Content uploaded by Jennifer A. Dever
Author content
All content in this area was uploaded by Jennifer A. Dever on Mar 19, 2018
Content may be subject to copyright.
BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research
libraries, and research funders in the common goal of maximizing access to critical research.
A New Cryptic Species of the Theloderma asperum Complex (Anura:
Rhacophoridae) from Myanmar
Author(s): Jennifer A. Dever
Source: Journal of Herpetology, 51(3):425-436.
Published By: The Society for the Study of Amphibians and Reptiles
https://doi.org/10.1670/17-026
URL: http://www.bioone.org/doi/full/10.1670/17-026
BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and
environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published
by nonprofit societies, associations, museums, institutions, and presses.
Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of
BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries
or rights and permissions requests should be directed to the individual publisher as copyright holder.
Journal of Herpetology, Vol. 51, No. 3, 425–436, 2017
Copyright 2017 Society for the Study of Amphibians and Reptiles
A New Cryptic Species of the Theloderma asperum Complex (Anura: Rhacophoridae)
from Myanmar
JENNIFER A. DEVER
University of San Francisco, Biology Department, 2130 Fulton Street, San Francisco, California 94117 USA; E-mail: jadever@usfca.edu
ABSTRACT.—I describe a new species of Theloderma from two regions in Myanmar (Chin State in western Myanmar and Kachin State in
northern Myanmar). Highly similar in appearance and size to Theloderma albopunctatum and Theloderma asperum, the new species
differs by the presence of small, bilateral vocal sac openings absent in T. albopunctatum and T. asperum. Molecular phylogenetic analysis
from two mitochondrial and four nuclear gene fragments infers that individuals are members of a unique genetic lineage within the T.
asperum Complex.
Theloderma (Tschudi, 1838), in the family Rhacophoridae,
presently includes 24 recognized species of tree frogs distributed
throughout Southeast Asia, China, and India (Frost, 2017).
Information on the group is very limited, and its members
exhibit a high degree of morphological similarity to one another
(Nguyen et al., 2014, 2016). Poorly represented in museum
collections, most Theloderma species typically are known from
only a single or few samples per site. This coupled with the
paucity of morphological characters makes species delineation
in this group challenging (Nguyen et al., 2014, 2016).
Theloderma asperum is colloquially known as the ‘‘bird poop
frog’’ because of its splattered brown-and-white dorsal colora-
tion. This coloration provides excellent camouflage in the frog’s
tropical and subtropical forest habitat. Described initially as
Ixalus asper by Boulenger (1886) from two specimens collected in
Larut, Perak, Malaysia, they are identifiable from other
Theloderma by a combination of characteristics: coloration, small
size (SVL 25–35 mm), lack of vomerine teeth, lack of vocal sac
openings, dorsal asperities, fingers without webbing, large
tympanum equal to eye width, and a granular venter. Rarely are
these frogs observed in nature and little is known of them
outside of captivity because of their arboreal habits and effective
disguise. This species is thought to have the broadest
distribution of any member of Theloderma, inhabiting tropical
and subtropical forests up to 1,400 m in elevation, being
recorded from Sumatra, Malaysia, India, Myanmar, Thailand,
Vietnam, Cambodia, Laos, and China (Ohler et al, 2002; Ao et al,
2003; Chan-ard, 2003; Bain and Nguyen, 2004; Stuart, 2005; Fei
et al., 2009; Lau et al., 2016). The type specimen for T.
albopunctatum (Catalog number 601686) was collected in
Guangxi, China in 1960 and described by Liu and Hu (1962).
Li et al. (2011) provide both dorsal and ventral photographs of
the holotype, and it appears nearly identical in size and
coloration to T. asperum. However, a phylogenetic study of
Theloderma using 12S and 16S rRNA mitochondrial (mtDNA)
gene fragments recently conducted by Poyarkov et al., 2015,
revealed that T. albopunctatum is genetically distinct from T.
asperum. Herein, I examine the morphology and analyses of
DNA sequence data, from both the mtDNA and nuclear
genomes (nuDNA) on additional specimens collected from
distinct locations in Laos, western and northern Myanmar,
Thailand, and northern and southern Vietnam. The results
provide evidence of the existence of an undescribed species
from Myanmar that is highly similar in appearance to T.
albopunctatum and T. asperum. The putative species possesses
vocal sac openings (absent in T. albopunctatum and T. asperum)
and is genetically distinct from both T. albopunctatum and T.
asperum. These data illustrate the use of molecular markers and
examination of voucher specimens to reveal cryptic species.
MATERIALS AND METHODS
Morphology.—For comparisons, I examined morphological
features and measurements taken from 32 adult voucher
specimens collected from Laos, Myanmar, Thailand, and Vietnam
identified as T. asperum, including one of the syntypes originally
collected from Hill Garden, Larut, Perak, Malaysia (Boulenger,
1886) BMNH 1947.2.6.18 (the other syntype has been lost;
therefore, BMNH 1947.2.6.18 is herein designated as a lectotype).
Similarly, I examined the following Theloderma voucher speci-
mens: Theloderma bicolor, Theloderma corticale,Theloderma gordoni,
Theloderma horridum,Theloderma leporosum, Theloderma nebulosum,
Theloderma palliatum, Theloderma phrynoderma,Theloderma stella-
tum,Theloderma truongsonense,andTheloderma vietnamense (ma-
terials examined; institutional abbreviations, Sabaj M. H. 2016).
For comparisons, I also used published descriptions of currently
recognized species of Theloderma from China, India, Myanmar,
Thailand, and Vietnam (Tschudi, 1838; Boulenger, 1886, 1903a,b;
Smith, 1924; Ahl, 1927; Bourret, 1937; Liu and Hu, 1962; Taylor,
1962; Stuart and Heatwole, 2004; Orlov and Ho, 2005; Orlov et
al., 2006; McLeod and Ahmad, 2007; Bain et al., 2009; Fei et al.,
2009; Rowley et al., 2011; Orlov et al., 2012; Dever et al., 2015;
Poyarkov et al., 2015; Nguyen et al., 2016; Sivongxay et al., 2016).
I examined secondary sexual characters (presence of nuptial
pads, vocal sac openings) to determine sex. I made morpholog-
ical measurements (to the nearest 0.1 mm) with digital calipers:
snout–vent length (SVL, from tip of snout–vent); head length
(HL, from tip of snout to posterior border of angle of jaw); head
width (HW, width of head at widest point); internarial distance
(IND, distance between nares); interorbital distance (IOD,
minimum distance between upper eyelids); tympanum diameter
(TD, horizontal diameter of tympanum); tympanum to eye
distance (TYE, from anterior edge of tympanum to posterior
corner of eye); distance from nostril to eye (DNE, from center of
nostril to anterior border of eye); eye width (EW, distance from
posterior to anterior corners of eye); forelimb length (FLL, from
elbow to tip of third finger); width of disk of third finger (FDW3,
greatest horizontal width); thigh length (THL, from vent to knee);
tibia length (TIL, from knee to ankle); foot length (FL, from
proximal end of the tarsus to tip of fourth toe); width of disk of
DOI: 10.1670/17-026
fourth toe (TDW4, greatest horizontal width). I determined foot
webbing formula following Myers and Duellman (1982) as
modified by Savage and Heyer (1997). I also noted skin texture,
dorsal coloration, ventral coloration, and the presence/absence of
vocal sacs, supratympanic folds, circummarginal grooves,
transverse grooves, dorsolateral folds, vomerine teeth, hindlimb
banding, forelimb banding, metacarpal and metatarsal tubercles.
