ArticlePDF Available

Abstract and Figures

Wastewater treatment center (WTC) workers may be vulnerable to diseases caused by viruses, such as the common cold, influenza and gastro-intestinal infections. Although there is a substantial body of literature characterizing the microbial community found in wastewater, only a few studies have characterized the viral component of WTC aerosols, despite the fact that most diseases affecting WTC workers are of viral origin and that some of these viruses are transmitted through the air. In this study, we evaluated in four WTCs the presence of 11 viral pathogens of particular concern in this milieu and used a metagenomic approach to characterize the total viral community in the air of one of those WTCs. The presence of viruses in aerosols in different locations of individual WTCs was evaluated and the results obtained with four commonly used air samplers were compared. We detected four of the eleven viruses tested, including human adenovirus (hAdV), rotavirus, hepatitis A virus (HAV) and Herpes Simplex virus type 1 (HSV1). The results of the metagenomic assay uncovered very few viral RNA sequences in WTC aerosols, however sequences from human DNA viruses were in much greater relative abundance.
Content may be subject to copyright.
Human viral pathogens are pervasive in wastewater treatment
center aerosols
Evelyne Brisebois
1,2
, Marc Veillette
2
, Vanessa Dion-Dupont
1,2
, Jacques Lavoie
3
,
Jacques Corbeil
4
, Alexander Culley
1
, Caroline Duchaine
1,2,
1. Université Laval, Pavillon Alexandre Vachon, 1045, ave de la Médecine, Québec, QC G1V0A6, Canada
2. CRIUCPQ, 2725, Chemin Sainte-Foy, Québec, QC G1V 4G5, Canada
3. IRSST, 505 Boulevard de Maisonneuve O, Montréal, QC, H3A 3C2, Canada
4. CRCHU, 2705 Boulevard Laurier, RC-709, Québec, QC, G1V 4G2, Canada
ARTICLE INFO ABSTRACT
Article history:
Received 21 February 2017
Revised 18 July 2017
Accepted 20 July 2017
Available online xxxx
Wastewater treatment center (WTC) workers may be vulnerable to diseases caused by
viruses, such as the common cold, influenza and gastro-intestinal infections. Although
there is a substantial body of literature characterizing the microbial community found in
wastewater, only a few studies have characterized the viral component of WTC aerosols,
despite the fact that most diseases affecting WTC workers are of viral origin and that some
of these viruses are transmitted through the air. In this study, we evaluated in four WTCs
the presence of 11 viral pathogens of particular concern in this milieu and used a
metagenomic approach to characterize the total viral community in the air of one of those
WTCs. The presence of viruses in aerosols in different locations of individual WTCs was
evaluated and the results obtained with four commonly used air samplers were compared.
We detected four of the eleven viruses tested, including human adenovirus (hAdV),
rotavirus, hepatitis A virus (HAV) and Herpes Simplex virus type 1 (HSV1). The results of the
metagenomic assay uncovered very few viral RNA sequences in WTC aerosols, however
sequences from human DNA viruses were in much greater relative abundance.
© 2017 The Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences.
Published by Elsevier B.V.
Keywords:
Airborne viruses
Air sampling
Wastewater treatment plants
Viral metagenomics
Introduction
Wastewater treatment centers (WTCs) are, unsurprisingly,
highly contaminated environments. Concentrations of viruses
in effluent waters can be extremely high, sometimes reaching
10
11
viruses/mL (La Rosa et al., 2010). Several studies have
reported higher symptom and disease rates among this group
of workers (Khuder et al., 1998). They experience respiratory
symptoms, fevers, gastrointestinal symptoms, and headaches
more often than the non-exposed population (Khuder et al.,
1998; Smit et al.,2005; Van Hooste et al., 2010). Theterm sewage
worker's syndromewas used for the first time in 1973 to
describe the assemblage of these symptoms (Rylander et al.,
1976).
Despite the fact that most WTC occupational symptoms can
be associated with viral infections, only a few studies have
investigated viruses as an occupational risk in these environ-
ments. Previous studies have demonstrated the presence of
human pathogenic viruses in influent water, including
noroviruses (Pouillot et al., 2015; Qiu et al., 2015) and rotaviruses
(Baggi et al., 2001; Qiu et al., 2015) that cause gastroenteritis;
adenoviruses (Osuolale and Okoh, 2015; Qiu et al., 2015),
JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Corresponding author. E-mail: caroline.duchaine@bcm.ulaval.ca (Caroline Duchaine).
http://dx.doi.org/10.1016/j.jes.2017.07.015
1001-0742/© 2017 The Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V.
Available online at www.sciencedirect.com
ScienceDirect
www.elsevier.com/locate/jes
JES-01272; No of Pages 9
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
rhinoviruses andenteroviruses (Baggi et al., 2001, Qi u et al., 2015)
that are responsible for the common cold, and even herpes
simplex viruses, which can cause oral and genital sores and
blisters (Bibby and Peccia, 2013). Among the viruses detected at
WTCs, many of these pathogens are transmitted by aerosols
(Tseng et al., 2010; Bonifait et al., 2015). Despite the importance
of this route of transmission, surprisingly few studies have
examined the potential exposure of WTC workers to pathogenic
viruses through the air. Moreover, in these studies, only one or
two viruses were analyzed (Romano et al., 1999; Uhrbrand et al.,
2011; Masclaux et al., 2014). In Denmark WTCs, noroviruses
(Noro) GI and GII were detected for the first time in air
samples using personal samplers (Uhrbrand et al., 2011).
Adenovirus (AdV), hepatitis E virus (HEV) and norovirus were
also investigated in air samples from 31 Swiss WTCs. The
researchers found AdV, noroviruses and HEV in 100%, 2% and
0%, respectively of the WTC aerosols tested (Masclaux et al.,
2014). Enterovirus and reovirus were identified in 3.4% of the
air samples from an aerosol study of WTCs in Italy (Romano
et al., 1999).
To date, metagenomics has been used to characterize viral
communities inaerosols in only three studies (Whon et al., 2012;
Hall et al., 2013; Be et al., 2015). In all of these studies, RNA viruses
were excluded, despite the fact that most human respiratory
viruses have RNA genomes such as coronavirus, influenza virus,
and metapneumovirus. To the best of our knowledge, this is the
first time that a metagenomic approach has been used to
characterize viral communities from WTC aerosols.
In Eastern Canada, WTC secondary treatment can differ from
one plant to another. For example, some centers perform
biological removal of residual matter (also called biofiltration)
as the water exits the early stages of the treatment pipeline,
while others conduct a secondary decantation as an alternative
to biofiltration. Every day, WTC employees work in rooms or
locations where different processing steps are taking place,
some of which increase the risk of exposure to bioaerosols. In
this study, we used various air samplers to evaluate the presence
and abundance of some human pathogen viruses in aerosols in
different locations of WTCs using quantitative polymerase chain
reaction (qPCR). We also applied a viral metagenomics approach
in one of the participating WTCs.
1. Material and methods
1.1. WTCs and site selection
Since very few reports exist on occupational airborne viral
exposure, there is no consensus sampling strategy for the
collection and purification of viral nucleic acids from aerosols.
We therefore used both low and high flow rate sampling
approaches.
Air samples were collected from four different WTCs from
Eastern Canada during summertime. Indoor sites where
wastewater treatment occurs and workers daily tasks are
occurring were sampled. A total of 11 sites (or sampling
locations) distributed among four WTCs are presented in
this study. Pertinent details for each site are presented in
Table 1.
1.2. Air sampling methods
1.2.1. Sampling for qPCR analysis
In this study, two different samplers were used to collect
samples for qPCR detection (Coriolis®μand Marple). The
samplers were positioned at the same location at each water
treatmentsite. Although the sampling duration was dependent
on the sampler model, sampling was always performed during
the same day over the same 6-hour shift.
