Content uploaded by Ivan N. Marin
Author content
All content in this area was uploaded by Ivan N. Marin on Feb 18, 2020
Content may be subject to copyright.
576
Accepted by J. Goy: 19 Jun. 2017; published: 25 Aug. 2017
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN
1175-5334
(online edition)
Copyright © 2017 Magnolia Press
Zootaxa 4311 (4): 576
–
588
http://www.mapress.com/j/zt/
Article
https://doi.org/10.11646/zootaxa.4311.4.9
http://zoobank.org/urn:lsid:zoobank.org:pub:16BDFAAE-FEE0-4055-97A4-1438BE1F6D08
Troglocaris (Xiphocaridinella) kumistavi sp. nov., a new species of stygobiotic
atyid shrimp (Crustacea: Decapoda: Atyidae) from Kumistavi Cave, Imereti,
Western Georgia, Caucasus
IVAN MARIN
1,2
1
A. N. Severtzov Institute of Ecology and Evolution of RAS, Moscow, Russia.
1
Biological Department, Altai State University, Barnaul, Russia.
E-mail: coralliodecapoda@mail.ru, vanomarin@yahoo.com
Abstract
A new species of stygobiotic atyid shrimp genus Troglocaris (Xiphocaridinella) Dormitzer, 1853 from underground
stream and lakes of Kumistavi (Prometheus) Cave, Tskaltubo, Imereti region, Western Georgia is described based on mor-
phology and DNA analysis. Troglocaris (Xiphocaridinella) kumistavi sp. nov. clearly differs from all Caucasian conge-
ners by (1) long slender dorsally and ventrally armed rostrum with sting-like tip turned upward, (2) very slender fingers
of pereiopod II both in males and females and (3) distally expanded telson with 5–7 pairs of distal spines. These features
are rather unique within the known Caucasian Troglocaris (Xiphocaridinella) and show some morphological similarities
with Dinaric species of the genus. Neotype of Troglocaris (Xiphocaridinella) kutaissiana (Sadowsky, 1930) is also desig-
nated based on the material from Tskaltsitela Cave, Kutaisi, Georgia.
Key words: Crustacea, Decapoda, Atyidae, Troglocaris, Xiphocaridinella, stygobiotic, stygobiont, shrimps, new species,
Georgia, Caucasus
Introduction
The stygobiotic atyid shrimp genus Troglocaris Dormitzer, 1853 currently includes 5 valid Caucasian species
referring to the subgenus Xiphocaridinella Sadowsky, 1930 (according to WoRMS): Troglocaris
(Xiphocaridinella) kutaissiana (Sadowsky, 1930) (the type species of the subgenus), Troglocaris
(Xiphocaridinella) ablaskiri Birštein, 1939, Troglocaris (Xiphocaridinella) fagei Birštein, 1939, Troglocaris
(Xiphocaridinella) jusbaschjani Birštein, 1948, Troglocaris (Xiphocaridinella) osterloffi Juzbaš’jan, 1940.
Original descriptions of all species do not match modern standards of taxonomic descriptions and some problems
still remain in their taxonomy. Three species, T. jusbaschjani, T. fagei and T. kutaissiana, were currently re-
described based on topotypic material (Marin, 2013; Marin & Sokolova, 2014).
During the speleological survey along karst systems of Imereti region of Western Georgia in September 2016
and February 2017 numerous Troglocaris specimens were discovered in subterranean cave streams and lakes in
Kumistavi Cave (Prometheus Cave, Gliani Cave), Tskaltubo-Kumistavi (42°22'35.8"N 42°36'03.2"E). The only
known stygobiotic atyid shrimp from this region is Troglocaris (Xiphocaridinella) kutaissiana Sadowsky, 1930
found in a small stream flowing from Tskaltsitela Cave (42°16'19.62"N 42°44'1.63"E), situated in a valley of
Tskaltsitela River in Kutaisi (see Sadowsky, 1930; Marin & Sokolova, 2014). Careful DNA and morphological
examination of specimens from Kumistavi (Prometheus) Cave and their comparison with topotypic material of T.
kutaissiana from Tskaltsitela Cave (the type locality of the species) showed that they belong to distinctly
morphologically and genetically separated species described herewith as new to science. Furthermore, neotype of
Troglocaris (Xiphocaridinella) kutaissiana (Sadowsky, 1930) is also designated based on the material from
Tskaltsitela Cave (Kutaisi) as Sadowsky’s material is presently considered as lost and non-extant.
