ArticlePDF Available

EVALUATION OF KALLISTATIN AS A BIOMARKER IN CHRONIC HEPATITIS C PATIENTS *Corresponding Author

Authors:

Abstract and Figures

Early outcome prediction after hepatitis C viral infections has a great interest. This study aims to evaluate kallistatin in the prediction of liver fibrosis in chronic hepatitis C Egyptian patients. This study included 62 patients with chronic HCV infection (30 patients suffering from early liver fibrosis, 16 with advanced liver fibrosis, 16 with HCC) and 14 healthy subjects. Serum liver function tests were determined by colorimetric methods, HBsAg, HCVAb, AFP, CRP and kallistatin were investigated by ELISA, HCV-RNA and the expression of SERPINA4 gene were determined by qRT-PCR assay, abdominal ultrasound and ultrasonic-guided liver biopsy were done to determine the stage of fibrosis. Serum kallistatin level was significantly lower in patients with chronic liver disease (CLD) than healthy subjects at the gene expression and protein levels (P=0.003 & 0.001, respectively). Also, there was a significant difference in kallistatin concentration in early and advanced fibrosis, (p=0.044). Serum kallistatin had greater sensitivity and NPV values than did AST/ALT ratio (AAR) and AST/platelet ratio index (APRI) in patients with CLD compared with healthy subjects with sensitivity 95.1%, specificity 50%, PPV 89.2%, and NPV 70%. Moreover, Kallistatin could significantly distinguish patients at early stage of liver fibrosis from healthy subjects with sensitivity 96.7% and specificity 50%. Compared with single detection, combined measurement of the AAR, APRI and kallistatin markers showed 90% sensitivity and 78.6% specificity, 90% PPV and 78.6% NPV. These data support that kallistatin may be an efficient
Content may be subject to copyright.
www.wjpps.com Vol 6, Issue 9, 2017.
150
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
EVALUATION OF KALLISTATIN AS A BIOMARKER IN CHRONIC
HEPATITIS C PATIENTS
Halla M. Ragab*1, Fawzy A. Attaby2, Nabila Abd El Maksoud1, Wael Mohamed Aref3,
Mona A. Amin3, Heba K. Abdelhakim2 and Wafaa Abd Elaziz*1
1Department of Biochemistry, Genetic Engineering and Biotechnology Division, National
Research Centre, Dokki, Giza, Egypt.
2Department of Chemistry, Faculty of Science, Cairo University.
3Department of Internal Medicine, Kasr Al-Aini, Cairo University, Egypt.
ABSTRACT
Early outcome prediction after hepatitis C viral infections has a great
interest. This study aims to evaluate kallistatin in the prediction of liver
fibrosis in chronic hepatitis C Egyptian patients. This study included
62 patients with chronic HCV infection (30 patients suffering from
early liver fibrosis, 16 with advanced liver fibrosis, 16 with HCC) and
14 healthy subjects. Serum liver function tests were determined by
colorimetric methods, HBsAg, HCVAb, AFP, CRP and kallistatin
were investigated by ELISA, HCV-RNA and the expression of
SERPINA4 gene were determined by qRT-PCR assay, abdominal
ultrasound and ultrasonic-guided liver biopsy were done to determine
the stage of fibrosis. Serum kallistatin level was significantly lower in
patients with chronic liver disease (CLD) than healthy subjects at the
gene expression and protein levels (P=0.003 & 0.001, respectively). Also, there was a
significant difference in kallistatin concentration in early and advanced fibrosis, (p=0.044).
Serum kallistatin had greater sensitivity and NPV values than did AST/ALT ratio (AAR) and
AST/platelet ratio index (APRI) in patients with CLD compared with healthy subjects with
sensitivity 95.1%, specificity 50%, PPV 89.2%, and NPV 70%. Moreover, Kallistatin could
significantly distinguish patients at early stage of liver fibrosis from healthy subjects with
sensitivity 96.7% and specificity 50%. Compared with single detection, combined
measurement of the AAR, APRI and kallistatin markers showed 90% sensitivity and 78.6%
specificity, 90% PPV and 78.6% NPV. These data support that kallistatin may be an efficient
WORLD JOURNAL OF PHARMACY AND PHARMACEUTICAL SCIENCES
SJIF Impact Factor 6.647
Volume 6, Issue 9, 150-174 Research Article ISSN 2278 4357
Article Received on 07 July 2017, Revised on 27 July 2017, Accepted on 17 August 2017, DOI: 10.20959/wjpps20179-10058
*Corresponding Author
Halla M. Ragab &
Wafaa Abd Elaziz
Department of
Biochemistry, Genetic
Engineering and
Biotechnology Division,
National Research Centre,
Dokki, Giza, Egypt.
www.wjpps.com Vol 6, Issue 9, 2017.
151
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
biomarker in early detection of fibrosis. Also, it suggested that combination of kallistatin with
AAR and APRI could improve the sensitivity and specificity for the diagnosis of CLD and
this can be used as a practical method for clinical diagnosis for the early stage of liver
fibrosis.
KEYWORDS: Chronic liver disease, Kallistatin, SERPINA4, qRT-PCR, ELISA.
INTRODUCTION
HCV is one of several factors inducing liver fibrosis and its consequences as liver cirrhosis
(LC) and hepato-cellular carcinoma (HCC) over several decades.[1] Recent evidence indicates
that around 71 million people are infected with HCV globally.[2] In Egypt, hepatitis C viral
infection is endemic with the prevalence rate of 14.7% and this rate is considered the highest
prevalence rate around the world.[3]
Hepatic fibrosis occurs due to the wound-healing response of the liver to repeated injuries,
which contribute to the occurrence of chronic damage accompanied by activation of the
innate immune system and progressive accumulation of extracellular matrix (ECM) proteins,
including collagen type I and III.[4,5] As liver fibrosis advances, the bands of collagen,
bridging fibrosis and frank cirrhosis forms and this is an important risk factor for portal
hypertension, liver failure and development of primary liver cancer.[5]
Early detection of liver fibrosis is a vital need for successful management and prevention of
the health problems associated with advanced liver cirrhosis and HCC, evaluating the
therapeutic indications and improving the treatment regimens for better health community.
Liver biopsy (LB) is the gold standard for appraising hepatic fibrosis. However, this
procedure has several drawbacks including being invasive test with the risk of complications,
high cost, high rate of refusal by patients and sampling errors, which led to approximately
1030% false negative result in cirrhotic patients.[6]
Nowadays, use of non-invasive approaches could be recommended as a screening tool, which
allows physicians to determine patients who need further assessment of fibrosis by liver
biopsy.[7]
The complexity of liver cirrhosis and the influence of a variety of genetic and environmental
factors on the progression of disease and response to therapy are the major obstacles for
www.wjpps.com Vol 6, Issue 9, 2017.
152
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
discovering a specific marker for non-invasive staging and early detection of fibrosis.
Routine assessment of liver enzymes (ALT and AST) can increase the sensitivity and
specificity of currently diagnostic and prognostic markers.
C-reactive protein (CRP) is a non-specific acute-reactant secreted by the liver in response to
infections.[8] CRP levels are elevated during viral and bacterial infections, non-infectious
inflammatory diseases and malignancies.[9] Alpha-fetoprotein (AFP) is a 72 kD glycoprotein
produced normally by the liver and the fetal yolk sac. AFP levels are elevated in HCC, other
neoplastic and non-neoplastic conditions.[10]
Kallistatin (Kal) is a 58-60 kD inhibitory protein of the serine proteinase inhibitors (SERPIN)
family. In human, it is encoded by the SERPINA4 gene.[11] Kallistatin is widely expressed in
organs such as the kidney, eye, liver, heart, body fluids, blood cells and blood vessel but liver
is the main primary source of its production and secretion. Therefore, it was believed that the
levels of kallistatin in plasma reflect its production in the liver.[12-14] Kallistatin has valuable
effects as anti-inflammatory, antioxidant, anti-fibrotic and anti-tumor growth protein by its
heparin-binding domain.[15] It is also a negative acute phase protein, whose expression in the
liver is rapidly decreased after lipopolysaccharide-induced inflammation.[16]
More recent evidence[17] highlights that kallistatin levels could be considered as a potential
biomarker for liver cirrhosis in a Chinese population. However, there is no study indicated its
diagnostic role in the Egyptian population. Thus, this work aims to identify and appraise the
diagnostic value of kallistatin to predict liver fibrosis in chronic hepatitis C (CHC) Egyptian
patients. Also, to investigate whether combination between kallistatin and other routine liver
function tests will improve the sensitivity and specificity of its diagnostic value.
SUBJECTS AND METHODS
Subjects
This study included (76) subjects divided into (62) clinically and laboratory confirmed HCV-
Induced chronic liver disease patients (CLD) and 14 matched healthy controls. CLD patients
were selected from the outpatient clinic of hepatology department of Kasr El Aini Hospital,
Cairo, Egypt, from October 2015 to December 2016. The study was approved by the Ethics
Committee of National Research Centre, Cairo, Egypt (Code No. 15208). An informed
consent was taken from each individual participated in the present study and all were fully
informed concerning the nature of the disease and the diagnostic procedures.
www.wjpps.com Vol 6, Issue 9, 2017.
153
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
All patients and controls included in the present study were subjected to full medical history
and clinical examination. The HCV infection was diagnosed based on serologic detection of
hepatitis C antibodies with positive serum HCV-RNA by polymerase chain reaction and they
were negative for hepatitis B virus testing. None of the patients had a history of habitual
alcohol consumption. These chronic liver disease patients were divided into patients with
early liver fibrosis (F0-F2) (n=30) and patients with advanced liver fibrosis (F3-F4) (n=16)
and HCC (n=16). Liver fibrosis was diagnosis by using liver biopsy. Also, spiral CT-scan of
the abdomen (triphasic study) was performed to confirm diagnosis of HCC.
