-induced G2/M arrest, protein histidine kinase, and cyclin-dependent kinases, modulation of different signaling pathways associated with the growth of cancer cells (e.g., NF-κB, Akt, MAPK), etc. Moreover, genistein is also a potent inhibitor of angiogenesis. Uncontrolled angiogenesis is considered as a key step in cancer growth, invasion, and metastasis. Genistein was found to inhibit angiogenesis through regulation of multiple pathways, such as regulation of VEGF, MMPs, EGFR expressions and NF-κB, PI3-K/Akt, ERK1/2 signaling pathways, thereby causing strong antiangiogenic effects. This review focuses on the antiangiogenic properties of soy isoflavonoids and examines their possible underlying mechanisms.
Polyphenolic compounds are plant nutraceuticals showing a huge structural diversity, including chlorogenic acids, hydrolyzable tannins, and flavonoids (flavonols, flavanones, flavan-3-ols, anthocyanidins, isoflavones, and flavones). Most of them occur as glycosylated derivatives in plants and foods.
In order to become bioactive at human body, these polyphenols must undergo diverse intestinal transformations, due to the action of digestive enzymes, but also by the action of microbiota metabolism. After elimination of sugar tailoring (generating the corresponding aglycons) and diverse hydroxyl moieties, as well as further backbone reorganizations, the final absorbed compounds enter the portal vein circulation towards liver (where other enzymatic transformations take place) and from there to other organs, including behind the digestive tract or via blood towards urine excretion. During this transit along diverse tissues and organs, they are able to carry out strong antiviral, antibacterial, and antiparasitic activities. This paper revises and discusses these antimicrobial activities of dietary polyphenols and their relevance for human health, shedding light on the importance of polyphenols structure recognition by specific enzymes produced by intestinal microbial taxa.
Type 2 diabetes (T2D) has become a major public health threat across the globe. It has been widely acknowledged that diet plays an important role in the development and management of T2D. Phytoestrogens are polyphenols that are structurally similar to endogenous estrogen and have weak estrogenic properties. Emerging evidence from pre-clinical models has suggested that phytoestrogens may have anti-diabetic function via both estrogen-dependent and estrogen-independent pathways. In the current review, we have summarized the evidence linking two major types of phytoestrogens, isoflavones and lignans, and T2D from epidemiological studies and clinical trials. The cross-sectional and prospective cohort studies have reported inconsistent results, which may due to the large variations in different populations and measurement errors in dietary intakes. Long-term intervention studies using isoflavone supplements have reported potential beneficial effects on glycemic parameters in postmenopausal women, while results from short-term small-size clinical trials are conflicting. Taken together, the current evidence from different study designs is complex and inconsistent. Although the widespread use of phytoestrogens could not be recommended yet, habitual consumption of phytoestrogens, particularly their intact food sources like soy and whole flaxseed, could be considered as a component of overall healthy dietary pattern for prevention and management of T2D.
Fatty liver disease (FLD) is a growing public health problem worldwide. There is an urgent requirement for alternative and natural medicine to treat this disease. As phytochemicals, isoflavones have attracted considerable attention for the prevention of FLD. Numerous studies have revealed that isoflavones protect against FLD through various pathways which modulate fatty acid β-oxidation, lipid synthesis, and oxidative stress. Recently, the aldose reductase (AR)/polyol pathway has been reported to be involved in the development of FLD by modulating hepatic fructose production, peroxisome proliferator-activated receptor (PPAR)α activity, cytochrome P450 (CYP)2E1 expression, and gut bacterial endotoxin-induced cytokine release. It has been reported that some isoflavones are potent AR inhibitors. Here, we review the anti-FLD actions of isoflavones and the proposed mechanism whereby isoflavones protect against FLD, with regard to the AR/polyol pathway. We propose that isoflavones block the AR/polyol pathway and in turn reduce fructose production and subsequent fat accumulation in the liver in diabetic or high-glucose-diet mice. In addition, in rodents with alcoholic liver disease or nonalcoholic fatty liver disease/nonalcoholic steatohepatitis, inhibition of AR by isoflavones may improve PPARα-mediated fatty acid oxidation, reduce hepatic steatosis, and attenuate CYP2E1-mediated oxidative stress or AR/gut bacterial endotoxin-mediated cytokine overproduction, to alleviate progression of FLD.
Prostate function is critical for male fertility and its well-known oncological biomarker, namely Prostate-Specific Antigen (PSA), can be also used to monitor prostate epithelial human cells upon treatment with pharmaceutical drugs or natural bioactive compounds. The LNCaP human prostate cell line was previously set up as a model system to investigate chemicals affecting prostate epithelium functionality by means of a tiered approach integrating two different toxicological endpoints, cell viability (MTS) and PSA secretion assays. Here, the same approach has been used to characterize the biological effects of phytochemicals on prostate epithelium. The anti-androgenic ability of phytochemicals to inhibit DHT-induced PSA secretion has been investigated also characterizing their intracellular distribution, in the presence or absence of sex steroids. Intracellular distribution allows to verify whether and to which extent each phytochemical is able to enter the cell and to reach the nucleus, the latter being the target of the supposed transcriptional modulatory activity upon phytochemicals' binding to sex steroid receptors. Some phytochemicals, supposed to have a role in the functionality of the prostate epithelium, have been tested in a dose-dependent manner in both MTS and PSA secretion assays. In parallel, to establish the "effective concentration", in comparison to the "nominal one", the intracellular amount of each phytochemical has been assessed upon cell fractionation of LNCaP-treated cells and subsequent chromatographic measurements.