Zootaxa 4311 (4) © 2017 Magnolia Press
·
577
TROGLOCARIS (XIPHOCARID INELLA) KUMISTAVI
Material and methods
Shrimps were collected in subterranean cave streams and lakes in Kumistavi Cave (Prometheus Cave, Gliani
Cave), Tskaltubo-Kumistavi (42°22'35.8"N 42°36'03.2"E) by hand net. The study does not include endangered or
protected species. All collected specimens were preserved in 90% ethanol for further DNA analysis. Postorbital
carapace length (pcl., in mm), the length from posterior orbit to posterodorsal margin of carapace, and total body
length (tbl., in mm), dorsal length from the tip of rostrum till distal margin of telson, are used as standard
measurements. The type material is deposited in the collection of Zoological Museum of Moscow State University,
Moscow (ZMMU) and additional material - in the Laboratory of Ecology and Evolution of Marine Invertebrates
(LEMMI) of A.N. Severtzov Institute of Ecology and Evolution of Russian Academy of Sciences, Moscow,
Russia. Only primary synonyms are given in the paper.
To resolve the taxonomy of cryptic diversity a fragment of the mitochondrial gene coding for cytochrome c
oxidase subunit I gene (COI) was amplified, sequencing and compared. Total genomic DNA was extracted from
abdominal and pereiopod muscle tissue using the innuPREP DNA Micro Kit (AnalitikJena, Germany) following
the manufacturer’s protocol. The mitochondrial marker COI was amplified with the help of the universal primers
LCO1490 (5'–ggtcaacaaatcataaagatattgg–3') and HC02198 (5'–taaacttcagggtgaccaaaaaatca–3') (Folmer et al.
1994). PCR products were performed on amplificator T100 (Bio-Rad, USA) under the following conditions: initial
denaturation at 96°C for 1.5 min followed by 42 cycles of 95°C for 2 min, 49°C for 35 seconds, and 72°C for 1.5
min, followed by chain extension at 72°C for 7 min. The volume of 10 uL of reaction mixture contained 1 uL of
total DNA, 2 uL of 5x PCR mix (Dialat, Russia) and 1 uL of each primer. The amplification products were
separated by using gel electrophoresis of nucleic acids on a 1.5% agarose gel in 1xTBE, and then stained and
visualized with 0.003% EtBr using imaging UV software. DNA nucleotide sequences were determined using
Genetic Analizer ABI 3500 (Applied Biosystems, USA) and BigDye 3.1 (Applied Biosystems, USA) with direct
and reverse primers. Uniformity of obtained sequences was processed using the program BioEdit v. 5.0.9.
Uniformity of obtained sequences was processed using the program BioEdit v. 5.0.9. The resulting markers of COI
gene of mtDNA with 620+ nucleotide long sections were registered in GenBank (NCBI) and used for further
phylogenetic analysis. A dataset of COI gene of mtDNA of our specimens and sequences from GenBank (NCBI)
were assembled for phylogenetic analysis (see Table 1). The aligned sequences of COI gene, 658 base pairs in
length, were analyzed for divergence using the Kimura–2–parameter (K2P) distance model with MEGA 7.0. The
received nucleotide alignments of COI gene were used to construct the phylogenetic relations (tree) in MEGA 7.0
using k–nearest neighbor’s algorithm (k–NN, Neighbor–Joining method) and Maximum–Likelihood (ML)
algorithm. Pairwise sequence divergence (uncorrected p–distances) was calculated based on COI sequences using
MEGA 7.0.
Results
DNA analysis of Troglocaris. The intraspecific uncorrected pairwise genetic distances (p–distances) between
sequenced Troglocaris specimens from Kumistavi Cave (n = 9) and Troglocaris kutaissiana from Tskaltsitela Cave
(n = 6) vary from 0.055 to 0.061, with the mean distance (d)—0.057±0.010. The mean distance within population
of Trogloca ris from Kumistavi Cave (n = 9) is 0.002±0.001, while in population of Troglocaris kutaissiana (n = 6)
is 0.001±0.001. Such inter-population genetic split and low level of intra-population genetic variability reflect the
presence of two evolutionarily distinct lineages allopatrically separated in relatively recent past (e.g. Knowlton et
al., 1993; Knowlton & Weigt, 1998; Avise, 2000; Lushai et al., 2003; Zakšek et al., 2006).
