ArticlePDF Available

Design and Fabrication of a Hypoxia-Inducing Chamber for Simulation Studies in Environmental Bio-monitoring Using Chironomus larvae

Authors:
  • Savitribai Phule Pune University Pune India
Article

Design and Fabrication of a Hypoxia-Inducing Chamber for Simulation Studies in Environmental Bio-monitoring Using Chironomus larvae

Abstract and Figures

The larvae of the aquatic Chironomid midge (Diptera, Chironomidae) are known to survive in freshwater habitats exposed to stress especially that of hypoxic stress. Hence, a study of the effect of alterations in the levels of dissolved oxygen on the physiology of the larvae could help in establishing them as potential sensitive bio indicators for monitoring such freshwater habitats. A simple inexpensive and non-cumbersome experimental setup unlike commercially available sophisticated set-ups was designed and fabricated in the lab. The validation of this set-up was carried out and alterations in the hemoglobin levels in the larvae of the tropical midge species Chironomus ramosus exposed to hypoxic conditions were studied. It was observed that there was an increase in the level of hemoglobin on exposure to hypoxic conditions and the findings were further validated by studying the expression of hemoglobin gene at various time points during exposure to hypoxia. These findings suggest that the device designed could be used as an inexpensive and effective method for generating and maintaining the desired levels of dissolved oxygen as compared to several of the chemical and physical methods generally used. Further, this would be useful in studies to be done for the monitoring of hypoxia in freshwater habitats using Chironomus hemoglobin as a biomarker.
Content may be subject to copyright.
e-ISSN:2321-6190
p-ISSN:2347-2294
45
RRJZS| Volume 5 | Issue 2 | June, 2017
Research & Reviews: Journal of Zoological Sciences
INTRODUCTION
Hypoxia in freshwater ecosystems is a frequent threat to life forms thriving in such aquatic habitats. Hypoxic or low dissolved
oxygen conditions could arise as a result of increase in temperature, deposition of efuents, discharges from sewage treatment
plants and several such factors [1,2]. Introduction of nutrients which cause eutrophication eventually lead to hypoxic conditions in
the water body due to the decomposition of the dead algal mass [3]. Thus, in the current scenario of a steady increase in the global
ecological threats to freshwater ecosystems, the uctuations in the dissolved oxygen content in aquatic ecosystems is becoming
a pertinent issue [4-8]. In this context, arthropods, especially the aquatic insects have emerged as suitable models for investigating
hypoxic stress and global warming led climatic changes [9-12].
Amongst the aquatic ectotherms, chironomid midge larvae have proved to be a useful model organism and constitute an
important group of globally existing macro benthos. The non-biting midge of the genus Chironomus is one of the most abundant
group of insects found in freshwater ecosystems [13-15]. While the terrestrial adults of the midge have a short life span of a couple
of days, the aquatic larvae constitute the longest phase of the midge life cycle. Since these larvae coexist with other aquatic life
forms for several days, they form a very important component of the aquatic food chain. They are fed upon by several freshwater
sh and aquatic beetles as well as other predatory insects. In the context of environmental bio monitoring, the Chironomid larvae
have particularly gained importance owing to their ability to survive in hypoxic environments [16-19]. Hence studies on the density
uctuation of the larval population, increased incidence of mortality and other morphological, physiological and biochemical
changes in the larvae could provide an insight into the ecological conditions of such habitats. The ability of the larvae to survive
in aquatic habitats with low dissolved oxygen content has been attributed to the presence of a high content of the respiratory
pigment hemoglobin in the hemolymph [20-23]. Studies on the larval hem lymph have indicated that the hemoglobin constitutes
approximately 90% of the total hem lymph proteins [24]. The hemoglobin synthesis in the larvae occurs in the fat body and it is
Design and Fabrication of a Hypoxia-Inducing Chamber for
Simulation Studies in Environmental Bio-monitoring Using
Chironomus
larvae
Anupama Ronad1,2 and Nath BB1*
1Department of Zoology, Savitribai Phule Pune University, Pune, India
2Homi Bhabha Centre for Science Education, TIFR, Mumbai, India
Research Article
Received date: 04/07/2017
Accepted date: 28/07/2017
Published date: 31/07/2017
*For Correspondence
Nath BB, Department of Zoology, Savitribai
Phule Pune University, Pune, India
Tel: +912025601435
E-mail: bbnath@gmail.com
Keywords: Chironomus ramosus, Freshwa-
ter, Hemoglobin, Hypoxia, Environmental
bio monitoring
ABSTRACT
The larvae of the aquatic Chironomid midge (Diptera, Chironomidae)
are known to survive in freshwater habitats exposed to stress especially that
of hypoxic stress. Hence, a study of the effect of alterations in the levels of
dissolved oxygen on the physiology of the larvae could help in establishing
them as potential sensitive bio indicators for monitoring such freshwater
habitats. A simple inexpensive and non-cumbersome experimental set-
up unlike commercially available sophisticated set-ups was designed
and fabricated in the lab. The validation of this set-up was carried out and
alterations in the hemoglobin levels in the larvae of the tropical midge species
Chironomus ramosus exposed to hypoxic conditions were studied. It was
observed that there was an increase in the level of hemoglobin on exposure
to hypoxic conditions and the ndings were further validated by studying
the expression of hemoglobin gene at various time points during exposure
to hypoxia. These ndings suggest that the device designed could be used
as an inexpensive and effective method for generating and maintaining the
desired levels of dissolved oxygen as compared to several of the chemical and
physical methods generally used. Further, this would be useful in studies to be
done for the monitoring of hypoxia in freshwater habitats using Chironomus
hemoglobin as a biomarker.