Molecular Methods.—Total genomic DNA was extracted from
tissue samples recently collected from 27 individuals representing
nine species (Buergeria ocycephalus, Nyctixalus pictum,T. albopunc-
tatum, T. asperum,T. corticale,T. gordoni,T. licin,T. stellatum and T.
vietnamense), using the DNeasy Tissue Kit (Qiagen, Inc., Valencia,
CA). I used polymerase chain reaction (PCR) to amplify
fragments of the mtDNA 16S rRNA (16S) and cytochrome
oxidase subunit I (COI), as well as the nuDNA brain-derived
neurotrophic factor (BNDF), rhodopsin (Rho), seventh-in-absen-
tia (SIA), and tyrosinase (Tyr) genes. For each region, I used
different primer combinations for amplification (Table 1).
Amplified DNA was produced in 25 lL reactions after 33 cycles
of denaturation for 45 sec at 948C, annealing for 45 sec at 578C,
and extension for 1 min at 728C for all markers (except COI that
followed Grosjean et al.’s, 2015, conditions). PCR products were
purified using Promega Wizard SV Gel and PCR Clean Up
System. Purified PCR products were sequenced using BigDye
terminator v.3.1 and analyzed using an ABI 3730xl DNA
Analyzer. I verified sequences as representing the correct target
marker using a BLAST search against GenBank; they were then
edited using SEQUENCHER (Gene Codes, Ann Arbor, MI).
Genetic Variation and Phylogenetic Analysis.—Sequences (Gen-
Bank accession numbers shown in Table 2) were aligned in
SEQUENCHER first and then with the MAFFT v7.222 (Katoh et
al., 2002) algorithm in Geneious Pro 9.02 using the E-INS-I mode
and standard parameters. I included available 16S and COI
GenBank sequences covering the same region from all Theloderma
species and their closest rhacophorid relatives (Liuixalus,Nasutix-
alus,andNyctixalus). Because of differences in the genetic
behavior of mtDNA and nuDNA fragments (i.e., inheritance
pattern and recombination rate), I concatenated these fragments
separately into a combined matrix and used Geneious Pro to
independently analyze them.
Uncorrected pairwise genetic distances (p) for the 16S and
COI fragments between putative Theloderma species were
calculated in MEGA v7 (Tamura et al., 2013). Phylogenetic trees
were inferred separately for 16S, the concatenated mtDNA, and
the concatenated nuDNA via Bayesian analyses (BI) in Geneious
Pro using the MrBayes plugin v3.2.6 (Ronquist and Huelsen-
beck, 2003) in Geneious with the four chains run option for a
chain length of 10,000,000, a subsampling frequency of 2,000,
burn-in length of 10,000 and random number seed. I used the
program jModel Test (v2.1.7; Posada, 2008) to select the
appropriate model of evolution. I calculated Posterior Bayesian
credibility values (BC) for each branch in a 50% majority-rule
consensus tree and plotted the –ln Lper generation in Geneious.
Because B. oxycephalus is a basal lineage (Wilkinson et al., 2002;
Li et al., 2009), it was chosen as the outgroup taxon.
RESULTS
Morphology.—Male specimens from Myanmar generally agreed
with Boulenger’s (1886) original description of T. asperum and
Taylor’s (1962) expanded description with the exception of males
having vocal sac openings. The specimens from Chin and Kachin
States in Myanmar have a pair of vocal sac openings on each side
of the floor of the buccal cavity (Fig. 1), whereas all other adult
males described as T. albopunctatum from Laos, Vietnam, and
Thailand, and T. asperum from Malaysia, lack vocal sac openings.
There were no significant differences for any of the 15
TABLE 1. Primers used for amplification of the six molecular markers analyzed in this study.
Marker Primer Primer sequence (50-30) Source
COI AH-CO1A-S CTACAAYCCRCCRCCTRCTCGGCCAC
AH-CO1A-AS1 TADACYTCDGGRTGDCCAAARAATCA Grosjean et al., 2015
16S 16SaL CGCCTGTTTACCAAAAACAT
16SbH CCGGTCTGAACTCAGATCACGT Palumbi et al.,1991
BNDF BNDF-F GACCATCCTTTTCCTKACTATGGT TATTTCATACTT
BNDF-R CTATCTTCCCCTTTTAATGGTCAGTGTACAAAC Noonan and Chippindale, 2006
RHO Rhod1A ACCATGAACGGAACAGAAGGYCC
Rhod1D GTAGCGAAGAARCCTTCAAMGTA Bossuyt and Milinkovitch, 2000
SIA SIA1(T3) TCGAGTGCCCCGTGTGYTTYGAYTA
SIA2(T7) GAAGTGGAAGCCGAAGCAGSWYTGCATCAT Bonacum et al., 2001
TYR Tyr1A AGGTCCTCTTRAGCAAGGAATG
Tyr1G TGCTGGGCRTCTCTCCARTCCCA Bossuyt and Milinkovitch, 2000
FIG. 1. View of inside of mouth of male Theloderma pyaukkya sp. nov.
showing left side vocal sac opening. Arrow pointing to distal end of
vocal sac opening (3·magnification).
426 JENNIFER A. DEVER
quantitative characters between the putative species and T.
asperum, nor did I observe any other distinguishing qualitative
characters.
Genetic Variation and Phylogenetic Analyses.—The aligned 16S
fragments produced a 490 base pair region with 268 variable sites
and 227 parsimony informative sites. The COI fragments
produced a 647 bp region with 290 variable sites and 271
parsimony informative sites. The concatenated mtDNA frag-
ments produced a 1,134 bp region and the concatenated nuDNA
fragments produced a 1,883 base pair region. I selected the
general time-reversible model of sequence evolution with
gamma-distributed rate variation among sites (GTR) in jModel
Test for all regions, and I used the GTR option for BI.
The Bayesian analyses for both mtDNA and nuDNA regions
show that genetic distinction of the Myanmar specimens from
all other Theloderma species, with high support (Figs. 2–4).
Increased taxon sampling of the 16S region reveals that, within
Theloderma, the monophyletic T. asperum Complex exhibits
significant diversity with two distinct lineages produced, each
with its own subgroups (Fig. 4). One lineage includes GenBank
sequences identified as T. albopunctatum from Guangxi, China,
forming a genetically distinct clade with the individuals from
Laos (Luang Phabang and Savannakhet), Thailand (Nan), and
Vietnam (Tam Dao and Tuyen Quang). The other includes the
Myanmar specimens that are grouped among T. asperum and T.
licin specimens. Pairwise genetic distances (p) between the new
species and these congeners ranged from 8% for 16S, 18% for
COI, between the new species and T. albopunctatum from
Vietnam (GenBank accession numbers KU244360–LC018253),
9% for 16S between the new species and T. asperum from Fraser
FIG. 2. The phylogenetic consensus tree derived from partial DNA sequences of the concatenated 16S-COI mitochondrial genes based on Bayesian
analysis (scale bar: 0.04 estimated substitutions per site). Numbers above branches are Bayesian posterior probabilities (probabilities less than 70% are
not shown). Numbers of specimens correspond to Table 2.
NEW SPECIES OF THELODERMA 427
TABLE 2. Sequences Used in this Study.
