Content uploaded by You-Lin Tain
Author content
All content in this area was uploaded by You-Lin Tain on Nov 18, 2017
Content may be subject to copyright.
Biology of Reproduction, 2017, 97(4), 636–643
doi:10.1093/biolre/iox115
Research Article
Advance Access Publication Date: 9 September 2017
Research Article
Maternal melatonin or agomelatine therapy
prevents programmed hypertension in male
offspring of mother exposed to continuous
light†
You-Lin Tain1,2, Yu-Ju Lin3, Julie Y.H. Chan2, Chien-Te Lee4
and Chien-Ning Hsu5,6,∗
1Department of Pediatrics, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University, College of Medicine,
Taiwan; 2Institute for Translational Research in Biomedicine, Kaohsiung Chang Gung Memorial Hospital and Chang
Gung University, College of Medicine, Kaohsiung, Taiwan; 3Department of Obstetrics and Gynecology, Kaohsiung
Chang Gung Memorial Hospital and Chang Gung University, College of Medicine, Taiwan; 4Division of Nephrology,
Kaohsiung Chang Gung Memorial Hospital and Chang Gung University, College of Medicine, Taiwan; 5Department
of Pharmacy, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan and 6School of Pharmacy, Kaohsiung
Medical University, Kaohsiung, Taiwan
∗Correspondence: Department of Pharmacy, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 83301, Taiwan.
Tel: +88677317123 ext. 6131; E-mail: chien ning hsu@hotmail.com
†Grant support : This work was supported by Grant MOST 104-2314-B-182-056-MY3 from the Ministry of Science and
Technology, Taiwan.
Received 4 May 2017; Revised 6 August 2017; Accepted 7 September 2017
Abstract
Hypertension can originate from early-life insults, whereas maternal melatonin therapy can be
protective in a variety of models of programmed hypertension. We hypothesize that melatonin or
melatonin receptor agonist agomelatine can prevent programmed hypertension in adult offspring
induced by maternal exposure to continuous light. Female Sprague-Dawley pregnant rats ran-
domly divided into four groups: controls, rats exposed to continuous light, exposed to continuous
light plus treated with agomelatine (50 mg/day i.p.), and exposed to continuous light plus treated
with 0.01% melatonin in drinking water throughout pregnancy and lactation period. Male offspring
(n =10/group) from three litters were examined at 12 weeks of age. Maternal continuous light
exposure-induced hypertension in male offspring, which was prevented by melatonin or agomela-
tine therapy. Continuous light exposure did not affect melatonin pathway in adult offspring kidney.
Genes that belong to the renin-angiotensin system (RAS), sodium transporters, AMP-activated pro-
tein kinase pathway, and circadian rhythm were potentially involved in the maternal exposure to
continuous light-induced programmed hypertension. Maternal agomelatine therapy decreased Ace
expression but increased Agtr2 and Mas1. Maternal melatonin therapy prevented the increases
of Slc9a3, Slc12a3,andAtp1a1 expression induced by maternal continuous light exposure. In
conclusion, maternal melatonin or agomelatine therapy prevents programmed hypertension in-
duced by maternal exposure to continuous light. Agomelatine and melatonin reprogram the RAS
and sodium transporters differentially, to prevent negative programming of continuous light. Our
data highlight candidate genes and pathways in renal programming as targets for therapeutic
636 C
The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved.
For permissions, please e-mail: journals.permissions@oup.com
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
Melatonin prevents light-induced hypertension, 2017, Vol. 97, No. 4 637
approaches to prevent programmed hypertension caused by early-life disturbance of the circadian
rhythm.
Summary Sentence
Exposure of the mother to continuous light-induced programmed hypertension in adult off-
spring, which was prevented by maternal agomelatine or melatonin therapy via regulating renin-
angiotensin system, sodium transporters, AMP-activated protein kinase pathway, and circadian
rhythm.
Key words: circadian rhythms, developmental origins of health and disease (DOHaD), hypertension, melatonin,
melatonin receptor, next generation sequencing, renin–angiotensin system, sodium transporter.
Introduction
More and more people in the modern world become increasingly
active during night time, resulting in circadian disruption. Night
shift work can increase the risk of hypertension and adverse out-
comes of pregnancy [1,2]. However, the long-term effects of shift
work during pregnancy to offspring remains unclear. Hypertension
can come from early-life environmental insults, officially known as
“the developmental origins of health and disease” (DOHaD) [3].
Blood pressure (BP) regulation is a complex process, primarily gov-
erned by the kidneys. The number of nephrons decreases in multi-
ple animal models of developmental programming, indicating that
developmental programming during nephrogenesis plays an impor-
tant role in increasing susceptibility to adulthood hypertension [4,5].
In the developing kidneys, maternal insults may impair nephrogen-
esis and induce renal programming, consequently leading to pro-
grammed hypertension [6,7]. Accordingly, renal programming turns
out to be a driving mechanism of programmed hypertension [6–8].
So far, several mechanisms, including oxidative stress, alterations
of renin–angiotensin system (RAS) and sodium transporters, and
nutrient-sensing signal have been reported to be associated with re-
nal programming [6–8].
Adult rats exposed to continuous light cause melatonin deficiency
and leads to hypertension [9,10]. It is unclear whether maternal
continuous light exposure can induce programmed hypertension in
adult offspring in a melatonin signaling pathway-dependent manner.