Taxonomic part and species description
Order Decapoda Latreille, 1802
Family Atyidae De Haan, 1849
Genus Troglocaris Dormitzer, 1853
Subgenus Xiphocaridinella Sadowsky, 1930
MARIN
578
·
Zootaxa 4311 (4) © 2017 Magnolia Press
Troglocaris (Xiphocaridinella) kutaissiana (Sadowsky, 1930)
(Figs. 1, 2c, d)
Xiphocaridinella kutaissiana Sadowsky, 1930: 95 [type locality: Kutaisi, western Georgia].
Material examined. Neotype: 1 ovigerous, (pcl. 9.5 mm, tl. 27.0 mm), ZMMU Ma 5833, MF287657, Western
Georgia, Kutaisi near Godogni bridge, 42°16'19.62"N 42°44'1.63"E, southern part of Tskaltsitela River valley
(Tskaltsitela Canyon), in small subterranean stream flowing from Tskaltsitela Cave, about 135 meters above sea
level, coll. A. Sokolova & D. Palatov, 12 Sept. 2016; 5 non-ovigerous females, 7 males, (LEMMI), same locality
and date as neotype.
Body size. The largest collected female has tbl. 9.7 mm, pcl. 27.0 mm; the largest collected male has tbl. 7.0
mm, pcl. 22.0 mm.
Distribution. The species is known from Tskaltsitela Cave (42°16'19.62"N 42°44'1.63"E), Kutaisi, Western
Georgia, Caucasus suggested as type locality for neotype. The type locality of the species within Kutaisi (according
to Sadowsky, 1930) remains unknown and probably presented by an underground stream discovered during the
construction (see Sadowsky, 1930) and lately covered with the rock again; inaccessible at the moment.
GenBank accession numbers. MF287657, MF287655, MF287656.
Troglocaris (Xiphocaridinella) kumistavi sp. nov.
(Figs. 2a, b, 3–7)
Material examined. Holotype: non-ovigerous female (pcl. 7.0 mm, tl. 22.0 mm), ZMMU Ma 5834, MF287654,
Caucasus, Western Georgia, Imereti region, Tskaltubo-Kumistavi, 42°22'35.8"N 42°36'03.2"E, Kumistavi Cave, in
subterranean stream, about 100 meters above the sea level, coll. A. Sokolova & D. Palatov, 15 Sept. 2016. 4 non-
ovigerous females, 2 males (LEMMI), same locality and date as holotype; 5 ovigerous females, 2 males, same
locality as holotype, February 2017.
Description. Medium-sized shrimp with swollen, smooth, subcylindrical body. Carapace swollen, smooth,
with small dorsal carina in frontal part. Rostrum (Figs. 2a, b, 3, 4) relatively long, slender, curved upward, reaching
the midlength of second antennular segment, sometimes almost reaching its distal margin (Fig. 3e, f), sharply
pointed distally, with tip turned upward, broad proximally, with developed lateral lamina; rostrum armature and
length greatly vary (Figs. 2a, b, 3, 4), usually rostrum armed with relatively long slender dorsal spines (up to 11)
and 1 or 2 distal ventral teeth. Rostral formula of the species—0–4+0–11/0–2. The rostrum of some specimens (Fig.
2a) seems to be the longest among all known species of the Caucasian representatives of the genus Troglocaris
(Xiphocaridinella) (Birštein, 1939; Juzbaš’jan, 1940; Marin & Sokolova, 2014).
Abdominal somites smooth, unarmed; tergites non-carinate, without dorsal lobes, not posteriorly produced;
pleura of pleomeres I–IV posteroventrally and ventrally rounded; pleomere V small, with feebly developed pleura;
distal and distoventral margins of pleomere VI sharply produced posterodorsally. Telson (Fig. 5d, e) relatively
slender, smooth, about 3.5 times as long as wide proximally, expanded distally, with 2 pairs of slender dorsal
spines, each about 0.08 of telson length, inserted at about 0.35 and 0.6 telson length respectively; distal margin
convex, with 5–7 pairs of distal spines, including a pair of short lateral spines, a pair of long intermediate spines
and 3–5 pairs of slender medial dorso-marginal spines.
Eyes (Figs. 2, 3) small, partly reduced, swollen, subcylindrical, mostly covered by carapace; cornea rounded,
reduced and feebly marked, without pigment; eyestalk stout, swollen, cylindrical, about as long as wide.
Antennula (Fig. 5b) with stout unarmed articles, basal peduncular segment robust, about twice longer than
proximal width, without ventromedial tooth, distolateral angle with broadly produced sharp projection (Fig. 5c);
stylocerite stout, sharpening distally, overreaching the midlength of basal segment; second and third segments
stout, unarmed; second segment about 1.5–2 times as long as wide and about 1.5–2 times as long as distal segment;
distal segment about as long as wide.