46
RRJZS| Volume 5 | Issue 2 | June, 2017
e-ISSN:2321-6190
p-ISSN:2347-2294
Research & Reviews: Journal of Zoological Sciences
then secreted into the hemolymph. Thus the larval hemoglobin is found free-owing in the hemolymph unlike most of the higher
vertebrate organisms. Moreover, the larval hemoglobin is predominantly found as monomers and dimers in the larval hemolymph
[25,26]. A few seminal studies could be found in the literature where Chironomus hemoglobin (ChHb) has been shown as an indicator
of environmental toxicants and hypoxia [27,28]. Although there have been attempts to develop devices to be used for monitoring
hypoxic water samples, none of these devices are user-friendly and most of them are labor-intensive [29-31]. Such lab studies to
monitor the changes occurring in the organisms due to hypoxic conditions necessitate the need for a chamber to provide steady
simulated experimental conditions. The commercially available nitrogen gassing apparatus are cumbersome and expensive to
use at a small scale for studies involving juvenile stages of invertebrates such as insect larvae. Hence the need for a chamber to
suit the specic requirement was felt. The design and fabrication of such a hypoxia-inducing cum bio monitoring and simulation
chamber is reported in this paper. The fabricated chamber was validated and tolerance of test organisms to varying levels of
dissolved oxygen (DO) was monitored. Since DO levels below 2 ppm is termed as hypoxic for aquatic habitats [32], survival at ppm
levels of 2 ppm and below were tested. Changes in the hemoglobin content and the transcriptional level of ChHb gene due to
hypoxia over time were monitored using this chamber and the results have been reported. These lab-based simulation studies
could help in exploiting the midge larvae as potential indicators of hypoxia in aquatic freshwater ecosystems.
MATERIALS AND METHODS
Organisms
Third instar larvae of Chironomus ramosus, a tropical insect midge species was used in the present study. Isofemale lines
of C. ramosus were maintained at 25 ± 2°C and 14 h light: 10 h darkness cycle. The larvae were supplemented with food as
described by Nath and Godbole [33].
Design of the Hypoxia Set-up
A rectangular polypropylene box of 10 inches × 7 inches × 4 inches (l × b × d) dimensions was used as a chamber to house
the larvae during treatment. The chamber had a capacity of 5 litres (Figure 1). However, 2 litres of distilled water was used for the
experiments reported in this paper. Nitrogen gas under controlled pressure could be introduced into the aquatic system by the
tube connected to the Nitrogen cylinder tted with pressure valves. A diffuser was used at the point of introduction of nitrogen into
the water. An opening to allow the introduction of a dissolved oxygen meter probe was made available in the wall of the chamber.
The rectangular box was provided with a lid which could be closed and materials such as paralm could be used to seal the point
of contact between the box and the lid such that the oxygen levels achieved can be sustained for longer periods.
Figure 1. Schematic diagram illustrating the hypoxia-inducing chamber: (A) Polypropylene chamber (B) Gas diffuser (C) Pipeline for introduction
of N2 gas (D) Pressure valves (E) Nitrogen cylinder (F) Dissolved oxygen (DO) meter (G) DO probe.
Tolerance of the Test Organism to Hypoxia
The tolerance and survival of the larvae to DO levels of 2 ppm, 1 ppm, 0.5 ppm, 0.25 ppm and 0 ppm was studied. The study
was carried out by introducing larvae into the test chamber containing water with the DO level to be tested. Survival of larvae over
varying time periods upto 24 hours of exposure to hypoxia was recorded. Larvae exhibiting movement as well as responding to
tactile stimuli were taken as indication of the larvae being alive. 30 larvae were used for each experiment and all experiments
were carried out in triplicates.