Melatonin, the most abundant hormone secreted by the pineal
gland at night, regulates circadian rhythm. Other functions of mela-
tonin, including its anti-inflammatory and antioxidant properties,
epigenetic regulation, are linked to its regulation of BP [11,12]. The
kidney itself owns an intrinsic circadian clock involved in the con-
trol of sodium transport and BP [13,14]. Thus, disturbance of the
renal circadian clock is increasingly recognized as a risk factor for
hypertension [14].
The cellular circadian clock consists of interlinked positive and
negative regulatory limbs [13,14]. The positive limb includes the
including Clock (encoding for circadian locomotor output cycles
kaput) and Bmal1 (encoding for brain and muscle aryl-hydrocarbon
receptor nuclear translocator-like 1) that activate transcription of
their target genes. CLOCK/BMAL1 target genes include the Cry
(encoding for cryptochrome) and Per (encoding for period) genes,
whose proteins form the negative limb. Clock genes are expressed in
the oocyte and in fetal organs during organogenesis [15]. Maternal
melatonin signal plays a key role on establishing and entraining fetal
circadian clocks [16].
We reported previously that maternal melatonin treatment can
protect adult offspring exposed to a variety of early-life insults from
hypertension [17–22]. Additionally, we observed that the protective
mechanism of maternal melatonin therapy on programmed hyper-
tension might be related to its regulation on the melatonin path-
way in the offspring kidney [23]. Melatonin is known for its benefit
on placenta homeostasis and consequently on pregnancy and fetal
health [24,25]. However, whether maternal melatonin therapy can
regulate melatonin pathway and circadian clock in offspring kidney
to prevent maternal continuous light exposure-induced programmed
hypertension remains undetermined.
Melatonin receptor agonists have been reported to be helpful
in stabilizing circadian rhythm and treat circadian rhythm-related
disorders [26]. The DOHaD concept provides a shift on therapeutic
approach from adulthood to early life, through so-called reprogram-
ming [8]. Because of the essential role of continuous light exposure,
renal programming, and melatonin signaling in the development of
hypertension and the extended use of melatonin and its analogs
in clinical practice, therefore, this study examined whether maternal
melatonin or its analog agomelatine therapy prevented maternal con-
tinuous light exposure-induced programmed hypertension in adult
offspring and explored the underlying mechanisms with a focus on
the kidney.
Materials and methods
Animal models
This study was carried out in strict accordance with the recommen-
dations in the Guide for the Care and Use of Laboratory Animals of
the National Institutes of Health and approved by the Institutional
Animal Care and Use Committee of the Kaohsiung Chang Gung
Memorial Hospital (IACUC approval number: 2 014 111 001).
Virgin Sprague–Dawley (SD) rats (12–16 weeks old) were obtained
(BioLASCO Taiwan Co., Ltd, Taipei, Taiwan) and housed and main-
tained in a facility accredited by the Association for Assessment and
Accreditation of Laboratory Animal Care International. Rats were
exposed to a 12-h light/12-h dark photoperiod (lights on 0700–
1900). Male SD rats were caged with individual females until mating
was confirmed by observation of a vaginal plug. Pregnant rats were
randomly divided into four groups (N =3 per group): controls, rats
exposed to continuous light (light), exposed to continuous light plus
treated with agomelatine (light +A), and exposed to continuous light
plus treated with melatonin (light +M). Male offspring from three
independent litters (n =10 in total) were examined at 12 weeks of
age. The rats in the light group were exposed to a continuous light
environment (lights on 24 h every day) for 6 weeks during preg-
nancy and lactation (i.e. from gestational day 1 to postnatal day 21).
Agomelatine (50 mg/dose) was i.p. injection once a day prior to the
onset of the dark phase of the 12-h light/dark cycle, based on the cir-
cadian rhythm resynchronization properties [27], during pregnancy
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
638 Y.-L. Tain et al., 2017, Vol. 97, No. 4
and lactation. Another continuous light exposure rats will receive
0.01% melatonin in drinking water throughout the pregnancy and
lactation periods for a total of 6 weeks. The dose of melatonin was
adopted according to our previous studies [17–19]. Melatonin was
prepared twice weekly by dissolving the drug (10 mg) in 1 mL of
100% ethanol. For use, the stock solution was diluted with water
to a final concentration of 0.01%. Each water bottle was wrapped
with aluminum foil to protect the drug from light.
Because hypertension occurs at a higher rate and at an earlier
age in males than females [28], only male offspring was used in
subsequent experiments. After birth, the subjects came from litters
of 10 pups to standardize the received quantity of milk and maternal
pup care. To prevent maternal rejection, pups were not weighted at
birth. Each litter was left with the mother until weaning.
Blood pressure was measured in conscious rats by an indirect
tail-cuff method (BP-2000; Visitech Systems, Inc., Apex, NC) [17].
To ensure accuracy and reproducibility, the rats were acclimated to
restraint and tail-cuff inflation for 1 week prior to the experiment.
Rats were placed on the specimen platform. Their tails were passed
through tail cuffs and secured in place with tape. Following a 10-min
warm-up period, 10 preliminary cycles were performed to allow the
rats to adjust to the inflating cuff. A total of five cycles were recorded
at each time point for each rat. Three stable measures were taken
and averaged. Male offspring were euthanized by an i.p. overdose
of pentobarbital at 12 weeks of age. The midline of the abdomen
was opened, and the intestines were displaced laterally to allow
visualization of the aorta. The aorta was cannulated with a 23-gauge
butterfly needle, heparinized blood samples were collected, the vena
cava was cut, and PBS was perfused until the kidneys were blanched.