Species Locality Voucher number
Accession numbers
16S COI BNDF RHO SIA TYR
1Buergeria oxycephalus China: Hainan MVZ 230425 KU244359 KU244459 KU244396 KU244313 KU244427 KU244357
2Liuixalus romeri China: Hong Kong CIB<CH>20080048 AB871412
3Nasutixalus medogensis China: Motuo, Xizang 6255Rao GQ285679
4Nyctixalus margaritifer Indonesia: Java KUHE 26135 LC012864
5Nyctixalus pictus Malaysia: Sabah, Lahad Datu
Dist. FMNH 231095 DQ283133
6Nyctixalus pictus Malaysia: Sabah, Lahad Datu
Dist. FMNH 231094 GQ204726
7Nyctixalus pictus Malaysia: Sarawak, Bario KUHE 53517 LC012863
8Nyctixalus pictus Malaysia: Sarawak, Gunung
Mulu N.P. AH07001 GU154888
9Nyctixalus pictus Indonesia: Bengkulu MVZ 239460 KU561880 KU244454
10 Nyctixalus sp. Myanmar: Tanintharyi CAS 247868 KU244380 KU244457 KU244403 KU244314 KU244424 KU244355
11 Nyctixalus sp. Myanmar: Tanintharyi CAS 247498 KU561883 KU244456 KU561889 KU561892 KU561895 KU561898
12 Nyctixalus spinosum Indonesia ACA 940 AF458136
14 Nyctixalus spinosum Philippines: Mindanao Nsp1 KT461916
13 Nyctixalus spinosum Philippines: Mindanao ACD 1043 DQ283114
15 Theloderma albopunctatum Vietnam: Tuyen Quang ROM 30246 AF458148
16 Theloderma albopunctatum China: Yunnan KIZ 060821201 EF564521
17 Theloderma albopunctatum China: Guangxi KIZ 060821217 EF564522
18 Theloderma albopunctatum China: Hainan HN0806100 GQ285678
19 Theloderma albopunctatum Vietnam: Vinh Phuc VNMN J2916 KJ802913
20 Theloderma albopunctatum Vietnam: Lao Cai VNMN 3540 KJ802914
21 Theloderma albopunctatum Laos: Luang Phabang 2006.2573 KR828081 KR087994
22 Theloderma albopunctatum Vietnam: Kon Tum asperum-1 KT461884
23 Theloderma albopunctatum Vietnam: Kon Tum asperum-2 KT461908
24 Theloderma albopunctatum Vietnam: Kon Tum asperum-3 KT461909
25 Theloderma albopunctatum Vietnam: Hai Phong ZMMU NAP 03557 KT461910
26 Theloderma albopunctatum Vietnam: Hai Phong ZMMU NAP 03566 KT461911
27 Theloderma albopunctatum Vietnam: Hai Phong ZMMU NAP 03575 KT461912
28 Theloderma albopunctatum Myanmar: Shan CAS 241559 KU244362 KU244441 KU244401 KU244322 KU244416 KU244352
29 Theloderma albopunctatum Thailand: Nan FMNH 270722 KU244366 KU244440 KU244405 KU244325 KU244412 KU244345
30 Theloderma albopunctatum Laos: Savannakhet NCSM 79167 KU244367 KU244434 KU244385 KU244324 KU244409 KU244340
31 Theloderma albopunctatum Laos: Luang Phabang NCSM 79445 KU244369 KU244439 KU244388 KU244323 KU244415 KU244337
32 Theloderma albopunctatum Laos: Savannakhet NCSM 76483 KU244372 KU244437 KU244386 KU244327 KU244408 KU244343
33 Theloderma albopunctatum Vietnam: Tam Dao VNMN JR2887 KU244375 KU244431 KU244381 KU244318 KU244407 KU244338
34 Theloderma albopunctatum Laos: Luang Phabang NCSM 79444 KU244379 KU244438 KU244387 KU244326 KU244414 KU244347
35 Theloderma albopunctatum Vietnam: Tam Dao VNMN JR2888 LC012853 KU244432 KU244382 KU244319 KU244406 KU244351
36 Theloderma albopunctatum Vietnam: Kon Tum VNMN 4404 LC012854
37 Theloderma albopunctatum Vietnam: Gia Lai VNMN 4405 LC012855
38 Theloderma albopunctatum Vietnam: Than Hoa VNMN 4406 LC012856
39 Theloderma albopunctatum Vietnam: San La VNMN PAE 262 LC012857
40 Theloderma albopunctatum Thailand: Doi Changdao KUHE 23736 LC012858
41 Theloderma asperum Malaysia: Fraser Hill ZRC1.1.9321 GQ204725
42 Theloderma asperum Malaysia: Perak pet trade KT461929
43 Theloderma bicolor Vietnam MNHN 1999.5986 AY880529
44 Theloderma bicolor Vietnam: Lao Cai IEBR A.20011.4 JX046474
45 Theloderma bicolor Vietnam: Lao Cai VNMN 1394 JX046475
46 Theloderma bicolor Vietnam: Ninhbinh Tbic3 KT461899
47 Theloderma bicolor Vietnam: Ninhbinh Tbic2 KT461923
48 Theloderma corticale Vietnam: Vinh Phu AMNH A161499 DQ283050
49 Theloderma corticale Vietnam: Tuyen Quang VNMN J2892 KJ802916
428 JENNIFER A. DEVER
TABLE 2. Continued.
Species Locality Voucher number
Accession numbers
16S COI BNDF RHO SIA TYR
50 Theloderma corticale Vietnam: Ninhbinh Tcort1 KT461885
51 Theloderma corticale Vietnam: Ninhbinh Tcort2 KT461886
52 Theloderma corticale Vietnam: Tam Dao MVZ 223905 KU244364 KU244452 KU244393 KU244316 KU244417 KU244354
53 Theloderma corticale Vietnam: Tam Dao VNMN 3556 LC012841
54 Theloderma corticale Vietnam: Tam Dao MVZ 225131 KU244365 KU244453 KU244394 KU244315 KU244420 KU244353
55 Theloderma gordoni Vietnam: Tam Dao MVZ 226469 KU244363 KU244451 KU244395 KU244334 KU244423 KU244358
56 Thelodemra gordoni Vietnam: Kon Tum VNMN 4407 LC012852
57 Theloderma horridum Malaysia: Negeri Sembilan,
Kenaboi KUHE 52582 LC012861
58 Theloderma horridum Thailand: Satun ZMMU NAP 04015 KT461890
59 Theloderma laeve Vietnam: Binh Phuoc ZNMU NAP 02906 KT461883
60 Theloderma laeve Vietnam: Lam Dong ZNMU NAP 03383 KT491900
61 Theloderma laeve Vietnam: Binh Phuoc ZNMU NAP 02907 KT461905
62 Theloderma laeve Vietnam: Binh Phuoc ZNMU NAP 02908 KT461906
63 Theloderma laeve Vietnam: Lam Dong ZNMU NAP 01644 KT461907
64 Theloderma laeve Vietnam: Lam Dong ZNMU NAP 01645 KT461913
65 Theloderma lateriticum Vietnam, Lao Cai, SaPa AMNH 168757 LC012848
66 Theloderma lateriticum Vietnam: Son La VNMN PAE 226 LC012849
67 Theloderma lateriticum Vietnam: Bac Giang, Yen Tu VNMN 1215 LC012850
68 Theloderma lateriticum Vietnam: Bac Giang, Yen Tu VNMN 1216 LC012851
69 Thelodemra leporosum Malaysia: Kenaboi KUHE 52581 AB847128
70 Thelodemra leporosum Malaysia LJT W46 KC465841
71 Thelodemra leporosum Malaysia: Selangor Tlep1 KT461922
72 Theloderma licin Thailand: Nakon Sri Tamarat KUHE 19426 LC012859
73 Theloderma licin Malaysia: Selangor KUHE 52599 KJ802920
74 Theloderma licin Indonesia MVZ 272184 KU244368 KU244447 KU244384 KU244333 KU244425 KU244346
75 Theloderma moloch Arunachal Pradesh, India SDBDU 2011.345 KU169993
76 Theloderma moloch China: Medog, Tibet YPX31941 KU243081
77 Theloderma nebulosum Vietnam: Kon Tum AMS R 173409 JN688168
78 Theloderma nebulosum Vietnam: Kon Tum AMS R173877 JN688169
79 Theloderma nebulosum Vietnam: Kon Tum ROM 39588 KT461887
80 Theloderma nebulosum Vietnam VNMN ROM 39588 LC012845
81 Theloderma palliatum Vietnam: Lam Dong AMS R 173130 JN688172
82 Theloderma palliatum Vietnam: Lam Dong AMS R 173131 JN688173
83 Theloderma palliatum Vietnam: Lam Dong ZMMU NAP 02511 KT461902
84 Theloderma palliatum Vietnam: Lam Dong ZMMU NAP 02516 KT461903
85 Theloderma palliatum Vietnam: Dak Lak ZMMU NAP 02735 KT461926
86 Theloderma palliatum Vietnam: Dak Lak ZMMU NAP 02736 KT461927
87 Theloderma palliatum Vietnam: Dak Lak ZMMU NAP 02756 KT461930
88 Theloderma palliatum Vietnam: Dak Lak VNMN NAP 2735 LC012843
89 Theloderma palliatum Vietnam: Dak Lak VNMN NAP 2736 LCO12844
90 Theloderma phrynoderma Myanmar: Tanintharyi CAS 243920 KJ128282 KU244448 KU244402 KJ128278 KU244410 KJ128276
91 Theloderma phrynoderma Myanmar: Tanintharyi CAS 247910 KJ128283 KU244449 KU244404 KJ128279 KU244411 KJ128277
92 Theloderma pyaukkya, sp. nov. Myanmar: Kachin CAS 226113 KU244361 KU244443 KU244399 KU244331 KU244421 KU244339
93 Theloderma pyaukkya, sp. nov. Myanmar: Kachin CAS 236133 KU244360 KU244444 KU244400 KU244330 KU244419 KU244344
94 Theloderma pyaukkya, sp. nov. Myanmar: Chin CAS 234869 KU244370 KU244445 KU244398 KU244332 KU244418 KU244342
95 Theloderma pyaukkya, sp. nov. Myanmar: Chin CAS 234857 KU244371 KU244446 KU244397 KU244329 KU244426 KU244341
96 Theloderma rhododiscus Vietnam: Ha Giang, Vi Xuyen AMNH A163893 DQ283393
97 Theloderma rhododiscus China: Guangxi KIZ 060821063 EF564533
98 Theloderma rhododiscus China: Guangxi KIZ 060821170 EF564534
99 Theloderma rhododiscus China: Mt. Dayao, Guangxi SCUM 061192L EU215530
NEW SPECIES OF THELODERMA 429
Hill, Malaysia, ~300 km south of the type locality of Hill
Garden, (GenBank accession numbers KU244360–GQ204725),
and 11% for 16S, 20% for COI between the new species and T.