47
RRJZS| Volume 5 | Issue 2 | June, 2017
e-ISSN:2321-6190
p-ISSN:2347-2294
Research & Reviews: Journal of Zoological Sciences
Measurement of Hemoglobin Content
The hemoglobin content as a function of time of exposure of larvae to hypoxia was carried out by measuring the Soret peak
(λmax=415 nm) [34-36] of hemoglobin present in the hemolymph of the larvae. The hemolymph was obtained by homogenizing
30 larvae, of a given time point of exposure, in phosphate buffer (pH 7). The homogenate was centrifuged at 12000 rpm for 20
minutes while maintaining the temperature at 4°C. The absorbance values of the supernatant at 415 nm were measured by
spectrophotometry using an ELISA plate reader (Biotek Instruments, Inc, Vermont, USA).
RNA Isolation and RT-qPCR
Whole larvae (n=5) were homogenized in 700 μl of TRIsoln reagent (Merck) and total RNA was isolated as per the
manufacturer’s standard protocol. At the end of the procedure, RNA obtained was resuspended in 50 μl nuclease free water.
Quantication was carried out spectrophotometrically using plate reader (Biotek Instrument Inc., Vermont, USA). Post quantication,
2 μg total RNA was used to synthesise cDNA using cDNA synthesis kit (SD Prodigy) by following the manufacturer’s protocol. The
total volume of the cDNA reaction was 20 μl. At the end of cDNA synthesis, 30 μl of nuclease free sterile water was added. 2 μl of
cDNA was used for RT-qPCR analysis using primer sequences previously described by Lee et al. [27]. Hb (GenBank accession no.
X56272 - F: 5’TTGAGATTCCACGGTTGTGA3’; R: 5’AAGTTGACATCCTTGCTGCC3’) and actin (GenBank accession no. AB073070 - F:
5’GATGAAGATCCTCACCGAACG3’; R: 5’CCTTACGGATATCAACGTCGC3’). Of the several isoforms of Hb present in the Chironomus
larvae, one of the isoforms was studied for expression. 2 μl of cDNA template was mixed with 2 μl each of the forward and reverse
primers and 10 μl of the SsoFast EvaGreen Supermix (BioRad). The volume of the reaction mixtures was made up to 20 μl by
the addition of 4 μl nuclease free sterile water. The reaction conditions used during the RT-qPCR were as follows: 2 min for initial
denaturation at 95°C, 40 cycles of 30 sec denaturation at 94°C, 30 sec annealing at 60°C and 30 sec extension at 72°C. A 5
min nal elongation step at 72°C was the last step in the reaction. All samples were analysed as triplicates and the Ct values were
calculated. Expression of the actin gene was used as reference for normalization. mRNA levels in the samples were represented
as fold induction relative to the control value (set to 1).
Statistics
Statistical analysis was done using the IBM SPSS Version 20 Software.
RESULTS AND DISCUSSION
Test of Hypoxia-Inducing Efcacy of the Chamber
It was observed that nitrogen gassing at a steady pressure of 1 psi led to a gradual decrease in the dissolved oxygen content
in the test chamber. At the start of the experiment a DO level of 5.73 ppm was recorded. In about 10 minutes from the start of gas
introduction, the DO content reached a value of 1.14 ppm and within the next 20 mins it further dropped to 0.35 ppm (Figure 2).
Five replicates were carried out and it was observed that a hypoxic condition of about 0.3 ppm could be reached within 30 mins of
the start of the experiment. A similar set-up without the nitrogen bubbling was used as a control. The ndings have indicated that
the fabricated experimental set-up could serve as a hypoxia-inducing chamber for simulation experiments. The gas ow can be
controlled in a manner such that DO content in a required range can be maintained using the set-up over time. Thus, it provides
a possibility to carry out simulation studies for aquatic ecosystems varying in oxygen concentrations.
Figure 2. Testing of the hypoxia-inducing chamber expressed as changes in the dissolved oxygen (DO) content in the control and hypoxia-
inducing (test) chambers over time.
Tolerance of the Test Organism to Hypoxia
Test organisms (n=30) were exposed to varying DO content and the survival of the larvae was monitored at various time
48
RRJZS| Volume 5 | Issue 2 | June, 2017
e-ISSN:2321-6190
p-ISSN:2347-2294
Research & Reviews: Journal of Zoological Sciences
points upto 24 hr. The survival plot of the larvae at various experimental DO content of 2 ppm, 1 ppm, 0.5 ppm, 0.25 ppm and 0
ppm shows that the lowest concentration of DO at which the larvae show maximum survival is 0.5 ppm whereas the death
rate increases at 0.25 ppm and 0 ppm. The plot showing the survival of larvae re-establishes the fact that the larvae of
Chironomus are able to survive in hypoxic conditions for prolonged periods of time (Figure 3) as documented in many of the
past studies [14,16,19]. Since the lowest DO at which maximum tolerance was observed was 0.5 ppm, exposure to 0.5 ppm was
selected for further studies.
