ArticlePDF Available

Abstract and Figures

NAD(+) depletion is a common phenomenon in neurodegenerative pathologies. Excitotoxicity occurs in multiple neurologic disorders and NAD(+) was shown to prevent neuronal degeneration in this process through mechanisms that remained to be determined. The activity of nicotinamide riboside (NR) in neuroprotective models and the recent description of extracellular conversion of NAD(+) to NR prompted us to probe the effects of NAD(+) and NR in protection against excitotoxicity. Here, we show that intracortical administration of NR but not NAD(+) reduces brain damage induced by NMDA injection. Using cortical neurons, we found that provision of extracellular NR delays NMDA-induced axonal degeneration (AxD) much more strongly than extracellular NAD(+) Moreover, the stronger effect of NR compared to NAD(+) depends of axonal stress since in AxD induced by pharmacological inhibition of nicotinamide salvage, both NAD(+) and NR prevent neuronal death and AxD in a manner that depends on internalization of NR. Taken together, our findings demonstrate that NR is a better neuroprotective agent than NAD(+) in excitotoxicity-induced AxD and that axonal protection involves defending intracellular NAD(+) homeostasis.-Vaur, P., Brugg, B., Mericskay, M., Li, Z., Schmidt, M. S., Vivien, D., Orset, C., Jacotot, E., Brenner, C., Duplus, E. Nicotinamide riboside, a form of vitamin B3, protects against excitotoxicity-induced axonal degeneration.
Somatic application of NMDA on cortical neurons induces neuronal death and axonal degeneration. A) 3-dimensional representation of microfluidic devices composed of 3 separated chambers connected by funnel-shaped microchannels. Cortical neurons are seeded in the proximal chamber, and axons reach the distal chamber after 4-6 d in vitro. An overpressured central channel enables optimal fluidic isolation and compartmentalized treatment between somatic and axonal compartments. B) Light microscope image of microchannels between proximal and distal chambers. C-E ) Representative micrographs of somatic and axonal compartments after NMDA treatment. Cortical neurons were cultured for 11 d and treated for 24 h with 100 mM NMDA. Left: the somatodendritic compartment stained with anti-MAP2 (red) and Hoechst 33342 (blue). Asterisks denote condensed nuclei. Right: the axonal compartment stained with anti-b 3tubulin: control condition (ø/ø) (C ); somatodendritic treatment with NMDA (NMDA/ø) (D); and selective axonal treatment with NMDA (ø/NMDA) (E ). Scale bars, 20 mm. F ) Quantification of nuclear condensation in control and after compartmentalized NMDA treatment. Condensed nuclei were counted after Hoechst staining (n = 3). G) Quantification of AxD in control and after compartmentalized NMDA treatment (n = 3). Axonal fragmentation index was calculated as described in Methods. H, I ) Effect of the NMDA antagonist MK-801 on NMDA-induced nuclear pyknosis and AxD: Cells were cotreated with 100 mM NMDA and 10/50 mM MK-801 in the somatodendritic compartment. Quantification of somatic status (H ) and AxD (I ) (n = 3). *P , 0.05.
… 
Content may be subject to copyright.
THE
JOURNAL RESEARCH www.fasebj.org
Nicotinamide riboside, a form of vitamin B
3
, protects
against excitotoxicity-induced axonal degeneration
Pauline Vaur,* Bernard Brugg,* Mathias Mericskay,*
,
Zhenlin Li,*
,
Mark S. Schmidt,
§
Denis Vivien,
{
Cyrille Orset,
{
Etienne Jacotot,* Charles Brenner,
§
and Eric Duplus*
,1
*Unit´
e Mixte de Recherche (UMR) Adaptation Biologique et Vieillissement (UMR 8256), Institut Biologie Paris Seine, Centre National de la
Recherche Scientifique (CNRS), INSERM, Universit´
e Pierre et Marie Curie (UPMC), Sorbonne Universit´
es, Paris, France;
Equipe de Recherche
Labellis´
ee (ERL) U1164 and
Unit´
e Signalisation et Physiopathologie Cardiovasculaire, INSERM, Universit´
e ParisSaclay, Universit´
e Paris Sud,
Chˆ
atenay-Malabry, France;
§
Department of Biochemistry, Carver College of Medicine, University of Iowa, Iowa City, Iowa, USA; and
{
Unit´
e
INSERM 1237, GIP Cyc´
eron, Centre Hospitalier Universitaire de Caen, Universit´
e Caen Normandie, Caen, France
ABSTRACT: NAD
+
depletion is a common phenomenon in neurodegenerative pathologies. Excitotoxicity occurs in
multiple neurologic disorders and NAD
+
was shown to prevent neuronal degeneration in this process through
mechanisms that remained to be determined. The activity of nicotinamide riboside (NR) in neuroprotective models
and the recent description of extracellular conversion of NAD
+
to NR prompted us to probe the effects of NAD
+
and
NR in protection against excitotoxicity. Here, we show thatintracortical administration of NRbut not NAD
+
reduces
brain damage induced by NMDA injection. Using cortical neurons, we found that provision of extracellular NR
delays NMDA-induced axonal degeneration (AxD) much more strongly than extracellular NAD
+
. Moreover, the
stronger effect of NR compared to NAD
+
depends of axonal stress since in AxD induced by pharmacological
inhibition of nicotinamide salvage, both NAD
+
and NR prevent neuronal death and AxD in a manner that depends
on internalization of NR. Taken together, our findings demonstrate that NR is a better neuroprotective agent than
NAD
+
in excitotoxicity-induced AxD and that axonal protection involves defending intracellular NAD
+
homeostasis.Vaur, P., Brugg, B., Mericskay, M., Li, Z., Schmidt, M. S., Vivien, D., Orset, C., Jacotot, E., Brenner, C.,
Duplus, E. Nicotinamide riboside, a form of vitamin B
3
, protects against excitotoxicity-induced axonal degeneration.
FASEB J. 31, 000000 (2017). www.fasebj.org
KEY WORDS: NAD
+
NMDA FK866 cortical neurons NR
Axonal degeneration (AxD) is an early major event in
acute cerebral injury and in chronic neurodegenerative
diseases, including Alzheimer and Parkinson diseases
(14). Preserving axonal integrity by stopping neurode-
generative expansion and preventing irreversible neuro-
nal damage could represent a powerful therapeutic
strategy in prevention of brain disorders. Several lines of
reasoning support AxD proceeding via amechanism
associated with dysregulated NAD
+
metabolism that is
distinct from neuronal cell body death (58). Notably,
a spontaneous mutation termed Wlds,whichdelays
axotomy-induced AxD in neurons derived from the
peripheral nervous system (PNS), has been discovered
in mice (9). Wlds encodes a fusion protein that over-
expresses and stabilizes the complete coding sequence
of nicotinamide mononucleotide adenylyltransferase
(Nmnat)-1, an enzyme that converts nicotinamide
mononucleotide (NMN) to NAD
+
(10). Moreover, sev-
eral studies revealed a protective effect of Nmnat over-
expression or application of NAD
+
or NAD
+
precursors
in axotomy-induced AxD in the PNS (5, 7, 8, 11). One
such precursor, nicotinamide riboside (NR), protects
against diabetic peripheral neuropathy in vivo (12).
Themolecularcascadeandthetimecourseofeventsin
AxD have been explored intensively. Axonal lesion in
dorsal root ganglia induces a loss of Nmnat2 protein and
activation of sterile aand TIR motifcontaining (Sarm)-1
protein, thereby triggering the MAPK signaling pathway,
NAD
+
depletion and subsequent AxD (1315). More re-
cently, it has been shown that Nmnat1 expression can
ABBREVIATIONS: ADPR, adenosine diphosphate receptor; AxD, axonal
degeneration; CMP, cytidine monophosphate; CNT, concentrative nucle-
oside transporter; DP, dipyridamole; D-PBS, Dulbecco-PBS; ENPPase,
ectonucleotide pyrophosphatase phosphodiesterase; ENT, equilibrative
nucleoside transporter; ENTase, ectonucleotidase; HPRT, hypoxanthine-
guanine phosphoribosyltransferase; KO, knockout; MAP2, microtubule-
associated protein 2; NAM, nicotinamide; NMDAR, NMDA receptor;
NMN, nicotinamide mononucleotide; Nmnat, nicotinamide mono-
nucleotide adenylyltransferase; Nmrk, nicotinamide riboside kinase; NR,
nicotinamide riboside; NT, nucleoside transporter; PNS, peripheral ner-
vous system
1
Correspondence: Laboratoire Adaptation Biologique et Vieillissement,
UMR 8256, Neuronal Stress and Aging Team, Universit´
e Pierre et Marie
CurieCNRS, case courrier 12, 9 Quai St Bernard, 75005 Paris, France.
E-mail: eric.duplus@upmc.fr
doi: 10.1096/fj.201700221RR
This article includes supplemental data. Please visit http://www.fasebj.org to
obtain this information.
0892-6638/17/0031-0001 © FASEB 1
The FASEB Journal article fj.201700221RR. Published online August 24, 2017.
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
inhibit Sarm1-mediated NAD
+
depletion (16). These
results highlight the essential role of NAD
+
metabo-
lism in AxD of PNS-derived neurons. Whether a sim-
ilar relationship exists between NAD
+
metabolism and
AxD in the CNS has not been well explored.
AstrongNAD
+
depletion in neurons has been revealed
during excitotoxicity (1720). Excitotoxicity is a common
process taking place in most neurodegenerative disorders
affecting the CNS and is the main cell death mechanism in
ischemia and hypoxia. Moreover, excitotoxicity has been
shown to induce AxD in CNS-derived neurons (21, 22).
The involvement of NAD
+
in excitotoxic stress was con-
firmed by studies demonstrating a neuroprotective effect
of NAD
+
repletion via overexpression of NAD
+
bio-
synthetic enzymes, application of extracellular NAD
+
or
its precursors (17, 19, 23).
In the CNS, it has not been determined whether NAD
+
functions as a neurotransmitter or as a source of intracellular
NAD
+
in protecting against excitotoxicity-induced AxD.
This mechanistic understanding is needed in pursuing
therapeutic strategies with either NR or NAD
+
.Because
NAD
+
contains 2 phosphate groups, transport across the
plasma membrane is not expected, such that the protective
effect of extracellular NAD
+
may be related to extracellular
conversion to NR, one of its biosynthetic precursors (2428).
This extracellular conversion pathway is mediated by ecto-
nucleotide pyrophosphatase/phosphodiesterase (ENPPase)
and ectonucleotidase (ENTase) activities, previously char-
acterized for extracellular ATP conversion (29). After NAD
+
and NMN are converted to NR extracellularly, NR is used
intracellularly through the NR kinase pathway (28, 30).
NR is a recently described vitamin precursor of NAD
+
that is found in milk (31, 32) and is orally available in
humans (33). It enters cells through nucleoside trans-
porters (NTs) and is converted to NMN and NAD
+
through the successive action of NR kinases (Nmrk1/2)
and Nmnat isozymes (28). In vitro, NR delays AxD after
axotomy in dorsal root ganglion neurons (7). In mice, NR
prevents cognitive decline and amyloid-bpeptide aggre-
gation (34), protects against noise-induced neurite re-
traction of inner hair cells and hearing loss (35), and
protects against diabetic peripheral neuropathy (12). In
rats, NR both protects and reverses chemotherapeutic
peripheral neuropathy (36). We performed a comparative
study of NAD
+
and NR and examined NAD
+
extracellular
conversion in cortical neurons during excitotoxic stress.
We found that NR has a strong protective effect on
NMDA-induced neurodegeneration both in vitro and in
vivo. More specifically, NR, but not NAD
+
, had a strong
effect on NMDA-induced AxD, involving a local NR me-
tabolism within the axon. Finally, we showed that NAD
+
efficiency in cortical AxD protection is limited by conver-
sion to NR.
MATERIALS AND METHODS
Microfluidic chip production
The 3-compartment chip master was constructed as described in
Kanaan et al. (37). For chip production, polydimethylsiloxane
(Sylgard 184, PDMS; Dow Corning, Midland, MI, USA) was
mixed with a curing agent (9:1 ratio) and degassed under a
vacuum. The resulting preparation was poured onto a polyester
resin replicate and reticulated at 70°C for at least 2 h. The elas-
tomeric polymer print was detached, and 2 reservoirs were
punched for each macrochannel. The polymer print and a glass
coverslip, cleaned with isopropanol and dried, were treated for
3 min in an air plasma generator (98% power, 0.6 mbar; Diener
Electronic, Ebhausen, Germany) and bonded together. The chips
were placed under UV for 20 min and then coated with a solution
of poly D-lysine (10 mg/ml, P7280; Millipore-Sigma, St. Louis,
MO, USA) overnight and washed with Dulbecco-PBS (D-PBS)
(14190169; Thermo Fisher Scientific, Waltham, MA, USA) before
cell seeding. Alternatively, 3-compartment chips were purchased
from Microbrain Biotech (Paris, France).
