Angelica sinensis Suppresses Body Weight Gain and Alters Expression of the FTO Gene in High-Fat-Diet Induced Obese Mice

Abstract

The root of Angelica sinensis (RAS) is a traditional Chinese medicine used for preventing and treating various diseases. In this study, we assessed RAS supplementation effects on body weight and the FTO gene expression and methylation status in a high-fat-diet (HFD) induced obese mouse model. Female obese mice were divided into groups according to RAS dosage in diet as follows: normal diet, HFD diet (HC), HFD with low-dosage RAS (DL), HFD with medium-dosage RAS (DM), and HFD with high-dosage RAS (DH). After RAS supplementation for 4 weeks, body weight suppression and FTO expression in DH mice were significantly higher than in HC mice, whereas no significant change in FTO expression was detected between DM and DL mice or in their offspring. Bisulfite sequencing PCR (BSP) revealed that the CpG island in the FTO promoter was hypermethylated up to 95.44% in the HC group, 91.67% in the DH group, and 90.00% in the normal diet group. Histological examination showed that adipocytes in the DH group were smaller than those in the HC group, indicating a potential role of RAS in obesity. This study indicated that RAS could ameliorate obesity induced by HFD and that the molecular mechanism might be associated with the expression of the FTO gene.

Full text

Research Article
Angelica sinensis Suppresses Body
Weight Gain and Alters Expression of the FTO Gene in
High-Fat-Diet Induced Obese Mice
Tao Zhong, Xiao-Yue Duan, Hao Zhang, Li Li, Hong-Ping Zhang, and Lili Niu
Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province,
College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
Correspondence should be addressed to Lili Niu; niulili@sicau.edu.cn
Received 7 April 2017; Revised 12 June 2017; Accepted 24 July 2017; Published 20 September 2017
Academic Editor: Ming D. Li
Copyright ©  Tao Zhong et al. is is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
e root of Angelica sinensis (RAS) is a traditional Chinese medicine used for preventing and treating various diseases. In this study,
we assessed RAS supplementation eects on body weight and the FTO gene expression and methylation status in a high-fat-diet
(HFD) induced obese mouse model. Female obese mice were divided into groups according to RAS dos age in diet as follows: normal
diet, HFD diet (HC), HFD with low-dosage RAS (DL), HFD with medium-dosage RAS (DM), and HFD with high-dosage RAS
(DH). Aer RAS supplementation for  weeks, body weight suppression and FTO expression in DH mice were signicantly higher
than in HC mice, whereas no signicant change in FTO expression was detected between DM and DL mice or in their ospring.
Bisulte sequencing PCR (BSP) revealed that the CpG island in the FTO promoter was hypermethylated up to .% in the HC
group, .% in the DH group, and .% in the normal diet group. Histological examination showed that adipocytes in the DH
group were smaller than those in the HC group, indicating a potential role of RAS in obesity. is study indicated that RAS could
ameliorate obesity induced by HFD and that the molecular mechanism might be associated with the expression of the FTO gene.
1. Introduction
Obesity is a global health priority and resistance to diet
induced obesity has been studied in many animal models.
A diet rich in sugar and containing up to % fat has been
widely used to induce obesity in mice [–]. Scientists have
found that some Chinese herbs like berberine, curcuma
longa, and Sibiraea angustata could eectively ameliorate
obesity by inhibiting the synthesis, growth, and accumulation
of fatty acid in adipocytes [–]. e functions of Chinese
herbs have been investigated in vivo in mouse models of high-
fat-diet (HFD) induced obesity [].
e root of Angelica sinensis (Chinese named Danggui),
a well-known herbal medicine, has been historically used as
a tranquilizer or a tonic agent [, ]. As a functional food,
RAS can also be used for the amelioration of inammation,
diabetes, and cardiovascular disorders. Previous studies have
shown that the Angelica sinensis polysaccharide (ASP), the
active chemical components of RAS, had hematopoietic
eects in animal and cellular models []. Two acidic polysac-
charides (APS-b and APS-c) signicantly inhibited the
growth of S tumors and increased the life span of S
tumor-bearing mice []. Furthermore, the antioxidant eects
of ASP could stimulate the endothelial production of nitric
oxide and resist ischemia/reperfusion (I/R) injury [].