Figure 3. Survival plot of larvae of C. ramosus exposed to varying DO.
Alterations in the Hb Content as a Function of Time of Exposure to Hypoxic Conditions
Measurement of the hemoglobin content in the larvae exposed to hypoxia (0.5 ppm) showed a signicant change of about
25% at the end of a 24-hr period as compared to larvae exposed to normoxia for the same time period (p<0.005) (Figure 4). The
hemoglobin content has been expressed as μg per mg larva. Hb measurements were done for larvae exposed to the respective
conditions for 2, 4, 8 and 24 hours. The hemoglobin content for larvae exposed to hypoxia shows an increase as compared to
larvae under normoxic conditions for every time point.
Figure 4. Hemoglobin content (μg/mg larva) of C. ramosus larvae at various time points under control (normoxic) and treated (hypoxic) conditions;
** indicates change is signicant relative to the corresponding control value (p <0.005).
Effect of Hypoxia on Hb Gene Expression
RT qPCR analysis revealed that there was an increase in the transcriptional level of the ChHb gene expression when the
larvae were exposed to hypoxia for increasing time periods upto 24 hr. The results indicate that there is an increase in the levels
of expression of the Hb at all-time points of exposure to hypoxia with the increase being signicant at 4 hr and 24 hr (p<0.05)
(Figure 5).
49
RRJZS| Volume 5 | Issue 2 | June, 2017
e-ISSN:2321-6190
p-ISSN:2347-2294
Research & Reviews: Journal of Zoological Sciences
Figure 5. Rt qPCR analysis for detection of Hb expression at various time periods after exposure to hypoxia; *indicates change is signicant (p
<0.05).
CONCLUSIONS
The larvae of Chironomus popularly known as bloodworms due to the presence of high content of hemoglobin in the
hemolymph have been documented to survive in aquatic habitats with low oxygen content. Field studies on these larvae have
been carried out in several instances with emphasis on the efuents that are introduced into these naturally occurring water
bodies. However, in order to establish specic effects of changes in the levels of dissolved oxygen in the aquatic surrounding in
which these larvae survive, one needs to carry out such experiments under controlled conditions in the lab. A chamber to carry out
such experiments where the DO content can be easily altered would facilitate such studies. The efcacy of the hypoxia-inducing
chamber designed and fabricated was evaluated and the effectiveness of the chamber in acquiring and maintaining low DO
content in an aqueous body was demonstrated. The effect of hypoxia on a tropical midge species Chironomus ramosus showed
that the larvae were tolerant to DO as low as 0.5 ppm. Exposure of the larvae to 0.5 ppm over time was studied with respect to
physiological, biochemical as well as molecular parameters. There was a steady increase in the Hb content during the initial hours
of treatment which was conrmed by gene expression studies at the transcriptional level of the ChHb gene. The test performance
indicated that such a chamber mimics natural hypoxic aquatic habitats leading to alterations in the Hb of Chironomus larvae which
reafrm the studies on the effect of hypoxia that have been reported in the past. Hence it could be used as a reliable simulatory
aid for studying such habitats using ChHb as a parameter. To conclude, the hypoxia-inducing chamber fabricated and described
here is inexpensive and effective equipment for generating and maintaining hypoxia for bio monitoring studies on aquatic larvae.
This method also provides a good alternative to the traditionally used cumbersome chemical and physical methods of hypoxia
induction.
ACKNOWLEDGEMENTS
The authors are thankful to the Biology Olympiad Lab of Homi Bhabha Centre for Science Education, TIFR, Mumbai and the
Department of Zoology, S. P. Pune University for logistic and infrastructural support (DRDP, DST-PURSE and UGC-CAS-III) as well as
contingency and travel support from SPPU-BCUD grant (2016-18). The authors are also thankful to the workshop staff of HBCSE
for help in fabricating the apparatus. We also thank Dr. Jacinta D’souza of UM-DAE CBS, Mumbai for logistic help in carrying out
the RT qPCR experiments.
CONFLICT OF INTERESTS
The authors declare that the work reported here has no conict of interest of any kind.
REFERENCES
1. Diaz RJ. Overview of hypoxia around the world. J Environ Qual 2001;30:275-281.
2. Colodey AG and Wells PG. Effects of pulp and paper mill efuents on estuarine and marine ecosystems in Canada: a review.
J Aquat Ecosyst Health 1992;1:201-226.
3. Jenny JP, et al. Urban point sources of nutrients were the leading cause for the historical spread of hypoxia across European
lakes. Proc Natl Acad Sci 2016;113:12655-12660.