Liver histology and quantification of liver fibrosis
For patients who had liver biopsy, liver biopsy was fixed in formalin and paraffin embedded.
All biopsy specimens were analyzed independently by two experienced pathologists, who
were blinded to the patients' clinicopathological data. Liver biopsies that contained less than
10 portal tracts (except for cirrhosis) were excluded from the histological analysis. Fibrosis
was staged according to the METAVIR scoring system as follows: no or mild fibrosis (no
fibrosis or portal fibrosis without septa, F0-F1), moderate fibrosis (portal fibrosis and few
septa, F2), severe fibrosis (numerous septa without cirrhosis, F3) and cirrhosis F4.
Exclusion criteria
1) Patients with age <18.
2) Patients with chronic liver disease due to causes other than HCV.
3) Patients suffering from renal or cardiac disease, hypertension, diabetes, community
acquired pneumonia, any other malignant disease except HCC, or patients with current
infection that might affect the Kallistatin level.
Methods
Samples collection
Eight ml of blood were collected from each individual (patient and control) by vein-puncture
then divided into three portions; 2 ml of the blood was treated immediately with EDTA-K2
for routine blood pictures (CBC) by Sysmex the automated hematology analyzer SF-300,
which produced by Sysmex Corporation, Japan, 2 ml of the blood was treated immediately
with EDTA-K2 for RNA extraction. Sera were separated from the rest of blood samples and
biochemical analysis including aspartate aminotransferase (AST), alanine aminotransferase
(ALT), bilirubin, serum albumin, creatinine and random blood sugar were done according to
www.wjpps.com Vol 6, Issue 9, 2017.
154
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
the manufacturer's instructions. The reagents were purchased from Spectrum Company,
Cairo, Egypt.
The AST-ALT ratio was calculated as [AST/ ALT]. The AST/Platelet ratio index (APRI) was
calculated as [AST/ (upper limits of normal) / platelets count 109/L] × 100.
Quantitation of CRP antigen by (ELISA)
Serum CRP levels were measured using an ELISA kit purchased from (IMMUNOSPEC
CORPORATION, 14155 Farmington Rd. D, Livonia, MI 48154 USA), according to the
manufacturer‟s instructions.
Quantitation of AFP by (ELISA)
Serum AFP levels were measured using an ELISA kit purchased from (IMMUNOSPEC
CORPORATION, 7018 Owensmouth Ave. Suite 103 Canoga Park, CA 91303, USA),
according to the manufacturer‟s instructions and values were reported as ng/ml.
Quantitation of kallistatin by (ELISA)
Serum kallistatin was measured in all enrolled subjects using ELISA kit supplied by (NOVA,
No. 18, Keyuan Road, DaXing Industry Zone, Beijing, China). The assay is based on a
double-antibody sandwich ELISA technique for the quantitative assay of human kallistatin in
samples. The assay was performed according to the manufacturer‟s instructions and values
were reported as pg/ml.
Gene expression of SERPINA4 by quantitative real timePCR (qRT-PCR)
To confirm the obtained results of protein levels of kallistatin with its expression status, the
expression profile of its gene (SERPINA4) was analyzed at messenger RNA (mRNA) in
peripheral blood samples of forty one patients and correlation between protein and gene
expression levels was detected.
Samples were taken from fourteen healthy controls and eight patients with early fibrosis, ten
patients with advanced fibrosis and nine patients with HCC (five with AFP concentrations of
20 ng/mL or less and four with concentrations higher than 20 ng/mL).
Total RNA was extracted from peripheral blood samples using RNA extraction kit according
to the manufacturer's instructions of the kit (Direct-zol™ RNA MiniPrep, ZYMO
RESEARCH CORP.,) then the concentration for extracted RNA was detected using Nano-
www.wjpps.com Vol 6, Issue 9, 2017.
155
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
drop2000 spectrophotometer (Thermo Fisher Scientific, USA). Eluted RNA was stored in -
80C till further processing. Secondly, PCR quantitation experiments were performed by
using SensiFAST SYBR Green PCR Master Mix Kit, (BIOLINE GmbH, Germany) on the
Rotor-Gene Q instrument (Qiagen, USA), to determine the expression of SERPINA4 and
housekeeping gene Glyceraldehyde3phosphate dehydrogenase (GAPDH) (used as an
endogenous control) for normalization. The working master mix was prepared according to
manufacturer's protocol. Fluorescence measurements were made in every cycle and the
thermal profile used as follows: Reverse transcription 1 cycle 45°C for 10 min; polymerase
activation 1 cycle of 95°C for 2 min; cycling 45 cycles of 95°C for 5 sec and 60°C for 20 sec.
The expression levels of SERPINA4 in tested samples were expressed in the form of ∆∆CT
(cycle threshold) value which calculated on the basis of threshold cycle (Ct) values, corrected
by Glyceraldehyde3phosphate dehydrogenase expression, with the following equation: the
relative amount of SERPINA4 = 2–ΔΔCt; ΔΔCt = [ΔCt of cases - ΔCt of control]; [ΔCt=Ct
(SERPINA4) Ct (GAPDH)]. The following primers were used in the quantitative real-time
PCR analyses: SERPINA4 forward primer: 5′- GTGGGCACAATCCAGCTTAT-3′, reverse
primer: 5′- ACCCGGACTGTTGTGTTCTC -3′; GAPDH forward primer: 5-
GTCCACTGGCGTCTTCACCACC -3′, reverse primer: 5′-
AGGCATTGCTGATGATCTTGAGGC -3′.
Statistical Analysis
In the present study, statistical analyses of data were carried out using SPSS version 23.
Shapiro Wilks test was used to test normal distribution of variables. Quantitative variables
were described in the form of mean ± SD or median and range, while qualitative variables
were described as number and percent. The significance of the difference between groups for
quantitative variables was determined by the student‟s t-test and Mann-Whitney (U-test) as
appropriate. Categorical variables were compared using the chi-squared (χ2) test.
Correlations between different parameters were done using spearman‟s correlation
coefficient. The Receiver Operating Characteristic (ROC) was plotted to assess the diagnostic
power of kallistatin in different CLD patients and controls. Also, it was constructed to obtain
the most sensitive and specific cutoff value for serum kallistatin in diagnosing liver fibrosis
and cirrhosis, and the area under the curve (AUC) greater than 0.5 was considered to be
statistically significant. The probability (P) values of ≤0.05 were considered statistically
significant indicated *, while P> 0.05 was considered statistically not significant.
www.wjpps.com Vol 6, Issue 9, 2017.
156
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
RESULTS
Overall, 76 participants were recruited in this study (40 male and 36 female); Sixty two (62)
patients were divided into (48.4%) with early liver fibrosis (F0-F2) (n=30), (25.8%) with
advanced liver fibrosis (F3-F4) (n=16) and HCC was present in 16 (25.8%) of Patients; with
mean age 47.85 ± 12.13, 60.6 ± 8.48 and 57.62 ± 11.22 years (Y) respectively; and 14
matched healthy controls with mean age 41.93 ± 15.69 years. Studied patients displayed a
significant trend of elder age with the progression of liver disease from early fibrosis to
advanced fibrosis and HCC.
By considering the hematological characteristics of the studied groups; there were significant
differences among certain hematological parameters including red blood cells count (RBCs),
hemoglobin and platelets count in different CLD patients when compared to controls.
Patients with advanced liver fibrosis and HCC had significantly lower mean value of
hemoglobin and platelet count compared to both control subjects and early fibrosis patients
(P≤0.001). However, there was no significant difference in the mean value of WBCs between
all groups (P >0.05) (Table.1). The variation in routine clinical investigations of liver
function among different groups was shown in Table. 1. Patients with CLD had significantly
higher CRP levels than those without (P≤0.05) (Table 1 & Figure1A). Although the median
concentration of serum AFP was increased for HCC patients than its level in healthy controls,
as expected (P<0.0001), significant increases were also detected in patients with early and
advanced liver fibrosis than healthy participants (P = 0.014 and P<0.0001 respectively, Table
1 & Figure 1B).
It is interesting to note that serum Kallistatin was significantly lower in cases with chronic
liver disease than those without (P=0.001), suggesting a potential link between serum
Kallistatin levels and CLD (Table 1&Figure1C). This results confirmed by qRT-PCR, as it
was detected that the expression levels of SERPINA4 were frequently lower in patient
suffering from CLD than healthy controls (P=0.003) (Figure 2). Furthermore, when early
liver fibrosis patients compared with advanced fibrosis in eighteen cases, there was no
significant difference at the gene expression or protein levels (P>0.05). Moreover, a moderate
positive correlation was found between serum protein level of kallistatin and its gene
expression(r = 0.328, P = 0.036, Figure 2C). A noticeable finding is that when serum
Kallistatin concentration was measured in a large number of patients (forty six) by ELISA,
the median level of kallistatin was 32.69% lower in patients with early liver fibrosis
www.wjpps.com Vol 6, Issue 9, 2017.