The Coriolis®μ(Bertin Technologies, Montigny-le-Bretonneux,
France) is a liquid cyclone that collects particles in 15 mL of
Phosphate Buffer Saline (PBS). The flowrate was 200 L/min for
10 min, for a total of 2 m
3
of air/sample. The volume of the
recipient was readjusted to 15 mL after sampling to compen-
sate for evaporation.Five mL of the total were concentrated in a
final volume of 200 μL using tangential flow filtration devices
(100 kDa, Millipore, Darmstadt, Germany) used to conduct viral
qPCR analyses (0.67 m
3
of air).
The second sampler, a size fractionating collector, the
Marple Personal Cascade Impactor (Thermo Fisher Scientific,
Waltham, USA) was used to collect information about aerosols
size distribution of viruses containing bioaerosols. Due to
material limitation, a maximum of two sampling locations per
WTC were selected. In this sampler, air is accelerated by going
through six radial slots of a first impactor stage in which each of
the 8 stages impacts a subfraction of particles ranging from 0.5
to 21 μm of aerodynamic diameters that are ultimately collected
on filters. After the 8th stage, another filter collects the
remaining fine particles. It was used at a flowrate of 2 L/min
for 5 hr, for a total of 0.6 m
3
collected. Each of the 9 filters was
eluted in 5 mL of PBS and 500 μL were concentrated in a final
volume of 25 μL using tangential flow filtration devices
(100 kDa, Millipore, Darmstadt, Germany). Nucleic acids were
extracted for this subsample and then used for qPCR.
1.2.2. Viral metagenomics
For viral metagenomics approach, the sampling was accom-
plished with the SASS 2300 sampler (Research International,
Table 1 Description of wastewater treatment centers (WTCs) and sites of the study.
WTCs Sites Tasks
WTCs 1 and 2 Screening Removal of big objects (e.g.,: plastics and paper)
Grit/fats, oils and greases (FOGs) removal) Removal of granular matter and FOGs
Biofiltration Biological degradation of residual organic matter
WTC3 Primary screening Removal of big objects
Secondary screening Removal of residual big objects
WTC4 Screening Removal of big objects
Grit/fats, oils and greases removal Removal of granular matter and FOGs
Secondary decantation Removal of residual particles by decantation
2JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
Washington, USA) a high flowrate (300 L/min) liquid cyclone
that allow extended sampling periods and resulting in a
larger air sample in a smaller collection liquid volume (5 mL).
A total of 30 m
3
of air was sampled (sampling time of
100 min).
1.3. Nucleic acid extraction
All nucleic acids were extracted and eluted in 100 μL with the
QIAamp MinElute Spin Virus kit (Qiagen, Hilden, Germany)
that co-purifies DNA and RNA as per instructions. Reverse
transcription was performed on samples used for quantifica-
tion of RNA viruses with the iScriptcDNA Synthesis kit
(Bio-Rad Laboratories, Mississauga, Canada) according to the
manufacturers' instructions.
1.4. qPCR analyses
We selected viral qPCR primers based on two criteria: (1) whether
they amplified human pathogens that can cause symptoms
often encountered by WTC workers and (2) whether their
presence in wastewaters had been demonstrated. Eleven viruses
fit these criteria: influenza viruses (Inf) A and B, noroviruses
(Noro) GI and GII, herpes simplex viruses (HSV) 1 and 2, human
rhinovirus, enterovirus, human adenovirus, rotavirus (rota) and
hepatitis A virus.
A volume of 2 μL of nucleic acids (DNA or cDNA) was used
for each 20 μL qPCR reactions using the iQSupermix kit
(Bio-Rad Laboratories, Mississauga, Canada). The same
thermocycler protocol was performed for all eleven viruses:
an initial denaturation step of 3 min at 94°C, followed by
40 cycles of a denaturation step at 94°C for 15 sec followed by
an annealing/extension step at 60°C for 1 min. All standard
curves had efficiency between 90% and 110% and an R
2
above
0.98. Table 2 lists the sequences of the primers and probes
used for the quantitative amplification assays.
1.5. Metagenomics study
Samples from SASS 2300 samplers intended for metagenomics
analyses were thawed from the 80°C freezer and concentrat-
ed in Amicon 100 kDa tangential flow filtration devices
(Millipore) to a final volume of 200 μL. Nucleic acids were
subsequently extracted with the QIAamp MinElute Spin
Virus kit (Qiagen, Hilden, Germany) as per instructions.
Concentrated nucleic acids were eluted in a final volume of
87.5 μL to directly undergo the digestion of DNA with the
RNase-Free DNase Set from Qiagen, followed by RNA purifica-
tion with the RNeasy MinElute Cleanup kit from Qiagen. RNA
samples were processed for library construction with the Kapa
Stranded mRNA-Seq Kit (Kapa Biosystems, San Diego, USA)
and then sequenced on the MiSeq sequencing platform
(Illumina, Inc., paired-end 300 nucleotides reads) at the
sequencing facility of the Centre hospitalier de l'Université Laval
(CHUL). The reads were assembled into contigs by Ray Meta
(Boisvert et al., 2012). The Ray Meta software uses a bloom filter
to remove k-mers that are potentially background noise and
sequencing errors. Data were subsequently analyzed via the
web-based MG-RAST (Meyer et al., 2008) and MetaVir plat-
forms (Roux et al., 2011).
Table 2 Primers and probes used for qPCR detection of selected viruses.
Viruses RNA/
DNA
Forward primers Reverse primers Probes Reference
Inf A RNA GACCRATCCTGTCACCTCTGAC AGGGCATTYTGGACAAAKCGTCTA TGCAGTCCTCGCTCACTGGGCACG (Selvaraju and Selvarangan, 2010)
Inf B RNA TCCTCAACTCACTCTTCGAGCG CGGTGCTCTTGACCAAATTGG CCAATTCGAGCAGCTGAAACTGCGGTG (Selvaraju and Selvarangan, 2010)
Noro GI RNA CGYTGGATGCGNTTYCATGA CTTAGACGCCATCATCATTYAC AGATYGCGATCYCCTGTCCA (Kageyama et al., 2003)
Noro GII RNA CARGARBCNATGTTYAGRTGGATGAG TCGACGCCATCTTCATTCACA TGGGAGGGCGATCGCAATCT (Kageyama et al., 2003)
HSV-1 DNA CGCATCAAGACCACCTCCTC GCTCGCACCACGCGA TGGCAACGCGGCCCAAC (Corey et al., 2005)
HSV-2 DNA CGCATCAAGACCACCTCCTC GCTCGCACCACGCGA CGGCGATGCGCCCCAG (Corey et al., 2005)
HRV RNA GTGAAGAGCCSCRTGTGCT GCTSCAGGGTTAAGGTTAGCC TGAGTCCTCCGGCCCCTGAATG (Hayden et al., 2003)
EV RNA GGCCCCTGAATGCGGCTAAT CAATTGTCACCATAAGCAGCCA CGGACACCCAAAGTAGTCGGTTCCG (Donaldson et al., 2002, Meijer et al., 2012)
hAdV DNA GCCACGGTGGGGTTTCTAAACTT GCCCCAGTGGTCTTACATGCACAT TGCACCAGACCCGGGCTCAGGTACTCCGA (Heim et al., 2003)
Rotavirus RNA ACCATCTWCACRTRACCCCTCTATGAG GGTCACATAACGCCCCTATAGC AGTTAAAAGCTAACACTGTCAAA (Zeng et al., 2008)
HAV RNA GGTAGGCTACGGGTGAAAC CCTCCGGCGTTGAATGGTTT ACAGCGGCGGATATTGGTGAGTTGTTAAGA (Qiu et al., 2014)
W = A/T, S = C/G, K = G/T, R = A/G, Y = C/T and N = A, T, C or G.
3JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
2. Results
2.1. qPCR
Among all targeted viruses, two were detected; HAV and
rotavirus. Table 3 shows where they were detected and at
what concentration.
From the Marple samples, only rotavirus cDNA could be
detected almost everywhere except in samples from site 1 of
WTC 3. Samples from site 2 of WTC 1 seem to have viral
material on larger airborne particles, and site 3 of WTC 4
presents the opposite situation, viral material on smaller
airborne particles. The other samples show a spread of the
viral particles among the stages of the sampler (Table 4).