50
RRJZS| Volume 5 | Issue 2 | June, 2017
e-ISSN:2321-6190
p-ISSN:2347-2294
Research & Reviews: Journal of Zoological Sciences
4. Alexander TJ, et al. Does eutrophication-driven evolution change aquatic ecosystem? Phil Transect Royal Soc B: Biol Sci
2016.
5. Jenny JP, et al. Global spread of hypoxia in freshwater ecosystems during the last three centuries is caused by rising local
human pressure. Global Change Biology 2016;22:1481-1489.
6. McCrackin ML, et al. Recovery of lakes and coastal marine ecosystems from eutrophication: A global meta-analysis.
Limnology and Oceanography 2016.
7. Conley DJ, et al. Ecosystem thresholds with hypoxia. Hydrobiologia 2009;629:21-29.
8. Landman MJ, et al. Combined effects of pulp and paper efuent, dehydroabietic acid, and hypoxia on swimming performance,
metabolism, and hematology of rainbow trout. Ecotoxicology and Environmental Safety 2006;65:314-322.
9. Verberk WCEP and Calosi P. Oxygen limits heat tolerance and drives heat hardening in the aquatic nymphs of the gill
breathing damsely Calopteryx virgo (Linnaeus, 1758). Journal of Thermal Biology 2012;37:224-229.
10. Verberk WCEP and Bilton DT. Respiratory control in aquatic insects dictates their vulnerability to global warming. Biology
Letters 2013;9:5.
11. Verberk WCEP, et al. Can respiratory physiology predict thermal niches?. Annals of the New York Academy of Sciences
2016;1365:73-88.
12. Verberk WCEP, et al. Does oxygen limit thermal tolerance in arthropods? A critical review of current evidence. Comparative
Biochemistry and Physiology Part A: Molecular & Integrative Physiology 2016;192:64-78.
13. Ferrington LC Jr. Global diversity of non-biting midges (Chironomidae; Insecta-Diptera) in freshwater. Hydrobiologia
2008;595:447-455.
14. Armitage PD. The Chironomidae Biology and Ecology of non-biting midges. In: Cranston PS, Pinder LCV (eds.). Chapman
and Hall, London; 1995.
15. Oliver DR. Life history of Chironomidae. Annu Rev Entomol 1971;16:11-230.
16. Hoback WW. Ecological and experimental exposure of insects to anoxia reveals surprising tolerance. In: Attenbach AV,
Bernhard JM, Seckback J (eds.). Evidence for Eukaryote survival and paleontological strategies. Springer, Heidelberg
2012;3:167-188.
17. McLachlan AJ. Phenotypic plasticity and adaptation in a holometabolous insect: The Chironomid midge. ISRN Zoology
2012.
18. Connolly NM, et al. Effect of low dissolved oxygen on survival, emergence and drift of tropical stream macroinvertebrates.
J N Am Benthol Soc 2004;23:251-270.
19. Pinder LCV. Biology of freshwater Chironomidae. Annu Rev Entomol 1986;37:1-23.
20. Walshe BM. The function of haemoglobin in Chironomus plumosus under natural conditions. J Exptl Biol 1950;27:73-95.
21. Weber RE and Vinogradov SN. Non-vertebrate hemoglobins: functions and molecular adaptations. Physiol Rev
2001;81:569-628.
22. Osmulski PA and Leyko W. Structure, function and physiological role of Chironomus hemoglobin. Review in Comparative
Biochemical Physiology 1986;85:701-722.
23. Redecker B and Zebe E. Anaerobic metabolism in aquatic insect larvae: studies on Chironomus thummi and Culex pipiens.
Journal of Comparative Physiology B 1988;158:307-315.
24. Bergtrom G, et al. Fat Body: A Site of Hemoglobin Synthesis in Chironomus thummi (Diptera). The Journal of Cell Biology.
1976;69:264-274.
25. Gaikwad PS, et al. Differential sensitivity of Chironomus and human haemoglobin to gamma radiation. Biochem Biophys
Res Commun 2016;476:371-378.
26. Ruf HH, et al. Preparation and characterization of insect hemoglobins from Chironomus thummi thummi. Methods in
Enzymology 1994;231:95-111.
27. Lee SM, et al. Expression of heat shock protein and haemoglobin genes in Chironomus tentans (Diptera, Chironomidae)
larvae exposed to various environmental pollutants: A potential biomarker of freshwater monitoring. Chemosphere
2006;65:1074-1081.
28. Ha MH and Choi J. Effects of environmental contaminants on haemoglobin of larvae of aquatic midge Chironomus riparius
(Diptera: Chironomidae): A potential biomarker for ecotoxicity monitoring. Chemosphere 2008;71:1928-1936.