e fat mass and obesity associated (FTO) gene has a
relative eect on obesity []. FTO islocatedonchromosome
 in humans and encodes a protein with a double-stranded
b-helix fold, homologous to the members of the nonheme and
-oxoglutarate oxygenase superfamily (which mainly impact
the metabolism of fatty acid) []. Further, studies in humans
and rodents suggested that FTO is involved in food intake
regulation and lipid metabolism []. Histological studies
revealed that the localization of FTO mRNA and protein in
the hypothalamic nucleus was of critical importance in the
regulation of feed intake in mice []. Loss of function of FTO
in mice led to postnatal growth retardation and a signicant
reduction in adipose tissue and lean body mass []. Over
Hindawi
BioMed Research International
Volume 2017, Article ID 6280972, 8 pages
https://doi.org/10.1155/2017/6280972

BioMed Research International
expression of FTO, however, led to a dose-dependent increase
in body and fat mass []. Furthermore, Merkestein and col-
leagues found that FTO inuences adipogenesis by regulating
the process of mitotic clonal expansion in obese mice [].
In the present study, we assessed the eects of RAS
supplementation on body weight in HFD mice. Furthermore,
mRNA expression and promoter methylation status of the
FTO gene were determined to compare the eects of RAS
between control and treated groups. is study will provide a
foundation for understanding the functions of RAS in obesity
resistance.
2. Materials and Methods
2.1. Ethics Statement. Animas involved in this study were sac-
riced according to the Regulations for the Administration
of Aairs Concerning Experimental Animals and approved
by the Institutional Animal Care and Use Committee at
the College of Animal Science and Technology, Sichuan
Agricultural University, Sichuan, China, under the permit
number DKY-B.
2.2. Animals and Diets. Female KM mice at  weeks of age
were obtained from the Chengdu Dossy Laboratory Animal
Co., Ltd, in Sichuan province, China. Mice were reared at
standard conditions within a free access to food and water for
 week to acclimatize to experimental conditions. Mice were
then randomly assigned to the normal diet group (GC, 𝑛=
10)ortheHFDgroup(HC,𝑛=48) without RAS supplemen-
tation. Aer  weeks, the obese mice were randomly divided
into four groups. All groups were continually fed with HFD.
e rst group (𝑛=12) was designated the high-fat control
group (HC) without RAS supplementation. e second group
(𝑛=11) received RAS supplementation at . g/kg⋅BW and
was designated as the low-dose group (DL). e third group
(𝑛=11) received RAS supplementation at . g/kg⋅BW and
was designated the medium-dose group (DM) and the last
group (𝑛=12) was designated the high-dose group (DH)
with RAS supplementation at . g/kg⋅BW. e female
ospring were obtained by mating with the male KM fed
under same conditions for each group. e diet formula is
showninTable.eRASwasdriedandgroundandthen
added to the mixture, which was kneaded and made into a
cylindrical shape using -mL injectors. Finally, the mixture
was dried at ∘Covernightandstoredinahermeticbagaer
cooling to room temperature. Body weight was measured
weekly. Adipose tissues were collected from  mice in each
group aer RAS supplementation for , , and  days.
2.3. Total RNA Extraction and Reverse Transcription. Mice
were sacriced by cervical dislocation and adipose tissue
was collected and rapidly frozen in liquid nitrogen and then
stored at −∘C. Total RNA was extracted using TRIzol
reagent (Invitrogen, CA, USA). e purity of the isolated
RNA was determined by agarose gel electrophoresis and the
concentration was quantied by the ND- Nanodrop
(ermo Scientic, MA, USA). cDNA was synthesized using
the Prime Script RT reagent Kit (Takara, Dalian, China)
according to the manufacturer’s recommendations.
