ArticlePDF Available

Angelica sinensis Suppresses Body Weight Gain and Alters Expression of the FTO Gene in High-Fat-Diet Induced Obese Mice

Authors:

Abstract and Figures

The root of Angelica sinensis (RAS) is a traditional Chinese medicine used for preventing and treating various diseases. In this study, we assessed RAS supplementation effects on body weight and the FTO gene expression and methylation status in a high-fat-diet (HFD) induced obese mouse model. Female obese mice were divided into groups according to RAS dosage in diet as follows: normal diet, HFD diet (HC), HFD with low-dosage RAS (DL), HFD with medium-dosage RAS (DM), and HFD with high-dosage RAS (DH). After RAS supplementation for 4 weeks, body weight suppression and FTO expression in DH mice were significantly higher than in HC mice, whereas no significant change in FTO expression was detected between DM and DL mice or in their offspring. Bisulfite sequencing PCR (BSP) revealed that the CpG island in the FTO promoter was hypermethylated up to 95.44% in the HC group, 91.67% in the DH group, and 90.00% in the normal diet group. Histological examination showed that adipocytes in the DH group were smaller than those in the HC group, indicating a potential role of RAS in obesity. This study indicated that RAS could ameliorate obesity induced by HFD and that the molecular mechanism might be associated with the expression of the FTO gene.
This content is subject to copyright. Terms and conditions apply.
Research Article
Angelica sinensis Suppresses Body
Weight Gain and Alters Expression of the FTO Gene in
High-Fat-Diet Induced Obese Mice
Tao Zhong, Xiao-Yue Duan, Hao Zhang, Li Li, Hong-Ping Zhang, and Lili Niu
Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province,
College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
Correspondence should be addressed to Lili Niu; niulili@sicau.edu.cn
Received 7 April 2017; Revised 12 June 2017; Accepted 24 July 2017; Published 20 September 2017
Academic Editor: Ming D. Li
Copyright ©  Tao Zhong et al. is is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
e root of Angelica sinensis (RAS) is a traditional Chinese medicine used for preventing and treating various diseases. In this study,
we assessed RAS supplementation eects on body weight and the FTO gene expression and methylation status in a high-fat-diet
(HFD) induced obese mouse model. Female obese mice were divided into groups according to RAS dos age in diet as follows: normal
diet, HFD diet (HC), HFD with low-dosage RAS (DL), HFD with medium-dosage RAS (DM), and HFD with high-dosage RAS
(DH). Aer RAS supplementation for  weeks, body weight suppression and FTO expression in DH mice were signicantly higher
than in HC mice, whereas no signicant change in FTO expression was detected between DM and DL mice or in their ospring.
Bisulte sequencing PCR (BSP) revealed that the CpG island in the FTO promoter was hypermethylated up to .% in the HC
group, .% in the DH group, and .% in the normal diet group. Histological examination showed that adipocytes in the DH
group were smaller than those in the HC group, indicating a potential role of RAS in obesity. is study indicated that RAS could
ameliorate obesity induced by HFD and that the molecular mechanism might be associated with the expression of the FTO gene.
1. Introduction
Obesity is a global health priority and resistance to diet
induced obesity has been studied in many animal models.
A diet rich in sugar and containing up to % fat has been
widely used to induce obesity in mice [–]. Scientists have
found that some Chinese herbs like berberine, curcuma
longa, and Sibiraea angustata could eectively ameliorate
obesity by inhibiting the synthesis, growth, and accumulation
of fatty acid in adipocytes [–]. e functions of Chinese
herbs have been investigated in vivo in mouse models of high-
fat-diet (HFD) induced obesity [].
e root of Angelica sinensis (Chinese named Danggui),
a well-known herbal medicine, has been historically used as
a tranquilizer or a tonic agent [, ]. As a functional food,
RAS can also be used for the amelioration of inammation,
diabetes, and cardiovascular disorders. Previous studies have
shown that the Angelica sinensis polysaccharide (ASP), the
active chemical components of RAS, had hematopoietic
eects in animal and cellular models []. Two acidic polysac-
charides (APS-b and APS-c) signicantly inhibited the
growth of S tumors and increased the life span of S
tumor-bearing mice []. Furthermore, the antioxidant eects
of ASP could stimulate the endothelial production of nitric
oxide and resist ischemia/reperfusion (I/R) injury [].
e fat mass and obesity associated (FTO) gene has a
relative eect on obesity []. FTO islocatedonchromosome
 in humans and encodes a protein with a double-stranded
b-helix fold, homologous to the members of the nonheme and
-oxoglutarate oxygenase superfamily (which mainly impact
the metabolism of fatty acid) []. Further, studies in humans
and rodents suggested that FTO is involved in food intake
regulation and lipid metabolism []. Histological studies
revealed that the localization of FTO mRNA and protein in
the hypothalamic nucleus was of critical importance in the
regulation of feed intake in mice []. Loss of function of FTO
in mice led to postnatal growth retardation and a signicant
reduction in adipose tissue and lean body mass []. Over
Hindawi
BioMed Research International
Volume 2017, Article ID 6280972, 8 pages
https://doi.org/10.1155/2017/6280972
BioMed Research International
expression of FTO, however, led to a dose-dependent increase
in body and fat mass []. Furthermore, Merkestein and col-
leagues found that FTO inuences adipogenesis by regulating
the process of mitotic clonal expansion in obese mice [].
In the present study, we assessed the eects of RAS
supplementation on body weight in HFD mice. Furthermore,
mRNA expression and promoter methylation status of the
FTO gene were determined to compare the eects of RAS
between control and treated groups. is study will provide a
foundation for understanding the functions of RAS in obesity
resistance.
2. Materials and Methods
2.1. Ethics Statement. Animas involved in this study were sac-
riced according to the Regulations for the Administration
of Aairs Concerning Experimental Animals and approved
by the Institutional Animal Care and Use Committee at
the College of Animal Science and Technology, Sichuan
Agricultural University, Sichuan, China, under the permit
number DKY-B.
2.2. Animals and Diets. Female KM mice at  weeks of age
were obtained from the Chengdu Dossy Laboratory Animal
Co., Ltd, in Sichuan province, China. Mice were reared at
standard conditions within a free access to food and water for
 week to acclimatize to experimental conditions. Mice were
then randomly assigned to the normal diet group (GC, 𝑛=
10)ortheHFDgroup(HC,𝑛=48) without RAS supplemen-
tation. Aer  weeks, the obese mice were randomly divided
into four groups. All groups were continually fed with HFD.
e rst group (𝑛=12) was designated the high-fat control
group (HC) without RAS supplementation. e second group
(𝑛=11) received RAS supplementation at . g/kgBW and
was designated as the low-dose group (DL). e third group
(𝑛=11) received RAS supplementation at . g/kgBW and
was designated the medium-dose group (DM) and the last
group (𝑛=12) was designated the high-dose group (DH)
with RAS supplementation at . g/kgBW. e female
ospring were obtained by mating with the male KM fed
under same conditions for each group. e diet formula is
showninTable.eRASwasdriedandgroundandthen
added to the mixture, which was kneaded and made into a
cylindrical shape using -mL injectors. Finally, the mixture
was dried at Covernightandstoredinahermeticbagaer
cooling to room temperature. Body weight was measured
weekly. Adipose tissues were collected from  mice in each
group aer RAS supplementation for , , and  days.
