PresentationPDF Available

Genetic tools weed out misconceptions of strain reliability in Cannabis sativa: Implications for a budding industry

Authors:

Abstract and Figures

Cannabis sativa is federally illegal and largely illegal worldwide. However, due to recent state legislation changes, eight states plus Washington DC legally allow the sale of Cannabis for recreational consumption, and 28 states allow Cannabis for medicinal use. Changes in legal status has resulted in an unprecedented surge of newly developed strains, which are usually associated with a Sativa, Indica, or Hybrid type, which is based on morphology and reported effects. Strains are propagated from clones or feminized clonal seed, and as such, the genetic profile of individuals with the same name should have identical genotypes, regardless the source of origin. Reports of inconsistencies suggest that Cannabis strain names are not reliable identifiers. This is likely the result of decades of unregulated trading and growing. Genetic data from ten nuclear microsatellites determined the genetic relatedness of 122 samples in Colorado, California, and Washington. The genetic analyses performed here found no genetic distinction between described Sativa, and Indica type strains, or Hybrids thereof. Moreover, within 12 popular strains acquired from various dispensaries, 1 strain showed genetic consistency, 7 strains had at least one obvious genetic outlier, while 4 strains showed no genetic consistency. Cannabis strains were found to be inconsistent not only across state lines, but also among cities within the same state, among dispensaries in the same city, and surprisingly even between samples of the same strain from the same dispensary. These results demonstrate that strains are inconsistent and that the public view of Sativa/Indica type is not genetically supported.
No caption available
… 
No caption available
… 
No caption available
… 
No caption available
… 
No caption available
… 
Content may be subject to copyright.
ATTAGCGCTACGTACCTATATATCGCGCAAA
TGTACAGAGATATGCGCTATATTAGCGCTA
CGTACCTATATATCGCGCAAATGTACAGAG
ATATGCGCTATATTAGCGCTACGTACCTATA
TATCGCGCAAATGTACAGAGATATGCGCTA
TATTAGCGCTACGTACCTATATATCGCGCAA
ATGTACAGAGATATGCGCTATATTAGCGCTA
CGTACCTATATATCGCGCAAATGTACAGAG
ATATGCGCTATATTAGCGCTACGTACCTATA
TATCGCGCAAATGTACAGAGATATGCGCTA
TATTAGCGCTACGTACCTATATATCGCGCAA
ATGTACAGAGATATGCGCTATATTAGCGCTA
CGTACCTATATATCGCGCAAATGTACAGAG
ATATGCGCTATATTAGCGCTACGTACCTATA
TATCGCGCAAATGTACAGAGATATGCGCTA
TATTAGCGCTACGTACCTATATATCGCGCAA
AAGATATGCGCTATATTAGCGCTACGTACCT
A friend of mine found a strain that she
really likes
The same strain is different from other
dispensaries
Smell
Appearance
Effect
I thought strains are largely propagated
through cloning
Therefore, shouldn’t strains be identical no
matter where you buy them?
Strains grown from clones or seed should
be genetically very similar
Clones Stable seed
RESEARCHERS
Broad/narrow leaflet drug
types, hemp type
C. sativa: narrow leaflet
low THC hemp (Clarke & Merlin 2013)
C. indica: all drug varieties
(Clarke & Merlin 2013, Leafly 2017)
Geographical origin
CONSUMERS
Sativa, Indica & Hybrid
Hemp < 0.3% THC
% THC and % CBD
Psychotropic effects
Taste & smell
Sativa phenotype
Indica phenotype
Indica phenotype
Sativa phenotype
0-30 degrees
latitude
Uplifting &
creative
Depression,
ADD, fatigue
30-50 degrees
latitude
Sedating &
relaxing
Anxiety, pain,
insomnia
https://strainz.com/faqs/
Cannabinoids Terpenes
http://blog.restek.com/?cat=30
http://blog.restek.com/?p=14961
Do genetic analyses support consumer
reports of strain inconsistencies?
Do described Sativa and Indica type
strains separate genetically?
Are samples within strains genetically
identical?