2.2. Metagenomics
The bigger samples obtained with the Sass 2300 sampler were
used to produce viral metagenomes from three sites from
WTC 4. The dataset for the three locations were as shown in
Table 5.
In Fig. 1a, the classification of assigned sequences is at a
domain taxonomic level. In Fig. 1b, the classification of
virus-assigned sequences (n= 9996) was divided by Family:
Families with less than 1% representation were classified in
the group other.Fig. 1c represents the hosts of viruses based
on the Fig. 1b assignments. Bacteria represented the most
abundant organisms in all three samples with an average of
almost 93% of all sequences. Among viral sequences, more
than 62% were from phages in the order Caudovirales. 1.2% of
the viruses' hosts were human (see Fig. 1ca). The classification
of these sequences to the lowest taxonomic level possible is
shown in Fig. 2. Table S1 (Appendix A) shows the taxonomy of
the viruses in the group otherto the family level. (See Fig. 3).
Human endogenous retroviruses were recovered from all
three samples. Sequences fromHSV1andHSV5,twotypesof
herpes simplex viruses causing latent infections, were also found
in all three sites. Chlamydiamicrovirus sequences were identified
in both site 2 and site 3 samples, and were the most highly
represented human virus in site 3. Human papillomavirus, a
virus that causes latent sexually transmissible infections, was
the most common human virus detected in site 2. Variola virus
sequences were found to be in the air sample from site 3 only.
We used a heatmap generated with MetaVir to compare
our metagenomic data from WTC aerosols with published
metagenomic data from WTC-related locations in order to
gain insight into the primary source of airborne microbes. In
this analysis, we included the complete dataset to construct
the map, and thus bacteria, archaea, fungi, and viruses were
included.
3. Discussion
Using qPCR, few viruses were detected with the tested
sampling devices. Rotavirus was detectable more frequently
with the Marple compared to the Coriolis. Rotavirus is a
double-stranded RNA virus and as RNA is extremely fragile
and rapidly degraded by RNases found ubiquitously in nature,
there is a chance that samplers with a flow rate higher than
200 L/min tend to lead to the degradation of less robust RNA
virus species during collection (Cao et al., 2011; Toulouse et al.,
2014). The Marple and the Coriolis are based on two
completely different capture mechanisms; filtration and
liquid impaction. Both of these mechanisms may induce
particle loss (bouncing and re-aerosolization). The different
sizes and characteristics of the eleven selected viruses likely
also plays a role in the capture efficiency of each sampler, as
some enveloped or non-enveloped viruses are more or less
resistant to desiccation caused by the sampling times and
rates. Marple samples also suggest a wide range of particles
sizes carrying viruses, suggesting lower and upper respiratory
tract exposure. In both cases, viruses can either remain in the
lungs or upper tract or be subsequently swallowed.
Overall, rotaviruses seem to be abundant in the air of
WTCs based on qPCR detection. The sites that showed the
highest concentrations of rotaviruses were also the sights
that had the highest concentration of total viruses (e.g.,
biofiltration sites of WTCs 1 and 2). Inhalation of pathogenic
viruses causing respiratory infections has been studied over
the years since it represents a preferential route of transmis-
sion for some viruses. Rotavirus is known to cause gastroen-
teritis. The infectious dose of this virus through the oral route
is below 100 viral particles (Payne et al., 2011), which was 10
4
times less than the concentrations of genome copies detected
by cubic meter in this study, although we did not test for viral
infectivity. It is clear from our data that additional studies
should be performed to determine the concentration of
infectious viruses in WTC aerosols. The impact on human
health of aerosol exposure to viruses such as HAV has not
been documented, as they are not known to be transmitted
through the airborne route. However, the possibility of these
viruses infecting a host via the air pathway cannot be ruled
out, and raises another avenue of future research. As
mentioned before, WTC workers experience symptoms such
as fever, nausea and vomiting that could be linked to
infections by HAV. Like HAV, the possibility of rotavirus
transmission via the air has not been examined to date,
nevertheless, the fact that these viruses have been detected in
air samples from a hospital (Dennehy et al., 1998) raises the
Table 3 Viral amplifications from air samples using
Coriolis high flow sampler in WTCs.
WTCs Sites Virus (gene copies/m
3
air)
WTC1 Site 1 Rota (3.2 × 10
4
)
Site 2 Rota (2.2 × 10
5
)
Site 3 Rota (3.5 × 10
4
), HAV (4.7 × 10
3
)
WTC2 Site 1 Rota (1.7 × 10
4
)
Site 2 Rota (2.2 × 10
5
)
Site 3 Rota (1.8 × 10
5
)
WTC3 Site 1
Site 2
WTC4 Site 1
Site 2
Based on limit of detection of qPCR reactions, the limit of detection
(LOD) for Coriolis sampleris estimated to 1.0 × 10
3
for both hepatitis A
virus (HAV) and Rotavirus.
4JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
likelihood of transmission via aerosol. In addition, a recent
study performed by our team showed that norovirus, a virus
responsible for gastroenteritis outbreaks worldwide, can be
present in the air (Bonifait et al., 2015), suggesting that
perhaps other viruses that cause the same disease, like
rotaviruses, could follow the same pattern. Establishing
whether aerosol transmission of these viruses is a viable
route is critical if we are to better understand the occupational
risks of WTC workers.
In this study, Noroviruses GI and GII were not detected
although WTC workers personal air samplers were positive in
previous studies (Uhrbrand et al., 2011; Masclaux et al., 2014).
This may be due to differences in flowrate between our
samplers and the personal samplers. The flowrate of personal
samplers, which use gelatin filters, is much less than the
devices we used (except for the Marple). It is possible that
norovirus, an RNA virus that is easily damaged by a greater
airflow, was removed during sampling in our study. hAdV was
not detected Coriolis and Marple samples, this virus was
observed in a previous study (Masclaux et al., 2014). Entero-
virus was not detected at all, which is consistent with the
literature data where only 2 out of 118 samples were positive
(Romano et al., 1999).
In addition to the direct inhalation of viruses in aerosols,
workers are exposed to viruses that can be trapped in the upper
respiratory tract or the lungs and swallowed afterwards.
Although this study did not aim to document the surface
contamination by viruses, workers can also be exposed to viral
particles deposited on surfaces via aerosol deposition, i.e.,the
fomite transmission route. In this pathway, aerosolized viruses
adsorb to charged fomites on a surface. The fomite with the
pathogen can then come into contact with a worker, his or her
hand for example. The worker is subsequently infected when
he/she touches his/her mouth and/or eyes. Many viruses
remain infectious for extended periods of time after deposition.
For example, HAV and rotavirus remain infectious for more
than two months on fomites (Boone and Gerba, 2007). This
route of infection has been proven for many viral pathogens,
including rotavirus (Butz et al., 1993; Hota, 2004), HAV
(Sundkvist et al., 2000; Aitken and Jeffries, 2001), and AdV
(Abad et al., 1994; Aitken and Jeffries, 2001; Hamada et al., 2008)
among others, and yet remains an underestimated and
understudied risk for workers.
Our metagenomic analysis focused on RNA viruses because
they are responsible for the majority of human respiratory and
enteric illnesses suffered by WTCs' workers and the DNA virus
community is typically dominated by viruses that infect bacteria
(i.e., bacteriophages) (Lundholm and Rylander, 1983; Uhrbrand
et al., 2011; Paez-Espino et al., 2016. However, the fact that the
majority of sequences that we were able to identify were not
viral in origin was not surprising. While some viral
metagenomic libraries are constructed with enriched or purified
viral nucleic acids, in this study, we chose to sequence
unpurified and unenriched samples directly in order to avoid
removing viruses adsorbed to large agglomerates of particles in
the air (data not shown). The most likely reason for the low
number of RNA viral sequences detected in ourstudy is that we
did not achieve an adequate depth of sequencing to fully
characterize this relatively minor component of the total
sequences in our samples and why the viruses targeted by
qPCR were not present in our metagenomic results.