Perfused kidneys were harvested, decapsulated, divided into cortex
and medulla, flash-frozen in liquid nitrogen, and stored at –80◦C
for further analysis. Renal melatonin level was measured using an
ELISA kit (MyBioSource, San Diego, CA) as previously described
[23]. The intra- and interassay variations of the melatonin ELISA
were 11.4% and 19.3%, respectively. Briefly, 100 mg kidney cortex
was homogenized in 500 μL PBS and protein concentration was
determined by the Bradford assay (Bio-Rad, Hercules, CA). After
two freeze–thaw cycles were performed, tissue homogenate samples
were centrifuged. Duplicate determinations in 100 μL of supernatant
samples were made, and the average of two measurements was used
in subsequent statistical analysis of the data. The melatonin level
was quantified spectrophotometrically at 450 nm. The results were
expressed as pg melatonin per mg of protein.
High performance liquid chromatography
Plasma L-arginine, L-citrulline, asymmetric dimethylarginine
(ADMA, an endogenous inhibitor of nitric oxide [NO] syn-
thase), and symmetric dimethylarginine (SDMA, an isomer of
ADMA) levels were measured using HPLC ([high performance
liquid chromatography] HP series 1100; Agilent Technologies
Inc, Santa Clara, CA) with the o-phtalaldehyde-3-mercaptoprionic
acid derivatization reagent described previously [17]. Standards
contained concentrations of 1–100 mM L-arginine, 1–100 mM
L-citrulline, 0.5–5 mM ADMA, and 0.5–5 mM SDMA. The recovery
rate was approximately 95%.
Quantitative real-time polymerase chain reaction
RNA was extracted as previously described procedures [22]. Two-
step quantitative real-time polymerase chain reaction (RT-qPCR)
was conducted using the QuantiTect SYBR Green PCR Kit (Qi-
agen, Valencia, CA, USA) and the iCycler iQ Multi-color Real-
Ta b l e 1 . Polymerase chain reaction primers sequences.
Gene Forward Reverse
Ren 5 aacattaccagggcaactttcact 3 5 acccccttcatggtgatctg 3
Atp6ap2 5 tgggaagcgttatggagaag 3 5 cttcctcaccagggatgtgt 3
Agt 5 gcccaggtcgcgatgat 3 5 tgtacaagatgctgagtgaggcaa 3
Ace 5 caccggcaaggtctgctt 3 5 cttggcatagtttcgtgaggaa 3
Ace2 5 acccttcttacatcagccctactg 3 5 tgtccaaaacctaccccacatat 3
Agtr1a 5 accaggtcaagtggatttcg 3 5 atcaccaccaagctgtttcc 3
Agtr2 5 caatctggctgtggctgactt 3 5 tgcacatcacaggtccaaaga 3
Mas1 5 catctctcctctcggctttgtg 3 5 cctcatccggaagcaaagg 3
Prkaa2 5 agctcgcagtggcttatcat 3 5 ggggctgtctgctatgagag 3
Prkab2 5 cagggccttatggtcaagaa 3 5 cagcgcatagagatggttca 3
Prkag3 5 gtgtgggagaagctctgagg 3 5 agaccacacccagaagatgc 3
Ppargc1a 5 atgtgtcgccttcttgctct 3 5 atctactgcctggggacctt 3
Clock 5 ccactgtacaatacgatggtgatctc 3 5 tgcggcatactggatggaat3
Bmal1 5 attccagggggaaccaga 3 5 gaaggtgatgaccctcttatcct 3
Cry1 5 atcgtgcgcatttcacatac 3 5 tccgccattgagttctatgat 3
Cry2 5 gggagcatcagcaacacag 3 5 gcttccagcttgcgtttg 3
Per1 5 gcttgtgtggactgtggtagca 3 5 gccccaatccatccagttgt 3
Per2 5 catctgccacctcagactca 3 5 ctggtgtgacttgtatcactgct 3
Per3 5 tggccacagcatcagtaca 3 5 tacactgctggcactgcttc 3
Ck1e 5 gcctctatcaacacccacct 3 5 ggagcccaggttgaagtaca 3
Nr1d1 5 ctactggctccctcacccagga 3 5 gacactcggctgctgtcttcca 3
Slc9a3 5 catttgtccctttccgaattg 3 5 ccaaatggcagctccaaatag 3
Slc12a3 5 tgatccgatgcatgctcaa 3 5 cgcctgcgccgtaatc 3
Slc12a1 5 acaggaggacccatgacaaga 3 5 gcagcagatacagaggccacta 3
Atp1a1 5 ggctgtcatcttcctcattgg 3 5 cggtggccagcaaacc 3
Rn18s 5 gccgcggtaattccagctcca 3 5 cccgcccgctcccaagatc 3
Ren =renin, Atp6ap2 =prorenin receptor (PRR), Agt =angiotensinogen,
Ace =angiotensin converting enzyme, Ace2 =angiotensin converting enzyme,
Agtr1 =angiotensin II type 1 receptor, Agtr2 =angiotensin II type 2 receptor,
Mas1 =angiotensin (1–7) receptor MAS, Prkaa2 =protein kinase AMP-
activated catalytic subunit α2, Prkab2 =protein kinase AMP-activated cat-
alytic subunit β2, Prkag3 =protein kinase AMP-activated catalytic subunit γ3,
Ppargc1a =peroxisome proliferator-activated receptor gamma coactivator 1-
α,Bmal1 =brain and muscle aryl-hydrocarbon receptor nuclear translocator-
like 1, Cry1 =cryptochrome 1, Cry2 =cryptochrome 2, Per1 =period 1,
Per2 =period 2, Per3 =period 3, Ck1e =casein kinase 1 epsilon, Nr1d1 =nu-
clear receptor subfamily 1, group D member 1 (also known as Rev-Erb-α),
Slc9a3 =type 3 sodium hydrogen exchanger, Slc12a3 =Na+/Cl−cotrans-
porter, Slc12a1 =Na-K-2Cl cotransporter, Atp1a1 =Na+/K+ATPase α1 sub-
unit, Rn18s =18S ribosomal RNA (r18S).