157
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
]734.4(154.7 1322.96) (pg/ml)[, 62.3% lower in patients with advanced liver fibrosis
]413.17(110.1 1230.3)[ and 44% lower in HCC patients ]610.15(165.7 1506.8[ than the
healthy subjects. ]1091.1(298.4 10859.3) (pg/ml)[p=0.047, p=0.005 and P=0.042;
respectively). A significant decrease 43.74% in serum kallistatin levels was observed when
patients with advanced liver fibrosis compared to patients with early stage of liver fibrosis
(p=0.044). While there was no significant difference in the median levels of kallistatin in
HCC patients when compared to both early and late stages of liver fibrosis (P >0.05) (Table
1 & Figure 1 C).
Receiver operating characteristic curves for predicting early fibrosis, advanced fibrosis,
and HCC
To detect whether serum Kallistatin and its combination with APRI and AAR could be used
as a diagnostic biomarker for chronic liver disease, non-parametric receiver operating
characteristic (ROC) curve analysis was performed. ROC curve showed the optimum cutoff
for Kallistatin was 1253.5 (pg/ml) for distinguishing patients with chronic liver disease from
healthy subjects with sensitivity 95.1% and specificity 50%; an area under the ROC curve
(AUROC) 0.725(95% CI: 0.561-0.890) (Figure 3A, Table2). In the assessment of
differential diagnostic accuracy, serum kallistatin had greater sensitivity and NPV values than
did AAR and APRI in patients with chronic liver diseases compared with healthy subjects
(Table2). Values of specificity, PPV and NPV elevated when the three tests were combined.
Furthermore, ROC curve also showed that at a cutoff value of 1224.89 (pg/ml), Kallistatin
could significantly distinguish patients at early stage of liver fibrosis from healthy subjects
with sensitivity 96.7% and specificity 50%; an area under the ROC curve (AUROC)
0.688(95% CI: 0.496-0.880) (Figure 3B, Table2). These data supported that kallistatin may
be an efficient biomarker in early detection of fibrosis. According to data mentioned in table
2, the sensitivity and NPV for kallistatin were also better than those for different studied
parameters. However, values of specificity and PPV improved when 3 different parameters
combined as showed in (Table2). On the other hand, there was no statistically significant
difference in the AAR between the „healthy subject‟ group and the „early liver fibrosis‟ group
(AUC 0.598, P =0.302).
Moreover, the area under the receiver operating characteristic (ROC) curve for distinguishing
between early and advanced stage of liver fibrosis using serum kallistatin level was 0.686
(Fig. 3C) and using a cutoff level of 586.49 (pg/ml) for serum kallistatin level yielded
www.wjpps.com Vol 6, Issue 9, 2017.
158
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
sensitivity and specificity values of 73.3% and 70%, respectively. Whereas, APRI showed
high sensitivity (92.3%) for differentiating between different stages of liver fibrosis but
combination between all studied parametres increased specificity and PPV to 96.7% and
91.7% respectively.
In patients with HCC, the AUC for kallistatin was 0.719 (95% CI: 0.5340.904) with
sensitivity of 87.5% and specificity of 50%, compared with controls (Table 2). ROC analysis
showed that testing of kallistatin, AAR and APRI increased the diagnostic accuracy for HCC
compared with either test alone (AUC 0.945, 95% CI: 0.8391, sensitivity 92.3% and
specificity 100%) and this is very similar to the sensitivity and specificity of AFP (93.8% &
91.7% respectively).
Correlation between serum kallistatin, CRP, AFP and other parameters including
hematological, hepatic functional capacity and liver damage parameters
The correlation between kallistatin, CRP, AFP and biochemical liver function tests is
mentioned in (Table 3&Figure 4).
Results of laboratory tests indicated a weak inverse correlation between serum kallistatin and
CRP (r = -0.244, P = 0.037, Fig. 4A), AFP (r = -0.232, P = 0.05, Fig. 4B), AST (r = -0.285, P
= 0.016, Fig. 4C), APRI (r = -0. 293, P = 0.014 Fig. 4D) or prothrombin time (r = -0.42, P =
0.002, Fig. 4E). Also, Serum kallistatin decreased in parallel with hemoglobin level (r
=0.374, P = 0.001, Fig. 4F), platelet count (r = 0.232, P = 0.046, Fig. 4G) and serum albumin,
(r = 0.305, P = 0.018, Fig. 4H).
However, serum kallistatin was not significantly correlated with Age (r = -0.122, P = 0.313),
WBCs (r = -0.212, P = 0.069), RBCs (r = 0.179, P = 0.125) total bilirubin (r = -0.212, P =
0.096), ALT (r = -0.106, P = 0.378) or AST/ALT ratio (r = -0.144, P = 0.232).
Also, CRP and AFP correlated with all studied parameters except WBCS and ALT for CRP
WBCS only for AFP as mentioned in table 3.
www.wjpps.com Vol 6, Issue 9, 2017.
159
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
Table 1: Demographic data and biochemical parameters of the patients and controls.
Variable Groups
Healthy
Controls(n=14)
Advanced
fibrosis patients
Group(n=16)
HCC patients
Group(n=16)
Age(Yrs.)
41.93 ± 15.69
60.6 ± 8.48ab:***
57.62 ±
11.22a**,b*
Gender
Male/Female
Percentage of
Male
2/12
(14.3%)
11/5a**
(68.8%)
13/3a***
(81.2%)
RBCs (106/µL)
4.89 ± 0.63
3.57 ± 0.68ab:***
3.49 ± 0.76ab:***
Hemoglobin(g/dl)
13.92± 1.08
10.44 ± 1.86ab:***
9.89 ± 2ab:***
Platelets count
(103/µL)
283 ± 28.93
93.87 ±
41.54ab;***
187.57 ±
96.49ac:***
WBCs (103/µL)
6.66 ± 1.65
8.29 ± 5.29
8.53 ± 4.18
ALT (U/L)
30 (20 39)
29 (7 53)b*
56 (26
152)a***,c**
AST(U/L)
28(16 39)
59.5 (27
255)a***
100 (26
386)a***,b**
AST/ALT ratio
(AAR)
0.904(0.552
1.56)
1.85(1.032
36.43)ab:***
1.67(0.68
6.031)ab:**
APRI
0.224(0.157-
0.417)
1.126(0.5-
6.73)ab:***
1.123(0.139-
9.95)ab:***
Total bilirubin
(mg/dl)
0.45(0.05 0.7)
1.6(0.3
15.9)ab;***
2.15(0.3
25.4)a***,b**
Prothrombin
time (sec.)
12.5(11 14.6)
21.1(15.2
31.3)ab:***
17.1(14.8
34)ab:***
Serum albumin
(g/dl)
4.05(3.7 4.5)
2.2(1.7 3.4)ab;***
2.6(1.7
3.4)ab:***
AFP (ng/ml)
1.49(0.79 2.2)
2.5(1.33
198.04)a***
14.58(1.58
426.56)ab:***,c**
CRP (mg/l)
6.55(2.38
9.96)
54.71(7.1
125.1)a***,b**
88.33(32.5
99.63)ab:***
Kallistatin
(pg/ml)
1091.1(298.4
10859.3)
413.17(110.1
1230.3) a**,b*
610.15(165.7
1506.8)a*
Parameters are presented as means ± SD for normally distributed and medians (range) for
non-normally distributed variables, and as total number (%) for categorical variables. Units
are in parentheses.
- a: significant difference from Healthy Controls, b: significant difference from Early fibrosis
patients, c: significant difference from Late fibrosis patients.
- *: P ≤0.05, **: P ≤0.01, ***: P ≤ 0.001.
Abbreviations: RBCs, red blood cells; WBCs, white blood cells; AST, aspartate
aminotransferase; ALT, Alanine aminotransferase; PT, prothrombin time; APRI: [(AST/ 40) /
platelets count 109/L]×100; CRP, C reactive protein; AFP, alpha fetoprotein.
www.wjpps.com Vol 6, Issue 9, 2017.
160
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
Table 2: ROC analysis of kallistatin, AAR and APRI in different studied groups.
Test
Best cut off
value
Sensitivity
(%)
Specificity
(%)
PPV
(%)
NPV
(%)
AUC (95%CI)
Healthy control vs chronic liver disease patients
Kallistatin
1253.5
95.1
50
89.2
70
0.725 (0.561-
0.890)
APRI
0.422
82.1
100
100
58.3
0.923(0.86-0.987)
AAR
0.977
75.4
78.6
93.5
44
0.737(0.61-0.865)
Kallistatin+ APRI
92.9
57.1
89.7
66.7
0.945(0.894-0.997)
Kallistatin+ APRI+AAR
94.6
78.6
94.6
78.6
0.955(0.905-1)
Healthy Control vs Early Stage of Fibrosis
Kallistatin
1224.89
96.7%
50%
80.6
87.5
0.688 (0.496-
0.880)
APRI
0.324
83.3
92.9
96.2
72.2
0.89 (0.792-0.988)
AAR
0.977
60
78.6
85.7
47.8
0.598(0.417-0.779)
Kallistatin +APRI
86.7
78.6
89.7
73.3
0.917(0.836-0.997)
Kallistatin +APRI+ AAR
90
78.6
90
78.6
0.931(0.851-1)
Early Stage vs Advanced Stage of Fibrosis
Kallistatin
586.49
73.3
70
55
84
0.686(0.513-0.858)
APRI
0.685
92.3
66.7
54.5
95.2
0.833(0.709-0.957)
AAR
1.41
85.7
90
80
93
0.929(0.842-1)
Kallistatin +APRI
53.8
93.3
77.8
82.4
0.856(0.743-0.969)
Kallistatin +APRI+ AAR
84.6
96.7
91.7
93.5
0.969(0.924-1)
Advanced Fibrosis Patients vs Healthy Control Subjects
Kallistatin
577.88
73.3
78.6
78.6
73.3
0.807 (0.647-
0.967)
APRI
0.458
100
100
100
100
1
AAR
0.993
100
78.6
82.4
100
0.964(0.906-1)
Kallistatin +APRI
100
100
100
100
1
Kallistatin +APRI+ AAR
100
100
100
100
1
HCC Patients vs HC
Kallistatin
1246.96
87.5
50
66.7
77.8
0.719 (0.534-
0.904)
APRI
0.468
92.3
100
100
93.3
0.923(0.778-1)
AAR
0.977
84.6
78.6
78.6
84.6
0.816(0.636-0.996)
AFP
1.836
93.8
91.7
93.8
91.7
0.977(0.932-1)
Kallistatin +APRI
92.3
100
100
93.3
0.945(0.839-1)
Kallistatin +APRI+ AAR
92.3
100
100
93.3
0.945(0.839-1)
www.wjpps.com Vol 6, Issue 9, 2017.