2.3. Total RNA Extraction and Reverse Transcription. Mice
were sacriced by cervical dislocation and adipose tissue
was collected and rapidly frozen in liquid nitrogen and then
stored at C. Total RNA was extracted using TRIzol
reagent (Invitrogen, CA, USA). e purity of the isolated
RNA was determined by agarose gel electrophoresis and the
concentration was quantied by the ND- Nanodrop
(ermo Scientic, MA, USA). cDNA was synthesized using
the Prime Script RT reagent Kit (Takara, Dalian, China)
according to the manufacturer’s recommendations.
2.4. Quantitative Real-Time PCR of the FTO Gene. We per-
formed quantitative real-time PCR (qPCR) to quantify the
relative mRNA expression levels of FTO in adipose tissues of
mice from GC, HC, DL, DM, and DH groups, as well as DH
ospring. Primer pairs used for qPCR (Table ) were designed
according to the mouse FTO gene (NM ). e qPCR
was performed in triplicate using a SYBRPremix Ex Taq
II kit (Takara, Dalian, China). Each qPCR reaction (total
volume  𝜇L) contained . 𝜇LcDNA,𝜇L SYBR Green II,
. 𝜇L primer pairs, and . 𝜇L ddH2O. e qPCR procedures
were as follows: Cformin,cyclesof
Cfors,s
at optimum temperatures, C for  s, and a nal extension
for  min, and then a temperature increment of .C/s from
Cto
C to build a melting curve. e specicity of
qPCR products was conrmed by melting curve analysis. e
relative expression of FTO mRNA was determined using the
geometric mean of GAPDH, 𝛽-actin, and 18s rRNA by the
2−ΔΔCT method [].
2.5. DNA Preparation and Methylation Analysis by BSP
Method. Genomic DNA was extracted from the adipose
tissues of mice from GC, HC, and DH groups aer RAS
supplementation for  days, using TIANamp Genomic DNA
Kit (Tiangen, Beijing, China). ree animals were randomly
selected from each group. DNA was quantied by the ND-
 Nanodrop and then treated with sodium bisulte
using the EZ DNA Methylation Gold Kit (Zymo Research,
CA, USA). Following the manufacturer’s instructions, DNA
dosage was strictly limited to insure complete cytosine to
uracil conversion.
e methylated CpGs in the FTO promoter (Acc.
number AC) were estimated by the online program
(http://www.urogene.org/cgi-bin/methprimer/methprimer.
cgi). e primer pairs were modied by Primer Premier
(Table).ePCRwasrunonaCPCRsystem
ermocycler (Bio-Rad, Richmond, CA) in a volume of
 𝜇Lincluding𝜇L bisulte-converted DNA or . 𝜇LPCR
products,  𝜇LZymoTaqPreMix, or 𝜇Lprimerpairs.
PCR reactions were as follows: C for  min,  cycles
of  s at C,  s at .C(secondround:.
C),
and  s at C, and a nal extension for  min at C.
e second PCR products were puried with a DNA Gel
Extraction Kit (TsingKe, Chengdu, China) and then ligated
into pMD -T vector (Takara, Dalian, China). At least ten
positive recombinants were sequenced on an ABI XL
DNA analyzer (Applied Biosystems, USA). e methylated
CpGs were analyzed with the QUantication tool (QUMA,
http://quma.cdb.riken.jp/).
2.6. Histological and Morphometric Analysis. e abdominal
adipose tissues were resected and xed in % paraformalde-
hyde aer washing. ey were then dehydrated in ethanol and
soaked in dimethylbenzene and then embedded in paran.
e tissue blocks were sectioned at -micron thickness and
then stained with haematoxylin and eosin (H&E) reagent.
BioMed Research International
T : Composition of the experimental diets used in the present study.
Ingredients Normal diet High-fat-diet
GC HC DL DM DH
Corn starch .% .% .% .% .%
Flour .% .% .% .% .%
Bran .% .% .% .% .%
Soybean meal .% .% .% .% .%
Fish meal .% .% .% .% .%
Lard .% .% .% .%
Egg .% .% .% .%
Sucrose .% .% .% .%
Angelica sinensis .% .% .%
Total .% .% .% .% .%
T : Information of primer pairs used in this study.
Primer name Primer sequence (󸀠-󸀠)Size(bp)Tm(
C)
QPCR
FTO-Q-F GAGTTCTATCAGCAGTGG  .
FTO-Q-R GCACATCTTTGCCTTGGA
GAPDH-F GGTGAAGGTCGGTGTGAACG  .
GAPDH-R CTCGCTCCTGGAAGATGGTG
ACTB-F CGTTGACATCCGTAAAGACC  .
ACTB-R AACAGTCCGCCTAGAAGCAC
S rRNA-F AGGGGAGAGCGGGTAAGAGA  .
S rRNA-R GGACAGGACTAGGCGGAAC
BPS
FTO-BF TAGTTGATTTTGTTTGAAGAGGAAGA  .
FTO-BR TCCTACTCACTATCAACAATTCCTAA
FTO-BF GGGTTGAAGAGGTGGTTTAGTAGTTA  .
FTO-BR ACAATCTCACTCAATCCACTTACATCT
Photomicrographs were obtained and analyzed using Image-
Pro Plus soware (Media Cybernetics).
2.7. Statistical Analyses. All of the statistical analyses were
performed using SPSS . (SPSS, Chicago, IL, USA) and
the data were represented as means ±SD. e signicance
between groups was estimated by a one-way ANOVA test and
Student’s 𝑡-test.
3. Results
3.1. Eects of RAS Supplementation on Body Weight in HFD
Fed Mice. Compared with the normal diet group (GC), the
HC mice showed marked obesity aer feeding with HFD
for  weeks (Figure (a)). During HFD treatment, appetite,
activity, and coat luster were normal for all animals. Aer
 weeks, the mice in the HC group were divided into ve
subgroups,HC,DL,DM,andDH,fedwithdierentdosage
of RAS supplementation for another  weeks. Compared with
themiceintheGC,HC,DL,andDMgroups,themicein
the DH group showed the lowest weight gain (Figure (b)
andTable).Welaterused.g/kgBW RAS to feed DH
ospring continually. However, RAS supplementation did not
show an obvious eect on body weight between the ospring
from the HC and DH groups (data not shown).