Time PCR Detection System (Bio-Rad, Hercules, CA). We analyzed
several components of RAS in this study, including renin (Ren),
prorenin receptor (atp6ap2), angiotensinogen (Agt), angiotensin
converting enzyme-1 (Ace), angiotensin converting enzyme-2 (Ace2),
angiotensin II type 1 receptor (Agtr1a), angiotensin II type 2 recep-
tor (Agtr2), and angiotensin (1–7) receptor Mas1. Next, expression
of four sodium transporters, namely, type 3 sodium hydrogen ex-
changer (Slc9a3), Na+/Cl−cotransporter (Slc12a3), Na-K-2Cl co-
transporter (Slc12a1), and Na+/K+-ATPase α1 subunit (Atp1a1),
was analyzed. Moreover, several core clock genes were studied, in-
cluding Clock and Bmal1 of the positive limb; and Cry1,Cry2,Per1,
Per2, and Per3 of the negative limb. In addition to these, other clock-
controlled genes, such as casein kinase 1 epsilon (Ck1e) and nuclear
receptor subfamily 1, group D member 1 (Nr1d1) were analyzed.
In the nutrient-sensing signal, we analyzed AMP-activated protein
kinase (AMPK) pathway, including protein kinase AMP-activated
catalytic subunit α2(Prkaa2), β2(Prkab2), and γ3(Prkag3), and
their downstream signal peroxisome proliferator-activated receptor
gamma coactivator 1-α(Ppargc1a). The 18S rRNA gene (Rn18s)
was used as a reference. All samples were run in duplicate. Primer
sequences are provided in Table 1. To quantify the relative gene
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
Melatonin prevents light-induced hypertension, 2017, Vol. 97, No. 4 639
Figure 1. Male offspring blood pressure. Effect of maternal exposure to con-
tinuous light, agomelatine, and melatonin on systolic blood pressure in male
offspring from 3 to 12 weeks of age. Data are shown as mean ±SEM. N=10/3
(pups/litter) per group. The asterisk indicates P<0.05 vs control; the pound
sign indicates P<0.05 vs maternal exposure to continuous light. A, agome-
latine; M, melatonin.
expression, the comparative threshold cycle (CT) method was em-
ployed. For each sample, the average CTvalue was subtracted from
the corresponding average Rn18s value, calculating the CT.CT
was calculated by subtracting the average control CTvalue from
the average experimental CT. The fold-increase of the experimen-
tal sample relative to the control was calculated using the formula
2−CT.
Western blot
Western blot analysis was performed as described previously [23].
Three melatonin receptors, including melatonin receptor-1 (MT1)
and -2 (MT2) and retinoid-related orphan receptor-α(RORα),
were analyzed. We used the following antibodies: a goat anti-rat
MT1 antibody (1:1000, overnight incubation; Santa Cruz Biotech-
nology, Santa Cruz, CA; SC13186); a rabbit anti-rat MT2 anti-
body (1:1000, overnight incubation; Biorbyt, AllBio Science Inc.,
Taichung, Taiwan; ORB11086); and a rabbit anti-rat RORαan-
tibody (1:2000, overnight incubation; Proteintech Group, Inc.,
Chicago, IL; 10616–1-AP). Bands of interest were visualized using
ECL reagents (PerkinElmer, Waltham, MA) and quantified by den-
sitometry (Quantity One Analysis software; Bio-Rad) as integrated
optical density (IOD) after subtraction of background. The IOD
was factored for Ponceau red staining to correct for any variations
in total protein loading. The protein abundance was represented as
IOD/PonS.
Statistical analysis
Data are given as mean ±SEM. For most parameters, statistical
analysis was done using one-way ANOVA with Tukey post hoc
test for multiple comparisons. Blood pressure was analyzed by two-
way repeated-measures ANOVA and Tukey post hoc test. A P-value
of 0.05 was considered statistically significant. All analyses were
performed using the Statistical Package for the Social Sciences soft-
ware (SPSS, Chicago, IL).
Results
Litter sizes were not significantly altered by maternal exposure to
continuous light, agomelatine, and melatonin therapy (pups per lit-
ter: control =11.4 ±0.4; light group =11.4 ±1.1; light +A
group =11 ±0.6; light +M group =11 ±0.8). Body weight (BW)
and kidney weight were lower in the offspring exposed to continuous
light than controls. However, mortality rates and kidney weight-to-
BW ratio did not differ among the four groups. As shown in Figure 1,
systolic BP was comparable in the four groups before 6 weeks of age.
The systolic BP of the light group was significantly greater than that
of the control from 8 to 12 weeks of age, which was prevented by
maternal agomelatine or melatonin therapy. A significant reduction
in systolic BP, diastolic BP, and mean arterial pressure was measured
in the light +A and light +M groups versus the light group at 12
weeks of age (Table 2).
Next, we examined a number of mechanisms which might be
involved in the continuous light-induced programmed hypertension
and protective effects of melatonin and agomelatine based on pub-
lished data. First, we looked at the melatonin synthesis and its recep-
tors. We found that protein levels of MT1, MT2, and RORα,and
renal melatonin level did not differ at 12 weeks of age among the
four groups (Figure 2). These observations suggest that continuous
light exposure did not affect melatonin pathway in adult offspring
kidney.