29. Choi J, et al. Effects of physical (hypoxia, hyperoxia) and chemical (Potassium dichromate, fenitrothion) stress on antioxidant
enzyme activities in Chironomus riparius Mg. (Diptera, Chironomidae) larvae: Potential biomarkers. Environmental toxicology
and chemistry 2000;19:495–500.
51
RRJZS| Volume 5 | Issue 2 | June, 2017
e-ISSN:2321-6190
p-ISSN:2347-2294
Research & Reviews: Journal of Zoological Sciences
30. Beauvais SL, et al. Use of cholinesterase activity to monitor exposure of Chironomus riparius (Diptera: Chironomidae) to a
pesticide mixture in hypoxic wetland mesocosms. Hydrobiologia 1999;416:163-170.
31. Gleixner E, et al. Oxygen-induced changes in hemoglobin expression in Drosophila The FEBS Journal 2008.
32. Johnson WS and Allen DM. Zooplankton of the Atlantic and Gulf Coasts: A Guide to their identication and ecology. The
Johns Hopkins University Press; 2005.
33. Nath BB and Godbole NN. Technique for mass rearing of Indian Chironomus species (Diptera, Nematocera, Chironomidae).
Studia Dipeterologia 1998;5:187-193.
34. Faber DJ, et al. Oxygen saturation – dependent absorption and scattering of blood. Physical Review Letters 2004;93:2.
35. Denninghoff KR, et al. Blood oxyhemoglobin saturation measurements by blue-green spectral shift. Journal of Biomedical
Optics 2007;12:034020.
36. Zebe E. In vivo -studies on the function of hemoglobin in the larvae of Chironomus thummi (Insecta, diptera). Comparative
Biochemistry and Physiology Part A: Physiology 1991;99:525-529.
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
Eutrophication increases primary production and changes the relative abundance, taxonomic composition and spatial distribution of primary producers within an aquatic ecosystem. The changes in composition and location of resources alter the distribution and flow of energy and biomass throughout the food web. Changes in productivity also alter the physico-chemical environment, which has further effects on the biota. Such ecological changes influence the direction and strength of natural and sexual selection experienced by populations. Besides altering selection, they can also erode the habitat gradients and/or behavioural mechanisms that maintain ecological separation and reproductive isolation among species. Consequently, eutrophication of lakes commonly results in reduced ecological specialization as well as genetic and phenotypic homogenization among lakes and among niches within lakes. We argue that the associated loss in functional diversity and niche differentiation may lead to decreased carrying capacity and lower resource-use efficiency by consumers. We show that in central European whitefish species radiations, the functional diversity affected by eutrophication-induced speciation reversal correlates with community-wide trophic transfer efficiency (fisheries yield per unit phosphorus). We take this as an example of how evolutionary dynamics driven by anthropogenic environmental change can have lasting effects on biodiversity and ecosystem functioning. This article is part of the themed issue ‘Human influences on evolution, and the ecological and societal consequences'.
Article
Full-text available
Enhanced phosphorus (P) export from land into streams and lakes is a primary factor driving the expansion of deep-water hypoxia in lakes during the Anthropocene. However, the interplay of regional scale environmental stressors and the lack of long-term instrumental data often impede analyses attempting to associate changes in land cover with downstream aquatic responses. Herein, we performed a synthesis of data that link paleolimnological reconstructions of lake bottom-water oxygenation to changes in land cover/use and climate over the past 300 years to evaluate whether the spread of hypoxia in European lakes was primarily associated with enhanced P exports from growing urbanization, intensified agriculture, or climatic change. We showed that hypoxia started spreading in European lakes around CE 1850 and was greatly accelerated after CE 1900. Socioeconomic changes in Europe beginning in CE 1850 resulted in widespread urbanization, as well as a larger and more intensively cultivated surface area. However, our analysis of temporal trends demonstrated that the onset and intensification of lacustrine hypoxia were more strongly related to the growth of urban areas than to changes in agricultural areas and the application of fertilizers. These results suggest that anthropogenically triggered hypoxia in European lakes was primarily caused by enhanced P discharges from urban point sources. To date, there have been no signs of sustained recovery of bottom-water oxygenation in lakes following the enactment of European water legislation in the 1970s to 1980s, and the subsequent decrease in domestic P consumption.