licin, (GenBank accession numbers KU244360–KU244368) (Table
3).
Theloderma pyaukkya sp. nov.
Burmese Camouflaged Tree Frog
Figures 5–6
Holotype.—CAS 236133, an adult male from Lwe Aein Stream,
Intawgyi Wildlife Sanctuary, Hepu Village, Mohnyin Township,
Kachin State, Myanmar; 25.055318N, 96.24225 8E, elevation 266
m. Collected 17 May 2003 by G. O. Wogan, J. A. Wilkinson, J. V.
Vindum, and T. Thin (Fig. 5).
Paratypes.—CAS 226112 (adult male) collected from Alanga
Village Kachin State, Machanbaw Township, Putao District,
Kachin State, Myanmar, 27.172338N, 97.413128E, elevation of 456
m. CAS 226113 (adult male) collected from Htan Ga Village,
Putao District, Machanbaw Township, Kachin State, Myanmar,
27.160108N, 97.475538E. Collected on 5 May 2002 by H. Win, Y. N.
T. Na and S. Di. CAS 234857 (an adult male) collected from Bee
Hoe Village, Mindat Township, Mindat District, Chin State,
Myanmar, 21.335298N, 93.582368E at an elevation of 1,071 m.
Collected by A. K. Shein, T. Nyo, and L. Shein on 11 August,
2005. CAS 234869 (adult male) from Htai Laung Village, Mintatt
Township, Chin State, Myanmar, 21.304968N, 93.583858E, eleva-
tion 1,338 m. Collected by A. K. Shein, T. Nyo, and L. Shein on 17
August 2005 (Fig. 6).
Diagnosis.—Theloderma pyaukkya sp. nov. is a member of
Theloderma having calcified tuberculate skin, two M. extensor
digitorum communis longus slips, Y-shaped terminal phalanges,
and a distinct tympanum (Taylor, 1962; Liem, 1970). The new
species can be identified by this combination of characters:
relatively small body (SVL 28.0–31.0mm); bilateral vocal sacs
present in males (Fig. 1); vomerine teeth absent; dorsal surface,
including arms and legs, with numerous distinct, pin-point sized
calcified, white-tipped asperities. Webbing absent between
fingers; inner and outer metacarpal tubercles absent, subarticular
tubercles present, fingers with prominent, large rounded discs at
tips; both transverse and circummarginal grooves present. Small
dark brown, transverse bands on fingers, single band on forearm,
irregular dark and light bands on legs and darker bands on toes;
toes completely webbed, inner metatarsal tubercle present, outer
metatarsal tubercle absent; toe tips with discs smaller than
fingers.
Comparisons.—Theloderma pyaukkya sp. nov. is genetically
closest to T. albopunctatum and T. asper u m but is distinguished
from T. albopunctatum by having small, yet noticeable asperities
covering the entire dorsum, (skin relatively smooth in T.
albopunctatum). Theloderma pyaukkya sp. nov. differs from T.
asperum by having vocal sac openings (absent in T. as p erum).
The new species has a relatively small body size, SVL 28–31 mm
(SVL >35 mm in T. bicolor,T. corticale, T. gordoni,T. horri d um,
Theloderma leporosum,Theloderma nagalandense,Theloderma phry-
noderma,andTheloderma ryabovi). Theloderma species that have
small adult body sizes (SVL <35 mm) include T. albopunctatum,
Theloderma andersoni,Theloderma annae,T. asperum,Theloderma
babiagense,Theloderma lacustrinum,Theloderma lateriticum,Thelo-
derma leave,T. licin,Theloderma nebulosum,Theloderma palliatum,
Theloderma petilum,Theloderma rhododiscus,T. stellatum,T. tr uong -
sonense,and T. vietnamense.Theloderma pyaukkya sp. nov. lacks
vomerine teeth, but vomerine teeth are present in T. nebulosum
and T. petilum.Theloderma pyaukkya sp.nov.hascompletely
TABLE 2. Continued.
Species Locality Voucher number
Accession numbers
16S COI BNDF RHO SIA TYR
100 Theloderma rhododiscus China: Guangxi CIB<CH>GX200807017 LC012842
101 Theloderma ryabovi Vietnam: Kon Tum, Mang
Canh VNMN 3924 LC012860
102 Theloderma ryabovi Vietnam: Kon Tum ryabovi-1 KT461914
103 Theloderma ryabovi Vietnam: Kon Tum ryabovi-2 KT461915
104 Theloderma sp. Vietnam: Gia Lai VNMN 4403 LC012846
105 Theloderma stellatum Thailand: Nakhonnayok NAP03961 KT461917
106 Theloderma truongsonense Vietnam: Quang Binh ROM 39363 KT461925
107 Theloderma truongsonense Vietnam: Khanh Hoa VNMN 4402 LC012847
108 Theloderma vietnamense Vietnam: Binh Thuan AMS R 173283 JN688170
109 Theloderma vietnamense Cambodia: Mondol Kiri AMS R 147047 JN688171 KU244460 KU244391 KU244335 KU244356
110 Theloderma vietnamense Vietnam: Kien Giang ZMMU NAP 03724 KT461888
111 Theloderma vietnamense Vietnam: Kien Giang NAP03723 KT461919
112 Theloderma vietnamense Vietnam: Tay Ninh ZMMU NAP 03680 KT461921
113 Theloderma vietnamense Thailand, MaeYom KUHE 22065 LC012862
114 Theloderma vietnamense Cambodia: Koh Kong FMNH 267765 KU561885 KU244462
115 Theloderma vietnamense Cambodia: Mondolkiri FMNH 262786 KU561884 KU244461
116 Theloderma vietnamense Laos: Savannakhet NCSM 76490 KU561886 KU244464
117 Theloderma vietnamense Vietnam: Binh Thuan NCSM 80384 KU561887 KU244463 KU561888 KU561891 KU561894 KU561897
430 JENNIFER A. DEVER
webbed toes (not completely webbed in T. ander s oni or T. leave).