Soy isoflavones are dietary components for which an association has been demonstrated with reduced risk of prostate cancer (PCa) in Asian populations. However, the exact mechanism by which these isoflavones may prevent the development or progression of PCa is not completely understood. There are a growing number of animal and in vitro studies that have attempted to elucidate these mechanisms. The predominant and most biologically active isoflavones in soy products, genistein, daidzein, equol, and glycetin, inhibit prostate carcinogenesis in some animal models. Cell-based studies show that soy isoflavones regulate genes that control cell cycle and apoptosis. In this review, we discuss the literature relevant to the molecular events that may account for the benefit of soy isoflavones in PCa prevention or treatment. These reports show that although soy isoflavone-induced growth arrest and apoptosis of PCa cells are plausible mechanisms, other chemo protective mechanisms are also worthy of consideration. These possible mechanisms include antioxidant defense, DNA repair, inhibition of angiogenesis and metastasis, potentiation of radio- and chemotherapeutic agents, and antagonism of estrogen- and androgen-mediated signaling pathways. Moreover, other cells in the cancer milieu, such as the fibroblastic stromal cells, endothelial cells, and immune cells, may be targeted by soy isoflavones, which may contribute to soy-mediated prostate cancer prevention. In this review, these mechanisms are discussed along with considerations about the doses and the preclinical models that have been used.
Genistein (Gen), the primary isoflavone in soy, has been shown to adversely affect various endocrine-mediated endpoints in rodents and humans. Soy formula intake by human infants has been associated with early age at menarche and decreased female-typical behavior in girls. Adipose deposition and expansion are also hormonally regulated and Gen has been shown to alter these processes. However, little is known about the impact of early-life soy intake on metabolic homeostasis in adulthood. The current study examined the impact of early-life Gen exposure on adulthood body composition (by magnetic resonance imaging, MRI) and the molecular signals mediating adipose expansion. From postnatal day (PND) 1 to 22, rat pups were daily orally dosed with 50 mg/kg Gen to mimic blood Gen levels in human infants fed soy formula. Female, but not male Gen-exposed rats had increased fat/lean mass ratio, fat mass, adipocyte size and number, and decreased muscle fiber perimeter. PND22 Gen-exposed females, but not males had increased expression of adipogenic factors, including CCAAT/enhancer binding protein alpha (Cebpα), CCAAT/enhancer binding protein beta (Cebpβ), and peroxisome proliferator-activated receptor gamma (Pparγ). Furthermore, Wingless related MMTV integration site 10b (Wnt10b), a critical regulator of adipogenic cell fate determination, was hypermethylated and had decreased expression in adipose of PND22 Gen-exposed females. These data suggest that developmental Gen exposure in rats has gender-specific effects on adiposity that closely parallel the effects of a post-weaning high-fat diet, and underscore the importance of considering timing of exposure and gender when establishing safety recommendations for early-life dietary Gen intake.
ATP:shikimate 3-phosphotransferase catalyzes the fifth chemical reaction of shikimate pathway. This metabolic route is responsible for the production of chorismate, a precursor of aromatic amino acids. This especially interesting enzymatic step is indispensable for the survival of the etiological agent of tuberculosis and not found in animals. Therefore the enzyme ATP:shikimate 3-phosphotransferase has been classified as a target for chemotherapeutic development of antitubercular drugs. The ATP:shikimate 3-phosphotransferase has also the denomination of shikimate kinase. This review highlights the available crystallographic studies of shikimate kinases that have been used to identify structural features for ligand-biding affinity. We also describe molecular docking studies focused on shikimate kinase. These computational studies were performed in order to identify the new generation of antitubercular drugs and several potential inhibitors have been described. In addition, a structural comparison of shikimate kinase ATP-binding pocket with human cyclin-dependent kinase 2 (CDK2) is described. This analysis shows the structural similarities between both enzymes, and the potential beneficial aspects of abundant structural studies of CDK2 and their inhibitors to bring further understanding of the ligand-binding specificity for shikimate kinase.
Cachexia, a negative prognostic factor, worsens a patient's quality of life. We established 2 novel cachexia models with the human stomach cancer cell line MKN-45, which was subcloned to produce potent cachexia-inducing cells by repeating the xenografts in immune-deficient mice. After subsequent xenografts, we isolated potent cachexia-inducing cells (MKN45cl85 and 85As2mLuc). Xenografts of MKN45cl85 cells in mice led to substantial weight loss and reduced adipose tissue and musculature volumes, whereas xenografts of 85As2mLuc cells resulted in highly metastatic and cachectic mice. Surgical removal of tumor tissues helped the mice regain body-weight in both mouse models. In vitro studies using these cells showed that isoflavones reduced their proliferation, implying that the isoflavones possess antiproliferative effects of these cancer cell lines. Isoflavone treatment on the models induced tumor cytostasis, attenuation of cachexia, and prolonged survival whereas discontinuation of the treatment resulted in progressive tumor growth and weight loss. The inhibitory effects of tumor growth and weight loss by isoflavones were graded as soy isoflavone aglycone AglyMax > daidzein > genistein. These results demonstrated that the 2 novel cachectic mouse models appear useful for analyzing the mechanism of cancer cachexia and monitoring the efficacy of anticachectic agents.