Zootaxa 4311 (4) © 2017 Magnolia Press
·
579
TROGLOCARIS (XIPHOCARID INELLA) KUMISTAVI
FIGURE 1. Troglocaris (Xiphocaridinella) kutaissiana Sadowsky, 1930 from Tskaltsitela Cave, Kutaisi, Western Georgia,
non-ovigerous females: a—front of carapace, dorsal view; b, c—front of carapace and rostrum, lateral view; d—telson; e—
pereiopod I; f—pereiopod II.
MARIN
580
·
Zootaxa 4311 (4) © 2017 Magnolia Press
FIGURE 2. Front of carapace and rostrum of Troglocaris (Xiphocaridinella) kumistavi sp. nov., Kumistavi Cave, Tskaltubo
(a—holotype female, b—paratype male) and Troglocaris (Xiphocaridinella) kutaissiana Sadowsky, 1930 from Tskaltsitela
Cave, Kutaisi (a—neotype female, b—male)
Antenna with basicerite stout, about 1.5 times as wide as long, with distolateral margin unarmed; carpocerite
robust, about 1.5 times as long as wide, not reaching midlength of scaphocerite; scaphocerite well developed,
broad, with small but well marked distolateral tooth, lamella bluntly rounded distally.
Mouth parts characteristic for the genus. Maxilliped III (Fig. 6l) with slender segments; epipodite stout, bluntly
rounded; arthrobranch reduced, but present; exopodite slender, reaching the distal margin of antepenultimate
segment; antepenultimate segment slender, about 8 times as long as wide; penultimate segment about 7–8 times as
long as wide, with straight lateral margins; ultimate (distal) segment slender, equal to penultimate segment, about 7
times as long as wide, tapering distally, with tufts of short simple stick-like setae along ventral and lateral margins,
with several tufts of long setae dorsally.
Pereiopods I equal in size and similar in shape, and similar in males (Fig. 6a) and females (Fig. 6e), with
smooth unarmed segments; coxa with well-developed slender epipodite and tuft of setobranchs; basis about as long
as wide, with well-developed exopodite overreaching carpo-meral articulation; ischium about 3.5–4 times longer
than wide, with straight margins; merus slender, about 3 times as long as wide, equal to ischium, with straight
margins; carpus relatively stout in males and slightly more slender in females, significantly widening distally,
slightly longer than merus, about as 1.5 times as long as maximal width; palm relatively stout, about as long as
wide, subcylindrical in cross-section, smooth; fingers relatively slender, subcylindrical, smooth, with blunt distal
margins, about 4 times as long as proximal width, armed with a row of stout strong plumose setae.
Zootaxa 4311 (4) © 2017 Magnolia Press
·
581
TROGLOCARIS (XIPHOCARID INELLA) KUMISTAVI
FIGURE 3. Front of carapace and rostrum of Troglocaris (Xiphocaridinella) kumistavi sp. nov., Kumistavi Cave, Tskaltubo,
Western Georgia, female (a, c, e, f), male (b, d, g).
MARIN
582
·
Zootaxa 4311 (4) © 2017 Magnolia Press
FIGURE 4. Front of carapace and rostrum of Troglocaris (Xiphocaridinella) kumistavi sp. nov., Kumistavi Cave, Tskaltubo,
Western Georgia, female (a, c, e, f), male (b, d).
Zootaxa 4311 (4) © 2017 Magnolia Press
·
583
TROGLOCARIS (XIPHOCARID INELLA) KUMISTAVI
FIGURE 5. Troglocaris (Xiphocaridinella) kumistavi sp. nov., Kumistavi Cave, Tskaltubo, Western Georgia, female (a–d),
male (e–j): a—front of carapace; b—antennula; c—same, distolateral margin of segment II; d, e—telson; f—same, distal margin;
g—pleopod I; h—same, appendix interna; i—pleopod II; j—same, appendix masculina.
MARIN
584
·
Zootaxa 4311 (4) © 2017 Magnolia Press
FIGURE 6. Troglocaris (Xiphocaridinella) kumistavi sp. nov., Kumistavi Cave, Tskaltubo, Western Georgia, male (a–d),
female (e–l): a, e—pereiopod I; b, f—pereiopod II; c, g—pereiopod III; d, h—dactylus of pereiopod III, i—pereiopod IV; j—
pereiopod V; k—dactylus of pereiopod V; l—maxilliped III.