Medical (29) Recreational (8)
of the U.S.
population lives
in a state where
marijuana has
been legalized
59.3%
Lacking product regulation
Producers
No strain verification available
No protection for developers
No registration & certification
(New or vintage strains)
Consumers
Inconsistent products
Unreliable effects
Unverifiable
No protection
Slight genetic distinction
between reported Sativa
and Indica types (Sawler et al. 2015)
Genotype 1 Genotype 2
Sampling
122 samples
30 widely available strains
20 dispensaries
8 cities
3 states
San Luis Obispo
Union Gap
Colorado
Sativa proportion retrieved from
Durban Poison
9100
Hawaiian 2100
Sour Diesel 7 90
Trainwreck 2 90
Island Sweet Skunk 3 80
AK-47 3 65
Golden Goat 7 65
Bruce Banner 6 60
Flo 4 60
Jillybean 3 60
Pineapple Express 5 60
Purple Haze 360
Tangerine 2 60
Jack Herer 3 55
OG Kush 4 55
Blue Dream 9 50
Tahoe OG 4 50
Chemdawg 7 45
Headband 2 45
Banana Kush 4 40
Girl Scout Cookies 8 40
Jack Flash 2 40
Larry OG 3 40
G-13 3 30
Lemon Diesel 2 30
Hash Plant 4 20
Pre98-Bubba Kush 2 15
Grape Ape 2 0
Purple Kush 4 0
Strain
Samples (n)
% Sativa
Sampling bias?
Consumer POV
Availability
Online strain
information
Sativa proportion retrieved from Strain information retrieved from
5 ’ A T T A G C G C T A C G T A C C T A T A T A T C G C G C A A
A T G T A C A G A G A T A T G C G C T A T A T T A G C G C T A C
G T A C C T A T T A T T A T T A T T A T T A T T A T T A T T A T
T A T T A T T A T T A T T A T T A T T A T T A T T A T T A T T A
T T A T T A T T A T G C G C A A A T G T A C A G A G A T A T G C
G C T A T A T T A G C G C T A C G T A C C T A T A T A T C G C G
C A A A T G T A C A G A G A T A T G C G C T A T A T T A G C G C
3’
Garden City 4
Denver 1
Garden City 3
Sativa type
Indica type
Hybrid type
(50/50)
PCoA indicated no genetic grouping among described Sativa and Indica types
Results not yet published
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
Boulder 1
Boulder 3
Denver 1
Denver 2
Fort Collins 3
Fort Collins 4
Garden City 1
Garden City 2
Union Gap 1
Boulder 1
Fort Collins 2
Boulder 1
Denver 4
Fort Collins 3
Garden City 1
Garden City 2*
Garden City 2
Greeley 1
Denver 1
Garden City 1
Boulder 1
Garden City 1
Garden City 2
Boulder 1
Denver 3
San Luis Obispo 2
Boulder 1
Boulder 2
Boulder 3
Denver 1
Garden City 1
Garden City 1
Garden City 2
Fort Collins 2
Garden City 1
San Luis Obispo 2
Boulder 1
Denver 1
Denver 4
Fort Collins 3
Fort Collins 4
Garden City 1
Boulder 1
Denver 1
Fort Collins 2
Garden City 1
Garden City 1
Garden City 2
Greeley 1
Boulder 1
Denver 1
Garden City 2
Longmont 1
Union Gap 1
Denver 4
Fort Collins 1
Greeley 1
Denver 1
Garden City 1
Garden City 3
San Luis Obispo 1
Union Gap 1
Denver 3
Fort Collins 3
Garden City 2
San Luis Obispo 1
Boulder 1
Boulder 2
Boulder 3
Denver 1
Garden City 4
Garden City 4
San Luis Obispo 2
San Luis Obispo 3
San Luis Obispo 4
Boulder 1
Denver 1
Fort Collins 4
San Luis Obispo 3
Boulder 1
Boulder 2
Boulder 3
Denver 1
Denver 5
Garden City 2
Garden City 1
Garden City 1
Greeley 1
Denver 1
Garden City 1
Garden City 2
Greeley 1
Boulder 1
Denver 1
Fort Collins 2
Garden City 2
Garden City 3
San Luis Obispo 3
San Luis Obispo 4
Union Gap 1
Boulder 1
Denver 3
Boulder 1
Denver 4
San Luis Obispo 3
Boulder 3
Fort Collins 3
Garden City 2
Boulder 1
Garden City 2
Fort Collins 3
Garden City 1*
Garden City 1
Garden City 2
Denver 1
Fort Collins 3
Boulder 1
Union Gap 1
Denver 1