Phytoestrogens, estrogenic compounds derived from plants, are ubiquitous in human and animal diets. These chemicals are generally much less potent than estradiol but act via similar mechanisms. The most common source of phytoestrogen exposure to humans is soybean-derived foods that are rich in the isoflavones genistein and daidzein. These isoflavones are also found at relatively high levels in soy-based infant formulas. Phytoestrogens have been promoted as healthy alternatives to synthetic estrogens and are found in many dietary supplements. The aim of this review is to examine the evidence that phytoestrogen exposure, particularly in the developmentally sensitive periods of life, has consequences for future reproductive health.
Increasingly natural products particularly flavonoids are being explored for their therapeutic potentials in reducing bone loss and maintaining bone health. This article has reviewed previous studies on the two better known flavonoids, genistein and icariin, their structures, functions, action mechanisms, relative potency, and potential application in regulating bone remodeling and preventing bone loss. Genistein, an isoflavone abundant in soy, has dual functions on bone cells, able to inhibit bone resorption activity of osteoclasts and stimulate osteogenic differentiation and maturation of bone marrow stromal progenitor cells (BMSCs) and osteoblasts. Genistein is an estrogen receptor (ER)-selective binding phytoestrogen, with a greater affinity to ERβ. Genistein inhibits tyrosine kinases and inhibits DNA topoisomerases I and II, and may act as an antioxidant. Genistein enhances osteoblastic differentiation and maturation by activation of ER, p38MAPK-Runx2 and NO/cGMP pathways, and it inhibits osteoclast formation and bone resorption through inducing osteoclastogenic inhibitor osteoprotegerin (OPG) and blocking NF-κB signalling. Icariin, a prenylated flavonol glycoside isolated from Epimedium herb, stimulates osteogenic differentiation of BMSCs and inhibits bone resorption activity of osteoclasts. Icariin, whose metabolites include icariside I, icariside II, icaritin and desmethylicaritin, has no estrogenic activity. However, icariin is more potent than genistein in promoting osteogenic differentiation and maturation of osteoblasts. The existence of a prenyl group on C-8 of icariin molecular structure has been suggested to be the reason why icariin is more potent than genistein in osteogenic activity. Thus, the prenylflavonoids may represent a class of flavonoids with a higher osteogenic activity. J. Cell. Physiol. © 2012 Wiley Periodicals, Inc.
The EFSA ANS Panel was asked to deliver a scientific opinion on the possible association between the intake of isoflavones from food supplements and harmful effects on mammary gland, uterus and thyroid in peri- and post-menopausal women. Isoflavones are naturally occurring substances which can be found in, among other sources, soy, red clover and kudzu root. The main isoflavones are genistein, daidzein, glycitein, formononetin, biochanin A and puerarin. Their chemical structures are related to 17β-oestradiol and they possess oestrogenic properties. Furthermore, isoflavones may interact with the synthesis of thyroid hormone. Food supplements targeted at peri- and post-menopausal women typically provide a daily dose of isoflavones in the range of 35–150 mg/day. A systematic review was performed to investigate whether an association could be found between intake of isoflavones from food supplements and adverse effects on the three target organs in peri- and post-menopausal women. The human data did not support the hypothesis of an increased risk of breast cancer from observational studies nor of an effect on mammographic density nor on proliferation marker Ki-67 expression in interventional studies. No effect was found on endometrial thickness and histopathological changes in the uterus up to 30 months of supplementation with 150 mg/day of soy isoflavones. After 60 months some non-malignant histopathological changes were reported. Thyroid hormones levels were not changed following intake of isoflavones from food supplements. The background exposure from the diet in the general European population was estimated to be lower than 1 mg/day, whereas in consumers of soy-based foods it could be higher. The Panel concluded that it was not possible to derive a single health-based guidance value for the different preparations in post-menopausal women. However the doses used in the intervention studies and their duration could serve as guidance for the intake of food supplements.
Phytochemicals are non-nutrient bioactive compounds that occur in plant and food which possess the capacity to modulate one or more metabolic processes or pathways in the body, resulting to health benefits and promotion of well-being. At this regard, the interest of the scientific community continues to grow, powered by progressive research efforts to identify properties and potential applications of bioactive substances, and coupled with public interest and consumer demand. However, the natural derivation of these compounds is not a feature of harmlessness, over that of therapeutic efficacy, to which is also added the absence of post-marketing monitoring that does not allow to evaluate the occurrence of adverse effects related to the use of their related products. The literature is particularly reach of studies concerning phytochemicals as environmental estrogens, that result in infertility, reproductive abnormalities, and tumors but also in some endocrine-related health effects. Nevertheless further studies have been performed to better understand the bioavailability, pharmacokinetics and mode of action of these compounds that seems go beyond their ability to bind to oestrogen receptors and either stimulate or inhibit the activity of endogenous oestrogens, highlighting new interesting target molecules and signalling pathways. The present review summarizes the latest developments and knowledge concerning the assessment of endocrine activities of dietary phytochemicals focusing on pharmacological aspects.