Primary neuronal culture
All animals were ethically maintained and used in compliance
with the European Policy on Ethics. Cortices were microdissected
from E14 embryos of Swiss mice (Janvier, Le Genest Saint Isle,
France) in D-PBS supplemented with 0.1% (w/v) glucose
(Thermo Fisher Scientific). C57BL/6N mice were used in Nmrk2-
knockout (KO) experiments. Dissected structures were digested
with papain (15 U/ml in DMEM; 76220; Millipore-Sigma) for 5
min at 37°C. After papain inactivation with 10% (v/v) fetal bo-
vine serum (GE Healthcare, Little Chalfont, United Kingdom),
structures were mechanically dissociated with a pipette in
DMEM Glutamax-1 (31966; Thermo Fisher Scientific) containing
DNAse-I (D5025, Millipore-Sigma). After 2 7 min centrifugations
at 700 g, cells were resuspended in a medium containing DMEM
Glutamax-1, penicillin (100 U/ml)/streptomycin (100 mg/ml)
(15140; Thermo Fisher Scientific), 5% (v/v) fetal bovine serum,
N2 supplement (17502048; Thermo Fisher Scientific), and B-27
supplement (17504-044; Thermo Fisher Scientific) to a final den-
sity of 50 million cells/ml. Cortical cells were then seeded in the
somatic compartment. Cell culture medium was added equally
to the 4 reservoirs. Microfluidic chips were placed in Petri dishes
containing 10% EDTA (Millipore-Sigma) and incubated at 37°C
in a 5% CO
2
atmosphere. The culture medium was renewed
every 6 d. Upon differentiation, cortical axons entered the
microchannels and reached the second chambers after 45d.
Cortical axons continued growing thereafter.
Nmrk2-KO mouse
Nmrk2-KO mice were obtained by the injection of embryonic
stem cells (Nmrk2
tm1(KOMP)Vlcg
allele) from the Knockout Mouse
Project (KOMP) into C57BL/6N blastocysts at Centre National
de la Recherche ScientifiqueTransgenesis, Archiving and
Animal Models (CNRSTAAM) Transgenic Animal Facility
(SEAT; Villejuif, France). All exons and introns of the Nmrk2 gene
are replaced by a lacZ reporter gene to create a null allele in em-
bryonic stem cells (University of California, Davis, Davis, CA,
USA; https://www.komp.org/geneinfo.php?geneid=65082). Chimeric
male mice were used to obtain heterozygous Nmrk2-mutant mice
on a C57BL/6N background. Homozygous Nmrk2-KO mice were
viable and fertile. We validated the deletion by sequencing the
genomic DNA from the KO mice.
Pharmacological treatments
Cells were pretreated and/or treated between 11 and 13 d in vitro.
To ensure fluidic isolation, a differential hydrostatic pressure
between compartments was maintained.
The following compounds were used: NMDA, (100 mM;
M3262; Millipore-Sigma), FK866 (10 mM; F8557; Millipore-
Sigma), NAD
+
(N3014; Millipore-Sigma), NMN (N3501;
2 Vol. 31 December 2017 VAUR ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
Millipore-Sigma), NR (ChromaDex, Irvine, CA, USA), NAM
(N0636; Millipore-Sigma), dipyridamole (DP, 50 mM; D9766;
Millipore-Sigma), cytidine monophosphate (CMP; 25 mM;
C1006; Millipore-Sigma), and (+)MK-801-maleate (10/50 mM;
0924; Tocris Bioscience, Bristol, United Kingdom).
Immunofluorescence detection and
image acquisition
At various times, cultures were fixed with 4% (w/v) para-
formaldehyde (15714-S; Euromedex, Souffelweyersheim,
France) +4% (w/v) sucrose (S0389; Millipore-Sigma) for 20 min
at room temperature. Cellswere then washed once with PBS for
10 min and permeabilized for 30 min with D-PBS containing
0.2% (v/v) TritonX-100 (Millipore-Sigma) and 1% (w/v) BSA
(Millipore-Sigma). Immunostaining was performed as de-
scribed in Magnifico et al. (6) using the following conjugated
antibodies diluted in D-PBS: anti-bIII tubulin-Alexa Fluor 488
(1:500, AB15708A4; Millipore-Sigma) and anti-microtubule-
associated protein 2 (MAP2)-Alexa 555 (1:500, MAB3418A5;
Millipore-Sigma). Cell nuclei were stained by using Hoechst
33342 (2 mg/ml). The chips were then rinsed once with PBS
and filled with PBS+0.1% sodium azide.
Images were acquired with an Axio-observer Z1 microscope
(Zeiss, Wetzlar, Germany) fitted with a cooled CCD camera
(CoolsnapHQ2; Roper Scientific, Trenton, NJ, USA). The micro-
scope was controlled with Metamorph (Berlin, Germany) soft-
ware, and images were analyzed with ImageJ software (National
Institutes of Health, Bethesda, MD, USA).
Quantification of axonal fragmentation and
neuronal death
Axonal fragmentation was assessed with a macro developed in
ImageJ software that contained the following steps: 1)subtract
background, 2) plug in tubeness (s=1),3)pluginOtsu
thresholding, and 4) analyze particles by measuring total parti-
cle area (A
TOTAL
) and identifying particles with circularity
higher than 0.2 (A
0.2
). The fragmentation index is obtainedas the
ratio A
0.2
/A
TOTAL
. This index is almost linearly correlated with
fragmented axon percentages: indices under 0.2, ;0.5, and up to
0.8 correspond to ,10, 50, and more than 90% of fragmented
axons, respectively. Neuronal death was quantified by calcu-
lating the ratio of condensing nuclei to total nuclei.
PCR and real-time quantitative PCR
Primary cortical neurons were lysed at DIV 11, and tissues were
lysed from 8-wk-old mice. Three wells were pooled to obtain 1
sample. Total RNA was isolated with an RNeasy kit (74104;
Qiagen, Valencia, CA, USA) according to the manufacturers
protocol. From the total RNA, 1 mg was RNase free-DNase
treated and retrotranscribed with a SuperScript II reverse tran-
scriptase kit (18064-022; Thermo Fisher Scientific) according to
the manufacturers instruction. The remaining RNA was hy-
drolyzed using RNase H from E. coli (AM2293; Thermo Fisher
Scientific).
PCR amplification was performed in a thermocycler by mix-
ing 2 mlofcDNAwith0.5mM of forward and reverse nucleotide
sequences (Table 1) in a PCR buffer containing dNTP mix
(200 mMeach),MgCl
2
(1.5 mM), and 0.5 U of Taq DNA poly-
merase (18038; Thermo Fisher Scientific). Initially, the template
was denatured by heating to 95°C for 5 min, followed by
30 amplificationcycles. Eachcycle consisted of 3 steps:the first for
45 s at 94°C, the second for 30 s at annealing temperature
(depending of the amplified mRNA), and the third for 1 min at
72°C for polymerization. The final step was an extension at 72°C
for 10 min. PCR products were electrophoresed on 1.5% (w/v)
agarose gel and stained with ethidium bromide (0.5 mg/ml).
Quantitative PCR was performed with a LightCycler480
(RocheAppliedScience,Penzberg,Germany),bymixing1:50
diluted cDNA with the target-specific primers and Light Cycler
480 SYBRGreen I Master mix (4707516001; Roche, Basel, Swit-
zerland) according to the manufacturers instructions. Amplifi-
cation conditions were initial denaturation for 5 min at 95°C
followed by 40 cycles of 10 s at 95°C, 15 s at annealing tempera-
ture and 10 s at 72°C. Res ults were analyzed with LightCycler 480
SW 1.5 software. Individual PCR products were analyzed by
melting-point analysis. The expression level of a gene was nor-
malized relative to that of mouse b-actin or hypoxanthine-
guanine phosphoribosyltransferase (HPRT).
NAD
+
assay
NAD
+
was measured using EnzyChrom NAD
+
/NADH Assay
Kit (E2ND-100; Euromedex) according to the manufacturers
protocol. Targeted quantitative NAD
+
metabolomics were per-
formed as described in Trammell and Brenner (38).
In vivo NMDA-induced excitotoxicity experiments
Experiments were performed on male C57/BL6 mice (23 63g,
produced and provided by GIP Cyc´
eron animal facilities) in ac-
cordance with European Union Directives (210/63/UE) and
French Ethics laws (R214; 87-137; Minist `
ere de lAgriculture) on
animal experimentation and were approved by the Universit´
e
Caen Normandie Animal Welfare Committee. Mice were
deeply anesthetized with isoflurane 5% and maintained under
TABLE 1. PCR primer sequences
Gene
Primer, 59-39
Size (pb) T
a
Forward Reverse
b-Actin AGCCATGTACGTAGCCATCC CTCTCAGCTGTGGTGGTGAA 228 63
HRPT ATTATGCCGAGGATTTGGAA CCCATCTCCTTCATGACATCT 94 60
ENT1 AGCCTGTGCAGTTGTCATTTT TCTTCCTTTTGGCTCCTCTCC 153 60
ENT2 CGAGTCGGTGCGGATTCTG GCACGGCACAGAAGGAATTG 149 60
ENT3 ATAGCAGCGTTTACGGCCTC CACTGGATGCTGCCAGGTC 127 60
ENT4 TTTGGCAGTGTGCCCATGA TGCAGTAGGCCACAGCAGAG 127 60
Nmrk1 AGGGAAGACGACACTGGCTA AGCGCTTCAAGCACATCATA 141 63
Nmrk2 CACCTCAGGACCAGTCACCT CTGTTGGTCAGGGTGGTCTT 94 60
Nmnat1 TTCAAGGCCTGACAACATCGC GAGCACCTTCACAGTCTCCACC 94 60
Nmnat2 CAGTGCGAGAGACCTCATCCC ACACATGATGAGACGGTGCCG 94 60
Nmnat3 GGTGTGGAGGTGTGTGACAGC GCCATGGCCACTCGGTGATGG 94 60
NR PROTECTS AGAINST EXCITOTOXIC NEURODEGENERATION 3
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
anesthesia with 2% isoflurane in a 70/30% gas mixture (N
2
O/O
2
)
during surgery. The rectal temperature was maintained at 37 6
0.5°C throughout the surgical procedure using a feedback-
regulated heating system.
A cortical unilateral injection [coordinates: 0.5 mm posterior,
2.0 mm lateral, 20.5 mm ventral to the bregma (39)] of NMDA
(5 nmol; in 0.33 ml), coinjected or not with NAD
+
or NR (50 nmol)
was performed after placing the animals in a stereotaxic frame.
Solutions were injected by the use of a micropipette made with
hematologic micropipettes (calibrated at 15 mm/ml, assistant ref
555/5; Hecht, Sondheim-Rhoen, Germany). The micropipette
was removed 3 min later. The volume of the lesion was analyzed
48 h later.
MRI
Experiments were performed on a Pharmascan 7T (Bruker, Bre-
men, Germany). T2-weighted images were acquired with a
multislice multiecho sequence: TE/TR 51.3/2500 ms 48 h after
injection. Lesion volumes were quantified on MRI with ImageJ
software.
Statistical analysis
Differences were assessed by a Mann-Whitney Utest to compare
2 conditions or a Kruskal-Wallis test to compare .2 conditions.
RESULTS
NMDA treatment on neuronal cell bodies
induces neuronal death and
axonal degeneration
To dissect the protective effects of NAD
+
and NR on
AxD, we cultured cortical neurons in microfluidic
devices containing 3 chambers connected to each other
(37). When seeded in the left chamber, cortical neurons
projected their axons from the proximal to the distal
chamber through asymmetric filtering microchannels,
whereas the somata and dendrites were confined in the
left chamber. As a consequence of such compartmen-
talization, the right chamber of the microfluidic device
contained only axons. When depressurized, the central
chamberactsassiphonandensuresoptimalfluidic
isolation of the distal axonal and somatodendritic
chambers (Fig. 1A, B).
Analysis of dendrites (MAP2, red), nuclear chromatin
(Hoechst 33342, blue), and axons (b3-tubulin) indicated
that the seeded cortical neurons were healthy after 2 wk in
culture (Fig. 1C). Somatodendritic application of 100 mM
NMDA in the proximal chamber induced dendrite de-
generationmarkedbyalossofMAP2immunostaining
and nuclear condensation associated with a severe AxD
visualized by punctiform b3-tubulin immunostaining in
the distal chamber (Fig. 1CG). By contrast, local ap-
plication of NMDA to axons in the distal chamber had
no effect on neurons, consistent with the fact that NMDA
receptors (NMDARs) are exclusively localized to the
somatodendritic compartment (22) (Fig. 1EG). NMDAR
involvement in NMDA-induced neurodegeneration was
confirmed with the noncompetitive NMDAR antagonist
MK-801. Nuclear condensation and AxD after 8 h NMDA
treatment were fully blocked by coaddition of 10 or 50 mM
MK-801 (Fig. 1H,I).
NR has a stronger neuroprotective effect than
NAD
+
during excitotoxicity, both in vitro and
in vivo
To evaluate and compare the potential neuro-
protective properties of NAD
+
and NR, cortical neu-
rons were treated with 100 mM NMDA in the presence
or absence of 5 mM NAD
+
or1mMNR.Nuclearcon-
densation and AxD were then quantified over time. As
shown in Fig. 2A, after 24 h of treatment, no inhibition
of dendrite degeneration (MAP2) nor inhibition of
nuclear condensation was observed after NAD
+
or NR
treatment, whereas both molecules delayed AxD (Fig.