161
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
Table 3: Correlation between serum kallistatin, CRP, AFP and other parameters
including hematological, hepatic functional capacity and liver damage parameters.
Parameters
Concentration of
kallistatin (pg/ml )
Concentration of
CRP (mg/l)
concentration of
AFP (ng/ml)
r
P-value
r
P-value
R
P-value
kallistatin (pg/ml )
1.000
-
-0.244*
0.037
-0.232*
0.05
CRP (mg/l)
-0.244*
0.037
1.000
-
0.322**
0.006
AFP (ng/ml)
-0.232*
0.05
0.322**
0.006
1.000
-
Age(Yrs.)
-0.122
0.313
0.298*
0.012
0.489***
0.000
WBCs(103/µL)
-0.212
0.069
0.127
0.285
0.098
0.417
RBCs(106/µL)
0.179
0.125
-0.412***
0.000
-0.307**
0.009
Hemoglobin(g/dl)
0.374***
0.001
-0.552***
0.000
-0.332**
0.005
platelet count(103/µL)
0.232*
0.046
-0.336**
0.004
-0.290*
0.014
total bilirubin (mg/dl)
-0.212
0.096
0.422***
0.001
0.468***
0.000
serum albumin(g/dl)
0.305*
0.018
-0.605***
0.000
-0.567***
0.000
AST(U/L)
-0.285*
0.016
0.339**
0.004
0.610***
0.000
ALT(U/L)
-0.106
0.378
0.038
0.755
0.334**
0.005
AST/ALT ratio(AAR)
-0.144
0.232
0.406***
0.001
0.392***
0.001
AST/platelet ratio (APRI)
-0.293*
0.014.
0.359**
0.003
0.586***
0.000
Prothrombin Time(sec.)
-0.420**
0.002
0.566***
0.000
0.473***
0.001
relative SERPINA4 expression levels
0.328*
0.036
-0.242
0.138
-0.297
0.067
Figures
A
B
C
Figure 1: Serum levels of different biomarkers in the studied groups.
www.wjpps.com Vol 6, Issue 9, 2017.
162
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
The box represents the interquartile range. The whiskers indicate the highest and lowest
values and the line across the box indicates the median value.
Overall significance of differences among 4 groups was determined by KruskalWallis: for
CRP, P<0.001; for AFP, P<0.001; and for kallistatin, P<0.015.
A
B
C
Figure 2: Comparison between relative SERPINA4 expression levels in different studied
groups by RT-PCR.
Relative SERPINA4 expression levels in CLD and its clinical significance. A) SERPINA4
expression levels were significantly down-regulated in CLD patients as compared with the
normal control. GAPDH was used as an internal control. B) SERPINA4 expression levels
were significantly down-regulated in CLD patients without HCC as compared with the
normal control. GAPDH was used as an internal control. C) Correlation between expression
levels of SERPINA4 by real-time PCR and its protein levels by ELISA in the same cases.
www.wjpps.com Vol 6, Issue 9, 2017.
163
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
A: Healthy control vs chronic liver disease
B: Early fibrosis vs. Healthy control
C: Early fibrosis vs Advanced fibrosis
D: Advanced fibrosis vs. Healthy control
E: HCC vs. Healthy control
Figure 3: Diagnostic value of kallistatin for CLD. A, ROC curve analysis of kallistatin for
discrimination between chronic liver disease patients and healthy control subjects (AUC:
0.725 (95% CI: 0.561-0.890), P = 0.009. The cutoff value 1253.5 (pg/ml) has sensitivity
95.1% and specificity 50%. B, ROC curve analysis of kallistatin for discrimination between
patients with early fibrosis and healthy control subjects (AUC: 0.688 (95% CI: 0.496-0.880),
P = 0.047). the cutoff value 1224.89 (pg/ml) has sensitivity 96.7% and specificity 50%. C,
ROC curve analysis of kallistatin for discrimination between early fibrosis and advanced
fibrosis patients (AUC: 0.686 (95% CI: 0.513-0.858), P = 0.044. the cutoff value 586.49
(pg/ml) has sensitivity 73.3% and specificity 70%. D, ROC curve analysis of kallistatin for
www.wjpps.com Vol 6, Issue 9, 2017.
164
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
discrimination between advanced fibrosis patients and healthy control subjects (AUC: 0.807
(95% CI: 0.647-0.967), P = 0.005. The cutoff value 577.88 (pg/ml) has sensitivity 73.3% and
specificity 78.6%. E, ROC curve analysis of kallistatin for discrimination between HCC
patients and HC subjects (AUC: 0.719 (95% CI: 0.534-0.904), P = 0.042. The cutoff
value1246.96 (pg/ml) has sensitivity 87.5% and specificity 50%.
A
B
C
D
E
F
G
H
Figure 4: Relationship between kallistatin levels and AFP or other liver function test
parameters. Relationships between kallistatin levels and CRP (A), AFP (B), AST (C), AST
/platelets ratio index (D), prothrombin time (E), hemoglobin (F), platelet count (G), or serum
albumin (H) are shown. Spearman's rank correlation coefficient used to determine these
correlations.
www.wjpps.com Vol 6, Issue 9, 2017.
165
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
DISCUSSION
Early detection of the progression of fibrosis is a crucial step for preventing further
complications of chronic liver diseases. Currently, liver biopsy is still the gold standard
method for assessing hepatic fibrosis. However the risk of clinical complications, poor
acceptance and sampling errors are some of its remarkable limitations.[18]
Recently, several new non-invasive biomarkers have been evaluated as potential alternatives
to liver biopsy. However, identifying the hepatic fibrosis at an early stage remains an open
challenge, due to the poor diagnostic accuracy of many circulating biomarkers and algorithms
in the early and mild stages of liver fibrosis when compared to advanced fibrosis.[19,20]
Hepatic fibrosis is a silent disease affecting people all over the world as well as Egyptian
population. The slow and asymptomatic progression of the disease in the majority of cases is
considered as one of the major obstacles to adopt specific biomarkers for early detection of
fibrosis. This study aimed to demonstrate the utility of kallistatin as a potential biomarker for
the early detection of hepatic fibrosis and liver cirrhosis.
Results from the present study showed that RBCs count was significantly decreased in
advanced liver fibrosis and HCC than in both healthy subject and early liver fibrosis patients.
The main mechanism especially in those with portal hypertension is blood loss in variceal or
other gastrointestinal bleeding. Also, therapy used for the treatment of hepatitis C may be
associated with the development of anemia.[21]
In the current study, a statistically significant decrease in the mean of platelet counts was
observed in patients with CHC than control subjects. As expected, mean platelet count in the
advanced fibrosis group was extremely decreased compared to those in early fibrosis group
and the control subjects and these suggested that platelet count might be helpful in the
assessment of chronic liver diseases.
Chronic hepatitis C has been reported as one of the several causes that induce
thrombocytopenia, even in chronic non-cirrhotic patients.[22,23]
Thrombocytopenia in chronic liver disease may be explained by suppression of platelet
production by the bone marrow as a result of viral infection, alcohol consumption, iron
overload, and medications. Splenic sequestration of platelets due to hypersplenism may be
another cause of the reduction in the platelet numbers.[21,24]
www.wjpps.com Vol 6, Issue 9, 2017.
166
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
Also decreased activity of thrombopoietin (hematopoietic growth factor) as well as high
levels of platelet-associated immunoglobulins (PAIgG), which are responsible for the high
rate of platelets destruction in CLD patients, is other causes of thrombocytopenia.[24-26]
Lu et al., declared that thrombocytopenia was a valid surrogate of cirrhosis and acceptable
marker for the identification of individuals at high-risk for HCC, especially in areas that had a
high prevalence of HCV.[27] Furthermore, He et al., reported that hemoglobin values and
platelet counts were significantly low in HCV-infected patients In comparison to the
controls.[28] Mean platelet count in HCC patients was significantly higher than that in
advanced fibrosis in the current study. One patient (6.25%) of HCC group actually has
thrombocytosis with platelet count >400000 mm3 while five cases (31.25%) have
thrombocytopenia with platelet count <150000 mm3. All hepatocellular carcinoma cases have
a cirrhotic background and this preneoplastic state is the strongest predisposing factor.[29]
However, the incidence of liver decompensation in patients with HCC is variable. Signs of
liver failure and portal hypertension take a leading position in HCC patients with
decompensated cirrhosis while “toxic syndrome” coincides more frequently with the absence
of decompensation.[30-32]
Thus, depending on the pattern and the occurrence of cirrhosis, thrombocytopaenia may not
be a dominant feature. Also, High platelet count may predominate from other mechanisms.