We and others previously demonstrated that an early shift in
the ADMA-mediated NO-reactive oxygen species balance toward
increased oxidative stress leads to programmed hypertension in
later life [29–31]. However, maternal continuous light exposure,
Ta b l e 2 . Summary of weight and blood pressure.
Control LightaLight +AbLight +Mc
Mortality 0%0%0%0%
Body weight (BW), gd528 ±8 406 ±8e487 ±11 457 ±22
Left kidney weight, gd2.05 ±0.09 1.63 ±0.03e1.83 ±0.06 1.81 ±0.04
Left kidney weight/100g BWd0.39 ±0.01 0.40 ±0.005 0.38 ±0.01 0.40 ±0.01
Systolic blood pressure, mm Hgd134 ±3 158 ±3e142 ±3f140 ±5f
Diastolic blood pressure, mm Hgd86 ±497±3e78 ±3f83 ±2f
Mean arterial pressure, mm Hgd102 ±3 117 ±2e99 ±2f102 ±3f
aMother rats exposed to continuous light.
bMother rats exposed to continuous light plus agomelatine therapy.
cMother rats exposed to continuous light plus melatonin therapy.
dData are shown as mean ±SEM; n =10/group.
eP<0.05 vs control.
fP<0.05 versus light.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
640 Y.-L. Tain et al., 2017, Vol. 97, No. 4
Figure 2. Protein expression of melatonin receptors.(A) Representative western blots show melatonin receptor-1 (37 kDa), and -2 (40 kDa), and retinoid-related
orphan receptor-α(59 kDa) bands in offspring kidneys with maternal exposure to continuous light and/or treated with agomelatine or melatonin at 12 weeks
of age. Relative abundance of renal (B),melatonin receptor-1, (C) melatonin receptor-2, and (D) retinoid-related orphan receptor-αwere quantified. (E) Effect
of maternal exposure to continuous light and/or treated with agomelatine or melatonin on renal melatonin level. Data are shown as mean ±SEM. N=10/3
(pups/litter) per group. MT1R, melatonin receptor-1; MT2R, melatonin receptor-2, RORα, retinoid-related orphan receptor-α; A, agomelatine; M, melatonin.
Ta b l e 3 . Plasma levels of amino acids involved in nitric oxide pathway.
Control LightaLight +AbLight +Mc
L-Citrulline, μMd41.1 ±7.1 57.2 ±3.6 43.4 ±1.8 51.5 ±2.8
L-Arginine, μMd146 ±7 193 ±19 165 ±9 187 ±16
Asymmetric dimethylarginine, μMd1.61 ±0.29 1.72 ±0.03 1.64 ±0.09 1.80 ±0.04
Symmetric dimethylarginine, μMd0.81 ±0.08 1.01 ±0.03 0.82 ±0.09 0.94 ±0.04
L-Arginine-to- asymmetric
dimethylarginine ratio, μM/μMd
115 ±30 111 ±10 110 ±17 106 ±9
aMother rats exposed to continuous light.
bMother rats exposed to continuous light plus agomelatine therapy.
cMother rats exposed to continuous light plus melatonin therapy.
dData are shown as mean ±SEM; n =10/group.
agomelatine, and melatonin therapy had no effect on plasma levels
of L-citrulline, L-arginine, ADMA, and SDMA (Table 3). Therefore,
alterations in L-arginine-ADMA-NO pathway might not be a ma-
jor factor contributing to the programming of hypertension in this
model.
Also, activation of RAS and sodium transporters are important
mechanisms involved in programmed hypertension [4–7]. We then
performed qPCR to further validate the transcripts that are related
to these two pathways. Renal mRNA expression of renin, Atp6ap2,
Agt, Ace, Ace2,andAgtr1 was significantly increased in offspring ex-
posed to continuous light. Maternal agomelatine therapy decreased
Ace and Ace2 expression but increased Agtr2 and Mas1.Maternal
melatonin therapy just reduced Ace expression. (Figure 3A). As for
sodium transporters, continuous light exposure upregulated Slc9a3,
Slc12a3,andAtp1a1 expression in the kidney, which maternal mela-
tonin therapy prevented (Figure 3B).
Given that light and melatonin controls circadian clock and that
renal circadian rhythm related to hypertension, we next analyzed
core clock genes and clock-controlled genes in the offspring kidney
(Figure 3C). We found that renal mRNA expression of Clock, Bmal1,
Cry2, Per1, Per2,andCk1e was higher in the light group compared
to the control. Maternal agomelatine therapy downregulated mRNA
expression of the positive element Baml,andPer1, Per2, and Per3
of the negative limb. Melatonin therapy significantly downregulated
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
Melatonin prevents light-induced hypertension, 2017, Vol. 97, No. 4 641
Figure 3. Gene expression in the renin–angiotensin system, sodium transporters, Clock controlled genes, and AMP-activated protein kinase pathway. Effect of
maternal exposure to continuous light, agomelatine, and melatonin on gene expression of (A) renin–angiotensin system components, (B) sodium transporters,
(C) Clock controlled genes, and (D) AMP-activated protein kinase pathway in offspring kidneys with maternal exposure to continuous light and/or treated with
agomelatine or melatonin at 12 weeks of age. Data are shown as mean ±SEM. N=10/3 (pups/litter) per group. The asterisk indicates P<0.05 vs control;
the pound sign indicates P<0.05 vs maternal exposure to continuous light; the dollar sign indicates P<0.05 vs maternal exposure to continuous light plus
agomelatine treatment. A, agomelatine; M, melatonin.
mRNA expression of the positive element Clock and Baml,Cry1 of
the negative limb, and clock-controlled gene Ck1e.