2AC). NAD
+
protection was weak (67% of protection
compared to NMDA effect after 8 h of treatment, 22%
after 24 h), whereas NR fully protected axons after 8 h
and still provided 72% protection 24 h after NMDA
treatment (Fig. 2C). NAD
+
and NR efficiencies were
also compared in a doserange assay in cortical neu-
rons cotreated with 100 mM NMDA for 24 h (Fig. 2D).
NAD
+
started to delay AxD from 5 mM. In contrast,
NR was efficient at a 10-fold lower dose (0.5 mM; 33 vs.
43% of protection) with a maximum protective activity
at 1 mM. We asked whether the absence of protection
of NAD
+
and NR on NMDA-induced nuclear con-
densation was due to the high-dose of NMDA (100
mM) leading to irretrievable degeneration. Accord-
ingly, we challenged 5 mM NAD
+
or 1 mM NR with a
lower 10 mM NMDA concentration during 24 h (Sup-
plemental Fig. S1). A lower nuclear condensation was
observed with 10 mM NMDA (30%) compared with
that obtained with 100 mMNMDA(53%)butnei-
ther NAD
+
nor NR had any protective effect on this
phenomenon.
Considering the different neuroprotective activities of
NAD
+
and NR in our in vitro model of excitotoxicity, we
asked if NAD
+
and NR could be neuroprotective in an in
vivo setting of excitotoxicity. For this purpose, we coin-
jected NMDA (5 nmol) and NAD
+
or NR (50 nmol each)
into mouse cortical structures as published (40). Strikingly,
the volume of the NMDA-induced lesion as measured by
MRI was significantly reduced after NR coinjection,
whereas NAD
+
did not reveal a significant protection (Fig.
2E, F). Thus, NR has a more potent neuroprotective effect
than NAD
+
in NMDA-induced neurodegeneration, both
in vitro and in vivo.
NR is a more powerful brain NAD
+
-boosting
compound than NAD
+
We performed targeted quantitative NAD
+
metabolomics
to evaluate the effect of NR and NAD
+
on NMDA-treated
mouse brains (38). As shown in Fig. 2G, NR significantly
elevated brain NAD
+
from ,400 pmol/mg to nearly
500 pmol/mg, whereas the increase in brain NAD
+
from NAD
+
injection was not significant. Consistent
4 Vol. 31 December 2017 VAUR ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
with an elevated NAD
+
metabolome with NR as a
neuroprotective compound, NR tended to elevate
brain NAM and adenosine diphosphate receptor
(ADPR), whereas no changes were evident in brains
treated with NAD
+
(Fig. 2H, I).
NR has a local protective effect mainly
restricted to the axonal compartment
Previous results have shown that NAD
+
delays Wallerian
degeneration after axotomy on PNS-derived neuronal
0.0
0.2
0.4
0.6
0.8
1.0
Index of axonal fragmentation
0
10
20
30
40
50
Somatic NMDA -+++
MK-801 (µM) ø10 50 ø
--
10 50
**
**
Somatic NMDA -+++
MK-801 (µM) ø10 50 ø
--
10 50
β3-Tubulin
øø
ø
NMDA
ADMNø
Distal
chamber
Oriented micro channels
Central chamber
NMDA 100 µM :
*
ns
*
ns
*
***
*
*
*
*
*
Proximal
chamber
0
20
40
60
% condensed nuclei
0.0
0.2
0.4
0.6
0.8
1.0
Index of axonal fragmentation
NMDA 100 µM :
FG
Control
Proximal
Distal
Control
Proximal
Distal
A
B
C
D
E
H
I
% condensed nuclei
MAP2 / Hoechst 33342
Figure 1. SomaticapplicationofNMDAoncorticalneuronsinduces neuronal death and axonal degeneration. A)
3-dimensional representation of microuidic devices composed of 3 separated chambers connected by funnel-shaped
microchannels. Cortical neurons are seeded in the proximal chamber, and axons reach the distal chamber after 46din
vitro. An overpressured central channel enables optimal uidic isolation and compartmentalized treatment between
somatic and axonal compartments. B) Light microscope image of microchannels between proximal and distal chambers.
CE) Representative micrographs of somatic and axonal compartments after NMDA treatment. Cortical neurons were
cultured for 11 d and treated for 24 h with 100 mM NMDA. Left: the somatodendritic compartment stained with anti-MAP2
(red) and Hoechst 33342 (blue). Asterisks denote condensed nuclei. Right: the axonal compartment stained with anti-b
3
-
tubulin: control condition (ø/ø) (C); somatodendritic treatment with NMDA (NMDA/ø) (D); and selective axonal
treatment with NMDA (ø/NMDA) (E). Scale bars, 20 mm. F)Quantication of nuclear condensation in control and after
compartmentalized NMDA treatment. Condensed nuclei were counted after Hoechst staining (n=3).G)Quantication of
AxD in control and after compartmentalized NMDA treatment (n= 3). Axonal fragmentation index was calculated as
described in Methods. H,I) Effect of the NMDA antagonist MK-801 on NMDA-induced nuclear pyknosis and AxD: Cells
were cotreated with 100 mMNMDAand10/50mM MK-801 in the somatodendritic compartment. Quantication of somatic
status (H)andAxD(I)(n=3).*P,0.05.
NR PROTECTS AGAINST EXCITOTOXIC NEURODEGENERATION 5
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
cells. Furthermore, both NAD
+
and WldS protein prevent
AxD in a soma-independent fashion (8, 41). Because NAD
+
and NR protect AxD in our model, we examined if NAD
+
and NR act locally at the axon or also depend on the so-
matic compartment. NAD
+
or NR were applied either on
both compartments or the somatodendritic or the axonal
compartment simultaneously with somatodendritic addi-
tion of 100 mM NMDA for 24 h. Axonal application of NR
partially protected axons from NMDA-induced de-
generation (50% protection), whereas somatodendritic
NMDA NMDANAD /NMDANR /NMDA
*
ns
NMDA NR
NMDA
NAD
NMDA
lesion volume (mm3)
øø
ø
NAD 5mM
NR 1mM
24h
A
4)
3)
2)
D
C
EB
F
1)
Ø
-+++
15
Ø
Ø
+
ØØØ
+++
ØØØ 15
Ø
+
Ø
+
15
Ø
** *
ns
Somatic NMDA
NAD (mM)
NR (mM)
ø NMDA ø NMDA ø NMDA ø NMDA ø NMDA
*
***
RPDAMANDAN HGI
% condensed nucleiIndex of axonal fragmentation
50
40
30
20
10
0
NAD 5mM NR 1mM
NMDA
NAD 5mM-NMDA
4h 8h 24h 48h 72h
1.0
0.8
0.6
0.4
0.2
0.0 ø NMDA ø NMDA ø NMDA ø NMDA ø NMDA
4h 8h 24h 48h 72h
1.0
0.8
0.6
0.4
0.2
0.0
Index of
axonal fragmentation
0.1 0.5
0.1
2.5
2.0
1.5
1.0
0.5
0.0
pmol/mg
600
500
400
pmol/mg
350
300
250
200
150
pmol/mg
1000
800
600
400
200
0
NMDA
NMDA/NAD
NMDA/NR
NMDA
NMDA/NAD
NMDA/NR
NMDA
NMDA/NAD
NMDA/NR
NR 1mM-NMDA
MAP2/Hoechst 33342 β3-Tubulin
Figure 2. NR strongly prevents neurodegeneration induced by excitotoxicity both in vitro and in vivo. AD) NAD
+
weakly and NR
strongly reduced NMDA-induced axonal degeneration. A) Fluorescence microscopic analysis of somatic status and AxD after a
somatodendritic 100 mM NMDA treatment (24 h), with or without cotreatment with 5 mM NAD
+
or 1 mM NR. Left: the
somatodendritic compartment stained with Hoechst 33342 (blue) and anti-MAP2 (red) and the right picture shows the axonal
compartment stained with anti-b3-tubulin: control condition (ø/ø) (1); somatodendritic treatment with NMDA (NMDA/ø) (2);
somatodendritic cotreatment with NMDA and NAD
+
,axonaltreatmentwithNAD
+
(NAD
+
-NMDA/NAD
+
)(3); and
somatodendritic cotreatment with NMDA and NR, axonal treatment with NR (NR-NMDA/NR) (4). Scale bars, 20 mm. B, C)
Effect of 5 mM NAD
+
and 1 mM NR on neuronal death after different NMDA exposure times. B) Quantication of somatic status
by condensed nuclei (%) after Hoechst staining (n= 3). C) Quantication of AxD (n= 3). D) Quantication of AxD on cortical
neurons after 24 h of 100 mM NMDA and NR or NAD
+
cotreatment. Dose responses of NR and NAD
+
are shown (n= 3). E,F)In
vivo neuroprotective effect of NR after intracranial NMDA administration in mice. E) Representative MRI images obtained 48 h
after intracortical injection of 5 nmol NMDA or 5 nmol NMDA with 50 nmol NAD
+
or NR. Lesion volume is outlined in red. Scale
bar, 2 mm. F) Quantication of lesion volume at t= 48 h after NMDA injection (n= 20), NMDA/NAD
+
injection (n= 10), and
NMDA/NR injection (n= 10). GI) Quantitative metabolomic analysis of NAD
+
(G), NAM (H), and ADPR (I) of cortexes from
mice injected with NMDA (n= 9), NMDA/NAD
+
(n= 5), and NMDA/NR (n= 5). The data show that NR signicantly elevated
cortical NAD
+
, whereas injected NAD
+
did not. *P,0.05, **P,0.01, ***P,0.001.
6 Vol. 31 December 2017 VAUR ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
application did not prevent it (Fig. 3AF). Local NAD
+
treatment revealed no significant protective effects (Fig.
3G), but for both molecules NR and NAD
+
, the pro-
tection was increased or detected when applied on both
compartments together. These findings indicate that lo-
cal axonal treatment with NR is required for axonal
protection and that somatic NAD
+
or NR treatment is
insufficient to fully prevent AxD. The data indicate that
somatic application of these molecules helps to in-
crease axonal protection induced by axonal applica-
tion of the same compounds.
NR is converted to NAD
+
in cortical neurons
Not all models of WldS-dependent neuroprotection in-
voke a requirement for NAD
+
biosynthesis (42). Accord-
ingly, we tested the hypothesis that the protective effect of
NR depends upon its intracellular conversion to NAD
+
(Fig. 4A). First, we asked whether NR enters cortical neu-
rons for further conversion to NAD
+
.NRisanucleoside
reported to cross plasma membranes through NT (25, 27).
Among NT isoforms, expression analysis in our neuronal
cell culture model indicated that all equilibrative nucleo-
side transporter(ENT1-4) transcripts were expressed (Fig.
4B). However, none of the concentrative nucleoside
transporter (CNT1-3) mRNAs could be detected. DP, a
potent pharmacological inhibitorof ENT1 and -2 activities,
blocks NR cell entry in human cell lines (25, 43). Cotreat-
ment of cortical neurons with 100 mMNMDA,1mMNR,
and 50 mM DP almost completely prevented NR-induced
axonal protection (axonal protection decreased by 68%;
from 88 to 20%), establishing that the neuroprotective ef-
fect of NR requires DP-sensitive transport through the
plasma membrane (Fig. 4C).
Intracellular NR conversion to NAD
+
is initiated by
Nmrk1/2, which generates the NAD
+
-proximal pre-
cursor, NMN (Fig.4A). We analyzed Nmrk1 and -2 mRNA
expression by quantitative RT-PCR from both specific
mouse brain areas and from cortical neurons in culture.
We discovered that Nmrk1 mRNA is constitutively
expressed in all tissues, whereas Nmrk2 mRNA was
absent in all brain areas (cortex, hippocampus, and cere-
bellum) (Fig. 4D,E). However, Nmrk2 transcript was
highly expressed in heart and striated skeletal muscles, as
Figure 3. The NR protective effect is mainly restricted to the axonal compartment. AE) Fluorescence microscopy analysis of
somatic status and AxD after exposure of cortical neurons to 100 mM NMDA and 1 mM NR. Each molecule treatment was added
for 24 h. Left: the somatic compartment stained with Hoechst 33342; right: the axonal compartment stained with anti-b3-tubulin.
Control condition (ø/ø) (A); somatic NMDA treatment (NMDA/ø) (B); somatic NMDA-NR cotreatment and axonal NR
treatment (NR-NMDA/NR) (C); somatic NR-NMDA cotreatment (NR-NMDA/ø) (D); and somatic NMDA treatment and axonal
NR treatment (NMDA/NR) (E). Scale bars, 20 mm. F,G) Quantication of AxD after 100 mM NMDA treatment and total,
proximal or distal 1 mM NR treatment (F) or 5 mM NAD
+
treatment (G)(n= 3). *P,0.05.