2.4. Quantitative Real-Time PCR of the FTO Gene. We per-
formed quantitative real-time PCR (qPCR) to quantify the
relative mRNA expression levels of FTO in adipose tissues of
mice from GC, HC, DL, DM, and DH groups, as well as DH
ospring. Primer pairs used for qPCR (Table ) were designed
according to the mouse FTO gene (NM ). e qPCR
was performed in triplicate using a SYBRPremix Ex Taq
II kit (Takara, Dalian, China). Each qPCR reaction (total
volume  𝜇L) contained . 𝜇LcDNA,𝜇L SYBR Green II,
. 𝜇L primer pairs, and . 𝜇L ddH2O. e qPCR procedures
were as follows: ∘Cformin,cyclesof
∘Cfors,s
at optimum temperatures, ∘C for  s, and a nal extension
for  min, and then a temperature increment of .∘C/s from
∘Cto
∘C to build a melting curve. e specicity of
qPCR products was conrmed by melting curve analysis. e
relative expression of FTO mRNA was determined using the
geometric mean of GAPDH, 𝛽-actin, and 18s rRNA by the
2−ΔΔCT method [].
2.5. DNA Preparation and Methylation Analysis by BSP
Method. Genomic DNA was extracted from the adipose
tissues of mice from GC, HC, and DH groups aer RAS
supplementation for  days, using TIANamp Genomic DNA
Kit (Tiangen, Beijing, China). ree animals were randomly
selected from each group. DNA was quantied by the ND-
 Nanodrop and then treated with sodium bisulte
using the EZ DNA Methylation Gold Kit (Zymo Research,
CA, USA). Following the manufacturer’s instructions, DNA
dosage was strictly limited to insure complete cytosine to
uracil conversion.
e methylated CpGs in the FTO promoter (Acc.
number AC) were estimated by the online program
(http://www.urogene.org/cgi-bin/methprimer/methprimer.
cgi). e primer pairs were modied by Primer Premier
(Table).ePCRwasrunonaCPCRsystem
ermocycler (Bio-Rad, Richmond, CA) in a volume of
 𝜇Lincluding𝜇L bisulte-converted DNA or . 𝜇LPCR
products,  𝜇LZymoTaqPreMix, or  𝜇Lprimerpairs.
PCR reactions were as follows: ∘C for  min,  cycles
of  s at ∘C,  s at .∘C(secondround:.
∘C),
and  s at ∘C, and a nal extension for  min at ∘C.
e second PCR products were puried with a DNA Gel
Extraction Kit (TsingKe, Chengdu, China) and then ligated
into pMD -T vector (Takara, Dalian, China). At least ten
positive recombinants were sequenced on an ABI XL
DNA analyzer (Applied Biosystems, USA). e methylated
CpGs were analyzed with the QUantication tool (QUMA,
http://quma.cdb.riken.jp/).
2.6. Histological and Morphometric Analysis. e abdominal
adipose tissues were resected and xed in % paraformalde-
hyde aer washing. ey were then dehydrated in ethanol and
soaked in dimethylbenzene and then embedded in paran.
e tissue blocks were sectioned at -micron thickness and
then stained with haematoxylin and eosin (H&E) reagent.

BioMed Research International 
T : Composition of the experimental diets used in the present study.
Ingredients Normal diet High-fat-diet
GC HC DL DM DH
Corn starch .% .% .% .% .%
Flour .% .% .% .% .%
Bran .% .% .% .% .%
Soybean meal .% .% .% .% .%
Fish meal .% .% .% .% .%
Lard  .% .% .% .%
Egg  .% .% .% .%
Sucrose  .% .% .% .%
Angelica sinensis   .% .% .%
Total .% .% .% .% .%
T : Information of primer pairs used in this study.
Primer name Primer sequence (󸀠-󸀠)Size(bp)Tm(
∘C)
QPCR
FTO-Q-F GAGTTCTATCAGCAGTGG  .
FTO-Q-R GCACATCTTTGCCTTGGA
GAPDH-F GGTGAAGGTCGGTGTGAACG  .
GAPDH-R CTCGCTCCTGGAAGATGGTG
ACTB-F CGTTGACATCCGTAAAGACC  .
ACTB-R AACAGTCCGCCTAGAAGCAC
S rRNA-F AGGGGAGAGCGGGTAAGAGA  .
S rRNA-R GGACAGGACTAGGCGGAAC
BPS
FTO-BF TAGTTGATTTTGTTTGAAGAGGAAGA  .
FTO-BR TCCTACTCACTATCAACAATTCCTAA
FTO-BF GGGTTGAAGAGGTGGTTTAGTAGTTA  .