Finally, mindful of the fact that nutrient-sensing pathway, like
AMPK pathway, is considered a common mechanism underlying
programmed hypertension [32], we thus examined mRNA expres-
sion of Prkaa2,Prkab2,Prkag3,andPpargc1a. Our data showed
that continuous light exposure significantly increased the renal
mRNA expression of all four of them compared with those in con-
trols, while maternal agomelatine therapy decreased Prkaa2 and
Ppargc1a expression.
Discussion
Our study provides new insight into the mechanisms by which
early agomelatine or melatonin therapy provides a long-term protec-
tion on maternal exposure to continuous light-induced programmed
hypertension in adult male offspring. The major findings can be
summarized as follows: (1) exposure of the mother to continuous
light-induced programmed hypertension in adult offspring, which
maternal agomelatine or melatonin therapy prevented; (2) contin-
uous light exposure did not affect melatonin pathway in adult off-
spring kidney; (3) genes that belong to the RAS, sodium transporters,
AMPK pathway, and circadian rhythm were potentially involved in
the continuous light exposure-induced programmed hypertension;
(4) in continuous light exposure-induced programmed hypertension,
the components of RAS, sodium transporters, and AMPK pathway
were differentially regulated by agomelatine and melatonin therapy,
to reprogram the development of hypertension.
Despite the hypertensive effects of continuous light exposure in
adult rats [33,34], limited data are available regarding dams exposed
to continuous light causing elevation of BP in their adult offspring.
On the other hand, whether melatonin receptor agonists can pre-
vent hypertension caused by disrupted circadian rhythm remains
unclear [35], even with the reported BP lowering effects of mela-
tonin [11,17–23]. To the best of our knowledge, this study is the
first to show that maternal melatonin and agomelatine therapy can
prevent programmed hypertension of adult offspring whose mother
was exposed to continuous light. In adult rats, hypertension can be
induced over 2 weeks continuous light exposure [33]. Nevertheless,
this study showed that programmed hypertension develops in the
offspring exposed to continuous light as long as 8 weeks after birth.
These data suggest that mechanisms involved in the developmental
programming of hypertension might be different between these two
models.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
642 Y.-L. Tain et al., 2017, Vol. 97, No. 4
Continuous light exposure has been considered as an experimen-
tal model of melatonin-deficient hypertension [10]. Previous studies
showed that exposure of pregnant rats to continuous light suppressed
plasma melatonin circadian rhythm in the mother, fetal, and adult
offspring [10,36,37]. We observed that melatonin level and mela-
tonin receptor expression were not altered in the offspring kidney
at 12 weeks of age. Our findings implicate that the renal program-
ming is not specific to a single factor (i.e. melatonin pathway), and
therefore other mechanisms of programmed hypertension deserves
further clarification.
So far, some particular mechanisms contributing to programmed
hypertension have been studies in the kidney [5–8,29,38], such as
oxidative stress, alterations of RAS and sodium transporters, and
nutrient-sensing signal. Although a previous report showing that
continuous light-induced hypertension is related to oxidative stress
[35], our data implicated that ADMA-NO pathway might not be a
major underlying mechanism. In addition, activation of RAS in the
kidney has been considered as a key mechanism for the development
of hypertension [39]. This concept is supported by our data showing
that continuous light exposure-induced programmed hypertension
is associated with the increases of renal mRNA expression levels of
renin, Atp6ap2, Agt, Ace, and Agtr1, which promote vasoconstric-
tion in favor of developing hypertension. Our findings are consistent
with previous studies demonstrating that ACE inhibitor is protective
against continuous light exposure-induced hypertension [33,34]. In
contrast, maternal agomelatine therapy decreased Ace expression
but increased Agtr2 and Mas1. That is, agomelatine appears to acti-
vate the ACE2-Ang-(1–7)-Mas receptor axis opposes the actions of
the classical RAS axis, leading to BP-lowering effect. Next, early-life
insults can induce inappropriate sodium reabsorption that increase
the vulnerability to develop hypertension in later life [6,7]. Though
it is well known that circadian clock controls renal sodium han-
dling [14], very few studies have investigated sodium transporters
in response to continuous light exposure. Our study is the first to
show that continuous light exposure increased renal mRNA expres-
sion levels of Slc9a3,Slc12a3,andAtp1a1, which can be prevented
by maternal melatonin therapy. These findings suggest that agome-
latine and melatonin deprogram the RAS and sodium transporters
differentially, to prevent programmed hypertension.
Emerging evidence suggested that a number of clock genes in the
kidney play an integral role in the development of hypertension, such
as Baml, Ck1e, Cry1, Per1, and Per2 [13,14,40]. We observed that
continuous light exposure induced renal mRNA of Clock, Bmal1,
Cry2, Per1, Per2,andCk1e. The increases of Baml,andPer1, Per2,
and Per3 expression can be prevented by agomelatine therapy. Un-
like agomelatine, melatonin therapy reduced Clock,Baml,Cry1,and
Ck1e. It is possible that the protective effects of melatonin on hyper-
tension caused by disrupted circadian rhythm are coming, at least in
part, from receptor-independent actions.