Rotaviruses and HAV were detected by qPCR from samples
collected only with the Coriolis and the Marple devices. This
suggests that low flowrate samplers may result in a better
recovery of RNA viruses in these conditions. High flowrate
samplers are preferable when sampling rare events as they
can generate more concentrated samples than moderate to
low flowrate devices. Nonetheless, the greater rate of airflow
and the extended sampling period of these devices can
damage the particles and organisms collected by the sampler
(Toulouse et al., 2014). Some RNA viruses are particularly
prone to degradation because of the fragility of their envelope
and the instability of RNA due to the ubiquity of RNAses in the
environment (Li, 2013).
Table 4 Detection and quantification of rotaviruses with the Marple sampler.
WTC 1 WTC 2 WTC 3 WTC 4
Cut-Off (μm) Stages Site 2 Site 3 Site 2 Site 3 Site 1 Site 2 Site 2 Site 3
21.3 1 6.1 × 10
5
6.6 × 10
5
2.7 × 10
6
–––
14.8 2 2.4 × 10
5
1.3 × 10
5
8.0 × 10
5
6.6 × 10
4
––
9.8 3 1.2 × 10
4
4.5 × 10
4
7.3 × × 10
5
1.5 × 10
7
1.5 × 10
5
8.3× 10
5
6 4 3.7 × 10
5
7.4 × 10
5
4.6 × 10
5
–––
3.5 5 1.1 × 106 1.5 × 10
5
5.0 × 10
5
1.5 × 10
6
3.0 × 10
5
5.3 × 10
4
1.55 6 ––3.1 × 10
5
3.7 × 10
5
8.0 × 10
6
––
0.93 7 ––5.5 × 10
5
8.1 × 10
6
3.4 × 10
5
5.5 × 10
4
0.52 8 3.1 × 10
4
2.6 × 10
5
3.3 × 10
4
2.0 × 10
5
7.4× 10
5
0F––4.2 × 10
4
1.0 × 10
6
5.6× 10
5
1.0 × 10
5
Table 5 Sequencing and assembly output details.
Sites Number
of reads
Number
of contigs
Total size
of assembly
Average
contig length
N50 of
assembly
Median
contig length
Largest
contig
Site 1 18741055 45130 101595404 2251 8800 772 1635750
Site 2 764755 602 536721 891 811 588 15090
Site 3 604133 268 240403 897 849 622 8222
5JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
The most abundant family of RNA viruses based on our
metagenomic data was Retroviridae, a family that includes the
Human Immunodeficiency Virus. However, a particularity of
these viruses is that they possess a proviral stage in their
replication cycle where they insert their genetic material in
the form of DNA into the chromosome of their host. Given the
likely presence of contaminating DNA in our metagenomes,
we do not know if the sequences identified in our samples are
from the DNA provirus, retroviral messenger RNA or the
encapsidated retrovirus RNA genome. Five contigs were
92.88%
5.32%
1.49%
0.16%
0.11%
0.04%
a Domains distribution
Bacteria
Eukaroyta
Unassigned
Viruses
Archaea
Unclassified
29.5%
26.2%
19.9%
16.4%
4.5%
3.5%
b Virus families
Baculoviridae
Siphoviridae
Podoviridae
Myoviridae
Unclassified
Other
Phages
67.15%
1.19%
30.03%
0.06%
0.47%
0.28%
0.18%
0.63%
0.01%
c Hosts of viruses
Bacteria
Humans
Insects
Fishes
Mammals
Amoeba
Plants
Algae
Birds
Fig. 1 Air samples from WTC 4 (a) classification of assigned sequences at a domain taxonomic level, (b) classification of
virus-assigned sequences by Family, (c) hosts of viruses based on the panel b assignments.
8.9%
8.9%
7.1%
3.6%
71.4%
a Site 1
HSV1
HSV5
HAdV
HIV
Human endogenous
retrovirus
3.4%
3.4%
53.9%
14.6%
24.7%
b Site 2
HSV1
HSV5
Human papillomavirus
Chlamydiamicrovirus
Human endogenous
retrovirus
12.1%
12.1%
36.4%
6.1%
33.3%
c Site 3
HSV1
HSV5
Chlamydiamicrovirus
Variola virus
Human endogenous
retrovirus
Fig. 2 Distribution of human viruses in samples from sampling locations 1 (a), 2 (b), and 3 (c) from WTC 4.
6JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
homologous to Caulimoviridae, a family of single-stranded
RNA viruses that infects plants and insects. This is a plausible
result considering that the WTC inflow is a combination of
domestic, industrial and agricultural surface runoff and storm
water that includes many potential insect and plant viral
hosts. We must also underline the fact that the classification
of these data is based on the homology of our sequences to a
database and thus the presence of a particular virus must be
confirmed independently, something that was beyond the
scope of this study.
Fig. 3 Heat map comparing metagenomic results from sites 1, 2 and 3 of WTC 4 with samples from wastewater and source
water in North America (public databases). The red scale represents low abundance cases, as the green one represents high
abundance cases.
7JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
Herpes virus was the most abundant human DNA virus
pathogen identified by metagenomics in this study. Its detec-
tion is not surprising considering how widespread it is in the
human population. In fact, 65% of the population of the United
States possesses antibodies to HSV1 (Xu et al., 2002). Interest-
ingly, HSV1 was identified in our metagenomic data for site 4,
and was not detected by qPCR. The presence of sequence
homology to Variola virus, a pathogen responsible for smallpox,
was unexpected, but is presumably due to the presence of the
Vaccinia virus, the active agent in thesmallpox vaccine that has
a genome with high sequence similarity to the genome of
Variola virus. The Vaccinia virus, the active agent in the
smallpox vaccine, is in circulation in bovine populations. We
must again state that the presence of these viruses must be
identified independently (Assis et al., 2013).
Sequences with homology to adenoviruses were also
abundant in the WTC aerosol metagenome. In corroboration
with our results, human adenoviruses have also been found
in recent studies based on the viral metagenomic character-
ization of wastewaters (Bibby and Peccia, 2013). Among the
dsDNA phages identified herein, Chlamydiamicrovirus and its
host, Chlamydia, a taxon of bacteria that are obligate parasites
of eukaryotic cells and that are known to cause pneumoniae,
eye trachoma, sexually transmissible infections and psittaco-
sis, were detected as well.
In the future, a more complete and broader risk assess-
ment study could be performed in WTCs using symptoms,
epidemiological data that could be linked and metagenomic
analyses of viruses in aerosols and surfaces to better
understand the impacts of the presence of viral particles on
health problems.
4. Heatmap
As this was the first time that viral metagenomics had been
applied to air samples from WTCs, we supposed that viruses,
and also all organisms found in the air, would originate from
treated water. Although we hypothesized that the wastewater
and aerosol datasets would be most similar, this comparison
was ultimately inconclusive. Nevertheless, our results suggest
that WTC-related microbial communities are demonstrably
distinct from their most likely sources (i.e., wastewater and
source water).
Conflict of interests
The authors have no conflict of interests to declare.
Acknowledgements
This study was funded by the Fondation IUCPQ-J.-D. Bégin-P.-H.
Lavoie (2014) and Institut de recherche Robert-Sauvéen santé et
sécurité du travail (IRSST) (grant number 2010-050). EB received
a graduate program scholarship from IRSST. CDwas a Fonds de
recherche du Québec-Santé (FRQ-S) senior scholar. We would
like to thank WTCs workers and managers for their participa-
tion to the study.
Appendix A. Supplementary data
Supplementary data to this article can be found online at
http://dx.doi.org/10.1016/j.jes.2017.07.015.
REFERENCES
Abad, F.X., Pinto, R.M., Bosch, A., 1994. Survival of enteric viruses
on environmental fomites. Appl. Environ. Microbiol. 60 (10),
37043710.
Aitken, C.D., Jeffries, J., 2001. Nosocomial spread of viral disease.