3.2. Eects of RAS Supplementation on FTO mRNA Expres-
sion. To assess the eects of RAS supplementation on FTO
mRNA expression, we performed qPCR to quantify FTO
expression in adipose tissues collected from mice in the GC,
HC,DL,DM,andDHgroupsatdaysand.Inaddition,
we also determined FTO expression in HC and DH mice at
day , as well as in their progeny at day . e qPCR results
showed that the expression of FTO in the RAS-supplemented
groups (DL, DM, and DH) was signicantly higher than in
the HC group aer both  d and  d (Figures (a) and
(b)). No signicant dierence was detected between the
HC and DH groups aer  d (Figure (c)). Moreover, there
was no signicant dierence in FTO expression between the
ospring of mice in the HC and DH groups (Figure (d)).
3.3. Eects of RAS Supplementation on Methylation in the FTO
Promoter. e structure of the analyzed CpG sites and their
locations (GenBank Acc. number AC: –)
BioMed Research International
Body weight (g)
Time (weeks)
50
40
30
20
10
0
5 6 7 8 9 10 11
GC (n=10
)
HDF (n=48
)
(a)
Body weight (g)
Time (weeks)
55
50
45
40
35
30
8 10121416
GC
HDF
DL
DM
DH
(b)
F : Body weight changes in the HFD mice model (a). Eects of RAS supplementation on body weight alterations in the HFD mice (b).
Expression of FTO gene
GC HC DL DM DH
0-35 $
3
2
1
0
ab ab
ab
b
a
(a)
Expression of FTO gene
GC HC DL DM DH
0-60 $
8
6
4
2
0
ab
cc
bc
a
(b)
Expression of FTO gene
0-95 $
4
3
2
1
0
HC DH
(c)
Expression of FTO gene
∗∗
4
3
2
1
0
HC (0-35 D) HC (1-35 D) DH (0-35 D) DH (1-35 D)
(d)
F : Eects of RAS supplementation on FTO mRNA expression in HFD obese mice. Dierent letters above each bar represent being
signicantly dierent (𝑃 < 0.05). ∗∗ indicates signicant dierence (𝑃 < 0.01).
BioMed Research International
15 CpG sites in the 443-bp region
FTO-B1F FTO-B1R
FTO-B2F FTO-B2R
FTO promoter (AC105989: 31,474–31,968<)
(a)
DH 91.67%GC 90.00% HC 95.44%
Methylated
Unme thy lat ed
(b)
F : Schematic representation of the FTO promoter and the intragenic CpG sites in a -bp region (a). Methylation status of the FTO
promoter in adipose tissues in GC, HC, and DH mice aer being RAS-treated for  days (b). Each line represented as a sequence from each
clone, while each vertical bar corresponded to an identical CpG site.
within the FTO gene are shown in Figure . e DNA
methylation patterns of the GC, HC, and DH groups were
assessed by bisulte sequencing. e region analyzed includes
a dened CpG island, located  bp upstream of the start
codon. e FTO gene was hypermethylated in GC mice
(.%), while the mice fed with HFD showed a higher
methylation level in the HC group (.%). As expected,
supplementation of RAS reduced the methylation level,
which reached .% in DH mice.
3.4. Eects of RAS Supplementation on Adipocyte Morphology.
e H&E histological examination showed that adipocytes
had a polygonal morphology with typical peripherally located
nuclei and distinct cell borders (Figure (a)). Aer being
fed HFD with RAS supplementation for  d, the volume of
adipocytes in the DH group was smaller than that in the HC
group and showed some brous tissue in the intercellular
substance and a greater number of adipocytes (Figure (a)).
Adipocytes in DH mice fed RAS for  d were smaller again
and the cell arrangement was obviously abnormal compared
with HC mice. Histological and quantitative analyses revealed
that the mean diameter of adipocytes in the HC and DH mice
fed RAS for  d was 373.9 ± 64.8 𝜇mand227.7 ± 48.2𝜇m,
respectively,andadipocyteareawas115,817.8±38,956.0𝜇m2
and 44,655.3 ± 19,589.2𝜇m2, respectively (Figure (b)). In
theDHmicefedRASford,themeandiameterand
area of adipocytes were 171.4 ± 66.0 𝜇mand27,303.4 ±
20,430.6𝜇m2, respectively. Overall, the mean diameter and
area of adipocytes in HC mice were signicantly greater than
in DH mice (𝑃 < 0.05).
4. Discussion
In this report we demonstrate, for the rst time, the favor-
able eects of RAS supplementation on body weight, gene
expression, and promoter methylation of the FTO gene in
mice with HFD obesity. As many previous studies, the obesity
mouse model was induced by HFD; while formulas dier
between studies, common ingredients included sugar and
lard [, ]. e obesity mice model was established by HFD
and the standard deviation both in GC and HC groups was
accredited. Intragroup inconsistencies in body weight aer
the administration of RAS may have been due to individual
error [, ]. In the present study, body weight gain was lowest
in the DH group, which received . g/kgBW of RAS
supplementation (Table ). Meanwhile, body weight gain in
themicefedwithlowormoderatedosage(DLandDM
groups) was not dierent from the HC mice, indicating that
a higher dosage of RAS supplementation (.g/kgBW)
BioMed Research International
HC (35 >) DH (35 >) DH (60 >)
(a)
0
100
200
300
400
500
Diameter of adipocytes (G)
∗∗
HC (35 >) DH (35 >) DH (6 0 >)
(b)
0
50000
100000
150000
200000
∗∗
Area of adipocytes (G2)
HC (35 >) DH (35 >) DH (60 >)
(c)
F : Histological assessment of the adipose tissues of mice in the HC and DH groups (a). Scale bars,  𝜇m. e quantitative data of the
mean diameter and area of adipocytes are shown (b). Values are mean ±SD (𝑛=3). ∗∗𝑃< 0.01.
T : Eects of RAS supplementation on body weight alterations in mice.
Group AS contentSample size  weeks  weeks  weeks  weeks  weeks
GC NA  . ±. . ±. . ±. . ±. . ±.
HC NA  . ±. . ±. . ±. . ±. . ±.
DL . g/kgBW  . ±. . ±. . ±. . ±. . ±.
DM . g/kgBW  . ±. . ±. . ±. . ±. . ±.
DH . g/kgBW  . ±. . ±. . ±. . ±. . ±.
e dosage of AS was according to the recommendation.
might be more benecial in suppressing body weight in obese
individuals.
We found that the expression of FTO mRNA was sig-
nicantly increased in RAS-supplemented mice (DL, DM,
and DH groups) and body weight gain of HC mice was
markedly higher than that of DL, DM, and DH mice. is
suggests that RAS might inuence BW gain via alterations of
gene expression. As showed by qPCR, there was a signicant
dierence in FTO expression between RAS-supplemented
groups and the GC and HC groups in  d, suggesting a
correlation between FTO expression and body weight gain.