Our study has a few limitations. First, we did not examine other
organs are responsible for BP regulation. The protective effects of
agomelatine or melatonin therapy may be derived from other or-
gans, such as the brain, heart, and vasculature. Despite we normal-
ized the litter sizes, each pup might not receive identical maternal
care, milk composition, and milk consumption. Since birth weight
and growth rate were not recorded in this study, the implications
of intra-uterine growth retardation and catch-up growth on contin-
uous light-induced programmed hypertension deserve further clar-
ification. Next, we did not conduct the control +melatonin and
control +agomelatine groups. Thus, the long-term programmed
effects of melatonin or agomelatine on normal controls deserve fur-
ther evaluation. Another limitation is that clock genes expression
was measured only at one point, it is not possible to infer whether
the differences among the experimental groups are due to differ-
ences in gene expression degree or to a phase shift. Finally, we did
not examine other dosing and routes of administration, and test
other melatonin receptor agonists, whether these changes elicit same
reprogramming effects on continuous light exposure-induced hyper-
tension deserve further evaluation.
In conclusion, early agomelatine or melatonin therapy provides
protection against maternal exposure to continuous light-induced
programmed hypertension. Maternal agomelatine and melatonin
therapy reprogram the RAS and sodium transporters differentially to
prevent maternal exposure to continuous light-induced programmed
hypertension. By providing new information of candidate pathways
on BP regulation whose effects can be modified by agomelatine
or melatonin, our results are of significance to the development
of novel interventions in the prevention of programmed hyperten-
sion in children exposed to maternal night shift work and circadian
disruption.
Supplementary data
Supplementary data are available at BIOLRE online.
Supplemental Table 1. Antibodies used for Western blotting.
References
1. Reutrakul S, Knutson KL. Consequences of circadian disruption on car-
diometabolic health. Sleep Med Clin 2015; 10:455–468.
2. Bonzini M, Coggon D, Palmer KT. Risk of prematurity, low birthweight
and pre-eclampsia in relation to working hours and physical activities: a
systematic review. Occup Environ Med 2007; 64:228–243.
3. Hanson M. The birth and future health of DOHaD. J Dev Orig Health
Dis 2015; 6:434–437.
4. Luyckx VA, Brenner BM. The clinical importance of nephron mass. JAm
Soc Nephrol 2010; 21:898–910.
5. Luyckx VA, Bertram JF, Brenner BM, Fall C, Hoy WE, Ozanne SE, Vikse
BE. Effect of fetal and child health on kidney development and long-term
risk of hypertension and kidney disease. Lancet 2013; 382:273–283.
6. Kett MM, Denton KM. Renal programming: cause for concern? Am J
Physiol Regul Integr Comp Physiol 2011; 300:R791–R803.
7. Paix˜
ao AD, Alexander BT. How the kidney is impacted by the perinatal
maternal environment to develop hypertension. Biol Reprod 2013; 89:1–
10.
8. Tain YL, Joles J. Reprogramming: a preventive strategy in hypertension
focusing on the kidney. Int J Mol Sci 2015; 17:23.
9. Brown GM, Bar-Or A, Grossi D, Kashur S, Johannson E, Yie SM. Urinary
6-sulphatoxymelatonin, an index of pineal function in the rat. J Pineal Res
1991; 10:141–147.
10. Simko F, Reiter, RJ, Pechanova, O, Paulis, L. Experimental models of
melatonin-deficient hypertension. Front Biosci 2013; 18:616–625.
11. Reiter RJ, Tan DX, Korkmaz A. The circadian melatonin rhythm and its
modulation: possible impact on hypertension. J Hypertens Suppl 2009;
27:S17–S20.
12. Tain Y-L, Huang L-T, Chan JYH. Transcriptional regulation of pro-
grammed hypertension by melatonin: an epigenetic perspective. Int J Mol
Sci 2014; 15:18484–18495.
13. Gumz ML. Molecular origin of the kidney clock. Kidney Int 2014; 86:873–
874.
14. Bonny O, Vinciguerra M, Gumz ML, Mazzoccoli G. Molecular bases of
circadian rhythmicity in renal physiology and pathology. Nephrol Dial
Transpl 2013; 28:2421–2431.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
Melatonin prevents light-induced hypertension, 2017, Vol. 97, No. 4 643
15. Seron-Ferre M, Valenzuela GJ, Torres-Farfan C. Circadian clocks during
embryonic and fetal development. Birth Defects Res C Embryo Today
2007; 81:204–214.
16. Torres-Farfan C, Rocco V, Mons ´
o C, Valenzuela FJ, Campino C, Germain
A, Torrealba F, Valenzuela GJ, Seron-Ferre M. Maternal melatonin effects
on clock gene expression in a nonhuman primate fetus. Endocrinology
2006; 147:4618–4626.
17. Tain YL, Huang LT, Lin IC, Lau YT, Lin CY. Melatonin prevents hyper-
tension and increased asymmetric dimethylarginine in young spontaneous
hypertensive rats. J Pineal Res 2010; 49:390–398.
18. Wu TH, Kuo HC, Lin IC, Chien SJ, Huang LT, Tain YL. Melatonin
prevents neonatal dexamethasone induced programmed hypertension: hi-
stone deacetylase inhibition. J Steroid Biochem Mol Biol 2014; 144 (Pt
B):253–259.
19. Tain Y-L, Leu S, Wu KLH, Lee W, Chan JYH. Melatonin prevents ma-
ternal fructose intake-induced programmed hypertension in the offspring:
roles of nitric oxide and arachidonic acid metabolites. J Pineal Res 2014;
57:80–89.
20. Tain YL, Chen CC, Sheen JM, Yu HR, Tiao MM, Kuo HC, Huang LT.
Melatonin attenuates prenatal dexamethasone-induced blood pressure in-
crease in a rat model. J Am Soc Hypertens 2014; 8:216–226.