Clin. Microbiol. Rev. 14 (3), 528546.
Assis, F.L., Borges, I.A., Mesquita, V.S., Ferreira, P.C., Trindade, G.S.,
et al., 2013. Vaccinia virus in household environment during
bovine vaccinia outbreak. Brazil. Emerg. Infect. Dis. 19 (12),
2045.
Baggi, F., Demarta, A., Peduzzi, R., 2001. Persistence of viral
pathogens and bacteriophages during sewage treatment: lack of
correlation with indicator bacteria. Res. Microbiol. 152 (8),
743751.
Be, N.A., Thissen, J.B., Fofanov, V.Y., Allen, J.E., Rojas, M., Golovko,
G., et al., 2015. Metagenomic analysis of the airborne environ-
ment in urban spaces. Microb. Ecol. 69 (2), 346355.
Bibby, K., Peccia, J., 2013. Identification of viral pathogen diversity
in sewage sludge by metagenome analysis. Environ. Sci.
Technol. 47 (4), 19451951.
Boisvert, S., Raymond, F., Godzaridis, E., Laviolette, F., Corbeil, J.,
2012. Ray meta: scalable de novo metagenome assembly and
profiling. Genome Biol. 13 (12), R122.
Bonifait, L., Charlebois, R., Vimont, A., Turgeon, N., Veillette, M.,
Longtin, Y., et al., 2015. Detection and quantification of
airborne norovirus during outbreaks in healthcare facilities.
Clin. Infect. Dis. 61 (3), 299304.
Boone, S.A., Gerba, C.P., 2007. Significance of fomites in the spread
of respiratory and enteric viral disease. Appl. Environ.
Microbiol. 73 (6), 16871696.
Butz, A.M., Fosarelli, Dick, P.J., Cusack, T., Yolken, R., 1993.
Prevalence of rotavirus on high-risk fomites in day-care
facilities. Pediatrics 92 (2), 202205.
Cao, G., Noti, J.D., Blachere, F.M., Lindsley, W.G., Beezhold, D.H.,
2011. Development of an improved methodology to detect
infectious airborne influenza virus using the NIOSH bioaerosol
sampler. J. Environ. Monit. 13 (12), 33213328.
Corey, L., Huang, M.L., Selke, S., Wald, A., 2005. Differentiation of
herpes simplex virus types 1 and 2 in clinical samples by a
real-time taqman PCR assay. J. Med. Virol. 76 (3), 350355.
Dennehy, P.H.N., Crowley, S.M., Saracen, B.A., Cheryl, L., 1998.
Detection of Rotavirus Rna in Hospital air Samples by
Polymerase Chain Reaction (PCR). The American Pediatric
Society and The Society for Pediatric Research, New Orleans.
Donaldson, K.A., Griffin, D.W., Paul, J.H., 2002. Detection,
quantitation and identification of enteroviruses from surface
waters and sponge tissue from the Florida Keys using
real-time RT-PCR. Water Res. 36 (10), 25052514.
Hall, R.J., Leblanc-Maridor, Wang, M.J., Ren, X., Moore, N.E., Brooks,
C.R., et al., 2013. Metagenomic detection of viruses in aerosol
samples from workers in animal slaughterhouses. PLoS One 8
(8), e72226.
Hamada, N., Gotoh, K., Hara, K., Iwahashi, J., Imamura, Y.,
Nakamura, S., et al., 2008. Nosocomial outbreak of epidemic
keratoconjunctivitis
accompanying environmental contamination with
adenoviruses. J. Hosp. Infect. 68 (3), 262268.
Hayden, F.G., Herrington, D.T., Coats, T.L., Kim, K., Cooper, E.C., et al.,
2003. Efficacy and safety of oral pleconaril for treatment of colds
8JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
due to picornaviruses in adults: results of 2 double-blind,
randomized, placebo-controlled trials. Clin. Infect. Dis. 36 (12),
15231532.
Heim, A., Ebnet, C., Harste, G., Pring-Akerblom, P., 2003. Rapid and
quantitative detection of human adenovirus DNA by real-time
PCR. J. Med. Virol. 70 (2), 228239.
Hota, B., 2004. Contamination, disinfection, and cross-colonization:
are hospital surfaces reservoirs for nosocomial infection? Clin.
Infect. Dis. 39 (8), 11821189.
Kageyama, T., Kojima, S., Shinohara, M., Uchida, K., Fukushi, S.,
Hoshino, F.B., et al., 2003. Broadly reactive and highly sensitive
assay for Norwalk-like viruses based on real-time quantitative
reverse transcription-PCR. J. Clin. Microbiol. 41 (4), 15481557.
Khuder, S.A., Arthur, T., Bisesi, M.S., Schaub, E.A., 1998. Prevalence
of infectious diseases and associated symptoms in wastewater
treatment workers. Am. J. Ind. Med. 33 (6), 571577.
La Rosa, G., Pourshaban, M., Iaconelli, M., Muscillo, M., 2010.
Quantitative real-time PCR of enteric viruses in influent and
effluent samples from wastewater treatment plants in Italy.
Ann. Ist. Super. Sanita 46 (3), 266273.
Li, R., 2013. Forensic Biology. CRC Press, Boca Raton, FL.
Lundholm, M., Rylander, R., 1983. Work related symptoms among
sewage workers. Br. J. Ind. Med. 40 (3), 325329.
Masclaux, F.G., Hotz, P., Gashi, D., Savova-Bianchi, D., Oppliger, A.,
2014. Assessment of airborne virus contamination in
wastewater treatment plants. Environ. Res. 133, 260265.
Meijer, A., van der Sanden, S., Snijder s, B.E., Jaramillo-Gutierrez,
G., Bont, L., van der Ent, C.K., et al., 2012. Emergence and
epidemic occurrence of enterovirus 68 respiratory infections in
The Netherlands in 2010. Virology 423 (1), 4957.
Meyer, F., Paarmann, D., D'Souza, M., Olson, R., Glass, E.M., Kubal,
M., Paczian, T., Rodriguez, A., Stevens, R., Wilke, A., Wilkening,
J., Edwards, R.A., 2008. The metagenomics RAST server a
public resource for the automatic phylogenetic and functional
analysis of metagenomes. BMC Bioinforma. 9, 386.
Osuolale, O., Okoh, A., 2015. Incidence of human adenoviruses
and Hepatitis A virus in the final effluent of selected
wastewater treatment plants in Eastern Cape Province,
South Africa. Virol. J. 12, 98.
Paez-Espino, D., Eloe-Fadrosh, E.A., Pavlopoulos, G.A., Thomas,
A.D., Huntemann, M., Mikhailova, N., Rubin, E., Ivanova, N.N.,
Kyrpides, N.C., 2016. Uncovering Earth's virome. Nature 536
(7617), 425430.
Payne, D.C., Wikswo, M., Parashar, U.D., 2011. Chapter 13:
Rotavirus. VPD Surveillance Manual, 5th ed. C. f. D. C. a.
Prevention, Atlanta, p. 13-11.
Pouillot, R., Van Doren, J.M., Woods, J., Plante, D., Smith, M., Goblick,
G., et al., 2015. Meta-analysis of the reduction of norovirus and
male-specific Coliphage concentrations in wastewater treat-
ment plants. Appl. Environ. Microbiol. 81 (14), 46694681.
Qiu, F., Cao, J., Su, Q., Yi, Y., Bi, S., 2014. Multiplex hydrolysis probe
real-time PCR for simultaneous detection of hepatitis A virus
and hepatitis E virus. Int. J. Mol. Sci. 15 (6), 97809788.
Qiu, Y., Lee, B.E., Neumann, N., Ashbolt,N., Craik, S., Maal-Bared, R.,
Pang, X.L., 2015. Assessment of human virus removal during
municipal wastewater treatment in Edmonton, Canada. J. Appl.
Microbiol. 119 (6), 17291739.
Romano, M., Montesi, F., Rausa, G., 1999. Treatment plants:
viruses in aerosols. G. Ital. Med. Lav. Ergon. 21 (1), 912.