Article
Full-text available
In order to inform policies aimed at reducing nutrient emissions to surface waters, it is essential to understand how aquatic ecosystems respond to eutrophication management. Using data from 89 studies worldwide, we examined responses to the reduction or cessation of anthropogenic nutrient inputs relative to baseline conditions. Baseline conditions were pre-disturbance conditions, undisturbed reference sites, restoration targets, or experimental controls. We estimated recovery completeness (% baseline conditions reached) and recovery rate (annual % change relative to baseline conditions) for plant and animal abundance and diversity and for ecosystem functions. Categories were considered fully recovered if the 95% confidence interval (CI) of recovery completeness overlapped 100% and partially recovered if the CI did not overlap either 100% or zero. Cessation of nutrient inputs did not result in more complete or faster recovery than partial nutrient reductions, due likely to insufficient passage of time, nutrients from other sources, or shifting baselines. Together, lakes and coastal marine areas achieved 34% (±16% CI) and 24% (±15% CI) of baseline conditions decades after the cessation or partial reduction of nutrients, respectively. One third of individual response variables showed no change or worsened conditions, suggesting that achieving baseline conditions may not be possible in all cases. Implied recovery times after cessation of nutrient inputs varied widely, from < 1 yr to nearly a century, depending on response. Our results suggest that long-term monitoring is needed to better understand recovery timescales and trajectories and that policy measures must consider the potential for slow and partial recovery.
Article
Full-text available
Over the last decade, numerous studies have investigated the role of oxygen in setting thermal tolerance in aquatic animals, and there has been particular focus on arthropods. Arthropods comprise one of the most species-rich taxonomic groups on Earth, and display great diversity in the modes of ventilation, circulation, blood oxygen transport, with representatives living both in water (mainly crustaceans) and on land (mainly insects). The oxygen and capacity limitation of thermal tolerance (OCLTT) hypothesis proposes that the temperature dependent performance curve of animals is shaped by the capacity for oxygen delivery in relation to oxygen demand. If correct, oxygen limitation could provide a mechanistic framework to understand and predict both current and future impacts of rapidly changing climate. In arthropods, most studies testing the OCLTT hypothesis have considered tolerance to thermal extremes. These studies likely operate from the philosophical viewpoint that if the model can predict these critical thermal limits, then it is more likely to also explain loss of performance at less extreme, non-lethal temperatures, for which much less data is available. Nevertheless, the extent to which lethal temperatures are influenced by limitations in oxygen supply remains unresolved. Here we critically evaluate the support and universal applicability for oxygen limitation being involved in lethal temperatures in crustaceans and insects. The relatively few studies investigating the OCLTT hypothesis at low temperature do not support a universal role for oxygen in setting the lower thermal limits in arthropods. With respect to upper thermal limits, the evidence supporting OCLTT is stronger for species relying on underwater gas exchange, while the support for OCLTT in air-breathers is weak. Overall, strongest support was found for increased anaerobic metabolism close to thermal maxima. In contrast, there was only mixed support for the prediction that aerobic scope decreases near critical temperatures, a key feature of the OCLTT hypothesis. In air-breathers, only severe hypoxia (< 2 kPa) affected heat tolerance. The discrepancies for heat tolerance between aquatic and terrestrial organisms can to some extent be reconciled by differences in the capacity to increase oxygen transport. As air-breathing arthropods are unlikely to become oxygen limited under normoxia (especially at rest), the oxygen limitation component in OCLTT does not seem to provide sufficient information to explain lethal temperatures. Nevertheless, many animals may simultaneously face hypoxia and thermal extremes and the combination of these potential stressors is particularly relevant for aquatic organisms where hypoxia (and hyperoxia) is more prevalent. In conclusion, whether taxa show oxygen limitation at thermal extremes may be contingent on their capacity to regulate oxygen uptake, which in turn is linked to their respiratory medium (air vs. water). Fruitful directions for future research include testing multiple predictions of OCLTT in the same species. Additionally, we call for greater research efforts towards studying the role of oxygen in thermal limitation of animal performance at less extreme, sub-lethal temperatures, necessitating studies over longer timescales and evaluating whether oxygen becomes limiting for animals to meet energetic demands associated with feeding, digestion and locomotion.
Article
Full-text available
Predicting species responses to global warming is the holy grail of climate change science. As temperature directly affects physiological rates, it is clear that a mechanistic understanding of species vulnerability should be grounded in organismal physiology. Here, we review what respiratory physiology can offer the field of thermal ecology, showcasing different perspectives on how respiratory physiology can help explain thermal niches. In water, maintaining adequate oxygen delivery to fuel the higher metabolic rates under warming conditions can become the weakest link, setting thermal tolerance limits. This has repercussions for growth and scaling of metabolic rate. On land, water loss is more likely to become problematic as long as O2 delivery and pH balance can be maintained, potentially constraining species in their normal activity. Therefore, high temperatures need not be lethal, but can still affect the energy intake of an animal, with concomitant consequences for long-term fitness. While respiratory challenges and adaptive responses are diverse, there are clear recurring elements such as oxygen uptake, CO2 excretion, and water homeostasis. We show that respiratory physiology has much to offer the field of thermal ecology and call for an integrative, multivariate view incorporating respiratory challenges, thermal responses, and energetic consequences. Fruitful areas for future research are highlighted. © 2015 New York Academy of Sciences.