Background
For many years, anticancer polyphenols have attracted significant attention as substances that prevent tumor growth and progression. These compounds are simple phenolic acids, complex phenolic acids, such as caffeoylquinic acids, rosmarinic acid and its derivatives, stilbenes, flavones, isoflavones, and anthocyanins. Some compounds, such as tea and coffee polyphenols, can be produced in large quantities by traditional methods, while many others cannot.
Methods: We reviewed the available literature regarding the biotechnological aspects of polyphenol production by cultured plant cells and described approaches that have been used to obtain high levels of anticancer polyphenols (resveratrol, podophyllotoxin, genistein, lithospermic acid B, and others). Additionally, we provide our view on bioengineering strategies that could be important for the further improvement of cell biosynthetic characteristics.
Results: The main trend in the field is the activation of entire biosynthetic pathways based on a comprehensive knowledge of protein-protein interaction networks involved in the regulation of polyphenol biosynthesis. As an example, we consider the jasmonate subnetwork, which will be increasingly used by plant biotechnologists. The next-generation technologies to sustained polyphenol production involve manipulations with microRNAs and reproduction of rol-gene effects.
Conclusion: Plant polyphenols play an important role in maintaining human health, and their role in the prevention of cancer will continue to grow. Targeting mechanisms involved in uncontrolled cancer cell proliferation will increasingly become the standard for cancer patients. Plant biotechnological studies aiming at producing anticancer compounds will be developed in parallel with these studies to provide a wider range of metabolites for each particular case.
Recent data from Asia and North America indicate that soy foods may decrease the risk of breast cancer and improve the results of treatment in patients with breast cancer. Studying soy foods and isoflavones promises to be an exceptionally fertile area for a wide range of cancer researchers. See also pages 000-000.
Epidemiological studies suggest that soya consumption as a source of phyto-oestrogens and isoflavones may be associated with a reduced risk of colorectal cancer. However, findings have not yet been synthesised for all groups of phyto-oestrogens. A meta-analysis was conducted to quantify the association between phyto-oestrogens and colorectal cancer risk. Relevant observational studies published up to June 2016 were identified by searching MEDLINE, EMBASE and Cochrane Library databases. Study-specific relative risks (RR) were pooled in both categorical and dose–response meta-analyses. Out of seventeen identified studies, sixteen were included in the meta-analysis. Comparing the highest with the lowest intake category, inverse associations for phyto-oestrogens overall and by subgroup were observed but were statistically significant in case–controls studies and not in cohort studies. The pooled RR in case–control studies were 0·76 (95 % CI 0·69, 0·84), 0·77 (95 % CI 0·69, 0·85) and 0·70 (95 % CI 0·56, 0·89) for phyto-oestrogens, isoflavones and lignans, respectively, whereas the corresponding pooled RR were 0·95 (95 % CI 0·85, 1·06), 0·94 (95 % CI 0·84, 1·05) and 1·00 (95 % CI 0·64, 1·57) in cohort studies. Dose–response analysis yielded an 8 % reduced risk of colorectal neoplasms for every 20 mg/d increase in isoflavones intake in Asians (pooled RR 0·92; 95 % CI 0·86, 0·97). A non-linear inverse association with colorectal cancer risk was found for lignans intake, but no association for circulating enterolactone concentrations was observed. Thus, study heterogeneity precludes a rigorous conclusion regarding an effect of high exposure to isoflavones on risk of colorectal cancer. Current evidence for an association with lignans exposure is limited. Further prospective studies, particularly evaluating lignans, are warranted to clarify the association between different phyto-oestrogens and colorectal cancer risk.
Among naturally occurring isoflavones, soy isoflavones are an important class with various biological activities. Due to their phytoestrogenic structure, their effects on the brain are profound- thus making the neurobiological effects of these compounds an active area of research. One such compound is daidzein, which has been reported to affect various neurobiological regulatory mechanisms such as behavior, cognition, growth, development and reproduction. These effects are mainly elicited through the interaction of daidzein with different signaling molecules and receptors, thereby offering neuroprotection. In addition, daidzein has also been reported to possess activities against various neuropathological conditions mainly by its interaction with the cerebrovascular system. This review focuses on providing a comprehensive account on the bioavailability and metabolism of daidzein in vivo, and discusses its activities and mechanisms of action in detail, in both physiological and pathological conditions. In addition, the effects of daidzein on other disorders have also been examined briefly in this article.
Prostate cancer is the primary male cancer with increasing global incidence rates making this malignancy a significant healthcare burden. Androgens promote normal prostate maturity but also influence the development and progression of prostate cancer. Intriguingly, evidence now suggests endogenous and exogenous oestrogens, in the form of phytoestrogens, may be equally as relevant as androgens in prostate cancer growth. The prostate gland has the molecular mechanisms, catalysed by steroid sulphatase (STS), to unconjugate and utilise circulating oestrogens. Furthermore, prostate tissue also expresses enzymes essential for local oestrogen metabolism, including aromatase (CYP19A1) and 3β- and 17α-hydroxysteroid dehydrogenases. Increased expression of these enzymes in malignant prostate tissue compared to normal prostate indicates oestrogen synthesis is favoured in malignancy and thus may influence tumour progression. In contrast to previous reviews, here we comprehensively explore the epidemiological and scientific evidence on how oestrogens impact prostate cancer, particularly focusing on pre-receptor oestrogen metabolism and subsequent molecular action. We analyse how molecular mechanisms and metabolic pathways involved in androgen and oestrogen synthesis intertwine to alter prostate tissue. Furthermore, we speculate on whether oestrogen receptor status in the prostate affects progression of this malignancy.