Roux, S., Faubladier, M., Mahul, A., Paulhe, N., Bernard, A.,
Debroas, D., Enault, F., 2011. Metavir: a web server dedicated to
virome analysis. Bioinformatics 27 (21), 30743075.
Rylander, R., Andersson, K., Belin, L., Berglund, G., Bergstrom, R.,
Hanson, L.A., Lundholm, Mattsby, M.I., 1976. Sewage worker's
syndrome. Lancet 2 (7983), 478479.
Selvaraju, S.B., Selvarangan, R., 2010. Evaluation of three influenza
A and B real-time reverse transcription-PCR assays and a new
2009 H1N1 assay for detection of influenza viruses. J. Clin.
Microbiol. 48 (11), 38703875.
Smit, L.A., Spaan, M.S., Heederik, D., 2005. Endotoxin exposure
and symptoms in wastewater treatment workers. Am. J. Ind.
Med. 48 (1), 3039.
Sundkvist, T., Hamilton, G.R., Hourihan, B.M., Hart, I.J., 2000.
Outbreak of hepatitis A spread by contaminated drinking
glasses in a public house. Commun. Dis. Public Health 3 (1),
6062.
Toulouse, M.J., Turgeon, N., Veillette, M., Duchaine, C., 2014.
Fluorimetric neuraminidase assay to monitor airborne
respiratory viruses. AIRMON 2014The 8th International
Symposium on Modern Principles for Air Monitoring and
Biomonitoring, Marseille, France.
Tseng, C.C., Chang, L.Y., Li, C.S., 2010. Detection of airborne
viruses in a pediatrics department measured using real-time
qPCR coupled to an air-sampling filter method. J. Environ.
Health 73 (4), 2228.
Uhrbrand, K., Schultz, A.C., Madsen, A.M., 2011. Exposure to
airborne noroviruses and other bioaerosol components at a
wastewater treatment plant in Denmark. Food Environ. Virol. 3
(34), 130137.
Van Hooste, W., Charlier, A.M., Rotsaert, P., Bulterys, S., Moens, G.,
van Sprundel, M., et al., 2010. Work-related helicobacter pylori
infection among sewage workers in
municipal wastewater treatment plants in Belgium. Occup.
Environ. Med. 67 (2), 9197.
Whon, T.W., Kim, M.S., Roh, S.W., Shin, N.R., Lee, H.W., Bae, J.W.,
2012. Metagenomic characterization of airborne viral DNA
diversity in the near-surface atmosphere. J. Virol. 86 (15),
82218231.
Xu, F., Schillinger, J.A., Sternberg, M.R., Johnson, R.E., Lee, F.K.,
Nahmias, A.J., et al., 2002. Seroprevalence and coinfection with
herpes simplex virus type 1 and type 2 in the United States,
19881994. J Infect Dis 185 (8), 10191024.
Zeng, S.Q., Halkosalo, A., Salminen, M., Szakal, E.D., Puustinen, L.,
Vesikari, T., 2008. One-step quantitative RT-PCR for the
detection of rotavirus in acute gastroenteritis. J. Virol. Methods
153 (2), 238240.
9JOURNAL OF ENVIRONMENTAL SCIENCES XX (2017) XXXXXX
Please cite this article as: Brisebois, E., et al., Human viral pathogens are pervasive in wastewater treatment center aerosols, J.
Environ. Sci. (2017), http://dx.doi.org/10.1016/j.jes.2017.07.015
... 1 Individual testing has shown to be expensive, invasive, and symptom based. 2 Wastewater-based epidemiology (WBE) has been used for many years to monitor community health and has gained popularity following the severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) pandemic. [3][4][5][6][7] Wastewater-based epidemiology is a methodology that collects and analyzes wastewater for various biological and chemical indicators of population health. 8 It is a noninvasive, accurate, anonymous way to assess the overall health within a specific community served by a single watershed. ...
... Wastewater-based epidemiology has been successful in the detection of other infectious diseases and biological markers such as polio, stress hormones, norovirus, and orthopox/monkeypox of which USAFA is currently working on developing protocols and performing surveillance. 5,14 It has the potential to detect even more and be used as a helpful tool that can help catch outbreaks before they spread too large. Specifically in a military setting, WBE can be used by commanders to assess the overall health of the community and make calls based on those numbers. ...
Article
Introduction: The presence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) in wastewater has been proposed as a sentinel surveillance epidemiological tool for detection of infectious disease at a community level and as a complementary approach to syndromic surveillance of infectious disease outbreaks. We have designed a study to test the presence and quantity of SARS-CoV2, the virus responsible for COVID19, in the wastewater treatment facility (WWTF) of the U.S. Air Force Academy. Materials and methods: Wastewater samples were tested in the laboratory to quantify the amount of SARS-CoV2 RNA using reverse transcription-quantitative polymerase chain reaction. Raw SARS-CoV2 viral titer in wastewater was normalized to the viral titer of a fecal marker, pepper mild mottle virus, to correct for dilutions. Temporal and spatial trends of COVID19 were analyzed. Furthermore, we compared wastewater analysis results against clinical data to assist public health decisions. Results: Preliminary data suggest that wastewater analysis can provide temporal and spatial trends of COVID19. The geographically discrete WWTF at the U.S. Air Force suggests that wastewater testing is a useful approach to developing a comprehensive sentinel surveillance system. Conclusions: Together with ongoing syndromic surveillance data, this proof-of-concept study seeks to determine whether early detection of SARS-CoV2 in a closed system WWTF correlates to changes in community and clinically reported COVID19. The well-documented population served by the geographically discrete WWTF at the U.S. Air Force Academy may serve to better elucidate the adjunctive role of wastewater testing in a comprehensive surveillance system. These results may be of particular interest to the DoD and local commanders given the WWTFs under their immediate control and the information that these studies may provide in support of operational readiness through early detection of disease outbreaks.
... These new methods, specifically that utilize DNA/RNA based approaches along with Next Generation Sequencing (NGS) technologies showed great capability in improving the understanding of identities, distribution, abundance, diversity and function of airborne microbial communities in WWTPs. (Liang et al., 2012;Brisebois et al., 2018;Han et al., 2019;Corpuz et al., 2020;Kabir et al., 2020;Han et al., 2020b;Bhardwaj et al., 2021;Kathiriya et al., 2021;Mbareche et al., 2022). To conclude, the existing evidence base on bioaerosol emission from WWTPs stems from a range of sampling and post-collection analysis methods ranging from culture-based methods to immunoassay and advanced molecular methods. ...
... 2011). Additionally, viruses were also investigated as the pathogenic viral particles in WWTP air that can partly explain the work-related symptoms (Masclaux et al., 2014;Brisebois et al., 2018;Corpuz et al., 2020). Additionally, mesophilic heterotrophic bacteria (total coliforms, fecal coliforms, and enterococci), Escherichia coli (or E.coli) and staphylococci were monitored in the surrounding air at different stages of wastewater treatment since they are the indicators of fecal pollutants in the wastewater (Michalkiewicz, 2019). ...
Article
Full-text available
Rapid population growth and urbanization process have led to increasing demand for wastewater treatment capacity resulting in a non-negligible increase of wastewater treatment plants (WWTPs) in several cities around the world. Bioaerosol emissions from WWTPs may pose adverse health risks to the sewage workers and nearby residents, which raises increasing public health concerns. However, there are still significant knowledge gaps on the interplay between process-based bioaerosol characteristics and exposures and the quantification of health risk which limit our ability to design effective risk assessment and management strategies. This review provides a critical overview of the existing knowledge of bioaerosol emissions from WWTPs including their nature, magnitude and size distribution, and highlights the shortcoming associated with existing sampling and analysis methods. The recent advancements made for rapid detection of bioaerosols are then discussed, especially the emerging real time detection methods to highlight the directions for future research needs to advance the knowledge on bioaerosol emissions from WWTPs.