Theloderma pyaukkya sp. nov. lacks dermal fringes on fingers
(present in T. licin). Theloderma pyaukkya sp. nov. has a uniformly
red-colored iris (greenish-grey in T. annae, bicolored in T.
nebulosum). Theloderma pyaukkya sp. nov. has cream colored finger
and toe discs (gray-brown in T. nebulosum, red in T. rhododiscus).
Theloderma pyaukkya sp. nov has a dorsal pattern of a cream
colored head and shoulders with an irregular-shaped dark brown
patch covered with lighter splotches near urostyle (dorsal pattern
with conspicuous black-and-white patterning in Theloderma
baibengense, light brown dorsum with darker brown splotches;
red-wash over black green dorsum in T. lateriticum, dark
longitudinal streaks present in T. leave, dark brown spots on
pale background that can change in coloration in T. palliatum,
light brown with small darker brown markings in T. truongso-
nense, and trifoliate pattern on dorsum in T. stellatum and T.
vietnamense). Theloderma pyaukkya sp. nov. has dark marbling on
venter (venter uniformly grey in T. lacustrinum).
Description of Holotype.—Adult male, relatively small body size,
SVL 28.8 mm; head, flat and triangular, with width slightly
greater than length; snout sloping slightly from eye to nostril,
nostril at tip of snout, snout even with jaw in profile, squarely
truncate in dorsal view; slight concave depression between
nostrils at tip of snout; canthus rostralis rounded, curving inward
from eye to nostril; loreal region concave; sloping lateral from
canthus rostralis, latitudinally oval, angled medially and dorsally
towards tip of snout; interorbital and frontal areas flat; round
eyes, pupil horizontal; internarial distance more narrow than
interorbital distance; distinct round tympanum with a few small
tubercles on dorsal region, ~63% that of eye, separated from eye
by over half the tympanum diameter, annulus slight bordered by
tubercles; vomerine teeth absent; small vocal slits present;
choanae small, oval, ~2mmapart.
Forearm and hand length (elbow to tip of third finger) ~51%
snout–vent length; relative finger lengths III >IV >II >I, with
tips expanded to transverse oval disks with circummarginal and
transverse grooves, disk of third finger largest (2.1 mm),
webbing completely lacking between fingers. Small protruding
subarticular tubercles on midventral ridge of fingers, subartic-
ular formula I (1), II (1), III (2), IV (2); supernumerary tubercles
FIG. 3. The phylogenetic consensus tree derived from concatenated DNA sequences of the BNDF, SIA, RHO and TYR nuclear genes based on
Bayesian analysis (scale bar: 0.006 estimated substitutions per site). Bayesian posterior probabilities values >0.95 shown as * left of slash (probabilities
less than 70% are not shown). Numbers of specimens correspond to Table 2.
NEW SPECIES OF THELODERMA 431
FIG. 4. The phylogenetic consensus tree derived from partial DNA sequences of the 16S rRNA gene based on Bayesian analysis (scale bar: 0.04
estimated substitutions per site). Numbers above branches are Bayesian posterior probabilities (probabilities less than 70% are not shown). Numbers
of specimens correspond to Table 2.
TABLE 3. Uncorrected p-distances for 16S (below diagonal) and COI (above diagonal) regions among Theloderma and related species.
Species Voucher No.
T. pyaukkya sp. nov. CAS 236113 0.00 0.15 0.18 0.21 0.22 0.20 0.18 0.24
T. albopunctatum VNMN JR2888 0.08 0.00 0.18 0.23 0.21 0.20 0.20 0.23
T. licin MVZ 247184 0.11 0.12 0.00 0.20 0.21 0.18 0.20 0.23
T. corticale MVZ 225131 0.12 0.14 0.14 0.00 0.20 0.20 0.20 0.25
Nyctixalus sp. CAS 247498 0.12 0.12 0.14 0.13 0.00 0.21 0.21 0.23
T. gordoni MVZ226469 0.13 0.14 0.17 0.13 0.14 0.00 0.18 0.23
T. phyronoderma CAS 243920 0.13 0.12 0.14 0.11 0.12 0.14 0.00 0.22
T. vietnamense NCSM 80384 0.17 0.17 0.18 0.15 0.17 0.18 0.18 0.00
432 JENNIFER A. DEVER
on palmar surface absent; inner and outer metacarpal tubercles
absent. Long legs, heels overlap when legs at right angles to
body, tibiotarsal articulation nearly reaches snout, tibia ~58%
length of body; toes fully webbed, webbing formula I 1 – 1 1/3
II 1 – 1 1/3 III 1 – 1IV 1 – 1V with fringes reaching to disks
except for IV; disks of toes with circummarginal and transverse
grooves slightly smaller than those of fingers; round subartic-
ular tubercles on all toes, subarticular formula I (1), II (1), III (2),
IV (3), V (2); distinct inner metatarsal tubercle oval and
protruding; outer metatarsal tubercle absent.
Dorsal skin densely covered with numerous single fine,
calcified, white-tipped asperities. Supratympanic fold short,
extending from eye, curving around and ending behind
tympanum, ending near forearm. Chin with fewer but similar-
sized white-tipped asperities. Venter granular with smaller
asperities aggregated in fine clumps.
Measurements of Holotype (mm).—SVL 28.8; HL 10.4; HW 10.6;
IND 2.1; IOD 3.7; TD 2.6; TYE 0.6; DNE 2.9; EW 4.1; FLL 14.7;
FDW3 2.1; THL 16.2; TIL 16.1; FL 21.4; TDW4 1.9
Variation.—Paratypes conform to holotype description except
CAS 226113 has gold coloration on sides; CAS 274857, pectoral
region has coloration that appears small, beige, and X-shaped in
its center; CAS 234869, has lighter coloration on the top of the
head and back that is cloudier in appearance than the holotype.
Meristic characters are presented in Table 4.
Color in Life.—Head light white-cream in color, including loreal
region, except for brown coloration just beneath eyes, tympanum
and between eyes in form of irregular dark, brown patch. Cream-
white coloration continuing onto sides and lateral region of
dorsum. Distinct dark brown patch coming to point middorsal
between shoulders; posterior region near urostyle covered by
irregular white-cream splotch that extends to thigh and tibia.
Venter brown with cream marbling near thighs and pectoral
region. Legs with irregular dark brown banding, feet and toes
with distinct transverse bands. Forearms with single, darker
brown band; fingers with narrow brown transverse bands. Finger
discs and toe discs, rust brown with a tinge of gold flecking.
Palms, metacarpal and metatarsal tubercles, and nuptial pad all
light cream in color. Eyes rust colored, similar to finger and toe
pads.
Etymology.—Specific epithet pyaukkya (pronounced pee-ew-cha)
is Burmese for camouflaged, which reflects the frog’s cryptic
coloration.
Suggested Common Name.—Common name: The Burmese
Camouflaged Tree Frog
Geographic Distribution.—This species is known from two
localities in Kachin State, Myanmar ~276 km apart and two
localities in Chin State, Myanmar ~5.6 km apart, with elevations
ranging from 266 m to 1, 643 m (Fig. 7). The holotype collection
locality was in the Lwe Aein Stream, Intawgyi Wildlife Sanctuary,
Hepu Village Mohnyin Township, Kachin, Myanmar at an
elevation of 266 m.