FTO-BR ACAATCTCACTCAATCCACTTACATCT
Photomicrographs were obtained and analyzed using Image-
Pro Plus soware (Media Cybernetics).
2.7. Statistical Analyses. All of the statistical analyses were
performed using SPSS . (SPSS, Chicago, IL, USA) and
the data were represented as means ±SD. e signicance
between groups was estimated by a one-way ANOVA test and
Student’s 𝑡-test.
3. Results
3.1. Eects of RAS Supplementation on Body Weight in HFD
Fed Mice. Compared with the normal diet group (GC), the
HC mice showed marked obesity aer feeding with HFD
for  weeks (Figure (a)). During HFD treatment, appetite,
activity, and coat luster were normal for all animals. Aer
 weeks, the mice in the HC group were divided into ve
subgroups,HC,DL,DM,andDH,fedwithdierentdosage
of RAS supplementation for another  weeks. Compared with
themiceintheGC,HC,DL,andDMgroups,themicein
the DH group showed the lowest weight gain (Figure (b)
andTable).Welaterused.g/kg⋅BW RAS to feed DH
ospring continually. However, RAS supplementation did not
show an obvious eect on body weight between the ospring
from the HC and DH groups (data not shown).
3.2. Eects of RAS Supplementation on FTO mRNA Expres-
sion. To assess the eects of RAS supplementation on FTO
mRNA expression, we performed qPCR to quantify FTO
expression in adipose tissues collected from mice in the GC,
HC,DL,DM,andDHgroupsatdaysand.Inaddition,
we also determined FTO expression in HC and DH mice at
day , as well as in their progeny at day . e qPCR results
showed that the expression of FTO in the RAS-supplemented
groups (DL, DM, and DH) was signicantly higher than in
the HC group aer both  d and  d (Figures (a) and
(b)). No signicant dierence was detected between the
HC and DH groups aer  d (Figure (c)). Moreover, there
was no signicant dierence in FTO expression between the
ospring of mice in the HC and DH groups (Figure (d)).
3.3. Eects of RAS Supplementation on Methylation in the FTO
Promoter. e structure of the analyzed CpG sites and their
locations (GenBank Acc. number AC: –)

BioMed Research International
Body weight (g)
Time (weeks)
50
40
30
20
10
0
5 6 7 8 9 10 11
GC (n=10
)
HDF (n=48
)
(a)
Body weight (g)
Time (weeks)
55
50
45
40
35
30
8 10121416
GC
HDF
DL
DM
DH
(b)
F : Body weight changes in the HFD mice model (a). Eects of RAS supplementation on body weight alterations in the HFD mice (b).
Expression of FTO gene
GC HC DL DM DH
＆0-35 ＄
3
2
1
0
ab ab
ab
b
a
(a)
Expression of FTO gene
GC HC DL DM DH
＆0-60 ＄
8
6
4
2
0
ab
cc
bc
a
(b)
Expression of FTO gene
＆0-95 ＄
4
3
2
1
0
HC DH
(c)
Expression of FTO gene
∗∗
4
3
2
1
0
HC (＆0-35 D) HC (＆1-35 D) DH (＆0-35 D) DH (＆1-35 D)
(d)
F : Eects of RAS supplementation on FTO mRNA expression in HFD obese mice. Dierent letters above each bar represent being
signicantly dierent (𝑃 < 0.05). ∗∗ indicates signicant dierence (𝑃 < 0.01).

BioMed Research International 
15 CpG sites in the 443-bp region
FTO-B1F FTO-B1R
FTO-B2F FTO-B2R
FTO promoter (AC105989: 31,474–31,968＜Ｊ)
(a)
DH 91.67%GC 90.00% HC 95.44%
Methylated
Unme thy lat ed
(b)
F : Schematic representation of the FTO promoter and the intragenic CpG sites in a -bp region (a). Methylation status of the FTO
promoter in adipose tissues in GC, HC, and DH mice aer being RAS-treated for  days (b). Each line represented as a sequence from each
clone, while each vertical bar corresponded to an identical CpG site.
within the FTO gene are shown in Figure . e DNA
methylation patterns of the GC, HC, and DH groups were
assessed by bisulte sequencing. e region analyzed includes
a dened CpG island, located  bp upstream of the start
codon. e FTO gene was hypermethylated in GC mice
(.%), while the mice fed with HFD showed a higher
methylation level in the HC group (.%). As expected,
supplementation of RAS reduced the methylation level,
which reached .% in DH mice.