Garden City 4
Garden City 3
San Luis Obispo 2
Durban Poison Hawaiian Sour Diesel Trainwreck Island Sweet
Skunk
AK-47 Golden Goat Green Crack Bruce Banner Flo Jillybean Pineapple Express Purple Haze Tangerine Jack Herer OG Kush Blue Dream Tahoe OG Chemdawg Headband Banana Kush Girl Scout Cookies Jack Flash Larry OG G-13 Lemon
Diesel
Hash Plant Bubba
Kush
Grape
Ape
Purple Kush
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
Boulder 1
Boulder 3
Denver 1
Denver 2
Fort Collins 3
Fort Collins 4
Garden City 1
Garden City 2
Union Gap 1
Boulder 1
Fort Collins 2
Boulder 1
Denver 4
Fort Collins 3
Garden City 1
Garden City 2*
Garden City 2
Greeley 1
Denver 1
Garden City 1
Boulder 1
Garden City 1
Garden City 2
Boulder 1
Denver 3
San Luis Obispo 2
Boulder 1
Boulder 2
Boulder 3
Denver 1
Garden City 1
Garden City 1
Garden City 2
Fort Collins 2
Garden City 1
San Luis Obispo 2
Boulder 1
Denver 1
Denver 4
Fort Collins 3
Fort Collins 4
Garden City 1
Boulder 1
Denver 1
Fort Collins 2
Garden City 1
Garden City 1
Garden City 2
Greeley 1
Boulder 1
Denver 1
Garden City 2
Longmont 1
Union Gap 1
Denver 4
Fort Collins 1
Greeley 1
Denver 1
Garden City 1
Garden City 3
San Luis Obispo 1
Union Gap 1
Denver 3
Fort Collins 3
Garden City 2
San Luis Obispo 1
Boulder 1
Boulder 2
Boulder 3
Denver 1
Garden City 4
Garden City 4
San Luis Obispo 2
San Luis Obispo 3
San Luis Obispo 4
Boulder 1
Denver 1
Fort Collins 4
San Luis Obispo 3
Boulder 1
Boulder 2
Boulder 3
Denver 1
Denver 5
Garden City 2
Garden City 1
Garden City 1
Greeley 1
Denver 1
Garden City 1
Garden City 2
Greeley 1
Boulder 1
Denver 1
Fort Collins 2
Garden City 2
Garden City 3
San Luis Obispo 3
San Luis Obispo 4
Union Gap 1
Boulder 1
Denver 3
Boulder 1
Denver 4
San Luis Obispo 3
Boulder 3
Fort Collins 3
Garden City 2
Boulder 1
Garden City 2
Fort Collins 3
Garden City 1*
Garden City 1
Garden City 2
Denver 1
Fort Collins 3
Boulder 1
Union Gap 1
Denver 1
Garden City 4
Garden City 3
San Luis Obispo 2
Durban Poison Hawaiian Sour Diesel Trainwreck Island Sweet
Skunk
AK-47 Golden Goat Green Crack Bruce Banner Flo Jillybean Pineapple Express Purple Haze Tangerine Jack Herer OG Kush Blue Dream Tahoe OG Chemdawg Headband Banana Kush Girl Scout Cookies Jack Flash Larry OG G-13 Lemon
Diesel
Hash Plant Bubba
Kush
Grape
Ape
Purple Kush
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
Boulder 1
Boulder 3
Denver 1
Denver 2
Fort Collins 3
Fort Collins 4
Garden City 1
Garden City 2
Union Gap 1
Boulder 1
Fort Collins 2
Boulder 1
Denver 4
Fort Collins 3
Garden City 1
Garden City 2*
Garden City 2
Greeley 1
Denver 1
Garden City 1
Boulder 1
Garden City 1
Garden City 2
Boulder 1
Denver 3
San Luis Obispo 2
Boulder 1
Boulder 2
Boulder 3
Denver 1
Garden City 1
Garden City 1
Garden City 2
Fort Collins 2
Garden City 1
San Luis Obispo 2
Boulder 1
Denver 1
Denver 4
Fort Collins 3
Fort Collins 4
Garden City 1
Boulder 1
Denver 1
Fort Collins 2
Garden City 1
Garden City 1
Garden City 2
Greeley 1
Boulder 1
Denver 1
Garden City 2
Longmont 1
Union Gap 1
Denver 4
Fort Collins 1
Greeley 1
Denver 1
Garden City 1
Garden City 3
San Luis Obispo 1
Union Gap 1
Denver 3
Fort Collins 3
Garden City 2
San Luis Obispo 1
Boulder 1
Boulder 2
Boulder 3
Denver 1
Garden City 4
Garden City 4
San Luis Obispo 2
San Luis Obispo 3
San Luis Obispo 4
Boulder 1
Denver 1
Fort Collins 4
San Luis Obispo 3
Boulder 1
Boulder 2
Boulder 3
Denver 1
Denver 5
Garden City 2
Garden City 1