DISCUSSION
The phylogenetic analyses support the monophyly and
genetic distinctiveness of Theloderma pyaukkya. The new species
can be distinguished from T. asperum specimens in having small
bilateral vocal sac openings. The syntype specimens of T.
asperum were collected by L. Fea on Fraser Hill, Malaysia, and
described by Boulenger (1886). One was a male specimen
(BMNH 1947.2.6.18) that Boulenger specifically states was
‘‘without vocal sac,’’ and upon close examination of the
specimen, vocal sac openings apparently are absent. Taylor
(1962) describes another specimen identified as T. asperum
(BMNH 1904.7.19.26) from Bukit Itam, Selangor, Malaysia, as a
male with vocal sacs. Yet upon close inspection, this specimen
lacked vocal sac openings and, therefore, vocal sacs. None of the
FIG.5. Theloderma pyaukkya sp. nov.,holotype CAS 236133, adult
male in preservative, A) dorsal view, B) ventral view. Scale bar =5 mm.
FIG.6. Theloderma pyaukkya sp. nov.,paratype CAS 234869, adult
male, dorsolateral view.
TABLE 4. Measurements of the holotype and paratypes of Theloderma
pyaukkya sp. nov. Characters: SVL =snout–vent length; HL =head
length; HW =head width; IND =internare distance; IOD =interorbital
distance; TD =tympanum diameter; DNE =distance between nare and
eye; EW =eye diameter; FLL =forelimb length; FDW3 =third finger
disc width; THL =thigh length; FL =foot length; TDW4 =fourth toe
disc width.
Character
CAS
236133
CAS
226113
CAS
226112
CAS
234857
CAS
234869
SVL 28.8 29 28 31.5 30
HL 10.4 9.6 11.1 10.7 10.6
HW 10.6 9.6 11.1 11.7 11.2
IND 2.6 2.2 3 2.5 3.1
IOD 4.1 3.7 3.5 3.4 3.1
TD 2.1 2.3 2.1 2 2.1
TYE 3.7 4.1 3.6 4.2 4.2
DNE 0.6 0.8 0.8 0.9 1.2
EW 3.5 2.9 2.9 3.4 2.9
FLL 14.7 13.8 14.4 16.3 16.6
FDW3 2.1 1.7 1.9 2.4 2.3
THL 16.2 13.9 14.1 15.5 16.2
TIL 16.1 14.9 15.8 15.9 16.2
FL 13.7 14.1 12.8 13.9 14.4
TDW4 1.9 1.6 1.6 1.5 1.7
NEW SPECIES OF THELODERMA 433
male specimens from Laos, Thailand, or Vietnam possess vocal
sacs and the individuals from Laos, Thailand, and Vietnam
formed a monophyletic clade for both mtDNA and nuDNA
markers with those identified as T. albopunctatum by Poyarkov
et al. (2015). Additionally, the mean pairwise genetic distance
between the new species and other members of this species
complex for the 16S and COI regions respectively varied from of
8% and 18% (T. pyaukkya—T. albopunctatum) and 9% and 12% (T.
pyaukkya—T. albopunctatum). The level of divergence between
specimens from northern Myanmar and western Myanmar
indicated by the 16S region (5%) suggest these populations are
distinct evolutionary lineages, but because of a lack of
distinguishing morphological characters and a small sample
size, they are currently all considered members of T. pyaukkya.
These findings have conservation implications, because each
genetically distinct group’s distribution is reduced and, hence,
more perilous (Bickford et al., 2005; Kohler et al., 2005; Angulo
and Icochea, 2010). The situation is exacerbated by the fact that
the forests inhabited by T. albopunctatum,T. asperum and T.
pyaukka, are highly endangered, experiencing some of the
greatest deforestation rates in the world (Sodhi et al., 2004;
WWF, 2013). Although over 100 new species have been
described from the Indo-Burma region in the past decade, the
proportion of endemic frogs known from the region is relatively
low and the level of Data Deficient (IUCN, 2014) species is
relatively high compared to similar tropical regions (Howard
and Bickford, 2014). This discrepancy can be explained by our
lack of knowledge, with information on amphibian diversity
and distribution quite limited for most areas, particularly within
Myanmar, Laos, Cambodia, and Indonesia (Vieites et al., 2009;
Rowley et al., 2010). Therefore, an increased effort in herpeto-
faunal research in this region is duly warranted before
inevitable species loss occurs.
Acknowledgments.—I thank the University of San Francisco
(USF) for supporting this research. I thank A. K. Shein, T. Nyo,
L. Shein, G. O. Wogan, J. A. Wilkinson, J. V. Vindum, and T. Thin
for their work in the field as members of the Myanmar
Herpetological Survey Team, and U Tin Tun, past Director of
the Nature and Conservation; Division of the Forest Depart-
ment, Ministry of Forestry, for issuing permits for all Myanmar
specimens collected and examined in this study. The Myanmar
specimens stored at the CAS were collected under NSF-DEB
9971861. Thanks to M. Hoang for translating Li and Hu’s 1962
description and L. Scheinberg for generating the map figure.
Thanks to Alfred Si for providing the Burmese translation of
camouflage. Thanks to J. Rowley for helpful editorial comments.
Curators of the following institutions permitted us to examine
comparative material under their care: R. Sadlier (AMS), B.
Stuart, (NCSM), C. Spencer (MVZ), A. Resetar (FMNH), D.
Frost (ANMH), J. Streicher (BMNH), A. Ohler (MNHNP), and
R. Murphy (ROM).
LITERATURE CITED
AHL, E. 1927. Zur Systematik der asiatischen Arten der Froschgattung
Rhacophorus. Sitzungsberichte der Gesellschaft Naturforschender
Freunde zu Berlin 35–47.Available from: http://amphibiaweb.org/
http://www.webcitation.org/6kzX8mvv5 Archived at WebCite at
on 3 October 2016.
ANGULO,A.AND J. ICOCHEA. 2010. Cryptic species complexes, widespread
species and conservation: lessons from Amazonian frogs of the
Leptodactylus marmoratus group (Anura: Leptodactylidae). Systemat-
ics and Biodiversity 8:357–370.
AO, J.M., S. BORDOLOI,AND A. OHLER. 2003. Amphibian fauna of
Nagaland with nineteen new records from the state including five
new records for India. Zoos’ Print Journal 18:1117–1125.
BAIN, R.H. AND T. Q. NGUYEN. 2004. Herpetofaunal diversity of Ha Giang
Province in northeastern Vietnam, with descriptions of two new
species. American Museum Novitates 3453:1–42.
BAIN, R. H., T. Q NGUYEN,AND K. V. DOAN. 2009. A new species of the
genus Theloderma Tschudi, 1838 (Anura: Rhacophoridae) from
Northwestern Vietnam. Zootaxa 2191:58–68.
BICKFORD, D., D. J. LOHMAN,N.S.SODHI,P.K.L.NG,R.MEIER,K.WINKER,
K. K. INGRAM,AND I. DAS. 2005. Cryptic species as a window on
diversity and conservation. Trends in Ecology and Evolution 22:148–
155.
BONACUM, J., R. DESALLE, P. O’GRADY,D.OLIVERA,J.WINTERMUTE ,AND M.
ZILVERSMIT. 2001. New nuclear and mitochondrial primers for
systematics and comparative genomics in Drosophila.Drosophila
Information Service 84:201–204.
BOSSUYT,F.,AND M. C. MILNKOVITCH. 2000. Convergent adaptive
radiations in Madagascan and Asian ranid frogs reveal covariation
between larval and adult traits. Proceedings of the National
Academy of Sciences 97:6585–6590.
BOULENGER, G. A. 1886. First report on additions to the batrachian
collection in the Natural History Museum. Proceedings of the
Zoological Society of London 1886:411–416.
———. 1903a. Descriptions of three new batrachians from Tonkin.
Annals and Magazine of Natural History, Series 7, 12:186–188.