Background:
The evolution of the 'Green' movement in western society has changed attitudes in the general population who now perceive natural compounds as being inherently harmless and more desirable than artificial chemical products.
Objective:
Considering the growing interest towards introducing naturally emerged medicines, the purpose of this review was to overview the ongoing research into prevention and treatment of multiple sclerosis (MS) lesions.
Method:
This review was carried out by searching bibliographic databases such as PubMed and Scopus for studies reported between 1th January 2008 to 30rd January 2016 on MS patients or animal models of MS, investigating the beneficial effects of natural compounds in MS treatment. In this updated systematic review, the search terms were "multiple sclerosis" or "neurodegeneration" and ("natural compounds" or "medicinal plants", "traditional medicine" or "native medicine").
Results:
Studies with vitamins (A, B12, D, H), minerals (selenium and lithium), n-3 PUFAs, lipoic acid, statins, resveratrol, marijuana, EGCG and some probiotics have shown significant helpful effects in MS by preventing or delaying the onset of disease. Other natural compounds such as xanthines, anthocyanins, glucosinolates, isoflavones, organosulfurs, steroid glycosides, and alkaloids have also shown protective effects in the treatment of MS in animal models. Adverse effects were also reported in some of the experiments.
Conclusion:
Further studies with a focus on the molecular mechanisms of the protective natural compounds are needed to decrease possible side effects and to develop new medicines for MS. Apigenin, chrysin, baicalein, cyanidin, flavone glycoside, daidzein, coumestrol, sulforaphane, bee venom and huperzine A are the candidates for more prospective investigations.
Osteoporosis is an age-related disorder that affects both women and men, although estrogen deficiency induced by menopause accelerates bone loss in older women. As the demographic shifts to a more aged population, a growing number of men and women will be afflicted with osteoporosis. Since the current drug therapies available have multiple side effects, including increased risk of developing certain types of cancer or complications, a search for potential nonpharmacologic alternative therapies for osteoporosis is of prime interest. Soy isoflavones (SI) have demonstrated potential bone-specific effects in a number of studies. This article provides a systematic review of studies on osteoporotic bone loss in relation to SI intake from diet or supplements to comprehensively explain how SI affect the modulation of bone remodeling. Evidence from epidemiologic studies supports that dietary SI attenuate menopause-induced osteoporotic bone loss by decreasing bone resorption and stimulating bone formation. Other studies have also illustrated that bone site-specific trophic and synergistic effects combined with exercise intervention might contribute to improve the bioavailability of SI or strengthen the bone-specific effects. To date, however, the effects of dietary SI on osteoporotic bone loss remain inconclusive, and study results vary from study to study. The current review will discuss the potential factors that result in the conflicting outcomes of these studies, including dosages, intervention materials, study duration, race, and genetic differences. Further well-designed studies are needed to fully understand the underlying mechanism and evaluate the effects of SI on osteoporosis in humans.
Phytoestrogens are phenolic compounds derived from plants and exert an estrogenic as well as an antiestrogenic effect and also various biological efficacies. Chemopreventive properties of phytoestrogens has emerged from epidemiological observations indicating that the incidence of some cancers including breast and prostate cancers is much lower in Asian people, who consume significantly higher amounts of phytoestrogens than Western people. There are 4 main classes of phytoestrogens: isoflavones, stilbenes, coumestans, and lignans. Currently, resveratrol is recognized as another major phytoestrogen present in grape and red wine and has been studied in many biological studies. Phytoestrogens have biologically diverse profitabilities and advantages such as low cytotoxicity to patients, lack of side effects in clinical trials, and pronounced benefits in a combined therapy. In this review, we highlighted the effects of genistein, daidzein, and resveratrol in relation with their anticarcinogenic activity. A lot of in vitro and in vivo results on their chemopreventive properties were presented along with the underlying mechanisms. Besides well-known mechanisms such as antioxidant property and apoptosis, newly elucidated anticarcinogenic modes of action including epigenetic modifications and topoisomerase inhibition have been provided to examine the possibility of phytoestrogens as promising reagents for cancer chemoprevention and/or treatment and to suggest the importance of plant-based diet of phytoestrogens.
Soy isoflavones have been shown to affect lipid metabolism, however the underlying molecular mechanism(s) have not yet been fully understood. The present study, using female Bama mini-pig as a model, examined the effects of soy isoflavones on lipid metabolism and involved gene expression in different white adipose tissues. Female Bama Xiang mini-pigs of 35 days old were fed a basal diet (control, Con), or basal diet supplemented with increasing amounts of soy isoflavones (250, 500, or 1250 mg/kg diet) for 120 days. The results showed that soy isoflavones did not affect the body weight, but decreased the dorsal subcutaneous adipose tissue (DSA) mass and increased the mass of abdominal subcutaneous adipose tissue (ASA) and perirenal adipose tissue (PRA). Besides, soy isoflavones decreased the expression of lipogenic genes and increased the expression of lipolytic genes in DSA, while the opposite effects were observed in ASA and PRA. In addition, the expression of lipoprotein lipase was down regulated in DSA while up regulated in ASA and PRA by soy isoflavones. Moreover, the expression of estrogen receptors (ERs) was up regulated in DSA, and down regulated in ASA and PRA by soy isoflavones. Our results suggest that soy isoflavones affected the lipid metabolism in white adipose tissues of Bama mini-pigs in a site-specific manner, which might be mediated through PPARs and ERs regulated gene expression.