NR PROTECTS AGAINST EXCITOTOXIC NEURODEGENERATION 7
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
previously described (30, 44). Nmrk1 but not Nmrk2
mRNA was also expressed in cultured cortical neurons
(Fig. 4E). Nmrk2 mRNA was reported to be induced
in PNS neurons after sciatic nerve axotomy (7). To
investigate a potential induction of Nmrk2 after an
excitotoxic insult in cortical neurons, Nmrk2 mRNA was
quantified after 100 mMNMDAtreatmentfor24h.We
found a low induction of Nmrk2 transcript, but a 4-fold
increase of Nmrk1 mRNA. NR kinase activity leads to
formation of NMN, which is adenylylated to NAD
+
via
Nmnat enzymes. We analyzed Nmnat1-3 mRNA ex-
pression in cortical neurons treated or not with NMDA
100 mMfor3or24h.Weshowedthatallthetranscripts
areexpressed,withthehighestlevelforthecytosolic
isoform Nmnat2, followed by the mitochondrial en-
zyme Nmnat3 (Supplemental Fig. S2A). Each of the
mRNAs was induced by 24 h NMDA treatment such
that all components of the NR kinase pathway to NAD
+
biosynthesis were upregulated during neuronal insult.
NR conversion to NAD
+
can be initiated by nucleoside
phosphorylase, which converts NR to NAM, which is
further converted to NAD
+
(45). However, cotreatment
of cortical neurons with NMDA 100 mMandNAM
5 mM for 24 h demonstrated that NAM is unable to
prevent NMDA-induced AxD (Supplemental Fig. S2B).
We next evaluated NAD
+
levels in neurons during an
excitotoxic challenge. Treatment of cortical neurons
with 100 mM NMDA for 24 h induced a 36% decrease
in intracellular NAD
+
. This effect was reverted by
cotreatment with 1 mM NR (Fig. 4F). Together, these
results establish that conversion of NR to intracellular
NAD
+
via the transcriptionally induced NR kinase
pathway is critical for maintaining axoplasmic NAD
+
in
opposition to excitotoxicity-induced AxD.
Extracellular NAD
+
involves a potentially
unique mechanism to prevent
excitotoxicity-induced AxD
Extracellular NAD
+
has a lower axon-protective effect
than NR in our model. As reported previously in cell lines
and PNS-derived neuronal cells, NAD
+
can be converted
extracellularly to NMN by ENPPase and then to NR by
59-ENTase (Fig. 5A). We asked whether extracellular
Figure 4. Extracellular NR is transported through the plasma membrane for a neuroprotective effect and is metabolized to
intracellular NAD
+
.A) Schematic representation of NR metabolism in cells: NR enters the cell through CNTs or ENTs and is
metabolized to NAD
+
via NR kinase 1/2 (Nmrk1/2) and Nmnat. B) mRNA level of ENT 1-4 normalized to HPRT transcript in
cortical neurons. C) DP reverted the axon-protective effect of NR in neurons treated with NMDA. Quantication of AxD after
100 mM NMDA treatment, with or without 1 mM NR and 50 mM DP for 24 h (n= 4). D)Nmrk1 mRNA is constitutively expressed,
whereas Nmrk2 mRNA is not detectable in brain tissues. Nmrk1 and Nmrk2 mRNA level in brain tissues (cortex, hippocampus, and
cerebellum), heart, skeletal muscles, and liver normalized to b-actin transcript. E) NMDA treatment induces Nmrk1 but not
Nmrk2 transcript. mRNA levels were analyzed by real-time quantitative PCR 3 and 24 h after 100 mM NMDA treatment and
normalized to HPRT transcript (n= 3). F) NR treatment restores NMDA-induced NAD
+
depletion. The NAD
+
level was measured
in cortical neurons cultured on plates and exposed to 100 mM NMDA, with or without 1 mM NR for 24 h (n=4).*P,0.05, **P,
0.01, ***P,0.001.
8 Vol. 31 December 2017 VAUR ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
conversion of NAD
+
to NR is necessary for NAD
+
-
mediated axonal protection or if this effect is independent
of NR action. For this purpose, we probed 59-ENTase ac-
tivity in cortical neurons, using a high concentration of
CMP, a competitive inhibitor of this enzyme (29). First, we
treated cortical neurons with 100 mM NMDA, with or
without 5 mM NMN for 24 h. Extracellular NMN signifi-
cantlyreducedNMDA-inducedAxDand25mMCMP
reversed the protective effect of NMN (Fig. 5B). Consistent
with data in other tissues (28, 30), these data indicate that
NMN must be converted to NR to mediate axonal pro-
tection. The beneficial effect of NMN was also prevented
when cortical neurons were cotreated with NMDA and the
ENT1/2 inhibitor DP, confirming that NMN is converted
to the nucleoside NR before plasma membrane transport
to prevent NMDA-induced AxD. Consistent with a de-
pendence on conversion to NR, NR was more protective at
a lower concentration than NMN. Surprisingly, 5 mM
NAD
+
was slightly but significantly protective, yet nei-
ther CMP nor DP blocked the axonal protection con-
ferred by this high concentration of NAD
+
(Fig. 5C).
NAD
+
and NR protect neurons with the
same efficiency after FK866-induced
NAD
+
depletion
Because excitotoxicity and SARM1 activation induce NAD
+
depletion in a manner that can be protected by NR and
NAD
+
, we tested whether pharmacological inhibition of
NAD
+
homeostasis causes AxD. FK866, a specific inhibitor
of Nampt (46), which salvages NAM for resynthesis of
NAD
+
(Fig. 6A), was used to induce NAD
+
depletion.
Addition of 10 mM FK866 to the somatodendritic com-
partment of cortical neurons induced a rapid decrease of
NAD
+
levels after 24 h of treatment (Fig. 6B). At 72 h, this
drop in NAD
+
induced somatodendritic degeneration,
nuclear condensation, and AxD (Fig. 6C, D). Cotreatment
of cortical neurons with 10 mM FK866 and 50 mMNAD
+
or NR fully prevented these effects (Fig. 6DF). Notably,
the protective concentrations of NAD
+
and NR were
lower than those used in the NMDA-induced neuro-
degeneration model (50 mM for both in the FK866 model
and 5 mM NAD
+
or 1 mM NR in the NMDA model) (Figs.
2ADand 6DF). NAD
+
and NR remained fully pro-
tective when applied 24 h after treatment, at a time when
NAD
+
depletion was already observed, but dropped to
20% protection when applied 48 h later (Fig. 6E, F). These
findings highlight the existence of a temporal window in
which neuronal integrity can be rescued after a neurotoxic
insult. Taken together, these data show that NAD
+
and
NR have the same neuroprotective effect against FK866-
induced NAD
+
depletion.
Extracellular NAD
+
conversion
into NR is needed to prevent
FK866-induced neurodegeneration
We next evaluated the metabolic pathway from extracel-
lular NAD
+
/NMN/NR to intracellular NAD
+
in FK866-
induced neurodegeneration. First, cortical neurons were
cotreated with 50 mM FK866, 50 mMNR,and50mMDPfor
72 h, and axonal fragmentation was investigated. DP only
partially limited the NR-protective effect against FK866
(axonal protection reduced by 40%), whereas the pro-
tective effect of NR was totally inhibited under NMDA
stress (Figs. 4Cand 7A). These data suggest that FK866
treatment induces expression of NT that is relatively re-
sistant to DP. We analyzed ENT1-4 mRNA in cortical
neurons treated or not with 10 mM FK866 for 72 h. ENT2
and -4 mRNA were induced 2.2- and 1.7-fold, respectively,
by FK866 (Supplemental Fig. S3). NAD
+
and NMN also
prevented FK866-induced neurodegeneration in a manner
that was partially prevented by DP (Fig. 7B,C). As NAD
+
maydependonNTinprotectionagainstFK866neuro-
degeneration, we tested whether extracellular NAD
+
and
NMN need to be converted to NR before transport
through plasma membrane. Indeed, CMP fully blocked
the axon-protective effect of NAD
+
and NMN, indicating
Figure 5. NMN requires conversion to NR and nucleoside transporters to prevent NMDA-induced AxD. A) Schematic
representation of extracellular metabolism of NAD
+
: NAD
+
is converted into NMN via ENPPase and then into NR via ENTase. B)
Quantication of AxD in cortical neurons treated with 100 mM NMDA for 24 h after blocking the extracellular pathway by DP, an
ENT inhibitor, or CMP, an ENTase inhibitor. NMDA, NMN, DP, and CMP were added as indicated (n=37). C) Quantication
of AxD in cortical neurons treated with 100 mM NMDA for 24 h after blocking the extracellular pathway by DP or CMP. NMDA,
NAD
+
, DP, and CMP were added as indicated (n=37). *P,0.05, **P,0.01.
NR PROTECTS AGAINST EXCITOTOXIC NEURODEGENERATION 9
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
that both molecules require 59-ENTase activity to be con-
verted to NR and mediate their axon-protective effect (Fig.
7B, C). We also analyzed Nmrk1 and -2 mRNA expression
in cortical neurons treated or not with FK866 for 2472 h.
As expected, Nmrk1 mRNA was highly expressed com-
pared with the Nmrk2 transcript, which was not detectable
(Supplemental Fig. S4B,C). As previously described with
NMDA, FK866 treatment for 48 or 72 h induced Nmrk2 (3-
fold at 72 h). As Nmrk2 induction was a common phe-
nomenon observed in our experiments, we used cortical
neurons from wild-type or Nmrk2-KO mice. These neurons
were treated with 10 mMFK866for72hbeforecondensed
nuclei and axonal fragmentation were analyzed. Even in
the absence of the Nmrk2 gene, NAD
+
and NR provided
full protection against FK866-induced neurodegeneration,
indicating that Nmrk2 is not required for these effects
(Supplemental Fig. S4D,E). These results demonstrate
that NAD
+
,NMN,andNRuseasimilarpathway,likely
independent of Nmrk2, to prevent FK866-induced
neurodegeneration.
DISCUSSION
Excitotoxicity is a process commonly described in several
brain disorders, including stroke, traumatic brain injuries,
and the major neurodegenerative diseases. High gluta-
mate release activates ionotropic glutamate receptor, as
NMDAR, and triggers disruption of ion homeostasis,
leading to energetic dysfunction and oxidative stress.
BA
NR NMN NAD
Nmnat
NAM
Nampt
FK866
Nmrk1
Nmrk2
0
1
2
3
4
5
Control FK866 10 µM
NAD level
Cell Membrane
Cytosol
24h 48h 72h
0
20
40
60
FE
****
*
ns
0.0
0.2
0.4
0.6
0.8
1.0
****
*
ns
NR 50 µMNAD 50 µM
ØØ0
h0h
FK866 FK866
NR 50 µMNAD 50 µM
% condensed nuclei
24h48h24h48h
Index of
axonal fragmentation
ØØ0
h0h
24h48h24h48h
0
20
40
60
80
0.0
0.2
0.4
0.6
0.8
1.0
D
β3-Tubulin
72h
ControlFK866 10 µMNR / FK866NAD / FK866
C
*
ns
***
**
*
Control FK866 10 µM
% condensed nuclei
24h 48h 72h
Index of Fragmentation
24h 48h 72h MAP2 / Hoechst 33342
Figure 6. NAD
+
and NR have the same pro-
tective effect against FK866-induced cortical
neurodegeneration. A) Schematic representa-
tion of FK866 effect on NAD
+
metabolism. B)
NAD
+
level measured on cortical neurons
cultured on plates exposed to 10 mM FK866
for 24, 48, and 72 h (n=34). C) Quantication
of somatic status and AxD in cortical neurons
exposed to 10 mM FK866 (n= 4). D) Fluores-
cence microscopic analysis of somatic status and
AxD after somatodendritic 10 mM FK866
treatment in the presence of 50 mM NAD
+
or
50 mM NR in both compartments (72 h). Left:
the somatodendritic compartment stained with
anti-MAP2 (red) and Hoechst 33342 (blue);
right: the axonal compartment stained with
anti-b3-tubulin. Scale bars, 20 mm. E,F) Effect
of NR or NAD
+
on neuronal death and AxD in
presence of FK866: cortical neurons where
treated in both chambers with 50 mMNRor
NAD
+
at the same time (0 h) or 2448 h after 10
mM FK866 treatment for 72 h. E) Quantica-
tion of somatic status by percentage of con-
densed nuclei after Hoechst staining (n= 3). F)
Quantication of AxD after b-tubulin staining
(n= 3). *P,0.05, **P,0.01, ***P,0.001.
10 Vol. 31 December 2017 VAUR ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
Major events related to excitotoxicity are therefore
mitochondrial dysfunction, NAD
+
depletion and
metabolic dysregulation. Moreover, because neuronal
stress induces DNA damages, poly (ADP-ribose) poly-
merase (PARP) activation, and NAD
+
depletion, the role
of NAD
+
metabolism in excitotoxicity requires careful
characterization (47).