21. Tain Y-L, Huang L-T, Hsu C-N, Lee C-T. Melatonin therapy prevents
programmed hypertension and nitric oxide deficiency in offspring exposed
to maternal caloric restriction. Oxid Med Cell Longev 2014; 2014:1.
22. Tain YL, Lee CT, Chan JYH, Hsu CN. Maternal melatonin or N-
acetylcysteine therapy regulates hydrogen sulfide-generating pathway
and renal transcriptome to prevent prenatal NG-Nitro-L-arginine-methyl
ester (L-NAME)-induced fetal programming of hypertension in adult male
offspring. Am J Obstet Gynecol 2016; 215:636.e1.
23. Tain YL, Sheen JM, Yu HR, Chen CC, Tiao MM, Hsu CN, Lin YJ, Kuo
KC, Huang LT. Maternal melatonin therapy rescues prenatal dexametha-
sone and postnatal high-fat diet induced programmed hypertension in
male rat offspring. Front Physiol 2015; 6:377.
24. Sagrillo-Fagundes L, Soliman A, Vaillancourt C. Maternal and placental
melatonin: actions and implication for successful pregnancies. Minerva
Ginecol 2014; 66:251–266.
25. Chen YC, Sheen JM, Tiao MM, Tain YL, Huang LT. Roles of melatonin
in fetal programming in compromised pregnancies. Int J Mol Sci 2013;
14:5380–5401.
26. Liu J, Clough SJ, Hutchinson AJ, Adamah-Biassi EB, Popovska-Gorevski
M, Dubocovich ML. MT 1 and MT 2 melatonin receptors: a therapeutic
perspective. Annu Rev Pharmacol Toxicol 2016; 56:361–383.
27. Morley-Fletcher S, Mairesse J, Soumier A, Banasr M, Fagioli F, Gabriel
C, Mocaer E, Daszuta A, McEwen B, Nicoletti F, Maccari S. Chronic
agomelatine treatment corrects behavioral, cellular, and biochemical
abnormalities induced by prenatal stress in rats. Psychopharmacology
2011; 217:301–313.
28. Grigore D, Ojeda NB, Alexander BT. Sex differences in the fetal program-
ming of hypertension. Gend Med 2008; 5:S121–S132.
29. Tain YL, Hsu CN. Targeting on asymmetric dimethylarginine-related ni-
tric oxide-reactive oxygen species imbalance to reprogram the develop-
ment of hypertension. Int J Mol Sci 2016; 17:2020.
30. Wilcox CS. Oxidative stress and nitric oxide deficiency in the kidney: a
critical link to hypertension? Am J Physiol Regul Integr Comp Physiol
2005; 289:R913–R935.
31. Racasan S, Braam, B, Koomans, HA, Joles, JA. Programming blood pres-
sure in adult SHR by shifting perinatal balance of NO and reactive oxygen
species toward NO: the inverted Barker phenomenon. Am J Physiol Renal
Physiol 2005; 288:F626–F636.
32. Jansson T, Powell TL. Role of placental nutrient sensing in developmental
programming. Clin Obstet Gynecol 2013; 56:591–601.
33. Repov´
a-Bedn´
arov´
a K, Aziriov´
aS,Hren
´
ak J, Krajˇ
c´
ıroviˇ
cov´
a K, Adamcov´
a
M, Paulis L, Simko F. Effect of captopril and melatonin on fibrotic re-
building of the aorta in 24 hour light-induced hypertension. Physiol Res
2013; 62:S135–S141.
34. Simko F, Pechanova O, Repova Bednarova K, Krajcirovicova K, Celec
P, Kamodyova N, Zorad S, Kucharska J, Gvozdjakova A, Adamcova M,
Paulis L. Hypertension and cardiovascular remodelling in rats exposed
to continuous light: protection by ACE-inhibition and melatonin. Mediat
Inflamm 2014; 2014:1.
35. Kario K. Are melatonin and its receptor agonist specific antihyperten-
sive modulators of resistant hypertension caused by disrupted circadian
rhythm? J Am Soc Hypertens 2011; 5:354–358.
36. Mendez N, Abarzua-Catalan L, Vilches N, Galdames HA, Spichiger C,
Richter HG, Valenzuela GJ, Seron-Ferre M, Torres-Farfan C. Timed
maternal melatonin treatment reverses circadian disruption of the fetal
adrenal clock imposed by exposure to constant light. PLoS One 2012;
7:e42713.
37. Voiculescu SE, Le Duc D, Ros¸ca AE, Zeca V, Chit¸imus¸ DM, Arsene AL,
Dr˘
agoi CM, Nicolae AC, Z ˘
agrean L, Sch ¨
oneberg T, Z ˘
agrean A. Behavioral
and molecular effects of prenatal continuous light exposure in the adult
rat. Brain Res 2016; 1650:51–59.
38. Tain YL, Hsu CN, Chan JY. PPARs link early life nutritional insults to
later programmed hypertension and metabolic syndrome. Int J Mol Sci
2016; 17:20.
39. Te Riet L, Van Esch JHM, Roks AJM, Van Den Meiracker AH,
Danser AHJ. Hypertension: renin-angiotensin-aldosterone system alter-
ations. Circ Res 2015; 116:960–975.
40. Richards J, Diaz AN, Gumz ML. Clock genes in hypertension. Blood Press
Monit 2014; 19:249–254.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/97/4/636/4108097
by CHANG GUNG MEMORIAL HOSPITAL Kaoshiung Medical Lib user
on 16 November 2017