In HC mice, however, FTO expression was lowest and obesity
was highest. Previous studies reported that loss of FTO in
mice resulted in a signicant reduction of adipose tissue and
lean body mass [], and that FTO inuenced adipogenesis
by regulating events early in adipogenesis during the process
of mitotic clonal expansion []. FTO mRNA was more
highly expressed in RAS-treated groups than the control
group, especially the DH group. Aer  d, the highest FTO
expression level was in the RAS-treated groups. Moreover, no
signicant dierence was observed aer  d between the GC
and HC groups, or in their ospring. ese results suggest
that the eects of RAS supplementation on FTO expression
are not heritable.
FTO is a nucleic acid demethylase that removes methyl
groups from both DNA and RNA [, ]. Previous studies
have shown that DNA methylation is altered not only in
oocytes of obese mice but also in their ospring []. e
modication of DNA methylation provides a link between
the environment and gene expression, therefore, we investi-
gated the methylation levels of CpGs in the FTO promoter
region. ere are CpG dinucleotides present in the  Kb
upstream of the start codon of FTO.BSPresultsshowedthat
theCpGsiteswithintheFTO promoter were highly methy-
lated in all of the three groups (GC, HC, and DH). Although
the methylation levels were not signicantly dierent, our
BioMed Research International
results revealed that promoter methylation and expression of
FTO gene mRNA were negatively correlated. us, regulation
by a methyl group blocking the transcription factor binding
to this region (AC: ,–, bp) is possible.
Previous study has demonstrated the polysaccharide
of Angelica sinensis in ameliorating glucose and lipid
metabolism disorders related to obesity, possibly due to inter-
actions with insulin and serum inammatory factors []. e
molecular mechanisms, however, remained unclear. In the
present study, the extent of the adipose tissues was dierent
between HC and DH mice. We suggested that this dierence
in body weight may be caused by adipocyte morphology.
Furthermore, we performed histological examination to view
the alterations in adipocyte shape and size between HC and
DH mice. As shown in Figure , adipocytes in the HC group
were more mature and characterized by bigger lipid droplets,
whilethoseintheDHhadmoreandsmallerlipiddroplets.
e mice in the DH group fed RAS for  d showed much
smaller adipocytes and more intercellular substance than DH
mice fed RAS for  d.
5. Conclusion
is study investigated whether RAS could suppress body
weight in HFD obese mice. e supplementation of RAS was
associated with suppression of body weight, increased FTO
mRNA expression, and reduction of methylation. e present
study provides new insights into the biological role of RAS.
Further detailed analyses need to be performed to understand
themechanismofRASinbodyweightsuppression.
Conflicts of Interest
All authors declared that they have no conicts of interest.
Acknowledgments
isstudywassupportedbythegrantsfromtheUndergrad-
uate Innovative Experiment Program of Sichuan Agricultural
University (), the National Natural Science
Foundation of China (), and the Chinese Domestic
Animal Germplasm Resources Infrastructure.
References
[] A. Samuelsson, P. A. Matthews, M. Argenton et al., “Diet-
induced obesity in female mice leads to ospring hyperphagia,
adiposity, hypertension, and insulin resistance: a novel murine
model of developmental programming,Hypertension,vol.,
no. , pp. –, .
[] M.vanHeek,D.S.Compton,C.F.Franceetal.,“Diet-induced
obese mice develop peripheral, but not central, resistance to
leptin,Journal of Clinical Investigation,vol.,no.,pp.
, .
[] C. Church, S. Lee, E. A. L. Bagg et al., “A mouse model for the
metabolic eects of the human fat mass and obesity associated
FTO gene,PLoS Genetics,vol.,no.,ArticleIDe,
.
[] D.Y.Lu,C.H.Tang,Y.H.Chen,andI.H.Wei,“Berberinesup-
presses neuroinammatory responses through AMP-activated
protein kinase activation in BV- microglia,Journal of Cellular
Biochemistry,vol.,no.,pp.,.
[] J. Zhao, X.-B. Sun, F. Ye, and W.-X. Tian, “Suppression of
fatty acid synthase, dierentiation and lipid accumulation in
adipocytes by curcumin,Molecular and Cellular Biochemistry,
vol.,no.-,pp.,.
[] L. Xiao, J. Zhang, H. Li et al., “Inhibition of adipocyte dierenti-
ation and adipogenesis by the traditional Chinese herb Sibiraea
angustata,” Experimental Biology and Medicine,vol.,no.,
pp.,.
[] K. A. Fawcett and I. Barroso, “e genetics of obesity: FTO leads
the way,Trend s in Ge n eti cs,vol.,no.,pp.,.
[] K. Wang, P. Cao, W. Shui, Q. Yang, Z. Tang, and Y. Zhang,
Angelica sinensis polysaccharide regulates glucose and lipid
metabolism disorder in prediabetic and streptozotocin-induced
diabetic mice through the elevation of glycogen levels and
reduction of inammatory factors,Food and Function,vol.,
no.,pp.,.
[] W.G.P.H.-Y.Hsu,Chinese Herb Medicine and erapy, Aurora
Publishers Incorporated, Nashville, Tenn, USA, .
[] C. Liu, J. Li, F. Y. Meng et al., “Polysaccharides from the root of
Angelica sinensis promotes hematopoiesis and thrombopoiesis
through the PIK/AKT pathway,BMC Complementary and
Alternative Medicine,vol.,article,.
[] W. Cao, X.-Q. Li, X. Wang et al., “Characterizations and anti-
tumor activities of three acidic polysaccharides from Angelica
sinensis (Oliv.) diels,International Journal of Biological Macro-
molecules,vol.,no.,pp.,.
[]S.Zhang,B.He,J.Geetal.,“Extraction,chemicalanalysis
of Angelica sinensis polysaccharides and antioxidant activity of
the polysaccharides in ischemia-reperfusion rats,International
Journal of Biological Macromolecules,vol.,no.,pp.,
.
[] T. M. Frayling, N. J. Timpson, M. N. Weedon et al., “A common
variant in the FTO gene is associated with body mass index and
predisposes to childhood and adult obesity,Science,vol.,
no.,pp.,.
[] L. Sanchez-Pulido and M. A. Andrade-Navarro, “e FTO (fat
mass and obesity associated) gene codes for a novel member
of the non-heme dioxygenase superfamily,BMC Biochemistry,
vol. , article , .
[] A. Tiwari, S. M. Krzysik-Walker, and R. Ramachandran,
“Cloning and characterization of chicken fat mass and obesity
associated (FTO) gene: fasting aects FTO expression,Domes-
tic Animal Endocrinology,vol.,no.,pp.,.
[]T.Gerken,C.A.Girard,Y.-C.L.Tungetal.,“eobesity-
associated FTO gene encodes a -oxoglutarate-dependent
nucleic acid demethylase,Science,vol.,no.,pp.
, .
[] J. Fischer, L. Koch, C. Emmerling et al., “Inactivation of the FTO
gene protects from obesity,Nature,vol.,no.,pp.
, .
[] C. Church, L. Moir, F. McMurray et al., “Overexpression of FTO
leads to increased food intake and results in obesity,” Nature
Genetics, vol. , no. , pp. –, .