Several in vitro studies examined the effect of NAD
+
,its
precursors, and biosynthetic enzymes in prevention of
excitotoxicity-induced neuronal degeneration (17, 19, 23,
4850). However, the results appeared to depend on par-
ticulars of the excitotoxicity models. For instance, exoge-
nous NAM protects against neuronal degeneration after 6
or 12 h of glutamate/NMDA treatment, but not after 24 h
(19). Furthermore, only weak neuroprotective effects of
NAD
+
were observed after 100 mM glutamate application,
even with NAD
+
doses up to 15 mM (23, 50). Our results
showing that neither NAD
+
nor NR protects against
NMDA-induced somatic degeneration are consistent with
these studies. We discovered unexpectedly that NR and
NAD
+
have differential effects on NMDA-induced AxD in
vitro and in vivo.In vitro, 1 mM NR was highly efficient in
preventing AxD, whereas 5 mM NAD
+
was partially
protective. In vivo, injection of NR, but not NAD
+
,signif-
icantly reduced NMDA-induced lesions (Fig. 2E, F)and
elevated brain NAD
+
(Fig. 2G). We considered the possi-
bility that NR coinjection altered the severity of the initial
NMDA-triggered insult. One of the major initial neuro-
toxic events involved in NMDA receptor activation is a rise
in intracellular calcium (51). Metabolomic analyses have
shown that NR coinjection leads to ADPR induction (Fig.
2H, I). Actually, ADPR is known to enhance cytoplasmic
calcium concentration, indicating that NR should enhance
NMDA neurotoxicity, but this was not the case in this
study, suggesting that NR injection reduces NMDA-
induced lesion by acting downstream of the initial insult.
In PNS-derived neurons injured by axotomy, NR is
protective reportedly because Nmrk2 is transcription-
ally up-regulated by the injury (7). In the current study
we showed that NR enters neurons via DP-sensitive
transporters. Although Nmrk2 was slightly induced by
NMDA or FK866 treatment (Fig. 4Eand Supplemental
Fig. S4B,C), Nmrk1 was more highly induced and NR
prevented nuclear condensation and AxD in neurons
from Nmrk2-KO mice treated with FK866 (Supplemental
Fig. S4D,E). Thus, this result suggests that Nmrk1 is the
key mediator of the neuroprotective activity of NR. Al-
though NAD
+
, NMN, or NR can break down to NAM,
we found that NMDA-induced AxD is not prevented by
NAM (Supplemental Fig. S2B).
In PNS-derived neurons injured by axotomy, the cyto-
plasmic NAD
+
biosynthetic enzyme Nmnat2 is reportedly
unstable, leading to axonal NMN accumulation, which
has been described as deleterious and accelerating AxD
(27). However, NMN toxicity is not universally accepted,
as it was reported that high levels of NMN are not suffi-
cient to induce AxD in DRG neurons (16). In our model, no
NMN or NR toxicity was observed. On the contrary, we
report strong axonal protection with both molecules and
an NR-identical intracellular mechanism for NMN con-
sistent with inhibition by CMPand DP (Fig. 5). Moreover,
we discovered that transcripts encoding Nmnat13 are all
induced after 24 h of NMDA treatment (Supplemental Fig.
S2A). Thus, the 2-step NR kinase pathway to NAD
+
(31) is
induced by excitotoxic stress in cortical neurons. Nmnat2
protein subcellular localization and stability have been
described to modulate the axon-protective capacity of this
enzyme after axotomy in PNS-derived neurons (52), sug-
gesting that enzyme regulation at the protein level is an-
other important component of the response to NR.
Optimal NAD
+
and NR axon-protective effects
were observed when the compounds were applied to
both compartments, suggesting axonal protection can
be assisted by a somatic signal. Mitochondria trans-
port within the axon was recently shown to partici-
pate in axonal integrity (53). It will therefore be
interesting to test whether NR promotes an increase in
mitochondria biogenesis, the axonal transport of mi-
tochondria, or both as a component of its neuro-
protective effects.
Figure 7. NAD
+
and NMN conversion to NR is needed to prevent FK866-induced AxD, and nucleoside transporters ENT-1/2 are
partially involved. A) Quantication of AxD in cortical neurons treated with 10 mM FK866 for 72 h after blocking ENT1/2 by DP.
FK866, NR, and DP were added as indicated (n= 4). B) Quantication of AxD in cortical neurons treated with 10 mM FK866 for
72 h after blocking the extracellular pathway by DP and CMP. FK866, NMN, DP, and CMP were added as indicated (n= 3). C)
Quantication of AxD in cortical neurons treated with 10 mM FK866 for 72 h after blocking the extracellular pathway by DP and
CMP. FK866, NAD
+
, DP, and CMP were added as indicated (n=37). *P,0.05, ***P,0.001.
NR PROTECTS AGAINST EXCITOTOXIC NEURODEGENERATION 11
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
Finally, we note that the effective concentrations of
NR and NAD
+
for protection against two different
models of cortical neurotoxicity were quite distinct.
Whereas 1 mM or greater concentrations of NAD
+
,
NMN, and NR were necessary to protect against
NMDA-induced AxD, 50 mM was sufficient to prevent
FK866-induced neuronal degeneration (Figs. 2D,6,and
7).WeproposethattheNMDAexcitotoxicmodelin-
duces SARM1 activation (13, 16, 54, 55) in a manner that
leads to active NAD
+
depletion, whereas FK866 simply
produces a block of the NAD
+
salvage pathway. The
mechanisms involved in NAD
+
depletion are different,
and some distinct pathways could be required to me-
diate both NAD
+
and NR protective effects. We have
shown that NR-induced axonal protection was com-
pletely or partially prevented by DP in NMDA excito-
toxicity and FK866 models, respectively (Figs. 4Cand
7A). DP specifically inhibits ENT1/2 activities, but we
have shown that all the transcripts coding the different
ENT isoforms are expressed in cortical neurons (Fig.
4B). ENT3 is known to be an intracellular transporter
predominantly localized in lysosome or mitochondria,
whereas ENT4 is expressed at the plasma membrane
andwasdescribedtobeveryabundantinbrainand
heart (56). FK866 treatment of cortical neurons in-
duced ENT2 and -4 mRNA, suggesting that ENT4,
which is not inhibited by DP, is involved in nucleoside
transport when NAD
+
is highly depleted in neurons by
FK866 (Supplemental Fig. S2A). Further mechanistic
studies are under way to reveal the differences between
FK866 and NMDA-induced cortical neurotoxicity. The
human oral availability of NR (33) suggests the potential for
testing NR in diseases and conditions of central neuro-
degeneration including Alzheimers disease, Parkin-
sons disease, and traumatic brain injury.
ACKNOWLEDGMENTS
The authors thank ChromaDex (Irvine, CA, USA) for kindly
providing NR, and MicroBrain Biotech (Paris, France) for
technical advice and microuidic chips. Funding was provided
by Ile-de-France Region DIM Cerveau et Pens´
ee fellowship (to
P.V.); by Agence Nationale pour la Recherche (ANR) Grant
Neuroscreen: 2011-RPIB-008-001 2012-17 (to B.B.); and by the
Roy J. Carver Trust (to C.B.). C.B. serves as a member of the
scientic advisory board of ChromaDex and is cofounder of
ProHealthspan, which respectively developed NR for commer-
cialization and sells NR to consumers. The remaining authors
declare no conicts of interest.
AUTHOR CONTRIBUTIONS
P. Vaur, B. Brugg, and E. Duplus designed the research;
P. Vaur performed all the experiments involving micro-
uidic chips and real-time quantitative PCR; M. Mericskay
and Z. Li provided Nmrk2-KO mice and analyzed data;
D. Vivien and C. Orset performed in vivo NMDA-
induction experiments; B. Brugg and E. Jacotot analyzed
data and participated in writing the manuscript; M. S.
Schmidt and C. Brenner performed the metabolomic
analysis; P. Vaur, C. Brenner, and E. Duplus analyzed data
and wrote the manuscript; and all authors read and
approved the nal manuscript.
REFERENCES
1. Benarroch, E. E. (2015) Acquired axonal degeneration and
regeneration: recent insights and clinical correlations. Neurology 84,
20762085
2. Burke, R. E., and OMalley, K. (2013) Axon degeneration in
Parkinsonsdisease.Exp. Neurol. 246,7283
3. Kanaan,N.M.,Pigino,G.F.,Brady,S.T.,Lazarov,O.,Binder,L.I.,
and Morni, G. A. (2013) Axonal degeneration in Alzheimers
disease: when signaling abnormalities meet the axonal transport
system. Exp. Neurol. 246,4453
4. Selkoe, D. J. (2002) Alzheimers disease is a synaptic failure. Science
298,789791
5. Araki, T., Sasaki, Y., and Milbrandt, J. (2004) Increased nuclear NAD
biosynthesis and SIRT1 activation prevent axonal degeneration.
Science 305, 10101013
6. Magnico, S., Saias, L., Deleglise, B., Duplus, E., Kilinc, D., Miquel,
M.C.,Viovy,J.L.,Brugg,B.,andPeyrin,J.M.(2013)NAD+actson
mitochondrial SirT3 to prevent axonal caspase activation and axonal
degeneration. FASEB J. 27,47124722
7. Sasaki, Y., Araki, T., and Milbrandt, J. (2006) Stimulation of
nicotinamide adenine dinucleotide biosynthetic pathways delays
axonal degeneration after axotomy. J. Neurosci. 26,84848491
8. Wang,J.,Zhai,Q.,Chen,Y.,Lin,E.,Gu,W.,McBurney,M.W.,andHe,
Z. (2005)A local mechanism mediates NAD-dependent protection of
axon degeneration. J. Cell Biol. 170,349355
9. Lyon, M. F., Ogunkolade, B. W., Brown, M. C., Atherton, D. J., and
Perry, V. H. (1993) A gene affecting Wallerian nerve degeneration
maps distally on mouse chromosome 4. Proc. Natl. Acad. Sci. USA 90,
97179720
10. Coleman, M. P., and Freeman, M. R. (2010) Wallerian degeneration,
wld(s), and nmnat. Annu. Rev. Neurosci. 33,245267
11. Yahata, N., Yuasa, S., and Araki, T. (2009) Nicotinamide
mononucleotide adenylyltransferase expression in mitochondrial
matrix delays Wallerian degeneration. J. Neurosci. 29, 62766284
12. Trammell,S.A.,Weidemann,B.J.,Chadda,A.,Yorek,M.S.,Holmes,
A., Coppey, L. J., Obrosov, A., Kardon, R. H., Yorek, M. A., and
Brenner, C. (2016) Nicotinamide riboside opposes type 2 diabetes
and neuropathy in mice. Sci. Rep. 6, 26933
13. Osterloh,J.M.,Yang,J.,Rooney,T.M.,Fox,A.N.,Adalbert,R.,Powell,
E.H.,Sheehan,A.E.,Avery,M.A.,Hackett,R.,Logan,M.A.,MacDonald,
J.M.,Ziegenfuss,J.S.,Milde,S.,Hou,Y.J.,Nathan,C.,Ding,A.,Brown,
R.H.,Jr.,Conforti,L.,Coleman,M.,Tessier-Lavigne,M.,Z¨uchner, S., and
Freeman, M. R. (2012) dSarm/Sarm1 is required for activation of an
injury-induced axon death pathway. Science 337, 481484
14. Gerdts, J., Summers, D. W., Milbrandt, J., and DiAntonio, A. (2016)
Axon self-destruction: new links among SARM1, MAPKs, and NAD+
metabolism. Neuron 89, 449460
15. Gilley, J., and Coleman, M. P. (2010) Endogenous Nmnat2 is an
essential survival factorfor maintenance of healthy axons.PLoS Biol. 8,
e1000300
16. Sasaki, Y., Nakagawa, T., Mao, X., DiAntonio, A., and Milbrandt, J.
(2016)NMNAT1 inhibitsaxon degeneration via blockade of SARM1-
mediated NAD(+) depletion. eLife 5, e19749
17. Kim, S. H. Lu, H. F., and Alano, C. C. (2011) Neuronal Sirt3 protects
againstexcitotoxic injury in mousecortical neuronculture. PLoS ONE
6, e14731
18. Liu, D., Pitta, M., and Mattson, M. P. (2008) Preventing NAD(+)
depletion protectsneurons against excitotoxicity:bioenergetic effects
of mild mitochondrial uncoupling and caloric restriction. Ann. N. Y.
Acad. Sci. 1147, 275282
19. Liu,D.,Gharavi,R.,Pitta,M.,Gleichmann,M.,andMattson,M.P.
(2009)Nicotinamideprevents NAD+depletion and protects neurons
against excitotoxicity and cerebral ischemia: NAD+ consumption
by SIRT1 may endanger energetically compromised neurons.