———. 1903b. Report on the batrachians and reptiles. Annandale, N.
and C. Robinson eds, Fasciculi Malayenses. Pp. 131–176 in
Anthropological and Zoological Results of an Expedition to Perak
and the Siamese Malay States 1901–1903 Undertaken by Nelson
Annandale and Herbert C. Robinson under the Auspecies of the
University of Edinburgh and the University of Liverpool. Longmans,
Green and Company, London.
FIG. 7. Map of collection locations in Myanmar for Theloderma
pyaukkya sp. nov. Circle represents holotype collection site locality,
triangle represents western collection site locality.
434 JENNIFER A. DEVER
BOURRET, R. 1937. Notes herpe´tologiques sur l’Indochine fran ¸caise. XIV.
Les batraciens de la collection du Laboratoire des Sciences Naturelles
de l’Universite´. Descriptions de quinze especes ou varie´te´s nouvelles.
Annexe au Bulletin Ge´ne´ ral de l’Instruction Publique. Hanoi 1937:5–
56.
CHAN-ARD, T. 2003. A Photographic Guide to Amphibians in Thailand.
Darnsutha Press Co., Ltd, Thailand.
DEVER, J. A., H. NGUYEN,AND J. A. WILKINSON. 2015. Rediscovery and
redescription of Theloderma phrynoderma (Ahl, 1927) (Anura: Rha-
choporidae) from Myanmar. Copeia 103:402–415.
FEI, L., S. –Q.HU, C.-Y.YE,AND Y.-Z.HUANG. 2009. Fauna Sinica.
Amphibia. Volume 2. Anura. Chinese Academy of Science. Science
Press, China.
FROST, D. 2016. Amphibian species of the world: an online reference
[Internet]. Version 6. Available from: http://research.amnh.org/vz/
herpetology/amphibia/Amphibia/Anura/Rhacophoridae/
Rhaophorinae/Theloderma. Archived at WebCite at on 3 October
2016.
GROSJEAN, S., A. OHLER,Y.CHUAYNKERN,C.CRUAUD,AND A. HASSANIN.
2015. Improving biodiversity assessment of anuran amphibians
using DNA barcoding of tadpoles. Case studies from Southeast Asia.
Comptes Rendus Biologies 338:351–361.
HOWARD, S. D., AND D. P. BICKFORD. 2014. Amphibians over the edge:
silent extinction risk of Data Deficient species. Diversity and
Distributions 20:837–846.
IUCN. 2014. The IUCN Red List of Threatened Species. Version 2014.1.
International Union for Conservation of Nature, Gland, Switzerland.
KATO H, K., K. MISAWA,K.KUMA,AND T. M IYATA. 2002. MAFFT: a novel
method for rapid multiple sequence alignment based on fast Fourier
transform. Nucleic Acids Research 30:3059–66.
KOHLER, J., D. R. VIEITES,R.M.BONETT,F.H.GARCIA,F.GLAW,D.STEINKE,
AND M. VENCES. 2005. New amphibians and global conservation: a
boost in species discoveries in a highly endangered vertebrate group.
BioScience 55:693–696.
LAU, M. W. N., Z. EMI,P.P.VA N DIJK, L., MING,S.DUTTA,AND S. BORODOLOI.
2016. Theloderma asperum. The IUCN Red List of Threatened Species
2016: e.T59031A86241488 [Internet]. Available from: http://www.
webcitation.org/6kzYDrISV by WebCite on 3 October 2016.
LI, J. -T, J. CHE, R.W. MURPHY,H.ZHAO,E.ZHAO,D.RAO,AND Y. Z HANG.
2009. New insights to the molecular phylogenetics and generic
assessment in the Rhacophoridae (Amphibia: Anura) based on five
nuclear and three mitochondrial genes, with comments on the
evolution of reproduction. Molecular Phylogenetics and Evolution
53:509–522.
LI, J., Y. CHEN,S.LI,K.LV,AND Y. WANG. 2011. Catalogue of the type
specimens of amphibians and reptiles in the Herpetological Museum
of the Chengdu Institute of Biology, Chinese Academy of Sciences: I.
Rhacophoridae (Anura, Amphibia). Asian Herpetological Research
2:129–141.
LIEM, S. S. 1970. The morphology, systematics, and evolution of the Old
World tree frogs (Rhacophoridae and Hyperoliidae). Fieldiana:
Zoology 57:1–14.
LIU, C., AND S. HU. 1962. A herpetological report of Kwangsi. Acta
Zoologica Sinica/Dong wu xue bao. Beijing 14:73–104.
MCLEOD, D. S,. AND N. AHAMAD. 2007. A new species of Theloderma
(Anura: Rhacophoridae) from southern Thailand and peninsular
Malaysia. Russian Journal of Herpetology 14:65–72.
MYERS, C. W., W. E. DUELLMAN. 1982. A new species of Hyla from Cerro
Colorado, and other tree frog records and geographical notes from
western Panama. American Museum Novitates 2752:1–25.
NGUYEN, T. T., D. T. LE,S.H.L.NGUYEN,M.MATSUI,AND T. Q. NGUYEN.
2014. First record of Philautus petilus Stuart and Heatwole, 2004
(Amphibia: Anura: Rhacophoridae) from Vietnam and its phyloge-
netic position. Current Herpetology 33:112–120.
NGUYEN, T. Q., C. T. PHAM,T.T.NGUYEN,H.N.NGO,AND T. Z IEGLER. 2016.
A new species of Theloderma (Amphibia: Anura: Rhacophoridae)
from Vietnam. Zootaxa 4168:171–186.
NOONAN,B.P.,AND P. T . C HIPPINDALE. 2006. Dispersal and vicariance: The
complex evolutionary history of boid snakes. Molecular Phyloge-
netics and Evolution 40(2006):347–358.
OHLER, A., S. R. SWAN ,AND J. C. DALTRY. 2002. A recent survey of the
amphibian fauna of the Cardamom Mountains, southwest Cambo-
dia with descriptions of three new species. Raffles Bulletin of
Zoology 50:465–481.
ORLOV, N. L., AND C. T. HO. 2005. A new species of Philautus from
Vietnam (Anura: Rhacophoridae). Russian Journal of Herpetology
12:135–142.
ORLOV, N. L., S. K. DUTTA,H.V.GHATE,AND Y. KENT. 2006. New species of
Theloderma from Kon Tum Province (Vietnam) and Nagaland State
(India) [Anura: Rhacophridae]. Russian Journal of Herpetology 13:
135–154.
ORLOV, N. L., A. B. VASILIEVA,N.B.ANANJEVA,T.T.NGUYEN,N.N.SANG,
AND P. GEISSLER. 2012. Taxonomic notes on rhacophorid frogs
(Rhacophorinae: Rhacophoridae: Anura) of southern part of An-
namite Mountains (Truong Son, Vietnam), with description of three
new species. Russian Journal of Herpetology 19: 23–64.
PALUMBI, S., A. MARTIN,S.ROMANO,W.O.MCMILLAN,L.STICE,G.
GRABOWSKI. 1991. The Simple Fool’s Guide to PCR. Version 2.
University of Hawaii, Honolulu.
POSADA, D. 2008. jModelTest: phylogenetic model averaging. Molecular
Biology and Evolution 25:1253–1256.
POYARKOV, N. A., JR., N. L. ORLOV,A.V.MOISEEVA,P.PAWGKHANANT,T.
RUANGSUWAN,A.B.VASSILIEVA,E.A.GALOYAN,T.T.NGUYEN,AND S. V.
GOGOLEVA. 2015. Sorting out moss frogs: mtDNA data on taxonomic
diversity and phylogenetic relationships of the Indochinese species
of the genus Theloderma (Anura, Rhacophoridae). Russian Journal of
Herpetology 22:241–280.
RONQUIST,F.R.,AND J. P. HUELSENBECK. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19:1572–
1574.