High platelet count and even thrombocytosis are common in several malignant diseases[33]
including those of the ovary[34] and liver.[35]
The link between platelets and angiogenesis may be responsible for high platelet count in
patients with malignancies. VEGF, which is a platelet-derived cytokine appeared in many
malignant diseases, promotes the aggregation of platelet by endothelial cells. Aggregated
platelets lead to the release of many potential angiogenesis regulators such as platelet-derived
endothelial cell growth factor (PD-ECGF)[36,37] VEGF-A[38], VEGF-C.[39] The previous
findings suggest the active and causative role of platelets in tumor angiogenesis.
The current study is in good agreement with Saadeh et al. who found that differences in white
blood cell count between cirrhotic and non-cirrhotic patients were not significant.[40]
However, it does not support other results which showed a significant association between
WBCs and CLD. He et al. detected that WBCs count was significantly lower in HCV-
www.wjpps.com Vol 6, Issue 9, 2017.
167
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
infected patients as compared to controls.[28] Also, Friedman who categorized persistent
leukocytosis as one of the paraneoplastic syndromes associated with HCC.[41] The AST and
ALT are abundant hepatic enzymes that catalyze the transfer of amino groups to form the
hepatic metabolites pyruvate and oxaloacetate, respectively. The ALT is found in the cytosol
of the liver, whereas two AST isoenzymes are located in the cytosol and mitochondria,
respectively. Both the ALT and AST are released from damaged hepatocytes into the blood
after hepatocellular injury or death.
We observed that ALT levels were significantly higher in early liver fibrosis and HCC
patients than in healthy subjects. Also, ALT levels decreased in advanced liver fibrosis
patients than early fibrosis group. This is in agreement with Motawi et al., who reported a
significant increase in ALT between HCC and early fibrosis group. However they didn‟t find
any significant difference between levels of ALT in early fibrosis group and advanced
fibrosis group.[42] Also, Ahmed and his colleagues reported that ALT levels deceased in
advanced fibrosis than in HCC patients.[43] In all studied group, there were a statistically
significant increase in the median of AST in relation to the development of chronic liver
disease. This is in agreement with Fouad et al.[44], who reported a high level of AST in
cirrhotic patients in comparison with non-cirrhotic cases. The same finding was also detected
by Green and his coworkers.[45]
Multiple studies had reported that APRI is of a great value and has high accuracy in the
prediction of advanced fibrosis.[6] In our study the median level of APRI score showed a
statistical difference between different stages of liver fibrosis and healthy control. This
matches well with earlier researchers‟ observations.[44, 46-48] However, no statistically
significant different was found between APRI in patients suffering from the advanced fibrosis
and patients with HCC. This may be due to the increase in the platelets count of certain
patients with HCC patients than in patients with advanced fibrosis.
In patients with advanced liver fibrosis and HCC a significant increase in AAR score was
shown in both early liver fibrosis patients and healthy subjects, but no significance difference
was observed between patients with early fibrosis and healthy control. Ahmed et al. and Abd-
Elghany et al. in their studies documented that there was no statistically significant difference
between different stages of liver fibrosis and AAR.[43,49] Whereas Demerdash et al. mentioned
that there was a significant association between AAR levels and development of chronic liver
disease.[50] In HCC group, the AAR levels were showed a slightly decrease than in advanced
www.wjpps.com Vol 6, Issue 9, 2017.
168
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
liver fibrosis group. This can explained by the low level of ALT detected in advanced liver
fibrosis patients than that in HCC.
Kallistatin is expressed in several organs and tissues but it is primarily produced in the liver.
In our study, the expression levels of SERPINA4 were detected in peripheral blood samples
of 18 chronic liver disease patients without HCC, 9 HCC patients and 14 healthy controls by
using quantitative real time PCR to confirm the results obtained by ELISA. The results
revealed that the median level of SERPINA4 significantly decreased in patients who have
chronic liver disease as compared to control, suggesting a potential link between its down-
regulated levels and development of liver disease. Also, kallistatin levels were determined in
serum of healthy, early liver fibrosis, advanced liver fibrosis and HCC. The median level of
kallistatin showed a significant decrease in early fibrosis patients as compared to control.
Kallistatin levels were also lower in advanced liver fibrosis patients than both early liver
fibrosis patient and healthy subjects. In hepatocellular carcinoma patients, levels of kallistatin
were higher than advanced fibrosis patients but lower than both early liver fibrosis and
healthy controls. This substantiates previous findings by Badola and his coworkers[51] who
mentioned that SERPINS A1, A3, A4 and A11 shared distinct banding patterns with high
correlation, and this reflects that they are predominantly expressed in the liver. Also, they
declared that SERPINA4 was highly expressed in the normal human tissue, but its expression
decreased in cases with liver fibrosis. Furthermore, Chao et al.[12] studied the expression of
kallistatin in different types of cells included blood cells and hepatocytes. They confirmed
that kallistatin which produced in blood cells and hepatic cells was significantly reduced in
plasma samples of patients with liver disease.
This finding is in a good agreement with that obtained by Cheng et al.[17] who found that
kallistatin level reduced significantly in the serum of early liver fibrosis patients; however,
there was a marked reduction in kallistatin level of cirrhotic patients.
In the experimental model, Diao et al. reported that the secreted Kallistatin could protect the
liver against CCl4 induced damage.[52] They observed a significant decrease in the serum
level of peroxidation marker accompanied with enhancement in the activities of the hepatic
anti-oxidative defense system in kallistatin gene-transferred mice. Also, Huang et al.,
declared that liver injuries induced by CCl4 in animal model were attenuated by
administration of kallistatin as CCl4-induced liver fibrosis treatment.[53] Kallistatin attenuated
the pathological progression of fibrosis with concomitant fewer and smaller fibrotic nodules.
www.wjpps.com Vol 6, Issue 9, 2017.
169
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
Also in our study, levels of kallistatin in HCC patients were increased than its levels in
advanced fibrosis patients this may be due to the antitumor activity of kallistatin as it plays a
key role in inhibiting tumor growth and metastasis. Lu et al. mentioned that administration of
recombinant kallistatin protein attenuates tumor growth and intramural neo-vascularization in
grafted hepatocarcinoma mice and reduces VEGF expression in HCC cells.[54]
CONCLUSION
Our findings support that kallistatin may be an efficient biomarker in early detection of
fibrosis. Also, it indicated that combination of kallistatin with AAR and APRI could improve
the sensitivity and specificity for chronic liver disease diagnosis and this can be used as a
practical mean of clinical differential diagnosis for early stage of liver fibrosis. However, our
study is limited because the small sample size, all participants in this study are from the
Egyptian population and we examined chronic liver disease induced by HCV-infection with
no information if our findings would be valid for other patients with different etiologies.
Thus, further investigation should be carried out in order to validate these findings.
CONFLICT OF INTEREST
The authors declare that they have no conflicts of interest.
ACKNOWLEDGEMENTS
This work was financially supported by the National Research Centre, Cairo, Egypt.
The authors would like to thank Medical Center of Excellence (Medical Service Unit) at
National Research Centre. Special thanks to Dr. Eman Mahmoud for her technical assistance
in performing the gene expression of SERPINA4 by qRT-PCR.
REFERENCES
1. Bility MT, Nio K, Li F, McGivern DR, Lemon SM, Feeney ER, et al. Chronic hepatitis C
infectioninduced liver fibrogenesis is associated with M2 macrophage activation.
Scientific Reports. 2016; 6.
2. WHO. Hepatitis C, Fact sheet, Updated April 2017.
3. Elgharably A, Gomaa AI, Crossey MM, Norsworthy PJ, Waked I, Taylor-Robinson SD.
Hepatitis C in Egyptpast, present, and future. International Journal of General Medicine.
2017; 10: 1.
www.wjpps.com Vol 6, Issue 9, 2017.
170
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
4. Sebastiani G, Gkouvatsos K, Pantopoulos K. Chronic hepatitis C and liver fibrosis. World
journal of gastroenterology: WJG. 2014; 20: 11033-53.
5. Turato C, Calabrese F, Biasiolo A, Quarta S, Ruvoletto M, Tono N, et al. SERPINB3
modulates TGF-β expression in chronic liver disease. Laboratory investigation. 2010; 90:
1016-23.
6. Fallatah HI. Noninvasive biomarkers of liver fibrosis: an overview. Advances in
Hepatology. 2014; 2014.
7. Baranova A, Lal P, Birerdinc A, Younossi ZM. Non-invasive markers for hepatic
fibrosis. BMC gastroenterology. 2011; 11: 91.
8. Bansal T, Pandey A, D D, Asthana AK. C-Reactive Protein (CRP) and its Association
with Periodontal Disease: A Brief Review. Journal of Clinical and Diagnostic Research :
JCDR. 2014; 8: ZE21-ZE4.
9. Kao PC, Shiesh SC, Wu TJ. Serum C-reactive protein as a marker for wellness
assessment. Ann Clin Lab Sci. 2006; 36: 163-9.
10. Di Carlo I, Mannino M, Toro A, Ardiri A, Galia A, Cappello G, et al. Persistent increase
in alpha-fetoprotein level in a patient without underlying liver disease who underwent
curative resection of hepatocellular carcinoma. A case report and review of the literature.
World Journal of Surgical Oncology. 2012; 10: 79.
11. Li J, Krishna SM, Golledge J. The Potential Role of Kallistatin in the Development of
Abdominal Aortic Aneurysm. International Journal of Molecular Sciences. 2016; 17:
1312.