Neuromolecular Med. 11,2842
20. Zhang,W.,Xie,Y.,Wang,T.,Bi,J.,Li,H.,Zhang,L.Q.,Ye,S.Q.,and
Ding,S. (2010) Neuronal protective roleof PBEF in a mousemodel of
cerebral ischemia. J. Cereb. Blood Flow Metab. 30, 19621971
21. Chung, R. S., McCormack, G. H., King, A. E., West, A. K., and Vickers,
J. C. (2005) Glutamate induces rapid loss of axonal neurolament
proteins from cortical neurons in vitro. Exp Neurol 193,481488
12 Vol. 31 December 2017 VAUR ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
22. Hosie,K.A.,King,A.E.,Blizzard,C.A.,Vickers,J.C.,andDickson,
T. C. (2012) Chronic excitotoxin-induced axon degeneration in a
compartmented neuronal culture model. ASN Neuro 4
23. Bi,J., Li, H., Ye, S.Q., and Ding, S.(2012) Pre-B-cell colony-enhancing
factor exerts a neuronal protection through its enzymatic activity and
the reduction of mitochondrial dysfunction in in vitro ischemic
models. J. Neurochem. 120,334346
24. Bogan, K. L., and Brenner, C. (2008) Nicotinic acid, nicotinamide,
and nicotinamide riboside: a molecular evaluation of NAD+
precursor vitamins in human nutrition. Annu. Rev. Nutr. 28,115130
25. Nikiforov, A., D¨olle, C., Niere, M., and Ziegler, M. (2011) Pathways
and subcellular compartmentation of NAD biosynthesis in human
cells: from entry of extracellular precursors to mitochondrial NAD
generation. J. Biol. Chem. 286, 2176721778
26. Grozio, A., Sociali, G., Sturla, L., Caffa, I., Soncini, D., Salis, A.,
Raffaelli, N., De Flora, A., Nencioni, A., and Bruzzone, S. (2013) CD73
protein as a source of extracellular precursors for sustained NAD+
biosynthesis in FK866-treated tumor cells. J. Biol. Chem. 288,
2593825949
27. Di Stefano, M., Nascimento-Ferreira, I., Orsomando, G., Mori, V.,
Gilley, J., Brown, R., Janeckova, L., Vargas, M. E., Worrell, L. A.,
Loreto, A., Tickle, J., Patrick, J., Webster, J. R. M., Marangoni, M.,
Carpi, F. M., Pucciarelli, S., Rossi, F., Meng, W., Sagasti, A., Ribchester,
R.R.,Magni,G.,Coleman,M.P.,andConforti,L.(2015)Arisein
NAD precursor nicotinamide mononucleotide (NMN) after injury
promotes axon degeneration. Cell Death Differ. 22,731742
28. Ratajczak,J.,Joffraud,M.,Trammell,S.A.,Ras,R.,Canela,N.,
Boutant,M.,Kulkarni,S.S.,Rodrigues,M.,Redpath,P.,
Migaud,M.E.,Auwerx,J.,Yanes,O.,Brenner,C.,andCant´
o, C.
(2016) NRK1 controls nicotinamide mononucleotide and
nicotinamide riboside metabolism in mammalian cells. Nat.
Commun. 7, 13103
29. Zimmermann, H. (2000) Extracellular metabolism of ATP and other
nucleotides. Naunyn Schmiedebergs Arch. Pharmacol. 362,299309
30. Fletcher, R. S., Ratajczak, J., Doig, C. L., Oakey, L. A., Callingham, R.,
Da Silva Xavier, G., Garten, A., Elhassan, Y. S., Redpath, P., Migaud,
M. E., Philp, A., Brenner, C., Cant´o, C., and Lavery, G. G. (2017)
Nicotinamide riboside kinases display redundancy in mediating
nicotinamide mononucleotide and nicotinamide riboside
metabolism in skeletal muscle cells. Mol. Metab. 6,819832
31. Bieganowski, P., and Brenner, C. (2004) Discoveries of nicotinamide
riboside as a nutrient and conserved NRK genes establish a Preiss-Handler
independent route to NAD+ in fungi and humans. Cell 117,495502
32. Trammell, S. A., Yu, L., Redpath, P., Migaud, M. E., and Brenner, C.
(2016) Nicotinamide riboside is a major NAD+ precursor vitamin in
cow milk. J. Nutr. 146,957963
33. Trammell, S. A., Schmidt, M. S., Weidemann, B. J., Redpath, P.,
Jaksch, F., Dellinger, R. W., Li, Z., Abel, E. D., Migaud, M. E., and
Brenner, C. (2016) Nicotinamide riboside is uniquely and orally
bioavailable in mice and humans. Nat. Commun. 7,12948
34. Gong, B., Pan, Y., Vempati, P., Zhao, W., Knable, L., Ho, L.,
Wang,J.,Sastre,M.,Ono,K.,Sauve,A.A.,andPasinetti,G.M.
(2013) Nicotinamide riboside restores cognition through an
upregulation of proliferator-activated receptor-gcoactivator 1a
regulated b-secretase 1 degradation and mitochondrial gene
expression in Alzheimersmo
usemodels.Neurobiol. Aging 34,
15811588
35. Brown,K.D.,Maqsood,S.,Huang,J.Y.,Pan,Y.,Harkcom,W.,Li,W.,
Sauve, A., Verdin, E., and Jaffrey, S. R. (2014) Activation of SIRT3 by
the NAD
+
precursor nicotinamide riboside protects from noise-
induced hearing loss. Cell Metab. 20, 10591068
36. Hamity, M. V., White, S. R., Walder, R. Y.,Schmidt, M. S., Brenner, C.,
and Hammond, D. L. (2017) Nicotinamide riboside, a form of vitamin
B3 and NAD+ precursor, relieves the nociceptive and aversive
dimensions of paclitaxel-induced peripheral neuropathy in female
rats. Pain 158,962972
37. Deleglise, B., Lassus, B., Soubeyre, V., Alleaume-Butaux, A., Hjorth,
J.J.,Vignes,M.,Schneider,B.,Brugg,B.,Viovy,J.L.,andPeyrin,J.M.
(2013) Synapto-protective drugs evaluation in reconstructed neuro-
nal network. PLoS One 8,e71103
38. Trammell, S. A., and Brenner, C. (2013) Targeted, LCMS-based
metabolomics forquantitative measurement of NAD(+) metabolites.
Comput. Struct. Biotechnol. J. 4, e201301012
39. Paxinos G., and Franklin K. (2012) Paxinos and FranklinstheMouse
Brain in Stereotaxic Coordinates. 4th ed. Academic Press, Cambridge,
MA, USA
40. Jullienne, A., Montagne, A., Orset, C., Lesept, F., Jane, D. E.,
Monaghan, D. T., Maubert, E., Vivien, D., and Ali, C. (2011) Selective
inhibition of GluN2D-containing N-methyl-D-aspartate receptors
prevents tissue plasminogen activator-promoted neurotoxicity both
in vitro and in vivo. Mol. Neurodegener. 6,68
41. Cohen,M.S.,Ghosh,A.K.,Kim,H.J.,Jeon,N.L.,andJaffrey,S.R.
(2012) Chemical genetic-mediated spatial regulation of protein ex-
pression in neurons reveals an axonal function for wld(s). Chem. Biol.
19,179187
42. Antenor-Dorsey, J. A. V., and OMalley, K. L. (2012) WldS but not
Nmnat1 protects dopaminergic neurites from MPP+ neurotoxicity.
Mol. Neurodegener. 7,5
43. Grifth, D. A., and Jarvis, S. M. (1996) Nucleoside and nucleobase
transport systems of mammalian cells. Biochim. Biophys. Acta 1286,
153181
44. Cant´
o,C.,Houtkooper,R.H.,Pirinen,E.,Youn,D.Y.,Oosterveer,
M. H.,Cen, Y., Fernandez-Marcos, P. J.,Yamamoto,H., Andreux,P. A.,
Cettour-Rose, P., Gademann, K., Rinsch, C., Schoonjans, K., Sauve,
A. A., and Auwerx, J. (2012) The NAD(+) precursor nicotinamide
riboside enhances oxidative metabolism and protects against high-fat
diet-induced obesity. Cell Metab. 15,838847
45. Belenky, P., Racette, F. G., Bogan, K. L., McClure, J. M., Smith, J. S.,
and Brenner, C. (2007) Nicotinamide riboside promotes Sir2
silencing and extends lifespan via Nrk and Urh1/Pnp1/Meu1 path-
ways to NAD+. Cell 129,473484
46. Hasmann, M., and Schemainda, I. (2003) FK866, a highly specic
noncompetitive inhibitor of nicotinamide phosphoribosyltransferase,
represents a novel mechanism for induction of tumor cell apoptosis.
Cancer Res. 63,74367442
47. Martire, S., Mosca, L., and dErme, M. (2015) PARP-1 involvement in
neurodegeneration: a focus on AlzheimersandParkinsonsdiseases.
Mech. Ageing Dev. 146148,5
364
48. Ghosh, D., LeVault, K. R., Barnett, A. J., and Brewer, G. J. (2012) A
reversible early oxidized redox state that precedes macromolecular
ROS damage in aging nontransgenic and 3xTg-AD mouse neurons.
J. Neurosci. 32, 58215832
49. Verghese,P.B.,Sasaki,Y.,Yang,D.,Stewart,F.,Sabar,F.,Finn,M.B.,
Wroge,C.M.,Mennerick,S.,Neil,J.J.,Milbrandt,J.,andHoltzman,D.M.
(2011) Nicotinamide mononucleotide adenylyl transferase 1 protects
against acute neurodegeneration in developing CNS by inhibiting
excitotoxic-necrotic cell death. Proc. Natl. Acad. Sci. USA 108,1905419059
50. Wang, X., Li, H., and Ding, S. (2014) The effects of NAD+ on
apoptotic neuronal deathand mitochondrial biogenesis andfunction
after glutamate excitotoxicity. Int. J. Mol. Sci. 15,2044920468
51. Choi, D. W. (1987) Ionic dependence of glutamate neurotoxicity.
J. Neurosci. 7, 369379
52. Milde, S., Gilley, J., and Coleman, M. P. (2013) Subcellular
localization determines the stability and axon protective capacity of
axon survival factor Nmnat2. PLoS Biol. 11, e1001539
53. Zhou, B., Yu, P., Lin, M. Y., Sun, T., Chen, Y., and Sheng, Z. H. (2016)
Facilitation of axon regeneration by enhancing mitochondrial
transport and rescuing energy decits. J. Cell Biol. 214,103119
54. Gerdts, J., Summers, D. W.,Sasaki, Y., DiAntonio,A., and Milbrandt, J.
(2013) Sarm1-mediated axon degeneration requires both SAM and
TIR interactions. J. Neurosci. 33, 1356913580
55. Gerdts, J., Brace, E. J., Sasaki, Y., DiAntonio, A., and Milbrandt, J.
(2015)SARM1 activation triggers axon degeneration locallyvia NAD
+
destruction. Science 348,453457
56. Young,J.D.(2016)TheSLC28(CNT)andSLC29(ENT)nucleoside
transporter families: a 30-year collaborative odyssey. Biochem. Soc.
Trans. 44,869876
Received for publication March 16, 2017.
Accepted for publication July 31, 2017.
NR PROTECTS AGAINST EXCITOTOXIC NEURODEGENERATION 13
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
10.1096/fj.201700221RRAccess the most recent version at doi:
published online August 21, 2017FASEB J
Pauline Vaur, Bernard Brugg, Mathias Mericskay, et al.
excitotoxicity-induced axonal degeneration, protects against
3
Nicotinamide riboside, a form of vitamin B
Material
Supplemental http://www.fasebj.org/content/suppl/2017/08/21/fj.201700221RR.DC1
Subscriptions
http://www.faseb.org/The-FASEB-Journal/Librarian-s-Resources.aspx
is online at The FASEB JournalInformation about subscribing to
Permissions
http://www.fasebj.org/site/misc/copyright.xhtml
Submit copyright permission requests at:
Email Alerts
http://www.fasebj.org/cgi/alerts
Receive free email alerts when new an article cites this article - sign up at
© FASEB
Vol., No. , pp:, August, 2017The FASEB Journal. 193.54.110.55 to IP www.fasebj.orgDownloaded from
Somatic NMDA (µM) -10
Treatment NAD NADNRØ
10 10 100 100 100
NRØØ
0
20
40
60
% condensed nuclei
ns
ns
Supplemental Figure S1, P. Vaur et al.
0,057
Supplemental Figure S2, P. Vaur et al.
NMDA 100 µM
-
--
+
+
+
NAM 5 mM
ns
0.0
0.2
0.4
0.6
0.8
1.0
In de x o f Fr ag m en ta tio n
Nmnat1 Nmnat2 Nmnat3
0
1
2
3
Ctl 3h
NMD A 3 h
Ctl 24h
NMD A 2 4h
mRNA level (ref HPRT)
0,065
**
0,08
ab
Supplemental Figure S4, P. Vaur et al.
WT KO Nmrk2
0
20
40
60
80
100
ctl
FK866 NR / FK 866
NAD / FK 866
% condensed nuclei
WT K O Nmrk2
0.0
0.2
0.4
0.6
0.8
1.0
Index of axonal frag me ntation
Nmrk1 N mrk 2
0.0
0.5
1.0
1.5
2.0
2.5
Ctl 72h
FK 72h
mRNA level (ref HPRT)
ØØØFK 866 FK 866 FK 866
24 h 48 h 72 h
Actin
Nmrk 1
Nmrk 2
Muscles
ab
de
c
*
NR NMN NAD
Nmnat
NAM
Nampt
FK866
Nmrk1
Nmrk2
Cytosol
Cell Membrane
0.0
0.5
1.0
1.5
mRNA leve l (ref HPRT )
Control 72h FK 72h
ENT1 ENT2 ENT3 ENT4
Supplemental figure S3, P. Vaur et al.