[] M. Merkestein, S. Laber, F. McMurray et al., “FTO inuences
adipogenesis by regulating mitotic clonal expansion,Nature
Communications,vol.,article,.
BioMed Research International
[] K. J. Livak and T. D. Schmittgen, “Analysis of relative gene
expression data using real-time quantitative PCR and the
2−ΔΔ𝐶𝑇 method,Methods,vol.,no.,pp.,.
[] E. S. Jungheim, E. L. Schoeller, K. L. Marquard, E. D. Louden,
J.E.Schaer,andK.H.Moley,“Diet-inducedobesitymodel:
abnormal oocytes and persistent growth abnormalities in the
ospring,” Endocrinology,vol.,no.,pp.,.
[] G. Jia, Y. Fu, X. Zhao et al., “N-methyladenosine in nuclear
RNAisamajorsubstrateoftheobesity-associatedFTO,” Nature
Chemical Biology,vol.,no.,pp.,.
[] Z. J. Ge, S. M. Luo, F. Lin et al., “DNA methylation in oocytes
and liver of female mice and their ospring: eects of high-fat-
diet-induced obesity,” Environmental Health Perspectives,vol.
, no. , pp. –, .
... In carriers of AA genotype of rs9939609 polymorphism, dietary carbohydrate, fat, and calorie intake were higher than TT carriers. However, the results of recent studies about the association between dietary macronutrients and FTO polymorphism were inconsistent [19][20][21][22][23][24][25][26][27][28]. Oyeyemi [20]. ...
... On the other hand, Qi et al. in a cross-sectional study on white population (n = 154,439) found a lower energy intake per A risk allele (ß = − 7.2 kcal/d) [26]. Another study found no association between a high-fat diet and a high carbohydrate diet with the FTO gene in rats [27]. Drabsch et al. in a systematic review reported that there is no consistent evidence that the FTO gene SNPs are associated with total energy, carbohydrate, and fat intakes [28]. ...
Article
Full-text available
Background: Dietary macronutrients may indirectly affect body weight through their interactions with the fat mass and obesity associated (FTO) gene. This study aimed to investigate the association between FTO gene rs9939609 polymorphism with macronutrients intake in overweight adults. Methods: This study was carried out on 196 overweight adults of Shiraz, Iran. Dietary intake was assessed using a validated 168-item semi-quantitative food frequency questionnaire (FFQ). The FTO gene was genotyped for rs9939609 polymorphism. The association between dietary macronutrients and the FTO genotype were assessed using linear regression after adjustments for sex, age, physical activity, and the serum levels of triglycerides, fasting blood sugar (FBS), and low density lipoprotein (LDL). Results: The higher intake of carbohydrates (P < 0.001), fat (P = 0.009), and calorie (P = 0.001) were significantly associated with rs9939609 AA genotype (P = 0.001). Carriers of the AA genotype of rs9939609 had significantly higher calorie, fat, and carbohydrate intake than the carriers of the TT genotype after adjusting for age and sex (P = 0.019, P = 0.010 and P = 0.001, respectively). Further adjustments for physical activity, TG, LDL, and FBS did not change these results. Conclusion: The amounts of dietary calorie, carbohydrate, and fat intake were associated with FTO genotype. Further studies are warranted to confirm these associations and to identify the underlying mechanisms.
... An extract from Angelica sinensis and two extracts from Solanum melogena and S. aethipicum, respectively, have been shown to contribute to reducing obesity via modulation of the FTO gene [44][45][46][47] (Table 2). ...
Article
Full-text available
Obesity is considered an increasingly widespread disease in the world population, regardless of age and gender. Genetic but also lifestyle-dependent causes have been identified. Nutrition and physical exercise play an important role, especially in non-genetic obesity. In a three-compartment model, the body is divided into fat mass, fat-free mass and water, and obesity can be considered a condition in which the percentage of total fat mass is in excess. People with a high BMI index or overweight use self-medications, such as food supplements or teas, with the aim to prevent or treat their problem. Unfortunately, there are several obesity modulators that act both on the pathways that promote adipogenesis and those that inhibit lipolysis. Moreover, these pathways involve different tissues and organs, so it is very difficult to identify anti-obesity substances. A network of factors and cells contributes to the accumulation of fat in completely different body districts. The identification of natural anti-obesity agents should consider this network, which we would like to call “obesosome”. The nutrigenomic, nutrigenetic and epigenetic contribute to making the identification of active compounds very difficult. This narrative review aims to highlight nutraceuticals that, in vitro or in vivo, showed an anti-obesity activity or were found to be useful in the control of dysfunctions which are secondary to obesity. The results suggest that it is not possible to use a single compound to treat obesity, but that the studies have to be addressed towards the identification of mixtures of nutraceuticals.
... 실험군의 중재약물은 24편 [11][12][13][14]16,17,20,22,24,25,27,[33][34][35]37,39,44,45,47,50,54,56,57,60) 에서 단일약재, 나머지 26편에서 복합처방 형태로 사용되 었다. 논문에 사용된 단일약재는 모두 21종이었고 그 중 계지 12,17) , 갈근 16,37) , 차전초 33,34) 는 각각 2편에서 사용되었다. ...
... The increase in the mRNA levels of the FTO gene in WAT following induction in this study is in line with previous reports that HFD led to a significant increase in the adipose tissue of induced obese mice. [3,[66][67][68][69]. Likewise, a previous study reported that inactivation of the FTO gene in mice fed an HFD provoked a reduction in fat mass linked to obesity [70]. ...
Article
Full-text available
The Fat Mass and Obesity-associated (FTO) gene has been shown to play an important role in developing obesity, manifesting in traits such as increased body mass index, increased waist-to-hip ratio, and the distribution of adipose tissues, which increases the susceptibility to various metabolic syndromes. In this study, we evaluated the impact of fruit-based diets of Solanum melongena (SMF) and Solanum aethiopicum fruits (SAF) on the FTO gene expression levels in a high-fat diet (HFD)-induced obese animals. Our results showed that the mRNA level of the FTO gene was downregulated in the hypothalamus, and white and brown adipose tissue following three and six weeks of treatment with SMF- and SAF-based diets in the HFD-induced obese animals. Additionally, the Solanum fruit supplementation exhibited a curative effect on obesity-associated abrasions on the white adipose tissue (WAT), hypothalamus, and liver. Our findings collectively suggest the anti-obesity potential of SMF and SAF via the downregulation of the FTO gene.
... Baicalin has been reported to ameliorate high-fat diet-induced obesity and hepatic steatosis through carnitine palmitoyltransferase 1 (CPT1) (150), of which mRNA serves as a potential substrate of FTO for m6A modification, predicted by m6A-Atlas (151). Zhong et al. (152,153), reported that Angelica sinensis alleviated HFD-induce obesity through altering expression of FTO gene. Betaine was also found to decrease FTO expression and improved m6A methylation in adipose tissue of wild-type mice with high-fat diet, resulting in decreased final body weight and improved glucose tolerance (154). ...