ROWLEY, J. J. L., R. BROWN,R.BAIN,M.KUSRINI,R.INGER,B.STUART,G.
WOGAN,N.THY,AND T. CHAN-ARD. 2010. Impending conservation
crisis for Southeast Asian amphibians. Biology Letters 6:336–338.
ROWLEY, J. J. L., D. T. LE,H.D.HOANG,V.Q.DAU,AND T. T. C AO. 2011.
Two new species of Theloderma (Anura: Rhacophoridae) from
Vietnam. Zootaxa 3098:1–20.
SABAJ, M. J. 2016. Standard symbolic codes for institutional resource
collections in herpetology and ichthyology: an online reference
[Internet]. Available from: http://www.asih.org/resources/standard-
symbolic-codes-institutional-resource-collections-herpetology-
ichthyology.
SAVAGE, J. M., AND W. R. HEYER. 1997. Digital webbing formulae for
Anurans: a refinement. Herpetological Review 28:131.
SIVONGXAY, N., M. DAVANKHAM,S.PHIMMACHAK,K.PHOUMIXAY,AND B. L.
STUART. 2016. A new small-sized Theloderma (Anura: Rhacophor-
idae) from Laos. Zootaxa 4147:433–442.
SMITH, M. A. 1924. New tree-frogs from Indo-China and the Malay
Peninsula. Proceedings of the Zoological Society of London 1924:
224–234.
SODHI, N. S., L. P. KOH,B.W.BROOK,AND P. K. L. NG. 2004. Southeast
Asian biodiversity: an impending disaster. Trends in Ecology and
Evolution 19:654–660.
STUART, B. L. 2005. New frog records from Laos. Herpetological Review
36:473–479.
STUART, B. L., AND H. F. HEATWOLE. 2004. A new Philautus (Amphibia:
Rhachophoridae) from northern Laos. Asiatic Herpetological Re-
search 10:17–21.
TAMURA, K., D. PETERSON,N.PETERSON,G.STECHER,M.NEI,AND S. KUMAR.
2013. MEGA6: molecular evolutionary genetics analysis. Version 6.0.
Molecular Biology and Evolution 30:2725–2729.
TAYLOR, E. H. 1962. The amphibian fauna of Thailand. University of
Kansas Science Bulletin 43:265–599.
TSCHUDI, J. J. 1838. Classification der Batrachier mit Beru¨ cksichtigung der
fossilen Thiere dieser Abtheilung der Reptilien Neuch ˆatel, Petit-
pierre.
VIEITES, D. R., K. C. WOLLENBERG,F.ADREONE,J.KOHLER,F.GLAW,AND M.
VENCES. 2009. Vast underestimation of Madagascar’s biodiversity
evidenced by an integrative amphibian inventory. Proceeding of the
National Academy of Science USA 106:9267–8272.
WILKINSON, J. A., R. C. DREWES,AND O. L. TATUM . 2002. A molecular
phylogenetic analysis of the family Rhacophoridae with an emphasis
on the Asian and African genera. Molecular Phylogenetics and
Evolution 24:265–273.
WWF. 2013. Ecosystems in the Greater Mekong: past trends, current
status, possible futures [Internet]. Available from: wwf.panda.org/
greatermekong. Archived at http://www.webcitation.org/
6l0wuNMk2 by WebCite on 4 October 20.
Accepted: 20 March 2017.
Published online: 28 July 2017.
ZooBank ID: D10D45F0-2A4A-40B9-8B5D-65F07D95E152
NEW SPECIES OF THELODERMA 435
APPENDIX 1
Referred specimens.—Theloderma asperum: BMNH 1947.2.6.18,
[lectotype] male, Larut, Perak, Malaysia. BMNH 1904.7.19.26, male,
Burkit-Nam, Selanga, Malaysia.
Theloderma albopunctatum: AMNH 168771, female, Lao Cai
Province, Vietnam. AMS R 173734, Kon Tum Province, Vietnam.
AMNH 168772, male, Lao Cai Province, Vietnam. AMS R 173734,
female, Kon Tum Province, Vietnam. AMS R 177656, male, Nghe An
Province, Vietnam. BMNH 1973.13409, female, Me Wong Forest,
Thailand. BMNH 1973.13410, male, Me Wong Forest, Thailand.
BMNH 1973.13411, female, Me Wong Forest, Thailand. FMNH
261897, male, Xanakham District, Vientiane Province, Laos. FMNH
270722, male, Amphoe Bo Klaue, Tamboi Dong Paya, Nan,
Thailand. MNHNP 1973.13409–13411, males, Thailand. NCSM
76167, male, Cao Ven Village, Phuc Son Commune, Pu Mat
National Park, Anh Son District, Nghe An Province, Vietnam.
NCSM 79444, female, Tad Kuang Si Provincial Protected Area,
Luang Phabang District, Lunag Phabang Province, Laos. NCSM
76483, female, Houay Lavi Stream, Nam Pa Camp, Sepon Mining
Tenement, Viboui District, Savannakhet Province, Laos. NCSM
76445–6, females, Houay Liep Stream, Ban Pha Liep, Paklay
District, Xaingabouli Province, Laos. NCSM 86614, male, Phou
Dendin National Protected Area, Phongsaly Province, Laos. ROM
30246, male, Na Hang Nature Preserve, Tuyen Quang, Pac Ban,
Vietnam. ROM 30259, female, Tam Dao, Vinh Phu Province,
Vietnam. ROM 36823, male, Chi Linh, Hia Duong Province,
Vietnam. ROM 38002, female, Sa Pa, Lao Cai Province, Vietnam.
Theloderma bicolor: MNHNP 1948.153.1734–1, MNHNP
1948.153.1734–2, Chapa Haut Tonkin, Vietnam. MNHNP
1999.5986.1734–3, MNHNP 1999.5587.1734–3, Fan Si Pan, Lao Cai,
Vietnam.
Theloderma corticale: MVZ 225131, MVZ 226104, MVZ 226105,
MVZ 226106, MVZ 226100, Tam Dao, Vin Yen District, Vinh Phu
Province, Vietnam.
Theloderma gordoni: FMNH 253615, FMNH 253616, Ankhe
District, Gia Lai Province, Vietnam. FMNH 254287, Vinh Phu
Province, Vietnam.
Theloderma horridum: FMNH 186600, FMNH 186601, FMNH
186602, Selangor, Malaysia.
Theloderma nebulosum: AMS R173283, AMS R 173409, AMS R
171150 Kon Tum Province, Vietnam.
Theloderma palliatum: AMS R173130–131, Lam Dong Province,
Vietnam. BMNH 1973.1414, Vietnam.
Theloderma phrynoderma: BMNH 1947.2.7.59, Karen Hills, Myan-
mar. MSNG 29414 [lectotype], Karen State, Tao, Myanmar; CAS
243920, CAS 247910, Tanintharyi Division: Dawei District, Yephyu
Township, Myanmar.
Theloderma stellatum: AMS R1732823, Binh Thuan Province,
Vietnam. FMNH 253622, Gia Lai Province, Vietnam. KU 327995,
Sakaerat Environmental Research Station, Nakhon Ratchisma
Province, Thailand. MVZ 222113, MVZ 222114, MVZ 222116, Gia
Lai Province, Vietnam. NCSM 76485, NCSM 76486, NCSM 76487,
NCSM 76488, Nam Sangi River Drainage Basin, Vilabouli District,
Savannakhet Province, Laos. NCSM 76490, Tham Bing Cave, Sepon
Mining Tenement, Vilabouli District, Savannakhet Province, Laos.
NCSM 80384, Bac Binh District, Binh Thuan Province, Vietnam.
ROM 33123, Gia Lai Province, Vietnam. ROM 33160, Yon Don
National Park, Dac Lac, Vietnam.
436 JENNIFER A. DEVER