**
ns
ns
0,07
P. Vaur et al.
1
Supplemental Figure Legends 1
2
Figure S1: NAD+ and NR have no effect on NMDA-induced neuronal death even at low 3
NMDA dose 4
Quantification of somatic status in cortical neurons exposed to 10 or 100 µM NMDA and 1 5
mM NR or 5 mM NAD+ co-treatment for 24h. Condensed nuclei are counted after Hoechst 6
staining (n=3). 7
8
Figure S2: Level of Nmnat 1-3 mRNA and NAM effect in excitotoxic conditions 9
a) mRNA levels of Nmnat 1-3 were analyzed by RT-qPCR 3 h and 24 h after 100 µM 10
NMDA treatment and normalized to HPRT transcript in cortical neurons. NMDA treatment 11
of 24h induces Nmnat 1-3 transcript (n=3). **pvalue<0.01. b) Quantification of AxD in 12
cortical neurons co-treated with 100 µM NMDA and 5 mM NAM for 24h (n=3). 13
14
Figure S3: ENT2 and ENT4 mRNA are upregulated after FK866-induced NAD+ 15
depletion 16
Cortical neurons were treated or not with 10 µM FK866 for 72h. After total RNA extraction, 17
relative quantification of ENT1-4 mRNA was carried out by RT-qPCR. Results were 18
normalized with HPRT gene (n=4). **pvalue<0.01. 19
20
Figure S4: Nmrk2 is induced after FK866 treatment but is not necessary for the 21
protective effect of NR 22
a) Schematic representation of the effect of FK866 on NAD+ metabolism. b-c) Cortical 23
neurons were treated or not with 10 µM FK866 for 24, 48 or 72 h. After total RNA 24
extraction, both Nmrk1 and Nmrk2 mRNA were analyzed: b) by RT-PCR and agarose gel 25
electrophoresis. mRNA from mouse skeletal muscle was also studied as a positive control. 26
Actin mRNA was analyzed as a house-keeping gene; c) by RT-qPCR, results were 27
normalized with HPRT gene (n=4). d-e) Cortical neurons from WT or Nmrk2 KO mice were 28
co-treated or not with 10 µM FK866 and 50 µM NR or 50 µM NAD+ for 72h: d) 29
Quantification of somatic status (n=2); e) Quantification of AxD (n=2). 30
31
... In a variety of tissue culture and disease models, NAD + supplementation results in cytoprotection (Alano et al., 2010;Alano et al., 2004;Belenky et al., 2007;Brown et al., 2014;Canto et al., 2012;Gong et al., 2013;Hamity et al., 2017;Harlan et al., 2016;Hou et al., 2018;Khan et al., 2014;Liu et al., 2019;Sasaki et al., 2006;Sasaki et al., 2009;Trammell et al., 2016b;Vaur et al., 2017;Xie et al., 2017a;Xie et al., 2017b;Zhang et al., 2016;Zheng et al., 2019). NAD + can be effectively increased in culture and in the nervous system in vivo by exogenous application of NAD + , NAD + precursors (e.g., NAM, NMN, NR), or supplementation or manipulation of the enzymes involved in NAD + synthesis (e.g., NMNAT, NAMPT) (Brown et al., 2014;Sasaki et al., 2006;Zhou et al., 2015). ...
... Application of NAD + precursors to increase cellular NAD + levels is particularly effective. Their administration attenuates cell death (Hou et al., 2018), reduces lesion volume (Vaur et al., 2017), counteracts astrocyte toxicity and reactivity (Harlan et al., 2016;Hou et al., 2018), reduces inflammation (Hou et al., 2018;Zhang et al., 2016), modulates oxidative stress (Wei et al., 2017), protects axons and reduces axonal dysfunction (Brown et al., 2014;Gong et al., 2013;Hamity et al., 2017;Hou et al., 2018;Kitaoka et al., 2020;Vaur et al., 2017), stimulates neurogenesis (Hou et al., 2018;Zhou et al., 2020), and reduces cell senescence (Zhang et al., 2016). The ability of NAD + augmentation in other injury/disease models to modify these cellular processes, along with demonstration that exogenous administration of NAD + protects neurons against cell death in ischemic SCI (Xie et al., 2017a;Xie et al., 2017b), led us to examine whether elevating spinal cord NAD + could be an effective treatment for SCI. ...
... Application of NAD + precursors to increase cellular NAD + levels is particularly effective. Their administration attenuates cell death (Hou et al., 2018), reduces lesion volume (Vaur et al., 2017), counteracts astrocyte toxicity and reactivity (Harlan et al., 2016;Hou et al., 2018), reduces inflammation (Hou et al., 2018;Zhang et al., 2016), modulates oxidative stress (Wei et al., 2017), protects axons and reduces axonal dysfunction (Brown et al., 2014;Gong et al., 2013;Hamity et al., 2017;Hou et al., 2018;Kitaoka et al., 2020;Vaur et al., 2017), stimulates neurogenesis (Hou et al., 2018;Zhou et al., 2020), and reduces cell senescence (Zhang et al., 2016). The ability of NAD + augmentation in other injury/disease models to modify these cellular processes, along with demonstration that exogenous administration of NAD + protects neurons against cell death in ischemic SCI (Xie et al., 2017a;Xie et al., 2017b), led us to examine whether elevating spinal cord NAD + could be an effective treatment for SCI. ...
Preprint
Spinal cord injury (SCI)-induced tissue damage spreads to neighboring spared cells in the hours, days and weeks following injury leading to exacerbation of tissue damage and functional deficits. Among the biochemical changes is the rapid reduction of cellular nicotinamide adenine dinucleotide (NAD ⁺ ), an essential coenzyme for energy metabolism and an essential cofactor for non-redox NAD ⁺ -dependent enzymes with critical functions in sensing and repairing damaged tissue. NAD ⁺ depletion propagates tissue damage. Augmenting NAD ⁺ by exogenous application of NAD ⁺ , its synthesizing enzymes or its cellular precursors mitigates tissue damage. Among the NAD ⁺ precursors, nicotinamide riboside (NR) appears to be particularly well-suited for clinical translation. It safely and effectively augments cellular NAD ⁺ synthesis in a variety of species, including rats and humans, and in a variety of preclinical models, elicits tissue protection. Evidence of NR’s efficacy in the context of SCI repair, however, is currently lacking. These studies tested the hypothesis that administration of NR can effectively enhance NAD ⁺ in the injured spinal cord and that augmenting spinal cord NAD ⁺ protects spinal cord tissue from injury and leads to improvements in locomotor recovery. The results show that intraperitoneal administration of NR (500 mg/kg), administered four days prior to and two weeks following a mid-thoracic contusion-SCI injury, doubles spinal cord NAD ⁺ levels in Long-Evans rats. NR administration preserves spinal cord tissue after injury including neurons and axons, as determined by gray and white matter sparing, and enhances motor function, as assessed by the BBB subscore and missteps on the horizontal ladderwalk. Collectively, the findings demonstrate that administration of the NAD ⁺ precursor, NR, to elevate NAD ⁺ within the injured spinal cord mitigates the tissue damage and functional decline that occurs following SCI. HIGHLIGHTS Nicotinamide Riboside augments spinal cord nicotinamide adenine dinucleotide (NAD ⁺ ). Elevating NAD ⁺ protects spinal cord tissue from spinal cord injury (SCI). Elevating NAD ⁺ enhances motor recovery following SCI.
... Together with two other NAD + precursors, nicotinamide (NAM) and nicotinic acid (NA), NR belongs to the vitamin B3 family [14]. The literature is replete with the beneficial effects of NR-mediated NAD + elevation in a broad spectrum of diseases, including neurodegenerative diseases [18,19], metabolic disorders [20,21], and cardiac fibrosis [22]. Notably, SARS-CoV-2 infection disrupts NAD + homeostasis by depleting cellular NAD + contents and upregulating poly(ADP-ribose) polymerases (PARPs), the NAD + -utilizing enzymes [23,24]. ...
... It started with a one-pot ten-enzyme coupled reaction to convert 13 C-labeled glucose to 13 C-labeled NaAD, which can then be transformed to NAD + via NAD + synthetase-catalyzed amidation reaction ( Figure 4). The 13 C-labeled NAD + was then treated with chemically synthesized 18 O-NAM in the presence of ADP-ribosylcyclase. This enzyme-mediated "base exchange" reaction allowed the formation of NAD + with 13 C labels in the ribose moiety and 18 O label in NAM. ...
... The 13 C-labeled NAD + was then treated with chemically synthesized 18 O-NAM in the presence of ADP-ribosylcyclase. This enzyme-mediated "base exchange" reaction allowed the formation of NAD + with 13 C labels in the ribose moiety and 18 O label in NAM. The subsequent degradations of this NAD + isotopomer by phosphodiesterase and alkaline phosphatase generated 13 C, 18 O-labeled NR in good yield. ...
Article
Full-text available
Among all the NAD+ precursors, nicotinamide riboside (NR) has gained the most attention as a potent NAD+-enhancement agent. This recently discovered vitamin, B3, has demonstrated excellent safety and efficacy profiles and is orally bioavailable in humans. Boosting intracellular NAD+ concentrations using NR has been shown to provide protective effects against a broad spectrum of pathological conditions, such as neurodegenerative diseases, diabetes, and hearing loss. In this review, an integrated overview of NR research will be presented. The role NR plays in the NAD+ biosynthetic pathway will be introduced, followed by a discussion on the synthesis of NR using chemical and enzymatic approaches. NR’s effects on regulating normal physiology and pathophysiology will also be presented, focusing on the studies published in the last five years.
... Quantitative targeted NAD metabolomics 113 has revealed that the NAD system is functionally disturbed by conditions of metabolic stress including fatty liver 114 , peripheral 115 and central 116 Thus, when we have applied NR as a potential remedy, we have done so in the context that there is a functional deficit in key metabolites such as NAD + or NADPH that are putting cells and tissues at risk of not meeting bioenergetic needs, not being able to repair DNA, not being able to detoxify reactive oxygen species, not being able to conduct anabolic processes, not being able to support the activity of a monoADPribosylating PARP family member that is specifically induced, etc. While many redox and repair mechanisms associated with repletion of the NAD system are pleiotropic, we urge researchers to use genetic and other sound analytical techniques to probe NAD repletion mechanisms rather Reviewers and editors should expect more as well. ...
Article
Full-text available
It is central to biology that sequence conservation suggests functional conservation. Animal longevity is an emergent property of selected traits that integrates capacities to perform physical and mental functions after reproductive maturity. Though the yeast SIR2 gene was nominated as a longevity gene based on extended replicative longevity of old mother cells, this is not a selected trait: SIR2 is selected against in chronological aging and the direct targets of SIR2 in replicative lifespan are not conserved. Though it would be difficult to imagine how a gene that advantages 1 in 5 million yeast cells could have anticipated causes of aging in animals, overexpression of SIR2 homologs was tested in invertebrates for longevity. Because artifactual positive results were reported years before they were sorted out and because it was not known that SIR2 functions as a pro-aging gene in yeast chronological aging and in flies subject to amino acid deprivation, a global pursuit of longevity phenotypes was driven by a mixture of framing bias, confirmation bias and hype. Review articles that propagate these biases are so rampant that few investigators have considered how weak the case ever was for sirtuins as longevity genes. Acknowledging that a few positive associations between sirtuins and longevity have been identified after thousands of person-years and billions of dollars of effort, we review the data and suggest rejection of the notions that sirtuins 1) have any specific connection to lifespan in animals and 2) are primary mediators of the beneficial effects of NAD repletion.
... Because NAD + plays a role in diverse metabolic pathways, 37,38 it serves as a potential target for numerous pathophysiological conditions 39,40 which could be achieved through NR treatment. In fact, NR supplementation has been shown to prevent axonal degeneration 41 and neuroinflammation 42,43 in mice. NR's neuroprotective effects also have implications in Alzheimer's disease, Parkinson's disease, and neuromuscular diseases, 44 and are primarily mediated by sirtuins. ...
Article
Full-text available
Background Chemotherapy-induced peripheral neuropathy represents a major impairment to the quality of life of cancer patients and is one of the most common dose-limiting adverse effects of cancer treatment. Despite its prevalence, no effective treatment or prevention strategy exists. We have previously provided genetic evidence that the NAD+ -dependent deacetylase, SIRT2, protects against cisplatin-induced peripheral neuronal cell death and neuropathy by enhancing nucleotide excision repair. In this study, we aimed to examine whether pharmacologic activation of SIRT2 would provide effective prevention and treatment of cisplatin-induced peripheral neuropathy (CIPN) without compromising tumor cell cytotoxic response to cisplatin. Methods Using von Frey and dynamic hot plate tests, we studied the use of nicotinamide riboside (NR) to prevent and treat CIPN in mouse model. We also performed cell survival assays to investigate the effect of NAD+ supplementation on cisplatin toxicity in neuronal and cancer cells. Lewis lung carcinoma model was utilized to examine the effect of NR treatment on in vivo cisplatin tumor control. Results We show that NR, an NAD+ precursor and pharmacologic activator of SIRT2, effectively prevents and alleviates CIPN in mice. We present in vitro and in vivo genetic evidence to illustrate the specific dependence on SIRT2 of NR-mediated CIPN mitigation. Importantly, we demonstrate that NAD+ mediates SIRT2-dependent neuroprotection without inhibiting cisplatin cytotoxic activity against cancer cells. NAD+ may, in fact, further sensitize certain cancer cell types to cisplatin. Conclusions Together, our results identify SIRT2-targeted activity of NR as a potential therapy to alleviate CIPN, the debilitating and potentially permanent toxicity.