Article
Full-text available
The consumption of phytochemicals, bioactive compounds in fruits and vegetables, has been demonstrated to ameliorate obesity and related metabolic symptoms by regulating specific metabolic pathways. This review summarizes the progress made in our understanding of the potential of phytochemicals as metabolic signals: we discuss herein selected molecular mechanisms which are involved in the occurrence of obesity that may be regulated by phytochemicals. The focus of our review highlights the regulation of transcription factors toll like receptor 4 (TLR4), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), the peroxisome proliferator-activated receptors (PPARs), fat mass and obesity-associated protein (FTO) and regulation of microRNAs (miRNA). In this review, the effect of phytochemicals on signaling pathways involved in obesity were discussed on the basis of their chemical structure, suggesting molecular mechanisms for how phytochemicals may impact these signaling pathways. For example, compounds with an isothiocyanate group or an α, β-unsaturated carbonyl group may interact with the TLR4 signaling pathway. Regarding Nrf2, we examine compounds possessing an α, β-unsaturated carbonyl group which binds covalently with the cysteine thiols of Keap1. Additionally, phytochemical activation of PPARs, FTO and miRNAs were summarized. This information may be of value to better understand how specific phytochemicals interact with specific signaling pathways and help guide the development of new drugs to combat obesity and related metabolic diseases.
... In a recent in vivo study, rats fed with a high-fat diet in comparison with those fed a high carbohydrate diet showed higher FTO expression in both visceral and subcutaneous adipose tissues [21] consistent with a study by Nowacka-Woszuk et al., showing that a high-fat diet led to increased FTO gene expression in subcutaneous and visceral adipocytes of rats [37]. However, in another study, Zhong et al. demonstrated that mice with a high-fat diet compared to those with standard diet did not affect FTO expression in fat tissue [38]. It suggests that the quantity of fatty acid intake may contribute to the regulation of FTO gene expression and the mRNA level of FTO in the adipose tissue is dependent on macronutrient composition as well. ...
Article
Full-text available
Purpose The human obesity susceptibility gene, FTO, associates with body mass and obesity in humans through regulation of energy expenditure and intake. We aimed to determine how fatty acids in plasma and in diet associate with FTO gene expression in subcutaneous and visceral adipose tissues. Methods In this study, 97 participants aged ≥ 18 years were selected from patients admitted to the hospital for abdominal surgeries. Habitual dietary intake of participants was collected using a valid and reliable food frequency questionnaire (FFQ), from which the intake of fatty acids was quantified. Plasma fatty acids were assessed by gas–liquid chromatography. The mRNA expression of the FTO gene in visceral and subcutaneous adipose tissues obtained by biopsy was measured by Real-Time Quantitative Reverse Transcription PCR. Standardized β-coefficients were calculated by multivariable linear regression. Results After adjusting for age, homeostasis model insulin resistance index (HOMA-IR), and body mass index, total fatty acid intake was significantly associated with FTO gene expression in visceral (STZβ = 0.208, P = 0.037) and subcutaneous (STZβ = 0.236, P = 0.020) adipose tissues. Dietary intake of monounsaturated fatty acid (MUFA) and polyunsaturated fatty acids (PUFA) had positive significant associations with the expression of FTO in visceral (STZβ = 0.227, P = 0.023; STZβ = 0.346, P < 0.001, respectively) and subcutaneous (STZβ = 0.227, P = 0.026; STZβ = 0.274, P = 0.006, respectively) adipose tissues. There were no associations between plasma fatty acids and FTO mRNA expression in either subcutaneous or visceral adipose tissues. Conclusion The weak association of dietary total fatty acids, MUFA, and PUFA with FTO gene expression in both adipose tissues may highlight the importance of dietary fatty acids composition along with total fat intake in relation to FTO gene expression.
... Our study found no association between fat intake and gene expression. Zhong et al. found that a high-fat diet in comparison with a normal carbohydrate diet in mice did not change FTO gene expression [27,28]. Inconsistent with this study, Nowacka-Woszuk et al. reported that a high-fat diet could lead to an increase FTO and IRX3 genes expression in white adipose cells [29]. ...
Article
Full-text available
This study is the first to identify the effects of FTO genotype on the interactions between the level of macro-nutrients intake and the expression level of fat mass and obesity associated (FTO) and homeobox transcription factor iriquois-3 (IRX3) genes This longitudinal study was carried out on 84 overweight and obese adolescent boys in Tehran, Iran. The rs9930506 SNP in FTO was genotyped at baseline and the level of FTO and IRX3 expression in PBMCs and macro-nutrients’ intake were assessed at baseline and after 18 weeks of the intervention. The results identified that the higher carbohydrates intake significantly up-regulated the FTO gene (P = 0.001) and down-regulated the IRX3 gene (P = 0.01). Protein intake up-regulated the FTO gene (P = 0.001). In carriers of GG genotype of FTO gene, the amount of dietary carbohydrate had a positive association with FTO gene expression (p = 0.001, and p = 0.04, respectively). In AA/AG carriers, dietary protein was positively associated with FTO gene expression (p = 0.001) and dietary carbohydrate was negatively associated with IRX3 gene expression (P = 0.04). Therefore, dietary carbohydrateseems to be associated with FTO and IRX3 genes expression. These associations are influenced by FTO genotype.
Article
Carcinogenesis is a complicated process and originates from genetic, epigenetic, and environmental factors. Recent studies have reported a potential critical role for the fat mass and obesity-associated (FTO) gene in carcinogenesis through different signaling pathways such as mRNA N6-methyladenosine (m6A) demethylation. The most common internal modification in mammalian mRNA is the m6A RNA methylation that has significant biological functioning through regulation of cancer-related cellular processes. Some environmental factors, like physical activity and dietary intake, may influence signaling pathways engaged in carcinogenesis, through regulating FTO gene expression. In addition, people with FTO gene polymorphisms may be differently influenced by cancer risk factors, for example, FTO risk allele carriers may need a higher intake of nutrients to prevent cancer than others. In order to obtain a deeper viewpoint of the FTO, lifestyle, and cancer-related pathway interactions, this review aims to discuss upstream and downstream pathways associated with the FTO gene and cancer. The present study discusses the possible mechanisms of interaction of the FTO gene with various cancers and provides a comprehensive picture of the lifestyle factors affecting the FTO gene as well as the possible downstream pathways that lead to the effect of the FTO gene on cancer.