12. Chao J, Schmaier A, Chen L-M, Yang Z, Chao L. Kallistatin, a novel human tissue
kallikrein inhibitor: Levels in body fluids, blood cells and tissues in health and disease.
Journal of Laboratory and Clinical Medicine. 1996; 127: 612-20.
13. Wolf WC, Harley RA, Sluce D, Chao L, Chao J. Localization and expression of tissue
kallikrein and kallistatin in human blood vessels. Journal of Histochemistry &
Cytochemistry. 1999; 47: 221-8.
14. Chen VC, Chao L, Pimenta DC, Bledsoe G, Juliano L, Chao J. Identification of a major
heparin-binding site in kallistatin. J Biol Chem. 2001; 276: 1276-84.
15. Zhu H, Chao J, Raed A, Huang Y, Bhagatwala J, Parikh S, et al. Plasma Kallistatin is
Associated with Leukocyte Telomere Length in Young African Americans. The FASEB
Journal. 2016; 30: 625.1-.1.
www.wjpps.com Vol 6, Issue 9, 2017.
171
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
16. Chao J, Chen L, Chai K, Chao L. Expression of kallikrein-binding protein and alpha 1-
antitrypsin genes in response to sex hormones, growth, inflammation and hypertension.
Agents and actions Supplements. 1991; 38: 174-81.
17. Cheng Z, Lv Y, Pang S, Bai R, Wang M, Lin S, et al. Kallistatin, a new and reliable
biomarker for the diagnosis of liver cirrhosis. Acta Pharmaceutica Sinica B. 2015; 5:
194-200.
18. Jiang Z, Yamauchi K, Yoshioka K, Aoki K, Kuroyanagi S, Iwata A, et al. Support Vector
Machine-Based Feature Selection for Classification of Liver Fibrosis Grade in Chronic
Hepatitis C. Journal of Medical Systems. 2006; 30: 389-94.
19. Lichtinghagen R, Pietsch D, Bantel H, Manns MP, Brand K, Bahr MJ. The Enhanced
Liver Fibrosis (ELF) score: normal values, influence factors and proposed cut-off values.
Journal of hepatology. 2013; 59: 236-42.
20. Martinez SM, FernándezVaro G, González P, Sampson E, Bruguera M, Navasa M, et al.
Assessment of liver fibrosis before and after antiviral therapy by different serum marker
panels in patients with chronic hepatitis C. Alimentary pharmacology & therapeutics.
2011; 33: 138-48.
21. Marks PW. Hematologic manifestations of liver disease. Seminars in hematology:
Elsevier; 2013; 216-21.
22. Osada M, Kaneko M, Sakamoto M, Endoh M, Takigawa K, Suzuki-Inoue K, et al. Causes
of thrombocytopenia in chronic hepatitis C viral infection. Clinical and Applied
Thrombosis/Hemostasis. 2012; 18: 272-80.
23. Fouad YM. Chronic hepatitis C-associated thrombocytopenia: aetiology and
management. Tropical Gastroenterology. 2013; 34: 58-67.
24. Mitchell O, Feldman DM, Diakow M, Sigal SH. The pathophysiology of
thrombocytopenia in chronic liver disease. Hepatic medicine: evidence and research.
2016; 8: 39.
25. Sanjo A, Satoi J, Ohnishi A, Maruno J, Fukata M, Suzuki N. Role of elevated
plateletassociated immunoglobulin G and hypersplenism in thrombocytopenia of chronic
liver diseases. Journal of gastroenterology and hepatology. 2003; 18: 638-44.
26. Rios R, Sangro B, Herrero I, Quiroga J, Prieto J. The role of thrombopoietin in the
thrombocytopenia of patients with liver cirrhosis. The American journal of
gastroenterology. 2005; 100: 1311-6.
www.wjpps.com Vol 6, Issue 9, 2017.
172
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
27. Lu S-N, Wang J-H, Liu S-L, Hung C-H, Chen C-H, Tung H-D, et al. Thrombocytopenia
as a surrogate for cirrhosis and a marker for the identification of patients at high-risk for
hepatocellular carcinoma. Cancer. 2006; 107: 2212-22.
28. He Q, He Q, Qin X, Li S, Li T, Xie L, et al. The Relationship between Inflammatory
Marker Levels and Hepatitis C Virus Severity. Gastroenterology Research and Practice.
2016; 2016: 2978479.
29. Llovet JM, Burroughs A, Bruix J. Hepatocellular carcinoma. Lancet. 2003; 362: 1907-17.
30. Nzeako UC, Trevisani F, D'Intino PE, Caraceni P, Bernardi M. Etiologic factors and
clinical presentation of hepatocellular carcinoma: differences between cirrhotic and
noncirrhotic Italian patients. Cancer. 1995; 76: 915.
31. Calvet X, Bruix J, Ginés P, Bru C, Sole M, Vilana R, et al. Prognostic factors of
hepatocellular carcinoma in the west: a multivariate analysis in 206 patients. Hepatology.
1990; 12: 753-60.
32. Calvet X, Bruix J, Brú C, Ginés P, Vilana R, Solé M, et al. Natural history of
hepatocellular carcinoma in Spain: five year's experience in 249 cases. Journal of
hepatology. 1990; 10: 311-7.
33. Carr BI, Lin C-Y, Lu S-N. Platelet-related phenotypic patterns in hepatocellular
carcinoma patients. Seminars in oncology: Elsevier; 2014; 415-21.
34. Stone RL, Nick AM, McNeish IA, Balkwill F, Han HD, Bottsford-Miller J, et al.
Paraneoplastic thrombocytosis in ovarian cancer. New England Journal of Medicine.
2012; 366: 610-8.
35. Carr BI, Guerra V. Thrombocytosis and hepatocellular carcinoma. Digestive diseases and
sciences. 2013; 58: 1790-6.
36. Griffiths L, Stratford I. Platelet-derived endothelial cell growth factor thymidine
phosphorylase in tumour growth and response to therapy. British journal of cancer. 1997;
76: 689.
37. Verheul HM, Jorna AS, Hoekman K, Broxterman HJ, Gebbink MF, Pinedo HM. Vascular
endothelial growth factorstimulated endothelial cells promote adhesion and activation of
platelets. Blood. 2000; 96: 4216-21.
38. Ukropec JA, Hollinger MK, Salva SM, Woolkalis MJ. SHP2 association with VE-
cadherin complexes in human endothelial cells is regulated by thrombin. Journal of
Biological Chemistry. 2000; 275: 5983-6.
www.wjpps.com Vol 6, Issue 9, 2017.
173
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
39. Wartiovaara U, Salven P, Mikkola H, Lassila R, Kaukonen J, Joukov V, et al. Peripheral
blood platelets express VEGF-C and VEGF which are released during platelet activation.
Thrombosis and haemostasis. 1998; 80: 171-5.
40. Saadeh S, Cammell G, Carey WD, Younossi Z, Barnes D, Easley K. The role of liver
biopsy in chronic hepatitis C. Hepatology. 2001; 33: 196-200.
41. Friedman L, Martin P, Munoz S. Laboratory methods for evaluation of the liver disease.
Zakim and Boyer's hepatology: a textbook of liver disease 4th ed. Philadelphia: Saunders:
Elsevier Health Sciences; 2002; 661-708.
42. Motawi TK, Shaker OG, El-Maraghy SA, Senousy MA. Serum microRNAs as potential
biomarkers for early diagnosis of hepatitis C virus-related hepatocellular carcinoma in
Egyptian patients. PloS one. 2015; 10: e0137706.
43. Ahmad W, Ijaz B, Javed FT, Gull S, Kausar H, Sarwar MT, et al. A comparison of four
fibrosis indexes in chronic HCV: Development of new fibrosis-cirrhosis index (FCI).
BMC Gastroenterology. 2011; 11: 44.
44. Fouad SA, Esmat S, Omran D, Rashid L, Kobaisi MH. Noninvasive assessment of
hepatic fibrosis in Egyptian patients with chronic hepatitis C virus infection. World
journal of gastroenterology: WJG. 2012; 18: 2988.
45. Green RM, Flamm S. AGA technical review on the evaluation of liver chemistry tests.
Gastroenterology. 2002; 123: 1367-84.
46. Loaeza-del-Castillo A, Paz-Pineda F, Oviedo-Cárdenas E, Sánchez-Avila F, Vargas-
Vorácková F. AST to platelet ratio index (APRI) for the noninvasive evaluation of liver
fibrosis. Annals of hepatology. 2008; 7: 350-7.
47. Sebastiani G, Vario A, Guido M, Noventa F, Plebani M, Pistis R, et al. Stepwise
combination algorithms of non-invasive markers to diagnose significant fibrosis in
chronic hepatitis C. Journal of hepatology. 2006; 44: 686-93.
48. Snyder N, Gajula L, Xiao S-Y, Grady J, Luxon B, Lau DT, et al. APRI: an easy and
validated predictor of hepatic fibrosis in chronic hepatitis C. Journal of clinical
gastroenterology. 2006; 40: 535-42.
49. Abd-Elghany S, Ahmed Ibrahem E, El-Sayed S, Mohammed S, Morsy A. Serum
hyaluronic acid as a noninvasive marker of hepatic fibrosis in chronic hepatitis c patients.
Al-Azhar Assiut Medical Journal. 2016; 14: 67-75.
50. Demerdash HM, Hussien HM, Hassouna E, Arida EA. Detection of MicroRNA in
Hepatic Cirrhosis and Hepatocellular Carcinoma in Hepatitis C Genotype-4 in Egyptian
Patients. BioMed Research International. 2017; 2017: 1806069.
www.wjpps.com Vol 6, Issue 9, 2017.