... Wastewater treatment plants (WWTPs) are confirmed sources of bioaerosols containing microorganisms present in water and sediments, including bacteria, viruses, and protozoa [1][2][3]. They can also be a hotspot for the spread of antibiotic-resistant bacteria (ARB) and antibiotic-resistant genes (ARGs) [4][5][6]. ...
Article
Full-text available
Wastewater treatment plants (WWTPs) are confirmed sources of bioaerosols and can be a hotspot for both antibiotic-resistant bacteria and antibiotic-resistant genes (ARGs). Bioaerosols can be a source of dispersion for bacteria and ARGs into the environment. Biofiltration is one of the most effective technologies to mitigate odors from WWTPs. The objective of this study was to evaluate the capacity of an odor biofiltration system designed to remove volatile compounds, to influence the airborne bacterial diversity and to reduce the aerosolized microbial and ARG concentrations. In total, 28 air samples were collected before and after treatment of an interior WWTP. Overall, air samples collected upstream had higher total bacterial concentrations, and a shift in bacterial diversity was observed. Legionella and Mycobacterium were detected in low abundance upstream and downstream, whereas Legionella pneumophila was detected but not quantifiable in two samples. Of the 31 ARGs and mobile genetic elements detected by quantitative polymerase chain reaction, 15 exhibited a significant reduction in their relative abundance after biofiltration, and none were significantly higher in the effluent. Overall, these results show the benefits of odor biofiltration systems to reduce bacterial and antimicrobial resistance in treated air, a promising application to limit environmental dispersion.
Chapter
Given the global attention focused on indoor bioaerosols since the beginning of the COVID-19 pandemic, investigating the best ways to assess human exposure to airborne viruses, bacteria, and fungi is crucial. Humans, pets, plants, plumbing systems, HVAC systems, mold, dust resuspension, and the outdoor environment are among numerous sources of bioaerosols within indoor air. Diverse microbial communities populate human-occupied buildings. When looking for infectious agents or characterizing airborne microbial agents, several options are available, each of which forms the global picture of the bioaerosol complex nature. Following characterization of bioaerosols content using multiple approaches, including DNA sequencing, PCR, or culture, it remains a challenge to understand the role of each of the various components of bioaerosols and synergistic effects of multiple exposures in the development of diseases. Bioaerosol exposure can have varying effects on exposed individuals, and individual components of the complex mixture may have different effects, which are almost impossible to elucidate. This presentation will overview the main steps in bioaerosol investigation study and shed light on the limitations and strengths of various exposure assessment and experimental approaches and how collaborative research is necessary to elucidate disease transmission and data interpretation.KeywordsBioaerosolsIndoor airBacteriaVirusesCOVID-19
Preprint
Full-text available
Innovative methods for evaluating viral risk and spread, independent of test-seeking behavior, are needed to improve routine public health surveillance, outbreak response, and pandemic preparedness. Throughout the COVID-19 pandemic, environmental surveillance strategies, including wastewater and air sampling, have been utilized alongside widespread individual-based SARS-CoV-2 testing programs to provide population-wide data. To date, environmental surveillance strategies have mainly relied on pathogen-specific detection methods to monitor viruses through space and time. However, this provides a limited picture of the virome present in a sample, leaving us blind to most circulating viruses. In this study, we explore whether virus-agnostic deep sequencing can improve the utility of air sampling to detect human viruses captured in air samples. We show that sequence-independent single-primer amplification sequencing of nucleic acids from air samples can detect common and unexpected human respiratory and enteric viruses, including influenza virus type A and C, respiratory syncytial virus, human coronaviruses, rhinovirus, SARS-CoV-2, rotavirus, mamastrovirus, and astrovirus.
Chapter
COVID-19 pandemic, considered a disease in the respiratory system, has taken the lives of 4.4 million, around 211 million being infected globally, transmitting the deadly COVID-19 virus through the air from a symptomatic infected person to the other. However, the magnitude of asymptomatic COVID-19 is on the rise and is potentially responsible for spreading the COVID-19 virus among different communities. Excretion of SARS-CoV-2 from the human body, whether mainly in the format of faeces and urine, but either as saliva, sputum, or even body washings, can get into wastewaters, sewage, or sludge whether the person infected is symptomatic or not. Furthermore, dumping used personal protective equipment including face masks, is another way of spreading COVID-19 which attention needs to be paid. This chapter begins with a description of the SARS-CoV-2 structure and its variants. Next, we will be discussing how COVID-19 virus will be getting into wastewater and sludge and then the mechanism of survival and transmission of this deadly virus in wastewater and sludge. This knowledge will help researchers develop formulas to uncover epidemics in advance and thereby prevent community spreading. The utility of wastewater-based epidemiology (WBE) to monitor, manage, and control the COVID-19 infection cannot be underestimated.KeywordsCOVID-19SARS-CoV-2WastewaterWastewater-based epidemiology (WBE)
Article
Full-text available
Roughly half of the human population lives near the coast, and coastal water pollution (CWP) is widespread. Coastal waters along Tijuana, Mexico, and Imperial Beach (IB), USA, are frequently polluted by millions of gallons of untreated sewage and stormwater runoff. Entering coastal waters causes over 100 million global annual illnesses, but CWP has the potential to reach many more people on land via transfer in sea spray aerosol (SSA). Using 16S rRNA gene amplicon sequencing, we found sewage-associated bacteria in the polluted Tijuana River flowing into coastal waters and returning to land in marine aerosol. Tentative chemical identification from non-targeted tandem mass spectrometry identified anthropogenic compounds as chemical indicators of aerosolized CWP, but they were ubiquitous and present at highest concentrations in continental aerosol. Bacteria were better tracers of airborne CWP, and 40 tracer bacteria comprised up to 76% of the bacteria community in IB air. These findings confirm that CWP transfers in SSA and exposes many people along the coast. Climate change may exacerbate CWP with more extreme storms, and our findings call for minimizing CWP and investigating the health effects of airborne exposure.
Article
Full-text available
Viruses are the most abundant biological entities on Earth, but challenges in detecting, isolating, and classifying unknown viruses have prevented exhaustive surveys of the global virome. Here we analysed over 5 Tb of metagenomic sequence data from 3,042 geographically diverse samples to assess the global distribution, phylogenetic diversity, and host specificity of viruses. We discovered over 125,000 partial DNA viral genomes, including the largest phage yet identified, and increased the number of known viral genes by 16-fold. Half of the predicted partial viral genomes were clustered into genetically distinct groups, most of which included genes unrelated to those in known viruses. Using CRISPR spacers and transfer RNA matches to link viral groups to microbial host(s), we doubled the number of microbial phyla known to be infected by viruses, and identified viruses that can infect organisms from different phyla. Analysis of viral distribution across diverse ecosystems revealed strong habitat-type specificity for the vast majority of viruses, but also identified some cosmopolitan groups. Our results highlight an extensive global viral diversity and provide detailed insight into viral habitat distribution and host-virus interactions.
Article
Full-text available
Aims: To assess the removal of viruses through the multiple steps of wastewater treatment in a full-scale municipal wastewater treatment plant in Alberta, Canada. Methods and results: Samples were collected after each of the five treatment steps for a period of 16 months. The amount of viruses and their infectivity were analysed using real-time quantitative PCR (qPCR) and integrated viral cell culture (ICC), respectively. Bacterial indicator E. coli was also tested using membrane filtration. Seven viruses including Norovirus (NoV), Rotavirus (RV), Sapovirus (SaV), Astrovirus (AsV), Adenovirus (AdV), Enterovirus (EV) and JC virus (JCV) were detected in 16 primary effluents in which infectious viruses were present. Different treatment steps showed various efficiencies in virus removal, with membrane ultrafiltration as the most effective at 4.6 to 7.0 log reduction. Conclusions: We observed high prevalence of viruses in raw wastewater and different viral reduction after various treatment steps. The discharge of treated wastewater with infectious viruses represents potential risks to human, animal and environmental health. Significance and impact of the study: This study provides a comprehensive assessment of the removal of NoV, RV, SaV, AsV, AdV, EV, JCV and Reovirus from wastewater by current procedures of municipal wastewater treatment and discusses the applicability of various viruses as viral indicators for water quality. This article is protected by copyright. All rights reserved.