3.4. Eects of RAS Supplementation on Adipocyte Morphology.
e H&E histological examination showed that adipocytes
had a polygonal morphology with typical peripherally located
nuclei and distinct cell borders (Figure (a)). Aer being
fed HFD with RAS supplementation for  d, the volume of
adipocytes in the DH group was smaller than that in the HC
group and showed some brous tissue in the intercellular
substance and a greater number of adipocytes (Figure (a)).
Adipocytes in DH mice fed RAS for  d were smaller again
and the cell arrangement was obviously abnormal compared
with HC mice. Histological and quantitative analyses revealed
that the mean diameter of adipocytes in the HC and DH mice
fed RAS for  d was 373.9 ± 64.8 𝜇mand227.7 ± 48.2𝜇m,
respectively,andadipocyteareawas115,817.8±38,956.0𝜇m2
and 44,655.3 ± 19,589.2𝜇m2, respectively (Figure (b)). In
theDHmicefedRASford,themeandiameterand
area of adipocytes were 171.4 ± 66.0 𝜇mand27,303.4 ±
20,430.6𝜇m2, respectively. Overall, the mean diameter and
area of adipocytes in HC mice were signicantly greater than
in DH mice (𝑃 < 0.05).
4. Discussion
In this report we demonstrate, for the rst time, the favor-
able eects of RAS supplementation on body weight, gene
expression, and promoter methylation of the FTO gene in
mice with HFD obesity. As many previous studies, the obesity
mouse model was induced by HFD; while formulas dier
between studies, common ingredients included sugar and
lard [, ]. e obesity mice model was established by HFD
and the standard deviation both in GC and HC groups was
accredited. Intragroup inconsistencies in body weight aer
the administration of RAS may have been due to individual
error [, ]. In the present study, body weight gain was lowest
in the DH group, which received . g/kg⋅BW of RAS
supplementation (Table ). Meanwhile, body weight gain in
themicefedwithlowormoderatedosage(DLandDM
groups) was not dierent from the HC mice, indicating that
a higher dosage of RAS supplementation (.g/kg⋅BW)

BioMed Research International
HC (35 ＞) DH (35 ＞) DH (60 ＞)
(a)
0
100
200
300
400
500
Diameter of adipocytes (Ｇ)
∗∗
HC (35 ＞) DH (35 ＞) DH (6 0 ＞)
(b)
0
50000
100000
150000
200000
∗∗
Area of adipocytes (Ｇ2)
HC (35 ＞) DH (35 ＞) DH (60 ＞)
(c)
F : Histological assessment of the adipose tissues of mice in the HC and DH groups (a). Scale bars,  𝜇m. e quantitative data of the
mean diameter and area of adipocytes are shown (b). Values are mean ±SD (𝑛=3). ∗∗𝑃< 0.01.
T : Eects of RAS supplementation on body weight alterations in mice.
Group AS content∗Sample size  weeks  weeks  weeks  weeks  weeks
GC NA  . ±. . ±. . ±. . ±. . ±.
HC NA  . ±. . ±. . ±. . ±. . ±.
DL . g/kg⋅BW  . ±. . ±. . ±. . ±. . ±.
DM . g/kg⋅BW  . ±. . ±. . ±. . ±. . ±.
DH . g/kg⋅BW  . ±. . ±. . ±. . ±. . ±.
∗e dosage of AS was according to the recommendation.
might be more benecial in suppressing body weight in obese
individuals.
We found that the expression of FTO mRNA was sig-
nicantly increased in RAS-supplemented mice (DL, DM,
and DH groups) and body weight gain of HC mice was
markedly higher than that of DL, DM, and DH mice. is
suggests that RAS might inuence BW gain via alterations of
gene expression. As showed by qPCR, there was a signicant
dierence in FTO expression between RAS-supplemented
groups and the GC and HC groups in  d, suggesting a
correlation between FTO expression and body weight gain.