174
Ragab et al. World Journal of Pharmacy and Pharmaceutical Sciences
51. Badola S, Spurling H, Robison K, Fedyk ER, Silverman GA, Strayle J, et al. Correlation
of serpinprotease expression by comparative analysis of real-time PCR profiling data.
Genomics. 2006; 88: 173-84.
52. Diao Y, Zhao X-F, Lin J-S, Wang Q-Z, Xu R-A. Protection of the liver against CCl4-
induced injury by intramuscular electrotransfer of a kallistatin-encoding plasmid. World
Journal of Gastroenterology: WJG. 2011; 17: 111.
53. Huang X, Wang X, Lv Y, Xu L, Lin J, Diao Y. Protection Effect of Kallistatin on Carbon
Tetrachloride-Induced Liver Fibrosis in Rats via Antioxidative Stress. PLOS ONE. 2014;
9: e88498.
54. Lu L, Yang Z, Zhu B, Fang S, Yang X, Cai W, et al. Kallikrein-binding protein
suppresses growth of hepatocellular carcinoma by anti-angiogenic activity. Cancer letters.
2007; 257: 97-106.
... The measurement results were analyzed using the correspondence of the liver stiffness (kPa; m/s) to the fibrosis and cirrhosis stages according to the METAVIR scale (Castera et al. [24]) and the Soneus P7 correspondence table. Based on these data, we considered cases of liver stiffness (LS Me) in the range of 2.5-6.0 kPa as F0 stage according to METAVIR 8 A c c e p t e d m a n u s c r i p t score (no fibrosis), 6.0-7.0 kPa as F1 (weak fibrosis, star-shaped expansion of portal tracts by fibrosis without septal formation), 7.0-9.5 kPa as F2 (mild fibrosis, portal tracts expansion with single porto-portal septa (>1 sept)), 9.5-12.5 kPa as F3 (severe fibrosis, numerous portcentral septa), 12.5-60 kPa as the F4 (cirrhosis) stages, respectively. ...
... Cheng Z. et al. [27] found a significantly lower content of kallistatin in patients with liver fibrosis. Halla M. et al. [8] proved that even a single determination of the biomarker level allows to detect patients in the initial liver fibrosis stages with a sensitivity of 96.7% and a specificity of 50%. These data confirm the results of our study, where kallistatin levels differed between patients without fibrosis (F0) and with minor fibrosis (F1) both in the NAFLD and HT group (p=0.004) and in the isolated NAFLD group (р<0,001). ...
... However, literature data indicate a relatively low sensitivity (64%) and specificity (77%) of kallistatin as an indicator of liver cirrhosis [17]. In the detection of liver fibrotic changes in the study of Halla MR et al. [8] the kallistatin determination sensitivity was slightly higher and amounted to 96.7%, but the specificity of the test decreased to 50%. ...
Article
Full-text available
Background and Aim Non-alcoholic fatty liver disease (NAFLD) is closely linked to hypertension (HT). An important issue remains the search for non-invasive tests to NAFLD detection in the early stages of liver fibrosis. The objective of the study was to evaluate the diagnostic and prognostic value of kallistatin in assessing the liver fibrosis progression in NAFLD and HT patients. Patients and Methods 115 patients with NAFLD with and without HT were examined, the control group consisted of 20 relatively healthy volunteers. Plasma kallistatin level measurement, ultrasound steatometry and elastography were performed in all patients. Results Kallistatin level was 65.03 ng/ml (95% CI 61.38; 68.68), 83.42 ng/ml (95% CI 81.89; 84.94) and 111.70 ng/ml (95% CI 106.14; 113.22) in patients with NAFLD and HT, isolated NAFLD and control group, respectively. There were significant differences in the liver parenchyma condition between groups. Kallistatin levels strongly inversely correlated with the attenuation coefficient and the mean liver stiffness in NAFLD and HT (rs=-0.70) and in the isolated NAFLD patients (rs=-0.56; rs=-0.68, respectively). Kallistatin level was 71.82 ng/ml (95% CI 70.16; 79.51) and 58.62 ng/ml (95% CI 55.81; 64.45) in patients with HT stage I and HT stage II, respectively (p<0.001). Conclusions Concomitant HT in NAFLD patients is associated with greater severity of fatty and fibrotic liver changes. The course of NAFLD is accompanied by decrease in kallistatin level. Increased degree of liver steatosis and fibrosis, inflammation activity, increased BMI and increased stage of HT lead to inhibition of kallistatin activity. Kallistatin may be considered as a biomarker for progression assessment of NAFLD with or without HT.
Article
Full-text available
Background. Red cell distribution width (RDW) and platelet-lymphocyte ratio (PLR) have been studied in a variety of etiological diseases. We aim to investigate the relationship between RDW and PLR and the severity of hepatitis C virus- (HCV-) related liver disease. Methods. We included fifty-two chronic HCV and 42 HCV-related cirrhosis patients and 84 healthy controls. Hematological and virological parameters and liver function biomarkers of HCV-related patients at admission were recorded. Results. RDW, RDW-to-platelet (RPR), and 1/PLR values in HCV-related cirrhosis patients were significantly higher than in chronic HCV patients and healthy controls (all P<0.001 ). The aspartate aminotransferase (AST)/alanine aminotransferase (ALT) ratio (AAR), AST-to-platelet ratio index (APRI), and fibrosis index based on the four factors (FIB-4) scores in HCV-related cirrhosis patients were significantly higher than in chronic HCV patients (all P<0.001 ). The areas under the curve of the RDW, RPR, and 1/PLR for predicting cirrhosis were 0.791, 0.960, and 0.713, respectively. Bivariate logistic regression analysis showed that RDW could independently predict the presence of cirrhosis in chronic HCV patients. Conclusions. RDW, RPR, and PLR may be potential markers for estimating HCV severity.
Article
Full-text available
The immuno-pathogenic mechanisms of chronic hepatitis C virus (HCV) infection remain to be elucidated and pose a major hurdle in treating or preventing chronic HCV-induced advanced liver diseases such as cirrhosis. Macrophages are a major component of the inflammatory milieu in chronic HCV–induced liver disease, and are generally derived from circulating inflammatory monocytes; however very little is known about their role in liver diseases. To investigate the activation and role of macrophages in chronic HCV–induced liver fibrosis, we utilized a recently developed humanized mouse model with autologous human immune and liver cells, human liver and blood samples and cell culture models of monocyte/macrophage and/or hepatic stellate cell activation. We showed that M2 macrophage activation was associated with liver fibrosis during chronic HCV infection in the livers of both humanized mice and patients, and direct-acting antiviral therapy attenuated M2 macrophage activation and associated liver fibrosis. We demonstrated that supernatant from HCV-infected liver cells activated human monocytes/macrophages with M2-like phenotypes. Importantly, HCV-activated monocytes/macrophages promoted hepatic stellate cell activation. These results suggest a critical role for M2 macrophage induction in chronic HCV-associated immune dysregulation and liver fibrosis.
Article
Full-text available
Abdominal aortic aneurysm (AAA) is a vascular condition that causes permanent dilation of the abdominal aorta, which can lead to death due to aortic rupture. The only treatment for AAA is surgical repair, and there is no current drug treatment for AAA. Aortic inflammation, vascular smooth muscle cell apoptosis, angiogenesis, oxidative stress and vascular remodeling are implicated in AAA pathogenesis. Kallistatin is a serine proteinase inhibitor, which has been shown to have a variety of functions, potentially relevant in AAA pathogenesis. Kallistatin has been reported to have inhibitory effects on tumor necrosis factor alpha (TNF-α) signaling induced oxidative stress and apoptosis. Kallistatin also inhibits vascular endothelial growth factor (VEGF) and Wnt canonical signaling, which promote inflammation, angiogenesis, and vascular remodeling in various pre-clinical experimental models. This review explores the potential protective role of kallistatin in AAA pathogenesis.
Article
Full-text available
Thrombocytopenia is the most common hematological abnormality encountered in patients with chronic liver disease (CLD). In addition to being an indicator of advanced disease and poor prognosis, it frequently prevents crucial interventions. Historically, thrombocytopenia has been attributed to hypersplenism, which is the increased pooling of platelets in a spleen enlarged by congestive splenomegaly secondary to portal hypertension. Over the past decade, however, there have been significant advances in the understanding of thrombopoiesis, which, in turn, has led to an improved understanding of thrombocytopenia in cirrhosis. Multiple factors contribute to the development of thrombocytopenia and these can broadly be divided into those that cause decreased production, splenic sequestration, and increased destruction. Depressed thrombopoietin levels in CLD, together with direct bone marrow suppression, result in a reduced rate of platelet production. Thrombopoietin regulates both platelet production and maturation and is impaired in CLD. Bone marrow suppression can be caused by viruses, alcohol, iron overload, and medications. Splenic sequestration results from hypersplenism. The increased rate of platelet destruction in cirrhosis also occurs through a number of pathways: increased shear stress, increased fibrinolysis, bacterial translocation, and infection result in an increased rate of platelet aggregation, while autoimmune disease and raised titers of antiplatelet immunoglobulin result in the immunologic destruction of platelets. An in-depth understanding of the complex pathophysiology of the thrombocytopenia of CLD is crucial when considering treatment strategies. This review outlines the recent advances in our understanding of thrombocytopenia in cirrhosis and CLD.