Zootaxa 4311 (4) © 2017 Magnolia Press
·
585
TROGLOCARIS (XIPHOCARID INELLA) KUMISTAVI
FIGURE 7. Live coloration of Troglocaris (Xiphocaridinella) kumistavi sp. nov., Kumistavi Cave, Tskaltubo, Western
Georgia.
Pereiopods II (Fig. 6b, f) equal in size and similar in shape, similar to pereiopod I and similar in males and
females, with relatively stouter basal smooth unarmed segments; coxa with well-developed slender epipodite and
tuft of setobranchs; basis about as long as wide, with well-developed exopodite overreaching carpo-meral
articulation; ischium about 3 times as long as wide, with straight margins, unarmed; merus slender, about 3 times as
long as wide, usually equal to ischium or lightly longer, with straight margins; carpus slender, about 8 times as long
as wide, slightly widening distally, longer than merus; palm relatively stout, similar to palm of pereiopod I, about
as long as wide, subcylindrical in cross-section, smooth; fingers relatively slender, subcylindrical, smooth tapering
distally, about 4.5–5 times as long as proximal width, with simple and straight cutting edges, with broad blunt distal
margin, armed with a row of stout strong plumose setae.
Pereiopod III in females (Fig. 6g) with articles; coxa rectangular, about as long as wide, with tuft of
setobranchs, with small epipodite; basis about as long as wide, with well-marked exopodite almost reaching the
midlength of merus; ischium about 1.5 times as long as wide, with well-marked distoventral spine; merus about 6
times as long as wide, with straight margins, with 3 well marked spines along ventral margin; carpus relatively
slender, about 6 times as long as wide, slightly widening distally, about twice shorter than merus and slightly longer
than half of the length of propodus, with bluntly projecting distodorsal margin overlapping carpo-propodal
articulation and small subdistal spine; propodus about 10 times as long as wide, with straight margins, armed with
7–8 spines along proximal half of ventral margin (Fig. 6h); dactylus (Fig. 6h) about 3 times longer than wide,
MARIN
586
·
Zootaxa 4311 (4) © 2017 Magnolia Press
biunguiculate, ventral margin armed with 6–7 small spines, main unguis smooth, curved and sharp; accessory
unguis triangular, sharp, slightly larger than ventral teeth, about twice shorter than main unguis. Pereiopod IV in
females (Fig. 6i) generally similar to pereiopod III; merus armed with 3 spines, carpus armed with single spine;
exopodite smaller than in pereiopod III. Pereiopod V in females (Fig. 6j) generally similar to pereiopods III and IV,
but without armature on basal segments and exopodite on basis; segments covered with simple setae dorsally and
ventrally; propodus about 7–8 times as long as wide, with straight margins, armed with 8–10 long spines along
ventral margin and pair of long slender spines at distoventral angle; dactylus (Fig. 6k) with ventral margin armed
with a dense “brush” consisting of small simple sharp setae; without accessory unguis, main unguis curved,
triangular, sharp distally.
Morphological differences between males and females lead in the structure of distal part of propodi and dactyli
of pereiopods III and IV (Figs. 6c, d, g, h). Pereiopod III in males (Fig. 6c) with relatively slender segments; coxa
rectangular, about as long as wide, with tuft of setobranchs, with epipodite; basis about as long as wide, with well-
marked exopodite almost reaching the midlength of merus; ischium about 1.5 times as long as wide, with well-
marked distoventral spine; merus about 7 times as long as wide, with straight margins, with 3 well marked spines
along ventral margin; carpus relatively slender, about 6 times as long as wide, slightly widening distally, about
twice shorter than merus and 1.5 times shorter than propodus, with bluntly projecting distodorsal margin slightly
overlapping carpo-propodal articulation, with a single subdistal spine; propodus about 8 times as long as wide, with
straight margins, distal third of propodus widening and armed with a series of small spines along its ventral margin;
dactylus (Fig. 4d) about 4 times as long as wide, with single unguis, ventral margin armed with small relatively
stout sharp teeth, main unguis smooth, curved and sharp.
Pleopod I in males (Fig. 5g) with endopod bearing well marked appendix interna (Fig. 5h). Pleopod II in males
(Fig. 5g) with well-developed appendix interna and appendix masculina (Fig. 5j); appendix masculina covered
with numerous small sharp stout simple spines (Fig. 5j). Pleopods I and II in females normal, characteristic for the
genus without specific differentiating features.