In HC mice, however, FTO expression was lowest and obesity
was highest. Previous studies reported that loss of FTO in
mice resulted in a signicant reduction of adipose tissue and
lean body mass [], and that FTO inuenced adipogenesis
by regulating events early in adipogenesis during the process
of mitotic clonal expansion []. FTO mRNA was more
highly expressed in RAS-treated groups than the control
group, especially the DH group. Aer  d, the highest FTO
expression level was in the RAS-treated groups. Moreover, no
signicant dierence was observed aer  d between the GC
and HC groups, or in their ospring. ese results suggest
that the eects of RAS supplementation on FTO expression
are not heritable.
FTO is a nucleic acid demethylase that removes methyl
groups from both DNA and RNA [, ]. Previous studies
have shown that DNA methylation is altered not only in
oocytes of obese mice but also in their ospring []. e
modication of DNA methylation provides a link between
the environment and gene expression, therefore, we investi-
gated the methylation levels of CpGs in the FTO promoter
region. ere are CpG dinucleotides present in the  Kb
upstream of the start codon of FTO.BSPresultsshowedthat
theCpGsiteswithintheFTO promoter were highly methy-
lated in all of the three groups (GC, HC, and DH). Although
the methylation levels were not signicantly dierent, our

BioMed Research International 
results revealed that promoter methylation and expression of
FTO gene mRNA were negatively correlated. us, regulation
by a methyl group blocking the transcription factor binding
to this region (AC: ,–, bp) is possible.
Previous study has demonstrated the polysaccharide
of Angelica sinensis in ameliorating glucose and lipid
metabolism disorders related to obesity, possibly due to inter-
actions with insulin and serum inammatory factors []. e
molecular mechanisms, however, remained unclear. In the
present study, the extent of the adipose tissues was dierent
between HC and DH mice. We suggested that this dierence
in body weight may be caused by adipocyte morphology.
Furthermore, we performed histological examination to view
the alterations in adipocyte shape and size between HC and
DH mice. As shown in Figure , adipocytes in the HC group
were more mature and characterized by bigger lipid droplets,
whilethoseintheDHhadmoreandsmallerlipiddroplets.
e mice in the DH group fed RAS for  d showed much
smaller adipocytes and more intercellular substance than DH
mice fed RAS for  d.
5. Conclusion
is study investigated whether RAS could suppress body
weight in HFD obese mice. e supplementation of RAS was
associated with suppression of body weight, increased FTO
mRNA expression, and reduction of methylation. e present
study provides new insights into the biological role of RAS.
Further detailed analyses need to be performed to understand
themechanismofRASinbodyweightsuppression.
Conflicts of Interest
All authors declared that they have no conicts of interest.
Acknowledgments
isstudywassupportedbythegrantsfromtheUndergrad-
uate Innovative Experiment Program of Sichuan Agricultural
University (), the National Natural Science
Foundation of China (), and the Chinese Domestic
Animal Germplasm Resources Infrastructure.
References
[] A. Samuelsson, P. A. Matthews, M. Argenton et al., “Diet-
induced obesity in female mice leads to ospring hyperphagia,
adiposity, hypertension, and insulin resistance: a novel murine
model of developmental programming,” Hypertension,vol.,
no. , pp. –, .
[] M.vanHeek,D.S.Compton,C.F.Franceetal.,“Diet-induced
obese mice develop peripheral, but not central, resistance to
leptin,” Journal of Clinical Investigation,vol.,no.,pp.–
, .
[] C. Church, S. Lee, E. A. L. Bagg et al., “A mouse model for the
metabolic eects of the human fat mass and obesity associated
FTO gene,” PLoS Genetics,vol.,no.,ArticleIDe,
.
[] D.Y.Lu,C.H.Tang,Y.H.Chen,andI.H.Wei,“Berberinesup-
presses neuroinammatory responses through AMP-activated
protein kinase activation in BV- microglia,” Journal of Cellular
Biochemistry,vol.,no.,pp.–,.
[] J. Zhao, X.-B. Sun, F. Ye, and W.-X. Tian, “Suppression of
fatty acid synthase, dierentiation and lipid accumulation in
adipocytes by curcumin,” Molecular and Cellular Biochemistry,
vol.,no.-,pp.–,.