Article
Full-text available
Fourth instar larvae of Chironomus thummi were permitted to incorporate labeled amino acids and/or sigma-aminolevulinic acid (sigma-ALA) in vivo and in organ culture. The products secreted into the hemolymph or into the culture medium were examined by acrylamide gel electrophoresis. Nine electrophoretic bands can be resolved as hemoglobins without staining. When gels are sliced for scintillation counting, incorporated amino acids and sigma-ALA are shown to be associated primarily with the same nine hemoglobin bands, suggesting that hemoglobins are assembled and secreted. Staining of gels with Coomassie brilliant blue reveals that there are several bands in addition to the visible hemoglobins. These bands incorporate amino acids, but not sigma-ALA, suggesting that they are non-heme proteins. The results of culturing isolated salivary glands, gut, and fat body demonstrate that the fat body is the major site of hemoglobin synthesis and secretion. Labeled products of the gut represent about 5% of the total hemoglobins produced by the tissues, while no hemoglobins are produced by the salivary glands. Although nine hemoglobins are visibly resolved on gels, labeling techniques reveal as many as 14 hemoglobins. This is the first demonstration of hemoglobin synthesis by specific tissues in culture in an invertebrate.
Article
Chironomus ramosus is known to tolerate high doses of gamma radiation exposure. Larvae of this insect possess more than 95% of hemoglobin (Hb) in its circulatory hemolymph. This is a comparative study to see effect of gamma radiation on Hb of Chironomus and humans, two evolutionarily diverse organisms one having extracellular and the other intracellular Hb respectively. Stability and integrity of Chironomus and human Hb to gamma radiation was compared using biophysical techniques like Dynamic Light Scattering (DLS), UV-visible spectroscopy, fluorescence spectrometry and CD spectroscopy after exposure of whole larvae, larval hemolymph, human peripheral blood, purified Chironomus and human Hb. Sequence- and structure-based Bioinformatics methods were used to analyze the sequence and structural similarities or differences in the heme pockets of respective Hbs. Resistivity of Chironomus Hb to gamma radiation is remarkably higher than human Hb. Human Hb exhibited loss of heme iron at a relatively low dose of gamma radiation exposure as compared to Chironomus Hb. Unlike human Hb, the heme pocket of Chironomus Hb is rich in aromatic amino acids. Higher hydophobicity around heme pocket confers stability of Chironomus Hb compared to human Hb. Previously reported gamma radiation tolerance of Chironomus can be largely attributed to its evolutionarily ancient form of extracellular Hb as evident from the present study.
Article
The spread of hypoxia is a threat to aquatic ecosystem functions and services as well as to biodiversity. However, sparse long-term monitoring of lake ecosystems has prevented reconstruction of global hypoxia dynamics while inhibiting investigations into its causes and assessing the resilience capacity of these systems. This study compiles the onset and duration of hypoxia recorded in sediments of 365 lakes worldwide since AD 1700, showing that lacustrine hypoxia started spreading before AD 1900, 70 years prior to hypoxia in coastal zones. This study also shows that the increase of human activities and nutrient release is leading to hypoxia onset. No correlations were found with changes in precipitation or temperature. There is no evidence for a post-1980s return to well-oxygenated lacustrine conditions in industrialized countries despite the implementation of restoration programs. The apparent establishment of stable hypoxic conditions prior to AD 1900 highlights the challenges of a growing nutrient demand, accompanied by increasing global nutrient emissions of our industrialized societies, and climate change.
Article
Zooplankton play a vital role in the ecology of estuaries and coastal waters. In this revised edition of Johnson and Allen's instant classic, we are offered a guided tour of zooplankton, including early developmental stages of familiar shrimps, crabs, and fishes. Zooplankton of the Atlantic and Gulf Coasts details the behavior, morphology, and coloration of these tiny aquatic animals. Precise descriptions and labeled illustrations of hundreds of the most commonly encountered species provide readers with the best source available for identifying zooplankton. Inside the second edition an updated introduction that orients readers to the diversity, habitats, environmental responses, collection, history, and ecological roles of zooplankton descriptions of life cycles illustrations (including 88 new drawings) that identify 340 + taxa and life stages range, habits, and ecology for each entry located directly opposite the illustration appendixes with information on collection and observation techniques and suggested readings and citations for more than 1,300 scientific articles and books. © 2012 William S. Johnson and Dennis M. Allen. All rights reserved.