Garden City 1
Greeley 1
Denver 1
Garden City 1
Garden City 2
Greeley 1
Boulder 1
Denver 1
Fort Collins 2
Garden City 2
Garden City 3
San Luis Obispo 3
San Luis Obispo 4
Union Gap 1
Boulder 1
Denver 3
Boulder 1
Denver 4
San Luis Obispo 3
Boulder 3
Fort Collins 3
Garden City 2
Boulder 1
Garden City 2
Fort Collins 3
Garden City 1*
Garden City 1
Garden City 2
Denver 1
Fort Collins 3
Boulder 1
Union Gap 1
Denver 1
Garden City 4
Garden City 3
San Luis Obispo 2
Durban Poison Hawaiian Sour Diesel Trainwreck Island Sweet
Skunk
AK-47 Golden Goat Green Crack Bruce Banner Flo Jillybean Pineapple Express Purple Haze Tangerine Jack Herer OG Kush Blue Dream Tahoe OG Chemdawg Headband Banana Kush Girl Scout Cookies Jack Flash Larry OG G-13 Lemon
Diesel
Hash Plant Bubba
Kush
Grape
Ape
Purple Kush
\
Genotype 1
Genotype 2
Each bar = individual
Proportion of genetic
assignment to each
genotype
Within strain variation
30% G1
70% G2
Results not yet published
\
Do genetic analyses support consumer reports of
strain inconsistencies?
Do described Sativa and Indica type strains
separate genetically?
Are samples within strains genetically identical?
1. STRUCTURE analysis confirms many inconsistencies within strains
2. Inconsistencies are not limited to any particular source
STRUCTURE and PCoA show no separation of strains into the widely perceived
descriptions of Sativa and Indica types
Chemdawg (n=7), Island Sweet Skunk (n=3), Larry OG (n=3), Jack Flash (n=2)
11 strains had one obvious outlier
6 strains had n=2 with different genotypes
9 strains >1 outlier
Need consistency
Within states
Among states
Among countries
\
< 1Million registered medical marijuana
patients
Cannabis products lack of formal regulation
Strain names are not meaningful identifiers
Products distributed to medical patients and
recreational consumers
“While unexpected effects could simply be surprising
for the recreational user, this could have much more
serious implications for patients relying on a strain with
characters to alleviate specific medical symptoms.”
(Schwabe &McGlaghlin, 2017 in prep)
Committee Members
Mitchell McGlaughlin
Nolan Kane
Rob Reinsvold
Richard Hyslop
UNC Graduate Students
UNC Graduate School
UNC School of Biological
Sciences
References [1] Clarke R & Merlin M. 2013 [2] Hazekamp A & Fischedick JT 2012 [3] Sawler et al. 2015
Chapter
The growth, distribution, and use of Cannabis sativa (cannabis) have been tightly restricted for decades due to the therapeutic and psychoactive molecules it produces. Despite long-standing cultivation, scientific research on cannabis has been limited, with past efforts to breed and improve this crop largely supported by an illegal global economy. The easing of legal restrictions and the rapid growth of genomic tools and biotechnology have accelerated research and targeted trait development in cannabis. These advances have enabled the establishment of regulatory standards that ensure safe products for human consumption, and supported efforts to bioengineer cannabinoid production for an eco-conscious future. This chapter discusses societal and scientific influences on the cannabis plant, with a focus on the impact of genomics and biotechnology on cannabis research, and the legal and environmental challenges faced by the future of this industry and its impact on the global bioeconomy.
ResearchGate has not been able to resolve any references for this publication.