[] L. Xiao, J. Zhang, H. Li et al., “Inhibition of adipocyte dierenti-
ation and adipogenesis by the traditional Chinese herb Sibiraea
angustata,” Experimental Biology and Medicine,vol.,no.,
pp.–,.
[] K. A. Fawcett and I. Barroso, “e genetics of obesity: FTO leads
the way,” Trend s in Ge n eti cs,vol.,no.,pp.–,.
[] K. Wang, P. Cao, W. Shui, Q. Yang, Z. Tang, and Y. Zhang,
“Angelica sinensis polysaccharide regulates glucose and lipid
metabolism disorder in prediabetic and streptozotocin-induced
diabetic mice through the elevation of glycogen levels and
reduction of inammatory factors,” Food and Function,vol.,
no.,pp.–,.
[] W.G.P.H.-Y.Hsu,Chinese Herb Medicine and erapy, Aurora
Publishers Incorporated, Nashville, Tenn, USA, .
[] C. Liu, J. Li, F. Y. Meng et al., “Polysaccharides from the root of
Angelica sinensis promotes hematopoiesis and thrombopoiesis
through the PIK/AKT pathway,” BMC Complementary and
Alternative Medicine,vol.,article,.
[] W. Cao, X.-Q. Li, X. Wang et al., “Characterizations and anti-
tumor activities of three acidic polysaccharides from Angelica
sinensis (Oliv.) diels,” International Journal of Biological Macro-
molecules,vol.,no.,pp.–,.
[]S.Zhang,B.He,J.Geetal.,“Extraction,chemicalanalysis
of Angelica sinensis polysaccharides and antioxidant activity of
the polysaccharides in ischemia-reperfusion rats,” International
Journal of Biological Macromolecules,vol.,no.,pp.–,
.
[] T. M. Frayling, N. J. Timpson, M. N. Weedon et al., “A common
variant in the FTO gene is associated with body mass index and
predisposes to childhood and adult obesity,” Science,vol.,
no.,pp.–,.
[] L. Sanchez-Pulido and M. A. Andrade-Navarro, “e FTO (fat
mass and obesity associated) gene codes for a novel member
of the non-heme dioxygenase superfamily,” BMC Biochemistry,
vol. , article , .
[] A. Tiwari, S. M. Krzysik-Walker, and R. Ramachandran,
“Cloning and characterization of chicken fat mass and obesity
associated (FTO) gene: fasting aects FTO expression,” Domes-
tic Animal Endocrinology,vol.,no.,pp.–,.
[]T.Gerken,C.A.Girard,Y.-C.L.Tungetal.,“eobesity-
associated FTO gene encodes a -oxoglutarate-dependent
nucleic acid demethylase,” Science,vol.,no.,pp.–
, .
[] J. Fischer, L. Koch, C. Emmerling et al., “Inactivation of the FTO
gene protects from obesity,” Nature,vol.,no.,pp.–
, .
[] C. Church, L. Moir, F. McMurray et al., “Overexpression of FTO
leads to increased food intake and results in obesity,” Nature
Genetics, vol. , no. , pp. –, .
[] M. Merkestein, S. Laber, F. McMurray et al., “FTO inuences
adipogenesis by regulating mitotic clonal expansion,” Nature
Communications,vol.,article,.

BioMed Research International
[] K. J. Livak and T. D. Schmittgen, “Analysis of relative gene
expression data using real-time quantitative PCR and the
2−ΔΔ𝐶𝑇 method,” Methods,vol.,no.,pp.–,.
[] E. S. Jungheim, E. L. Schoeller, K. L. Marquard, E. D. Louden,
J.E.Schaer,andK.H.Moley,“Diet-inducedobesitymodel:
abnormal oocytes and persistent growth abnormalities in the
ospring,” Endocrinology,vol.,no.,pp.–,.
[] G. Jia, Y. Fu, X. Zhao et al., “N-methyladenosine in nuclear
RNAisamajorsubstrateoftheobesity-associatedFTO,” Nature
Chemical Biology,vol.,no.,pp.–,.
[] Z. J. Ge, S. M. Luo, F. Lin et al., “DNA methylation in oocytes
and liver of female mice and their ospring: eects of high-fat-
diet-induced obesity,” Environmental Health Perspectives,vol.
, no. , pp. –, .