Uropods relatively stout, slightly exceeding telson; lateral margin of uropodal exopodite straight, with sharp
triangular distolateral angle and large curved distolateral spine; dieresis simple, without spines.
Coloration. Body and appendages of shrimps are transparent whitish; cornea of eyes albescent; internal organs
(gonads and hepatopancreas) are whitish or yellowish; numerous small transparent fat granules can be seen through
carapace (Fig. 7).
Body size. The largest collected female has tbl. 8.0 mm, pcl. 24.0 mm; the largest collected male has tbl. 6.0
mm, pcl. 20.0 mm.
Distribution. The species is known from the type locality, underground stream and lakes inside Kumistavi
(Prometheus) Cave (42°22'35.8"N 42°36'03.2"E), Tskaltubo-Kumistavi, Imereti region, Western Georgia,
Caucasus.
GenBank accession numbers. MF287654, MF287652, MF287653.
Etymology. The species is named after the Kumistavi Cave where it was found. Kumistavi Cave, also known
as the Cave of Prometheus, was discovered in Imereti region in 1984, and now is considered as the biggest karst
cave in Georgia. Kumistavi owes a famous Caucasian myth about Caucasian ethnic hero Amirani for the sonorous
naming of the "Cave of Prometheus". The legend says that “Amirani, like Prometheus, angered the gods and was
punished. Days and nights eagle tormented him eating his liver; however, in contrast to the Greek giant, cruel gods
chained Amirani not to the rock, but somewhere inside a huge cave (presumably, in Kumistavi)”.
Ecological remarks. The specimens of Troglocaris (Xiphocaridinella) kumistavi sp. nov. were collected both
in subterranean stream and small lakes inside Kumistavi Cave. Several ovigerous females with 10–15 large eggs as
well as relatively numerous post-juveniles were found in February in tiny lake inside the cave, representing the first
described locality in Georgia where Caucasian Troglocaris shrimps were found breeding (“breeding pool”).
Previously, only non-ovigerous females and males of Troglocaris shrimps were found in Caucasian underground
lakes and cave streams; probably they were washed out there from their underground “breeding pools” by flood
water (Marin & Sokolova, 2012).
Zootaxa 4311 (4) © 2017 Magnolia Press
·
587
TROGLOCARIS (XIPHOCARID INELLA) KUMISTAVI
Discussion
Troglocaris (Xiphocaridinella) kumistavi sp. nov. morphologically differs from Caucasian congeners by relatively
long and slender rostrum with tip turned upward, very slender fingers (about 4 times longer than wide) of
pereiopods II both in males and females, and distally expanded telson with 5–7 pairs of distal spines. At the same
time, all described morphological features greatly vary even in specimens collected in the same subterranean lake.
However, these features (and their variations) are rather unique within the known Caucasian species of the
subgenus Trogl oc aris (Xiphocaridinella) and show some morphological similarities with Dinaric species of the
genus (e.g. Sket & Zakšek, 2009; Jugovic et al., 2010, 2011, 2012; Christodoulou et al., 2016). The most
remarkable feature of the new species is long and slender dorsally and ventrally armed rostrum developed unusual
for Caucasian species of the genus Troglocaris (Xiphocaridinella). Previously, it was shown that the length of
rostrum and its armature can be greatly vary within species and populations of Troglocaris s. str. (see Zakšek et al.,
2007; Jugovic et al, 2010, 2011, 2012; Marin & Sokolova, 2014), possibly affecting by predators such as cave
salamander Proteus anguinus Laurenti, 1768 (Amphibia: Caudata: Proteidae) (Jugovic et al., 2011). We may
suggest the presence of any stygobiotic predators in large karst cave basins of Imereti region, moreover, the
specimens of any goby (Neogobius sp.) were observed in subterranean stream inside deep part of Kumistavi Cave.