Article
Full-text available
Municipal effluent constitutes a large reservoir of human enteric viruses and bacteria. Contemporary monitoring practices rely on indicator bacteria, and do not test for viruses. Different viruses, including Norwalk-like viruses, Hepatitis A virus (HAV), adenoviruses, and rotaviruses, are important agents of illnesses in humans. The burden of disease caused by adenoviruses manifests as pneumonia, bronchiolitis, otitis media, conjunctivitis, and tonsillitis, whereas HAV infection can manifest as acute inflammatory diseases of the liver, fever, anorexia, malaise, nausea, and abdominal discomfort, followed by jaundice and dark urine. The public health implications of these viruses depend upon the physiological status of the wastewater microbial community. The occurrence of human adenovirus (HAdV) and HAV was determined in the final effluents of five wastewater treatment plants (WWTPs) in the Eastern Cape, South Africa, over 12 months (September 2012-August 2013). The viruses were detected with real-time PCR, and conventional PCR was used for serotyping. Adenovirus was detected in effluent samples from all five WWTPs and in 64 % of the total samples, whereas HAV was not detected in any effluent sample. At WWPT-A, samples were collected from the final effluent tank (adenoviral concentrations ranged from 1.05 × 10(1) to 1.10 × 10(4) genome/L, with a 41.7 % detection rate) and the discharge point (adenoviral concentrations ranged between 1.2 × 10(1) and 2.8 × 10(4) genome/L, with a 54.5 % detection rate). At WWPT-B, HAdV was detected in 91.7 % of samples, with viral concentrations of 7.92 × 10(1)-2.37 × 10(5) genome/L. The HAdV concentrations at WWPT-C were 5.32 × 10(1)-2.20 × 10(5) genome/L, and the detection rate was 75 %. The adenoviral concentrations at WWPT-D were 1.23 × 10(3)-1.05 × 10(4) genome/L, and the detection rate was 66.7 %. At WWPT-E, the viral concentrations were 1.08 × 10(1)-5.16 × 10(4) genome/L, and the detection rate was 54.5 %. Characterization of the adenoviruses revealed HAdV serotypes 2 (1.4 %) and 41 (7.1 %), in species C and F, respectively. This study is the first to report the prevalence of HAdV in the final effluents of WWTPs in the Eastern Cape, South Africa. The adenoviral detection rates indicate the potential contamination of the environment, with adverse effects on public health.
Article
Full-text available
Human norovirus (NoV) is the leading cause of foodborne illness in the United States and Canada. Wastewater treatment plant (WWTP) effluents impacting bivalve mollusk growing areas are potential sources of NoV contamination. We have developed a meta-analysis that evaluates WWTP influent concentrations and log10 reductions of NoV genotype I [NoV GI, in genome copies per l (gc/l)], NoV genotype II [NoV GII, in gc/l], and male-specific coliphage [MSC, in plaque-forming units per l (pfu/l)], a proposed viral surrogate for NoV. The meta-analysis includes relevant data (2943 measurements) reported in the scientific literature through September 2013 and previously unpublished surveillance data from the United States and Canada. Model results indicate the mean WWTP influent concentration of NoV GII [3.9 log10 gc/l; 95% Credible Interval (95%CI) 3.5-4.3] is larger than the value for NoV GI (1.5 log10 gc/l; 95%CI 0.4-2.4), with large variations from one WWTP to another. For mechanical WWTPs with chlorine disinfection, mean log10 reductions are -2.4 log10 (95%CI: -3.9; -1.1) for NoV GI, -2.7 log10 (95%CI: -3.6; -1.9) for NoV GII, and -2.9 log10 (95%CI: -3.4; -2.4) for MSC. Comparable values for lagoon WWTP with chlorine disinfection are -1.4 log10 (95%CI: -3.3; 0.5) for NoV GI, -1.7 log10 (95%CI: -3.1; -0.3) for NoV GII, and -3.6 log10 (95%CI: -4.8; -2.4) for MSC. Within WWTPs, correlations exist between mean NoV GI and NoV GII influent concentrations and between mean log10 reduction in NoV GII and mean log10 reduction in MSC. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Article
Full-text available
Background: Noroviruses are responsible for at least 50% of all gastroenteritis outbreaks worldwide. Noroviruses GII can infect humans via multiple routes including direct contact with an infected person, fecal matter, or vomitus, and contact with contaminated surfaces. Although norovirus is an intestinal pathogen, aerosols could, if inhaled, settle in the pharynx and later be swallowed. The aims of this study were to investigate the presence of norovirus GII bioaerosols during gastroenteritis outbreaks in healthcare facilities and to study the in vitro effects of aerosolization and air sampling on the noroviruses using murine norovirus as a surrogate. Methods: A total of 48 air samples were collected during norovirus outbreaks in 8 healthcare facilities. Samples were taken 1 m away from each patient, in front of the patient's room and at the nurses' station. The resistance to aerosolization stress of murine norovirus type 1 (MNV-1) bioaerosols was also tested in vitro using an aerosol chamber. Results: Norovirus genomes were detected in 6 of 8 healthcare centers. The concentrations ranged from 1.35 × 10(1) to 2.35 × 10(3) genomes/m(3) in 47% of air samples. MNV-1 preserved its infectivity and integrity during in vitro aerosol studies. Conclusions: Norovirus genomes are frequently detected in the air of healthcare facilities during outbreaks, even outside patients' rooms. In addition, in vitro models suggest that this virus may withstand aerosolization.
Article
Full-text available
The organisms in aerosol microenvironments, especially densely populated urban areas, are relevant to maintenance of public health and detection of potential epidemic or biothreat agents. To examine aerosolized microorganisms in this environment, we performed sequencing on the material from an urban aerosol surveillance program. Whole metagenome sequencing was applied to DNA extracted from air filters obtained during periods from each of the four seasons. The composition of bacteria, plants, fungi, invertebrates, and viruses demonstrated distinct temporal shifts. Bacillus thuringiensis serovar kurstaki was detected in samples known to be exposed to aerosolized spores, illustrating the potential utility of this approach for identification of intentionally introduced microbial agents. Together, these data demonstrate the temporally dependent metagenomic complexity of urban aerosols and the potential of genomic analytical techniques for biosurveillance and monitoring of threats to public health. Electronic supplementary material The online version of this article (doi:10.1007/s00248-014-0517-z) contains supplementary material, which is available to authorized users.
Article
Full-text available
Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.
Article
The prevalence of enteric viruses in wastewater, the efficacy of wastewater treatments in eliminating such viruses, and potential health risks from their release into the environment or by recycling of treated wastewaters, are very important issues in environmental microbiology. In this study we performed a quantitative TaqMan real-time PCR (polymerase chain reaction) analysis of enteric viruses on samples of influents and effluents from 5 wastewater treatment plants in and around Rome. Three epidemiologically important, waterborne enteric viruses were analyzed: adenoviruses, enteroviruses and noroviruses (GI and GII) and compared to classical bacterial indicators of fecal contamination. The concentration of adenoviruses was the highest, in both raw and treated waters. Mean values in influents were ranked as follows: adenovirus > norovirus GI > norovirus GII > enterovirus. In effluents, the ranking was: adenovirus > norovirus GI > enterovirus > norovirus GII. Removal efficiencies ranged from 35% (enterovirus) to 78% (norovirus GI), while removal efficiency for bacterial indicators was up to 99%. Since molecular quantification does not necessarily indicate an actual threat to human health, we proceeded to evaluate the infectivity of enterovirus particles in treated effluents through integrated cell culture and real-time PCR. Infectivity assays detected live virions in treated water, pointing to potential public health risks through the release of these viruses into the environment. A better understanding of viral presence and resistance to sewage purification processes have the potential of contributing to the effective management of risks linked to the recycling of treated wastewater, and its discharge into the environment.