Copyright © 2015. Published by Elsevier Inc.
With 13 million new cases worldwide every year, prostate cancer is as a very real public health concern. Prostate cancer is common in over-50s men and the sixth-leading cause of cancer-related death in men worldwide. Like all cancers, prostate cancer is multifactorial – there are non-modifiable risk factors like heredity, ethnicity and geographic location, but also modifiable risk factors such as diet. Diet–cancer linkages have risen to prominence in the last few years, with accruing epidemiological data pointing to between-population incidence differentials in numerous cancers. Indeed, there are correlations between fat-rich diet and risk of hormone-dependent cancers like prostate cancer and breast cancer. Diet is a risk factor for prostate cancer, but certain micronutrients in specific diets are considered protective factors against prostate cancer. Examples include tomato lycopene, green tea epigallocatechin gallate, and soy phytoestrogens. These micronutrients are thought to exert cancer-protective effects via anti-oxidant pathways and inhibition of cell proliferation. Here, we focus in on the effects of phytoestrogens, and chiefly genistein and daidzein, which are the best-researched to date. Soy phytoestrogens are nonsteroid molecules whose structural similarity lends them the ability to mimic the effects of 17ß-estradiol. On top of anti-oxidant effects, there is evidence that soy phytoestrogens can modulate the epigenetic modifications found in prostate cancer. We also studied the impact of phytoestrogens on epigenetic modifications in prostate cancer, with special focus on DNA methylation, miRNA-mediated regulation and histone modifications.
Background: Evidence suggests that estrogen plays a preventive role in primary liver cancer development, and it might be thought that isoflavones, which are structurally similar to estrogens and bind to estrogen receptors, are associated with the risk of liver cancer. We investigated this suspected association by measuring plasma concentrations of isoflavones in a nested case-control study of a population-based prospective cohort in Japan. Methods: From 18,628 target participants aged 40 to 69 years who returned the baseline questionnaire and provided blood samples, we selected those with either hepatitis B or hepatitis C virus infection at baseline (n=1,544). Among these, 90 (28 women and 62 men) were newly diagnosed with primary liver cancer from 1993 through 2006; they were matched with 175 controls (54 women and 121 men). Plasma concentrations of isoflavones (genistein, daidzein, glycitein, and equol) were measured using triple quadrupole tandem liquid chromatography-mass spectrometry. The odds ratios of liver cancer development based on plasma concentrations were estimated with a conditional logistic regression model. Results: Basically, distributions of plasma isoflavone concentrations did not differ between the cases and controls. No statistically significant associations of genistein, daidzein, glycitein, and equol with primary liver cancer risk were found in either women or men. Conclusions: In middle-aged Japanese women and men with hepatitis virus infection, plasma isoflavones were unassociated with the occurrence of primary liver cancer. Impact: The role of isoflavones in liver carcinogenesis merits further study using both biomarkers and data on dietary intake of isoflavones.
Copyright © 2014, American Association for Cancer Research.
Phytoestrogens are a group of non-steroidal compounds of plant origin that present structural and functional similarities with estradiol. Isoflavones are their most widely known category. There are different mechanisms of action of isoflavones accepted, although they may be considered as selective modulators of estrogen receptors. On the other hand, Cimicifuga Racemosa is a perennial plant used traditionally for problems related to menstruation. Its action mechanisms have not been totally identified. There is a growing interest in the usefulness of phytotherapy in the treatment of symptoms and menopause-related diseases. Isoflavones and Cimicifuga Racemosa moderately improve vasomotor symptoms in menopausal women, particularly in those who have a greater number of hot flushes. Furthermore, trials performed with soy isoflavones have observed a reduction of the loss of bone mineral density in postmenopausal women and a slight decrease in LDL cholesterol. In short, phytotherapy will constitute a therapeutic option that can offer assistance to women who want to improve their quality of life through relief of vasomotor symptoms or benefit from other effects for their health.
Isoflavones are phytoestrogens and natural plant compounds which are similar to 17-β-estradiol in chemical structure. It is known that they can act as estrogen agonists or antagonists, depending on endocrine estrogenic levels, but actions of isoflavones are rather complex due to large number of variables such as chemical structures and mechanisms. Some hypotheses on biological mechanisms have not satisfactorily been confirmed to date and human epidemiological and experimental studies have been relatively limited. Nevertheless, isoflavones and isoflavone rich foods have become a focus onf interest due to positive health benefits on many diseases, especially prevention of hormone-related cancers, cardiovascular disease, osteoporosis, and adverse postmenopausal symptoms, and improvement of physiological condition such as maintaining cognitive function. This review provides an overview of chemistry, analytical techniques (focused on human biospecimens), functions including biological mechanisms, and effects of isoflavones, on the basis of the available meta-analysis and review articles and some original articles, on health and cancer.