The most closely relative to the new species within Caucasian Troglocaris (Xiphocaridinella) is Troglocaris
(Xiphocaridinella) kutaissiana also known in Imereti region from a small subterranean stream flowing from
Tskaltsitela Cave (42°16'19.62"N 42°44'1.63"E) in Tskaltsitela River valley in Kutaisi (see Sadowsky, 1930),
situated about 20 km by straight line from Kumistavi Cave (42°16'19.62"N 42°44'1.63"E). The latter species is
characterized by similar long dorsally and ventrally armed rostrum overreaching distal margin of basal antennular
segment (Fig. 1c, d), previously the longest rostrum among Xiphocaridinella (Marin & Sokolova, 2012). However,
the new species can be distinguished from the latter one by (1) smaller size (maximum pcl. of larger collected
female of T. kutaissiana is about pcl. 9.5 mm, tbl. 27 mm vs. pcl. 8.0 mm and pcl. 24.0 mm in the largest collected
female of the new species); (2) more slender almost sting-like rostrum with tip usually turned upward (vs. stouter
rostrum with tip usually turned downward and possessing more developed lateral rostral carina in T. kutaissiana
(see Fig. 12 in Marin & Sokolova, 2012; Fig. 1a, b, 6a–c)); (3) both in males and females longer and slender
fingers of pereiopods I (Fig. 6a, e) (4 times as long as proximal width in the new species vs. about 2.5 times as long
as wide (Fig. 1e) and II (Fig. 6b, f) (4.5–5 times as long as proximal width in the new species vs. about 3 times as
long as wide in T. kutaissiana (Fig. 1f)) and (4) unique form of telson with expanded distal part armed with 5–7
pairs of distal spines (Fig. 5d, e) (vs. not distally expanded with usually 5 pairs in other described Caucasian
Trogloca ris (Xiphocaridinella) species, including T. kutaissiana (Fig. 1d, Marin & Sokolova, 2012)). Some minor
morphological features such as longer dorsal rostral spines, more slender carpus of pereiopod II, basal segments of
pereiopods I and II in Troglocaris (Xiphocaridinella) kumistavi sp. nov. as well as different position of dorsal
spine on telson will also help to separate these two related species in zoological collections.
Anyway, the genetic divergence (p–distances) of COI between Troglocaris (Xiphocaridinella) kumistavi sp.
nov. and Troglocaris (Xiphocaridinella) kutaissiana (about 5.7%) allow as separating them as two different
biological species, ranging them as “cryptic species” (d > 5%) (Knowlton et al., 1993; Knowlton & Weigt, 1998;
Hebert et al. 2003; Sites & Marshall 2004; Zakšek et al., 2006; Lefébure et al. 2006; Lushai et al., 2003). The
optimal average patristic intra- from inter-species divergence in crustaceans ranges from 0.16 (Lefébure et al.
2006) to 0.027 (Hebert et al. 2003). The species-specific morphology, especially rostrum and chela of pereiopod II
(see above), makes possible their identification and delimiting in nature and in museum collections. We consider
the split between Troglocaris (Xiphocaridinella) kumistavi sp. nov. and Troglocaris (Xiphocaridinella)
kutaissiana occurred about 2–4MYA according to “molecular clocks” suggested by Knowlton et al. (1993) and
Knowlton & Weigt (1998) as sequence divergence rate of 1.4–2.4% per MYA for COI in shrimps of the genus
Alpheus (Crustacea: Decapoda: Alpheidae). Besides, local endemism within separate cave systems is quite usual
and even characteristic for species of the genus Troglocaris s. l. (see Sket & Zakšek, 2009) and the split between
these species shows an example of a local speciation after separation of Dinaric and Caucasian Troglocaris lineages
about 6–11MYA (after Zakšek et al., 2006).
MARIN
588
·
Zootaxa 4311 (4) © 2017 Magnolia Press
Acknowledgements
Author is very thankful to Agniya Sokolova and Dmitry Palatov (A. N. Severtzov Institute of Ecology and
Evolution of RAS, Moscow) for the sampling material in Georgia and join their thanks to the staff of Kumistavi
(Prometheus) Cave, Tskaltubo-Kumistavi allowing sampling within the cave biotopes.
References
Avise, J.C. (2000) Phylogeography: the history and formation of species. Harvard University Press, Cambridge, MA, 447 pp.
Birštein, Ya. A. (1939) O peshernysh krevetkah Abhazii [About cave shrimps of Abkhazia]. Zoologichesky Zhurnal, XVIII, 960–974.
[in Russian]
Christodoulou, M., Anastasiadou, Ch., Jugovic, J. & Tzomos, T. (2016) Freshwater Shrimps (Atyidae, Palaemonidae,
Typhlocarididae) in the Broader Mediterranean Region: Distribution, Life Strategies, Threats, Conservation Challenges and
Taxonomic Issues. In: Kawai, T. & Cumberlidge, N. (Eds.), A Global Overview of the Conservation of Freshwater Decapod
Crustaceans. Springer International Publishing AG, Basel, pp. 199–236.
https://doi.org/10.1007/978-3-319-42527-6_7
Hebert, P.D.N., Cywinska, A., Ball, S.L. & De Waard, J.R. (2003) Biological identifications through DNA barcodes. Proceedings of
the Royal Society of London B, 270, 313–322.
https://doi.org/10.1098/rspb.2002.2218
Juzbaš’jan, S.M. (1940) On a cave shrimp from Shakuran. Trudy biologiceskoj stancii Narkomprosa Gruzinskoj SSR, 1, 73–86. [in
Russian]
Jugovic, J., Jalžić, B., Prevorčnik, S. & Sket, B. (2012) Cave shrimps Troglocaris s. str. (Dormitzer, 1853), taxonomic revision and
description of new taxa after phylogenetic and morphometric studies. Zootaxa, 3421, 1–31.