Article
Thermogenesis (non-exercise activity) in brown adipose tissue (BAT) promotes energy expenditure because of its higher number of mitochondria than white adipose tissue (WAT). The main function of thermogenesis in BAT can counteract obesity through the dissipation of calories as heat. N-butylidenephthalide (BP) is a natural derivative from Angelica sinensis, a Chinese herb that has been used for thousands of years. In this report, we demonstrated that BP improved the metabolic profiles of mice with high fat diet-induced obesity (DIO) by preventing weight gain, improving serum blood parameters, enhancing energy expenditure, stimulating white fat browning, and reversing hepatic steatosis. Further investigations demonstrated that BP administration upregulated the mRNA expression of beige (CD137, TMEM26) and brown fat selected genes (UCP1, PRDM16, PGC-1α, PPARγ) in white adipose tissues. In vitro studies, BP treatment increased multilocular lipid droplet levels, induced β-adrenergic receptor (cAMP/PKA) and AMP-activated protein kinase (AMPK) signaling (AMPK/acetyl-CoA carboxylase/SIRT1), and increased oxygen consumption in murine differentiated beige adipocytes, and the effects of BP were blocked by an AMPK inhibitor. BP promoted the interaction of AMPK with PGC-1α in beige adipocytes. Our findings provide novel insights into the application of BP in regulating energy metabolism and suggest its utility for clinical use in the treatment of obesity and related diseases.
Article
Full-text available
Non-alcoholic fatty liver disease (NAFLD) is considered a worldwide healthcare problem that mirrors the increased prevalence of obesity. Gut microbiota plays a crucial role in the progression and treatment of NAFLD. Bofutsushosan (BTS), a pharmaceutical-grade Japanese traditional medicine, has long been prescribed in Japan for obesity and obesity-related syndrome. Although BTS has been reported to exert an anti-obesity effect in obese patients as well as various obesity-model animals, its effect on gut microbiota is unknown. Here, the effects of BTS on obesity, liver damage, and the gut microbiome in genetically obese mice, ob/ob, were studied. Seven-week-old ob/ob mice were fed a standard diet with (BTS group) or without (CONT group) 5% BTS for 4 weeks. By comparison to the CONT group, the BTS group showed reduced body weight gain and hyperlipidemia as well as improved liver function. Moreover, gut microbiota in the CONT and BTS group formed a significantly different cluster. Specifically, the genera Akkermansia, Bacteroides and an unknown genus of the family Enterobacteriaceae expanded dramatically in the BTS group. Noteworthy, the population of Akkermansia muciniphila, which is reported to elicit an anti-obesity effect and improve various metabolic abnormalities, was markedly increased (93-fold) compared with the CONT group. These results imply that BTS may be a promising agent for treating NAFLD.
Article
Full-text available
The fat mass and obesity-associated (FTO) gene plays a pivotal role in regulating body weight and fat mass; however, the underlying mechanisms are poorly understood. Here we show that primary adipocytes and mouse embryonic fibroblasts (MEFs) derived from FTO overexpression (FTO-4) mice exhibit increased potential for adipogenic differentiation, while MEFs derived from FTO knockout (FTO-KO) mice show reduced adipogenesis. As predicted from these findings, fat pads from FTO-4 mice fed a high-fat diet show more numerous adipocytes. FTO influences adipogenesis by regulating events early in adipogenesis, during the process of mitotic clonal expansion. The effect of FTO on adipogenesis appears to be mediated via enhanced expression of the pro-adipogenic short isoform of RUNX1T1, which enhanced adipocyte proliferation, and is increased in FTO-4 MEFs and reduced in FTO-KO MEFs. Our findings provide novel mechanistic insight into how upregulation of FTO leads to obesity.
Article
Full-text available
Maternal obesity has adverse effects on oocyte quality, embryo development and it also affects the health of the offspring. To understand the underlying mechanisms responsible for these negative effects, we investigated the DNA methylation status of several imprinted genes and metabolism-related genes. A high-fat-diet (HFD)-induced mouse model was utilized to analyze the DNA methylation of several imprinted genes and of metabolism-related genes in oocytes from obese mice and in oocytes and liver from their offspring by employing combined bisulfite restriction analysis (COBRA) and bisulfite sequencing (BS). The DNA methylation of imprinted genes in oocytes was not altered in both obese mothers and their offspring, while DNA methylation of metabolism-related genes was changed. The DNA methylation level in the promoter of Leptin was significantly increased and that in the promoter of Ppar-alpha (Ppar-α) was reduced in oocytes of obese mice. The increased methylation of Leptin and decreased methylation of Ppar-α was also observed in the liver of female offspring from obese mothers (OHFD). The mRNA expressions of Leptin and Ppar-α were significantly altered in the liver of offspring from obese mothers. In OHFD oocytes, the DNA methylation level in the promoter of Ppar-α was increased. These results indicate that DNA methylation patterns of several metabolism-related genes are not only changed in oocytes of obese mice, but also in oocytes and liver of their offspring. These data may contribute to elucidating the adverse effects of maternal obesity on reproduction and the offspring's health.
Article
Full-text available
We report here that fat mass and obesity-associated protein (FTO) has efficient oxidative demethylation activity targeting the abundant N6-methyladenosine (m(6)A) residues in RNA in vitro. FTO knockdown with siRNA led to increased amounts of m(6)A in mRNA, whereas overexpression of FTO resulted in decreased amounts of m(6)A in human cells. We further show the partial colocalization of FTO with nuclear speckles, which supports the notion that m(6)A in nuclear RNA is a major physiological substrate of FTO.
Article
Full-text available
Dozens of Traditional Chinese Medicine (TCM) formulas have been used for promotion of "blood production" for centuries, and we are interested in developing novel thrombopoietic medicines from these TCMs. Our previous studies have demonstrated the hematopoietic effects of DangGui BuXue Tong (DBT), a formula composed of Radix Angelicae Sinensis and Radix Astragali in animal and cellular models. As a step further to identify and characterize the active chemical components of DBT, we tested the hematopoietic and particularly, thrombopoietic effects of polysaccharide-enriched fractions from the root of Radix Angelicae Sinensis (APS) in this study. A myelosuppression mouse model was treated with APS (10 mg/kg/day). Peripheral blood cells from APS, thrombopoietin and vehicle-treated samples were then counted at different time-points. Using the colony-forming unit (CFU) assays, we determined the effects of APS on the proliferation and differentiation of hematopoietic stem/progenitor cells and megakaryocytic lineages. Using a megakaryocytic cell line M-07e as model, we analyzed the cellular apoptosis progression with and without APS treatment by Annexin V, Mitochondrial Membrane Potential and Caspase 3 assays. Last, the anti-apoptotic effect of APS on cells treated with Ly294002, a Phosphatidylinositol 3-Kinse inhibitor (PI3K) was also tested. In animal models, APS significantly enhanced not only the recovery of platelets, other blood cells and their progenitor cells, but also the formation of Colony Forming Unit (CFU). In M-07e cells, we observed the anti-apoptotic effect of APS. Treatment by Ly294002 alone increased the percentage of cells undergoing apoptosis. However, addition of APS to Ly294002-treated cells significantly reduced the percentage of cells undergoing apoptosis. APS promotes hematopoiesis and thrombopoiesis in the mouse model. This effect likely resulted from the anti-apoptosis activity of APS and is likely to involve the PI3K/AKT pathway.