The incidence of gastric cancer throughout the world is ∼2-3 times higher in men than in women. Previous research suggested that isoflavones, which are structurally similar to 17β-estradiol, may prevent gastric cancer. Based on a large, population-based, prospective study, we recently reported a null association between dietary isoflavone intake and gastric cancer. However, epidemiologic studies using blood concentrations of isoflavones might better reflect the effect of isoflavones on gastric cancer carcinogenesis than dietary assessment. We therefore conducted a nested case-control study within the Japan Public Health Center-Based Prospective Study. Participants were followed-up from 1990 to 2004. Among 36,745 participants who answered the baseline questionnaire and provided blood samples, 483 gastric cancer cases matched to 483 controls were used in the analysis. ORs and 95% CIs were estimated with a conditional logistic regression model. The overall distribution of plasma isoflavone concentrations was not associated with the development of gastric cancer. Compared with groups with the lowest plasma concentrations (reference groups), the groups with the highest daidzein and genistein concentrations had adjusted ORs and 95% CIs of 1.11 (0.74-1.66; P-trend = 0.6) and 0.96 (0.64-1.44; P-trend = 0.9), respectively. The results did not change when analysis was based on sex, subsite, or histological type. We found no association of plasma isoflavone concentrations with gastric cancer risk. Our data support the previously observed null association between isoflavone intake and gastric cancer risk.
Scavenging rate constants of eight hydrophilic antioxidants, including caffeic acid, chlorogenic acid, genistein, glutathione, N-acetylcysteine, rutin, trolox, and uric acid against multiple ROS, namely superoxide anion, hydroxyl radical, singlet oxygen, and alkoxyl radical were determined with the electron spin resonance method. Direct flash photolysis measurement of the second-order rate constant in the reaction of alkoxyl radical plus the spin trap 5,5-dimethyl-pyrroline N-oxide made it possible to evaluate scavenging rate constants in antioxidants. The magnitudes of scavenging rate constants were notably dependent on the character of each ROS and the overall rate constants were highest in hydroxyl radical scavenging and the lowest in superoxide anion. The highest scavenging rate constant against superoxide anion was obtained by chlorogenic acid (2.9 × 10(5) M(-1) s(-1)) and the lowest was by N-acetylcysteine (5.0 × 10(2) M(-1) s(-1)). For singlet oxygen, the highest was by glutathione (9.4 × 10(8) M(-1) s(-1)) and the lowest was by uric acid (2.3 × 10(6) M(-1) s(-1)). All other numbers are listed and illustrated. Redox potential measurements of the antioxidants indicated that the antioxidants are likely to react with superoxide anion and singlet oxygen through electron transfer processes.
Objective:
To explore the effect and pathway of phytoestrogens on the growth of breast cancer cell line MCF-7.
Methods:
MCF-7 cells (human estrogen receptor-positive and progesterone receptor-positive breast cancer cells) were cultured in serum-free medium for 24 h and then treated with genistein, resveratrol, and quercetin (10(-10)-10(-4) mol/l). After further incubation for 24, 48, 72, and 92 h, the cells were harvested and extracted for 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. According to the above results, the proteins involving proliferative and apoptotic pathways were evaluated by Western blot analysis.
Results:
Genistein, resveratrol, and quercetin significantly inhibited cellular proliferation in a dose- and time-dependent manner. Significantly elevated caspase-3 activity was noted after treatment with genistein (10(-9)-10(-7) mol/l), as well as with resveratrol and quercetin (10(-9)-10(-5) mol/l). Significant reduction of PI3K and AKT protein and significant increase of Fas ligand, Fas-associated protein with death domain, cytochrome C, truncated Bid, caspase-9, and caspase-3 were all noted after genistein, resveratrol, and quercetin treatment. 17β-Estradiol induced completely opposite results. Estrogen receptor (ER) α expression was significantly increased with 17β-estradiol, whereas ERβ expression was significantly elevated in the cultures with genistein, resveratrol, and quercetin.
Conclusions:
These data demonstrate that genistein, resveratrol, and quercetin have antiproliferative effects on breast cancer cells. Their induction of apoptosis involves the activation of both the intrinsic and extrinsic apoptotic pathways, which may be related to the differential affinity to ERα and ERβ. Whether phytoestrogens have similar effects on normal breast cells remains to be examined.
The specific profile of estrogens on cardiovascular risk, with limiting action on atherogenesis but a less clear protection on cardiovascular episodes, might be improved by other agonists of the estrogen receptor, such as isoflavones. By using a systematic search based on the electronic Medline database plus a hand-search of reference lists of selected review papers, we reviewed the rapidly growing body of experimental and clinical data that, on average, follow a pattern of benefit rather similar to estrogens. Experimental models have used endothelial and vascular smooth muscle cells, isolated arteries, and live animals, including monkeys. The clinical evidence arises from studies on the lipid profile and lipid oxidation, insulin resistance, hemostasis, changes in the inflammatory factors, and indicators of endothelial function, including metabolites of nitric oxide and prostacyclin. There are not randomized trials investigating the action of isoflavones on the incidence of clinical episodes, but a few
Flavonoids are polyphenolic compounds that are abundant in fruits and vegetables, and increasing evidence demonstrates a positive relationship between consumption of flavonoid-rich foods and disease prevention. Epidemiological, in vitro and animal studies support the beneficial effects of dietary flavonoids on glucose and lipid homeostasis. It is encouraging that the beneficial effects of some flavonoids are at physiological concentrations and comparable to clinically-used anti-diabetic drugs; however, clinical research in this field and studies on the anti-diabetic effects of flavonoid metabolites are limited. Flavonoids act on various molecular targets and regulate different signaling pathways in pancreatic β-cells, hepatocytes, adipocytes and skeletal myofibers. Flavonoids may exert beneficial effects in diabetes by (i) enhancing insulin secretion and reducing apoptosis and promoting proliferation of pancreatic β-cells; (ii) improving hyperglycemia through regulation of glucose metabolism in hepatocytes; (iii) reducing insulin resistance, inflammation and oxidative stress in muscle and fat and (iv) increasing glucose uptake in skeletal muscle and white adipose tissue. This review highlights recent findings on the anti-diabetic effects of dietary flavonoids, including flavan-3-ols, flavanones, flavonols, anthocyanidins, flavones and isoflavones, with particular emphasis on the studies that investigated the cellular and molecular mechanisms involved in the beneficial effects of the compounds.