Jugovic, J., Prevorčnik, S., Blejec, A. & Sket, B. (2011) Morphological differentiation in the cave shrimps Troglocari s (Crustacea:
Decapoda: Atyidae) of the Dinaric karst—a consequence of geographical isolation or adaptation? Journal of Zoological
Systematic and Evolutionary Researches, 49 (3), 185–195.
https://doi.org/10.1111/j.1439-0469.2010.00611.x
Jugovic, J., Prevorčnik, S., Aljančič, G. & Sket, B. (2010) The atyid shrimp (Crustacea: Decapoda: Atyidae) rostrum: phylogeny
versus adaptation, taxonomy versus trophic ecology. Journal of Natural History, 44, 41–42, 2509–2533.
https://doi.org/10.1080/00222933.2010.502258
Knowlton, N. & Weigt, L.A. (1998) New dates and new rates for divergence across the Isthmus of Panama. Proceedings of the Royal
Society of London, Series B, 265, 2257–2263.
https://doi.org/10.1098/rspb.1998.0568
Knowlton, N., Weight, L.A., Solorzano, L.A., Mills, D.K. & Bermingham, E. (1993) Divergence in proteins, mitochondrial DNA and
reproductive compatibility across the Isthmus of Panama. Science, 260, 1629–1632.
https://doi.org/10.1126/science.8503007
Lefébure, T., Douady, C.J., Gouy, M. & Gibert, J. (2006) Relationships between morphological taxonomy and molecular divergence
within Crustacea: proposal of a molecular threshold to help species delimitation. Molecular Phylogenetics and Evolution, 40 (2),
435–447.
https://doi.org/10.1016/j.ympev.2006.03.014
Lushai, G., Smith, D.A.S., Goulson, D., Allen, J.A. & Maclean, N. (2003) Mitochondrial DNA clocks and the phylogeny of Danaus
butterflies. Insect Science and Its Application, 2, 309–315.
https://doi.org/10.1017/s1742758400012376
Marin, I.N. (2015) Atlas of Decapod Crustaceans of Russia. KMK Scientific Press, Moscow, 145 pp.
Marin, I. & Sokolova, A. (2014) Redescription of the stygobiotic shrimp Trogl oc ar is (Xiphocaridinella) jusbaschjani Birštein, 1948
(Decapoda: Caridea: Atyidae) from Agura River, Sochi, Russia, with remarks on other representatives of the genus from
Caucasus. Zootaxa, 3754 (3), 277–298.
https://doi.org/10.11646/zootaxa.3754.3.3
Sadowsky, A.A. (1930) Xiphocaridinella kutaissiana nov. gen. et sp. (fam. Atyidae) iz podzemnoi peshchery pod Kutaisom
[Xiphocaridinella kutaissiana nov. gen. et sp. (fam. Atyidae) from subterranean cave near Kutaisi]. Zakavkazskij kraevedstenny
sbornik naučnoissledovatel’nogo kraevedstvenogo kabineta Universiteta Tiflis, 1, 93–104. [in Russian]
Sites, J.W. & Marshall, J.C. (2004) Operational criteria for delimiting species. Annual Review of Ecology, Evolution and Systematics,
35, 199–227.
https://doi.org/10.1146/annurev.ecolsys.35.112202.130128
Sket, B. & Zakšek, V. (2009) European cave shrimp species (Decapoda: Caridea: Atyidae), redefined after a phylogenetic study;
redefinition of some taxa, a new genus and four new Troglocar is species. Zoological Journal of the Linnean Society, 155, 786–
818.
https://doi.org/10.1111/j.1096-3642.2008.00473.x
Zakšek, V., Sket, B. & Trontelj, P. (2007) Phylogeny of the cave shrimp Troglocaris: evidence of a young connection between Balkans
and Caucasus. Molecular Phylogenetics and Evolution, 42, 223–235.
https://doi.org/10.1016/j.ympev.2006.07.009