Article
Full-text available
Genome-wide association studies have identified SNPs within FTO, the human fat mass and obesity-associated gene, that are strongly associated with obesity. Individuals homozygous for the at-risk rs9939609 A allele weigh, on average, ~3 kg more than individuals with the low-risk T allele. Mice that lack FTO function and/or Fto expression display increased energy expenditure and a lean phenotype. We show here that ubiquitous overexpression of Fto leads to a dose-dependent increase in body and fat mass, irrespective of whether mice are fed a standard or a high-fat diet. Our results suggest that increased body mass results primarily from increased food intake. Mice with increased Fto expression on a high-fat diet develop glucose intolerance. This study provides the first direct evidence that increased Fto expression causes obesity in mice.
Article
Full-text available
Obesity has become a major health concern due to its strong association with the metabolic syndrome. Inhibition of adipocyte differentiation represents a key strategy to inhibit obesity. Sibiraea angustata (SA), a traditional Chinese herb, has a wide range of pharmacological effects, such as improving digestive functions. Here, we report a novel antiadipogenic effect of SA. By using the SA water extract (SAW), SA acetic ether extract (SAA) and the 3T3-L1 model of adipocyte differentiation and adipogenesis, we showed that both SAW and SAA impaired the proliferation and adipo-differentiation of 3T3-L1 in a dose- and time-dependent manner. At the molecular level, treatment of 3T3-L1 cells with SAW or SAA inhibited the expression of the key adipocyte differentiation regulator CCAAT enhancer binding protein β (C/EBPβ), as well as peroxisome proliferator activated receptor γ, adipocyte protein-2, lipoprotein lipase and glucose transporter 4. Cell cycle analysis showed that both SAW and SAA blocked cell cycle at the G1-S transition phase, causing cells to remain in the preadipocyte state. The expression of CyclinA and cyclin-dependent kinase 2 was also inhibited by SAW and SAA. Treatment with SAW also prevented the localization of C/EBPβ to the centromeres. Taken together, our results show that SA has a potent antiadipogenic effect in 3T3-L1 cells due to the inhibition of adipocyte differentiation and adipogenesis. We propose that SA may be used as a safe and effective neutraceutical to manage obesity.
Article
The present study was designed to evaluate the potential hypoglycemic and hypolipidemic effects of Angelica sinensis polysaccharide (ASP), purified from the fresh roots of Angelica sinensis (AS), in prediabetic and streptozotocin (STZ)-induced diabetic BALB/c mice. It was observed that fasting blood glucose (FBG) levels in both models were reduced after a 4-week oral administration of ASP or metformin, and abnormal fasting serum insulin (FINS) concentrations were ameliorated as well. Moreover, the homeostasis model assessment-insulin resistance (HOMA-IR) index was decreased strikingly and body weight (BW) was reduced significantly in prediabetic mice after treatment with ASP. In addition, ASP also contributed to improving the dyslipidemia conditions. Elevated serum total cholesterol (TC) or triglyceride (TG) concentrations were reduced after treatment with ASP in prediabetic mice or STZ-induced diabetic mice. Meanwhile, hepatic glycogen (HG) and muscle glycogen (MG) concentrations were increased while insulin resistance (IR)-related inflammatory factors IL-6 and TNF-α in serum were reduced in STZ-induced diabetic mice. Histopathological examination indicated that the impaired pancreatic/hepatic tissues or adipose tissues were effectively restored in STZ-induced diabetic mice or prediabetic mice after the ASP treatment. Taken together, these results revealed that ASP efficiently exerted hypoglycemic and hypolipidemic benefits, and its potential effect was associated with the amelioration of IR. ASP can be applied in the prevention and treatment of diabetes.
Article
The two most commonly used methods to analyze data from real-time, quantitative PCR experiments are absolute quantification and relative quantification. Absolute quantification determines the input copy number, usually by relating the PCR signal to a standard curve. Relative quantification relates the PCR signal of the target transcript in a treatment group to that of another sample such as an untreated control. The 2(-DeltaDeltaCr) method is a convenient way to analyze the relative changes in gene expression from real-time quantitative PCR experiments. The purpose of this report is to present the derivation, assumptions, and applications of the 2(-DeltaDeltaCr) method. In addition, we present the derivation and applications of two variations of the 2(-DeltaDeltaCr) method that may be useful in the analysis of real-time, quantitative PCR data. (C) 2001 Elsevier science.
Article
Fat mass and obesity associated gene (Fto), also known as Fatso, is a member of the Fe-II and 2-oxoglutarate-dependent dioxygenase superfamily. Recent studies in humans and rodents suggest that Fto is involved in food intake regulation and lipid metabolism, whereas single nucleotide mutations in the Fto gene are associated with obesity and type 2 diabetes. The Fto gene is highly conserved from green algae to humans, but little is known about the avian Fto gene or protein. The objectives of the current study were to clone full-length chicken Fto cDNA and to determine the effect of age or feeding status on Fto expression. With the use of rapid amplification of cDNA ends, the full-length chicken Fto cDNA was cloned and found to share 63% to 66% homology with the mammalian Fto nucleotide sequence. Several regions of the chicken Fto protein, including the substrate (2-oxoglutarate) binding domains, were found to be identical to mammalian Fto protein. Western blotting with anti-human Fto antibody and reverse transcription PCR studies showed that Fto protein and gene were ubiquitously expressed in various tissues of the chicken. With the use of quantitative PCR, Fto mRNA levels were found to be higher in liver and skeletal muscle of 8-wk-old chickens than in 4-wk-old chickens. In addition, alterations in feeding status resulted in significant changes in Fto mRNA and Fto protein expression in the liver but not in skeletal muscle and adipose tissue of broiler chickens. Taken together, our data suggest that Fto probably plays a significant role in liver function and energy metabolism in the chicken.
Article
Curcumin is a well-known component of the cook seasoning and traditional herb turmeric (Curcuma longa), which has been reported to prevent obesity. However, the mechanism still remains to be determined. In this study, curcumin is found to be an effective inhibitor of fatty acid synthase (FAS), and its effects on adipocytes are further evaluated. Curcumin shows both fast-binding and slow-binding inhibitions to FAS. Curcumin inhibits FAS with an IC₅₀ value of 26.8 μM, noncompetitively with respect to NADPH, and partially competitively against both substrates acetyl-CoA and malonyl-CoA. This suggests that the malonyl/acetyl transferase domain of FAS possibly is the main target of curcumin. The time-dependent inactivation shows that curcumin inactivates FAS with two-step irreversible inhibition, a specific reversible binding followed by an irreversible modification by curcumin. Like other classic FAS inhibitors, curcumin prevents the differentiation of 3T3-L1 cells, and thus represses lipid accumulation. In the meantime, curcumin decreases the expression of FAS, down-regulates the mRNA level of PPARγ and CD36 during adipocyte differentiation. Curcumin is reported here as a novel FAS inhibitor, and it suppresses adipocyte differentiation and lipid accumulation, which is associated with its inhibition of FAS. Hence, curcumin is considered to be having potential application in the prevention of obesity.