Article
Full-text available
Circulating microRNAs are deregulated in liver fibrosis and hepatocellular carcinoma (HCC) and are candidate biomarkers. This study investigated the potential of serum microRNAs; miR-19a, miR-296, miR-130a, miR-195, miR-192, miR-34a, and miR-146a as early diagnostic biomarkers for hepatitis C virus (HCV)-related HCC. As how these microRNAs change during liver fibrosis progression is not clear, we explored their serum levels during fibrosis progression in HCV-associated chronic liver disease (CLD) and if they could serve as non-invasive biomarkers for fibrosis progression to HCC. 112 Egyptian HCV-HCC patients, 125 non-malignant HCV-CLD patients, and 42 healthy controls were included. CLD patients were subdivided according to Metavir fibrosis-scoring. Serum microRNAs were measured by qRT-PCR custom array. Serum microRNAs were deregulated in HCC versus controls, and except miR-130a, they were differentially expressed between HCC and CLD or late fibrosis (F3-F4) subgroup. Serum microRNAs were not significantly different between individual fibrosis-stages or between F1-F2 (early/moderate fibrosis) and F3-F4. Only miR-19a was significantly downregulated from liver fibrosis (F1-F3) to cirrhosis (F4) to HCC. Individual microRNAs discriminated HCC from controls, and except miR-130a, they distinguished HCC from CLD or F3-F4 patients by receiver-operating-characteristic analysis. Multivariate logistic analysis revealed a panel of four microRNAs (miR-19a, miR-195, miR-192, and miR-146a) with high diagnostic accuracy for HCC (AUC = 0.946). The microRNA panel also discriminated HCC from controls (AUC = 0.949), CLD (AUC = 0.945), and F3-F4 (AUC = 0.955). Studied microRNAs were positively correlated in HCC group. miR-19a and miR-34a were correlated with portal vein thrombosis and HCC staging scores, respectively. In conclusion, studied microRNAs, but not miR-130a, could serve as potential early biomarkers for HCC in high-risk groups, with miR-19a as a biomarker for liver fibrosis progression to cirrhosis to HCC. We identified a panel of four serum microRNAs with high accuracy in HCC diagnosis. Additional studies are required to confirm this panel and test its prognostic significance.
Article
Full-text available
Kallistatin, which protects organs and cells against inflammation, fibrosis and oxidative stress, is mainly synthesized and secreted in liver. However, its relationship to human liver disease remains unclear. The purpose of this study was to explore the relationship between serum kallistatin and clinical evidence of both cirrhosis and hepatocellular carcinoma (HCC), and to determine if serum kallistatin levels could be used as a diagnostic indicator of hepatic health status, especially human liver cirrhosis (LC). Our cohort consisted of 115 patients with clinically proven liver fibrosis (LF), LC, or HCC by liver biopsies, and 31 healthy controls (CON). Serum kallistatin levels were quantified by ELISA. Results of the present study demonstrated that irrespective of the underlying etiology, serum kallistatin levels were significantly lower in the LF/LC group when compared with the CON group. A decrease in serum kallistatin levels appeared to reflect the extent of cirrhosis, with the lowest levels associated with higher grades of cirrhosis. Patients with LC had a noticeable correlation between serum kallistatin levels and other serum biochemical indicators. The area under the curve (AUC) for LC, viral liver cirrhosis (VLC) and alcoholic liver cirrhosis (ALC) was 0.845, 0.757 and 0.931, respectively. In conclusion, our findings demonstrated that kallistatin, a plasma protein produced by the liver, can be a useful and reliable diagnostic indicator of hepatic health status, especially for LC.
Article
Full-text available
Chronic infection with hepatitis C virus (HCV) is a leading cause of liver-related morbidity and mortality worldwide and predisposes to liver fibrosis and end-stage liver complications. Liver fibrosis is the excessive accumulation of extracellular matrix proteins, including collagen, and is considered as a wound healing response to chronic liver injury. Its staging is critical for the management and prognosis of chronic hepatitis C (CHC) patients, whose number is expected to rise over the next decades, posing a major health care challenge. This review provides a brief update on HCV epidemiology, summarizes basic mechanistic concepts of HCV-dependent liver fibrogenesis, and discusses methods for assessment of liver fibrosis that are routinely used in clinical practice. Liver biopsy was until recently considered as the gold standard to diagnose and stage liver fibrosis. However, its invasiveness and drawbacks led to the development of non-invasive methods, which include serum biomarkers, transient elastography and combination algorithms. Clinical studies with CHC patients demonstrated that non-invasive methods are in most cases accurate for diagnosis and for monitoring liver disease complications. Moreover, they have a high prognostic value and are cost-effective. Non-invasive methods for assessment of liver fibrosis are gradually being incorporated into new guidelines and are becoming standard of care, which significantly reduces the need for liver biopsy.
Article
Coagulation abnormalities, including an increased platelet turnover, are frequently found in patients with cancer. Because platelets secrete angiogenic factors on activation, this study tested the hypothesis that platelets contribute to angiogenesis. Stimulation with vascular endothelial growth factor (VEGF, 25 ng/mL) of human umbilical vein endothelial cells (HUVECs) promoted adhesion of nonactivated platelets 2.5-fold. In contrast, stimulation of HUVECs with basic fibroblast growth factor (bFGF) did not promote platelet adhesion. By blocking tissue factor (TF) activity, platelet adhesion was prevented and antibodies against fibrin(ogen) and the platelet-specific integrin, αIIbβ3, inhibited platelet adhesion for 70% to 90%. These results indicate that VEGF-induced platelet adhesion to endothelial cells is dependent on activation of TF. The involvement of fibrin(ogen) and the αIIbβ3 integrin, which exposes a high-affinity binding site for fibrin(ogen) on platelet activation, indicates that these adhering platelets are activated. This was supported by the finding that the activity of thrombin, a product of TF-activated coagulation and a potent platelet activator, was required for platelet adhesion. Finally, platelets at physiologic concentrations stimulated proliferation of HUVECs, indicative of proangiogenic activity in vivo. These results support the hypothesis that platelets contribute to tumor-induced angiogenesis. In addition, they may explain the clinical observation of an increased platelet turnover in cancer patients. Platelets may also play an important role in other angiogenesis-dependent diseases in which VEGF is involved, such as diabetes and autoimmune diseases.
Article
Background Patients with chronic hepatitis C virus (HCV) infection are often asymptomatic with few clinical signs of liver disease. Recognition of the presence of fibrosis or cirrhosis is difficult without liver biopsy, but with the availability of effective treatments, such as interferon, and the potential for progression to hepatoma in some cases, an accurate measure of the stage of disease is important. Serum hyaluronic acid (HA) has been identified as a potential marker of fibrosis or cirrhosis. Aim of the work The aim of this study was to evaluate the serum level of HA as a noninvasive marker of hepatic fibrosis in comparison with liver biopsy and indirect serum fibrosis markers such as AST/ALT ratio and aspartate transaminase to platelet ratio index (APRI) in chronic HCV patients. Patients and methods Our patients were classified into three groups: group 1 included 20 patients with mild hepatic fibrosis (F1 stage); group 2 included 20 patients with moderate hepatic fibrosis (F2 stage); and group 3 included 20 patients with marked hepatic fibrosis and cirrhosis (F3 and F4 stages). The control group included 20 normal volunteers. Serum HA level evaluation, liver function tests, and complete blood count were carried out for all groups, whereas liver biopsy was performed only for patients to determine the stage of liver fibrosis. Results There was a highly significant increase in serum HA level in group 2 and group 3 in comparison with the control group and a significant increase in group 1 in comparison with the control group. However, there was highly significant increase in group 3 in comparison with group 1 and group 2 and a significant increase in group 2 in comparison with group 1. The cutoff point for HA level was greater than 42.18 ng/l to discriminate between the patient and the control group, with a sensitivity of 91.7% and a specificity of 95.0% for HA. The cutoff point for HA level was greater than 81.68 ng/l to discriminate between group 1 (mild fibrosis) and group 2 (moderate fibrosis), with a sensitivity of 100% and a specificity of 70%. The cutoff point for HA level to discriminate between group 2 (moderate fibrosis) and group 3 (severe fibrosis and cirrhosis) was greater than 167.98 ng/l, with a sensitivity of 90% and specificity of 80%. There was a significant positive correlation between serum HA level and APRI. Conclusion HA is a promising reliable simple noninvasive marker for assessing liver fibrosis in HCV-infected patients with high sensitivity and specificity. There was a positive correlation between serum HA level with stages of hepatic fibrosis and APRI.
Article
C-reactive protein (CRP), a nonspecific inflammatory marker, is widely used to monitor treatment of cardiovascular diseases ( high serum CRP levels indicate poor outcome of heart disease). A healthy lifestyle decreases serum CRP levels, while obesity, physical inactivity, and smoking increase them. CRP, a stable pentameric protein, has a half-life of 19 hr, is not subject to diurnal variation, and can serve as a marker of wellness and a candidate for future direct access testing for people monitoring their health after adopting a healthier lifestyle. The CRP level may be influenced more by lifestyle than by genetics. Monozygotic twins may not have the same CRP level; within each twin pair, the one with higher adiposity generally has a higher CRP level than the one with low adiposity. Chronic diseases generally have a lower prevalence among Asians than among Westerners. Asians also have lower CRP levels than Westerners. In large population studies, the median CRP level of Asians is only one-tenth that of Westerners. Is there a factor in the lifestyle or diet of Asians that accounts for lower CRP levels? For example, a statin inhibitor of cholesterol synthesis occurs in red yeast rice, an important component of the Asian diet. In summary, CRP is a marker for monitoring cardiovascular therapy and assessing the wellness of the general population. Through improving health and preventing disease, CRP testing may help lower a nation's health costs.