Groundnut (Apios americana Medik) contains a novel isoflavone, genistein-7-O-gentiobioside. In the present study, we examined the biological activities of an alcohol extract of groundnut containing genistein-7-O-gentiobioside as the main component. Although the groundnut extract by itself did not show antioxidative activity, it drove the antioxidative system in cells. Pretreatment of human breast carcinoma MCF-7 cells for 24h with the groundnut extract and soybean isoflavone increased gene expression of heme oxygenase-1 (HO-1), a major antioxidative stress enzyme. These groundnut extract-treated cells showed antioxidative activity against free radicals derived from a radical initiator. Pretreatment of cells with 100μg/mL groundnut extract prevented the depletion of glutathione by the radical initiator; however, treatment with 100μg/mL of soybean isoflavone injured the cell membrane, indicating that glutathione might be released to the extracellular environment. These results suggest that the groundnut extract had isoflavone-like activity. Like soybean, groundnuts are a good source of isoflavones.
Type 2 diabetes is a result of chronic insulin resistance and loss of functional pancreatic β-cell mass. Strategies to preserve β-cell mass and a greater understanding of the mechanisms underlying β-cell turnover are needed to prevent and treat this devastating disease. Genistein, a naturally occurring soy isoflavone, is reported to have numerous health benefits attributed to multiple biological functions. Over the past 10 years, numerous studies have demonstrated that genistein has anti-diabetic effects, in particular, direct effects on β-cell proliferation, glucose-stimulated insulin secretion and protection against apoptosis, independent of its functions as an estrogen receptor agonist, antioxidant, or tyrosine kinase inhibitor. Effects are structure-specific and not common to all flavonoids. While there are limited data on the effects of genistein consumption in humans with diabetes, there are a plethora of animal and cell-culture studies that demonstrate a direct effect of genistein on β-cells at physiologically relevant concentrations (<10 μM). The effects appear to involve cAMP/PKA signaling and there are some studies that suggest an effect on epigenetic regulation of gene expression. This review focuses on the anti-diabetic effects of genistein in both in vitro and in vivo models and potential mechanisms underlying its direct effects on β-cells.
Although a growing body of evidence suggests that soy isoflavones help regulate lipid metabolism, the underlying mechanism has not yet been thoroughly clarified. The present study was undertaken to determine the effects of soy isoflavones on the expression of genes involved in lipid metabolism in different adipose tissue depots, skeletal muscle and liver of male Huanjiang mini-pigs, as well as the expression of adipokines and myokines. A total of 36 male Huanjiang mini-pigs were fed basal diet (control, Con), low-dose soy isoflavones (LSI) and high-dose soy isoflavones (HSI). The results showed that LSI and HSI regulated the expression of genes involved in the anabolism and catabolism of fatty acids in dorsal subcutaneous (DSA), abdominal subcutaneous (ASA) and perirenal (PRA) adipose tissue depots, as well as longissimus dorsi muscle (LDM) and liver. LSI and HSI also regulated the expression of adipokines in DSA, ASA and PRA, and the expression of myokines in LDM in male Huanjiang mini-pigs. In addition, soy isoflavones regulated plasma glucose, leptin and adiponectin contents after treatment for two months. Our results indicate that soy isoflavones, by regulating the expression of adipokines and myokines, may regulate the metabolism of lipids and could have potential therapeutic applications in lipid abnormalities.
Genistein (GEN) is a molecule of great interest as a potent chemopreventive agent against atherosclerosis and cancer. However, the bioavailability of GEN is very low in vivo. Our previous study showed that a GEN derivative, 7-difluoromethyl-5,4'-dimethoxygenistein (dFMGEN) has a better bioavailability than GEN in vivo. In this study, we further evaluated the efficacy of dFMGEN as a candidate for cancer therapy. We demonstrated that dFMGEN treatment decreased the viability of A549 cells in a concentration- and time-dependent manner and induced cell-cycle arrest at the G(1) phase. G(1) phase arrest was correlated with a significant reduction of Cdk4 and cyclin D1 protein level. Further studies showed that cyclin-dependent kinase (Cdk)4 and cyclin D1 protein-level decrease was caused by Cdk inhibitors p15, p21, and p27 level increase, and decreased protein level directly suppressed Rb protein phosphorylation and E2F-1 expression, then cell-cycle progression was arrested. Finally, we also found that dFMGEN has a dosage effect in suppressing tumor growth in vivo, and that dFMGEN was well tolerated by animals. In summary, our results suggest that dFMGEN has therapeutic potential for the treatment of human lung cancer.