... NR has better metabolic properties and works well in models of Alzheimer's disease [8,9]. NR treatment has been shown to improve cognitive function in Tg2576 transgenic mice [10]. It also supports hippocampal function, reduces brain inflammation and improves cognitive function in diabetic mice [11]. ...
Article
Full-text available
Nicotinamide adenine dinucleotide (NAD) is a critical cosubstrate for enzymes involved in supplying energy to the brain. Nicotinamide riboside (NR), an NAD⁺ precursor, emerges as a neuroprotective factor after chronic brain insults. However, researchers have not determined whether it improves cognition after acute ischemia. In the present study, mice with middle cerebral artery occlusion were treated with NR chloride (NRC, 300 mg/kg, IP., 20 min after reperfusion). The results of the Morris water maze test revealed better recovery of learning and memory function in the NRC-treated group. Acute NRC treatment decreased hippocampal infarct volume, reduced neuronal loss and apoptosis in the hippocampus. Western blot and high-performance liquid chromatography assays of hippocampal tissues revealed that the activation of Sirtin-1 and adenosine 5′ monophosphate-activated protein kinase was increased, the NAD content was elevated, and the production of adenosine triphosphate was strengthened by NRC. Collectively, acute NRC treatment increased the energy supply, reduced the neuronal loss and apoptosis, protected the hippocampus and ultimately promoted the recovery of cognitive function after brain ischemia.
... NR is also effective in axonal neurodegeneration in mice. Interestingly, the author identified that NR uses same pathway with NAD+ when preventing the neurodegeneration, but the effect of NR is much higher than that of NAD+ alone [189]. The decline of the dopaminergic (DA) neuron and climbing ability induced by human N370S GBA was mitigated by NR in a fruit fly model (Schondorf et al., 2018). ...
Article
Owing to the global exponential increase in population ageing, there is an urgent unmet need to develop reliable strategies to slow down and delay the ageing process. Age-related neurodegenerative diseases are among the main causes of morbidity and mortality in our contemporary society and represent a major socio-economic burden. There are several controversial factors that are thought to play a causal role in brain ageing which are continuously being examined in experimental models. Among them are oxidative stress and brain inflammation which are empirical to brain ageing. Although some candidate drugs have been developed which reduce the ageing phenotype, their clinical translation is limited. There are several strategies currently in development to improve brain ageing. These include strategies such as caloric restriction, ketogenic diet, promotion of cellular nicotinamide adenine dinucleotide (NAD+) levels, removal of senescent cells, 'young blood' transfusions, enhancement of adult neurogenesis, stem cell therapy, vascular risk reduction, and non-pharmacological lifestyle strategies. Several studies have shown that these strategies can not only improve brain ageing by attenuating age-related neurodegenerative disease mechanisms, but also maintain cognitive function in a variety of pre-clinical experimental murine models. However, clinical evidence is limited and many of these strategies are awaiting findings from large-scale clinical trials which are nascent in the current literature. Further studies are needed to determine their long-term efficacy and lack of adverse effects in various tissues and organs to gain a greater understanding of their potential beneficial effects on brain ageing and health span in humans.
Article
The role of nicotinamide adenine dinucleotide (NAD+) in ageing has emerged as a critical factor in understanding links to a wide range of chronic diseases. Depletion of NAD+, a central redox cofactor and substrate of numerous metabolic enzymes, has been detected in many major age-related diseases. However, the mechanisms behind age-associated NAD+ decline remains poorly understood. Despite limited conclusive evidence, supplements aimed at increasing NAD+ levels are becoming increasingly popular. This review provides renewed insights regarding the clinical utility and benefits of NAD+ precursors, namely nicotinamide (NAM), nicotinic acid (NA), nicotinamide riboside (NR) and nicotinamide mononucleotide (NMN), in attenuating NAD+ decline and phenotypic characterization of age-related disorders, including metabolic, cardiovascular and neurodegenerative diseases. While it is anticipated that NAD+ precursors can play beneficial protective roles in several conditions, they vary in their ability to promote NAD+ anabolism with differing adverse effects. Careful evaluation of the role of NAD+, whether friend or foe in ageing, should be considered.
Preprint
Full-text available
Hundreds of colleagues, trainees and members of the general public have asked me to evaluate the thesis that sirtuins--genes related to yeast SIR2--are conserved longevity genes. In this review article, I evaluate the data, and make the case that it is straightforward to reject the thesis that sirtuins are longevity genes. The preprint is in peer review. I encourage scientists to read and discuss this review and to provide comments that will help move the field forward.
Article
Wallerian degeneration (WD) is a well-known process by which degenerating axons and myelin are cleared after nerve injury. Although organophosphate-induced delayed neuropathy (OPIDN) is characterized by Wallerian-like degeneration of long axons in human and sensitive animals, the precise pathological mechanism remains unclear. In this study, we cultured embryonic chicken dorsal root ganglia (DRG) neurons, the model of OPIDN in vitro, to investigate the underlying mechanism of axon degeneration induced by tri-ortho-cresyl phosphate (TOCP), an OPIDN inducer. The results showed that TOCP exposure time- and concentration-dependently induced a serious degeneration and fragmentation of the axons from the DRG neurons. A collapse of mitochondrial membrane potential and a dramatic depletion of ATP levels were found in the DRG neurons after TOCP treatment. In addition, nicotinamide nucleotide adenylyl transferase 2 (NMNAT2) expression and nicotinamide adenine dinucleotide (NAD+) level was also found to be decreased in the DRG neurons exposed to TOCP. However, the TOCP-induced Wallerian degeneration in the DRG neurons could be inhibited by ATP supplementation. And exogenous NAD+ or NAD+ processor nicotinamide riboside can rescue TOCP-induced ATP deficiency and prevent TOCP-induced axon degeneration of the DRG neurons. These findings may shed light on the pathophysiological mechanism of TOCP-induced axonal damages, and implicate the potential application of NAD+ to treat OPIDN.
Article
Coronavirus replication results in expenditure of nicotinamide adenine dinucleotide (NAD+), the central catalyst of cellular metabolism, in the innate response to infection. Repletion of NAD+ levels has the potential to enhance antiviral responses.
Article
Full-text available
Overexpression of the NAD+ biosynthetic enzyme NMNAT1 leads to preservation of injured axons. While increased NAD+ or decreased NMN levels are thought to be critical to this process, the mechanism(s) of this axon protection remain obscure. Using steady-state and flux analysis of NAD+ metabolites in healthy and injured mouse dorsal root ganglion axons, we find that rather than altering NAD+ synthesis, NMNAT1 instead blocks the injury-induced, SARM1-dependent NAD+ consumption that is central to axon degeneration.
Article
Full-text available
Objective Augmenting nicotinamide adenine dinucleotide (NAD⁺) availability may protect skeletal muscle from age-related metabolic decline. Dietary supplementation of NAD⁺ precursors nicotinamide mononucleotide (NMN) and nicotinamide riboside (NR) appear efficacious in elevating muscle NAD⁺. Here we sought to identify the pathways skeletal muscle cells utilize to synthesize NAD⁺ from NMN and NR and provide insight into mechanisms of muscle metabolic homeostasis. Methods We exploited expression profiling of muscle NAD⁺ biosynthetic pathways, single and double nicotinamide riboside kinase 1/2 (NRK1/2) loss-of-function mice, and pharmacological inhibition of muscle NAD⁺ recycling to evaluate NMN and NR utilization. Results Skeletal muscle cells primarily rely on nicotinamide phosphoribosyltransferase (NAMPT), NRK1, and NRK2 for salvage biosynthesis of NAD⁺. NAMPT inhibition depletes muscle NAD⁺ availability and can be rescued by NR and NMN as the preferred precursors for elevating muscle cell NAD⁺ in a pathway that depends on NRK1 and NRK2. Nrk2 knockout mice develop normally and show subtle alterations to their NAD+ metabolome and expression of related genes. NRK1, NRK2, and double KO myotubes revealed redundancy in the NRK dependent metabolism of NR to NAD⁺. Significantly, these models revealed that NMN supplementation is also dependent upon NRK activity to enhance NAD⁺ availability. Conclusions These results identify skeletal muscle cells as requiring NAMPT to maintain NAD⁺ availability and reveal that NRK1 and 2 display overlapping function in salvage of exogenous NR and NMN to augment intracellular NAD⁺ availability.
Article
Full-text available
NAD⁺ is a vital redox cofactor and a substrate required for activity of various enzyme families, including sirtuins and poly(ADP-ribose) polymerases. Supplementation with NAD⁺ precursors, such as nicotinamide mononucleotide (NMN) or nicotinamide riboside (NR), protects against metabolic disease, neurodegenerative disorders and age-related physiological decline in mammals. Here we show that nicotinamide riboside kinase 1 (NRK1) is necessary and rate-limiting for the use of exogenous NR and NMN for NAD⁺ synthesis. Using genetic gain- and loss-of-function models, we further demonstrate that the role of NRK1 in driving NAD⁺ synthesis from other NAD⁺ precursors, such as nicotinamide or nicotinic acid, is dispensable. Using stable isotope-labelled compounds, we confirm NMN is metabolized extracellularly to NR that is then taken up by the cell and converted into NAD⁺. Our results indicate that mammalian cells require conversion of extracellular NMN to NR for cellular uptake and NAD⁺ synthesis, explaining the overlapping metabolic effects observed with the two compounds.
Article
Full-text available
Nicotinamide riboside (NR) is in wide use as an NAD⁺ precursor vitamin. Here we determine the time and dose-dependent effects of NR on blood NAD⁺ metabolism in humans. We report that human blood NAD⁺ can rise as much as 2.7-fold with a single oral dose of NR in a pilot study of one individual, and that oral NR elevates mouse hepatic NAD⁺ with distinct and superior pharmacokinetics to those of nicotinic acid and nicotinamide. We further show that single doses of 100, 300 and 1,000 mg of NR produce dose-dependent increases in the blood NAD⁺ metabolome in the first clinical trial of NR pharmacokinetics in humans. We also report that nicotinic acid adenine dinucleotide (NAAD), which was not thought to be en route for the conversion of NR to NAD⁺, is formed from NR and discover that the rise in NAAD is a highly sensitive biomarker of effective NAD⁺ repletion.
Article
Full-text available
Although neuronal regeneration is a highly energy-demanding process, axonal mitochondrial transport progressively declines with maturation. Mature neurons typically fail to regenerate after injury, thus raising a fundamental question as to whether mitochondrial transport is necessary to meet enhanced metabolic requirements during regeneration. Here, we reveal that reduced mitochondrial motility and energy deficits in injured axons are intrinsic mechanisms controlling regrowth in mature neurons. Axotomy induces acute mitochondrial depolarization and ATP depletion in injured axons. Thus, mature neuron-associated increases in mitochondria-anchoring protein syntaphilin (SNPH) and decreases in mitochondrial transport cause local energy deficits. Strikingly, enhancing mitochondrial transport via genetic manipulation facilitates regenerative capacity by replenishing healthy mitochondria in injured axons, thereby rescuing energy deficits. An in vivo sciatic nerve crush study further shows that enhanced mitochondrial transport in snph knockout mice accelerates axon regeneration. Understanding deficits in mitochondrial trafficking and energy supply in injured axons of mature neurons benefits development of new strategies to stimulate axon regeneration.
Article
Full-text available
Male C57BL/6J mice raised on high fat diet (HFD) become prediabetic and develop insulin resistance and sensory neuropathy. The same mice given low doses of streptozotocin are a model of type 2 diabetes (T2D), developing hyperglycemia, severe insulin resistance and diabetic peripheral neuropathy involving sensory and motor neurons. Because of suggestions that increased NAD+ metabolism might address glycemic control and be neuroprotective, we treated prediabetic and T2D mice with nicotinamide riboside (NR) added to HFD. NR improved glucose tolerance, reduced weight gain, liver damage and the development of hepatic steatosis in prediabetic mice while protecting against sensory neuropathy. In T2D mice, NR greatly reduced non-fasting and fasting blood glucose, weight gain and hepatic steatosis while protecting against diabetic neuropathy. The neuroprotective effect of NR could not be explained by glycemic control alone. Corneal confocal microscopy was the most sensitive measure of neurodegeneration. This assay allowed detection of the protective effect of NR on small nerve structures in living mice. Quantitative metabolomics established that hepatic NADP+ and NADPH levels were significantly degraded in prediabetes and T2D but were largely protected when mice were supplemented with NR. The data justify testing of NR in human models of obesity, T2D and associated neuropathies.