ArticlePDF Available

Abstract and Figures

Midas cichlid fish are a Central American species flock containing 13 described species that has been dated to only few thousand years old, a historical timescale infrequently associated with speciation. Their radiation involved the colonization of several clear water crater lakes from two turbid great lakes. Therefore, Midas cichlids have been subjected to widely varying photic conditions during their radiation. Being a primary signal relay for information from the environment to the organism, the visual system is under continuing selective pressure and a prime organ system for accumulating adaptive changes during speciation, particularly in the case of dramatic shifts in photic conditions. Here, we characterize the full visual system of Midas cichlids at organismal and genetic levels, to determine what types of adaptive changes evolved within the short time span of their radiation. We show that Midas cichlids have a diverse visual system with unexpectedly high intra-and interspecific variation in color vision sensitivity and lens transmittance. Midas cichlid populations in the clear crater lakes have convergently evolved visual sensitivities shifted towards shorter wavelengths compared to the ancestral populations from the turbid great lakes. This divergence in sensitivity is driven by changes in chromophore usage, differential opsin expression, opsin coexpression, and to a lesser degree by opsin coding sequence variation. The visual system of Midas cichlids has the evolutionary capacity to rapidly integrate multiple adaptations to changing light environments. Our data may indicate that, in early stages of divergence, changes in opsin regulation could precede changes in opsin coding sequence evolution.
Content may be subject to copyright.
!
Article: Discoveries
Rapid and parallel adaptive evolution of the visual system of Neotropical Midas cichlid
fishes
Julián Torres-Dowdall,1,2 Michele E.R. Pierotti,3 Andreas Härer, 1 Nidal Karagic,1 Joost M.
Woltering,1 Frederico Henning,1 Kathryn R. Elmer,1,4 Axel Meyer1*
1 Zoology and Evolutionary Biology, Department of Biology, University of Konstanz, Konstanz,
Germany
2 Zukunftskolleg, University of Konstanz, Konstanz, Germany
3 Naos Laboratories, Smithsonian Tropical Research Institute, Panama, Republic of Panama
4 Institute of Biodiversity, Animal Health and Comparative Medicine, College of Medical, Veterinary
and Life Sciences, University of Glasgow, Glasgow, United Kingdom
*Corresponding author: Email: (axel.meyer@uni-konstanz.de)
Key words: Amphilophus, cichlid, crater lake, opsin, vision, visual sensitivity
Abstract
Midas cichlid fish are a Central American species flock containing 13 described species that has
been dated to only few thousand years old, a historical timescale infrequently associated with
speciation. Their radiation involved the colonization of several clear water crater lakes from two
turbid great lakes. Therefore, Midas cichlids have been subjected to widely varying photic
conditions during their radiation. Being a primary signal relay for information from the environment
to the organism, the visual system is under continuing selective pressure and a prime organ
system for accumulating adaptive changes during speciation, particularly in the case of dramatic
shifts in photic conditions. Here, we characterize the full visual system of Midas cichlids at
organismal and genetic levels, to determine what types of adaptive changes evolved within the
short time span of their radiation. We show that Midas cichlids have a diverse visual system with
unexpectedly high intra- and interspecific variation in color vision sensitivity and lens transmittance.
Midas cichlid populations in the clear crater lakes have convergently evolved visual sensitivities
shifted towards shorter wavelengths compared to the ancestral populations from the turbid great
lakes. This divergence in sensitivity is driven by changes in chromophore usage, differential opsin
expression, opsin coexpression, and to a lesser degree by opsin coding sequence variation. The
visual system of Midas cichlids has the evolutionary capacity to rapidly integrate multiple
adaptations to changing light environments. Our data may indicate that, in early stages of
divergence, changes in opsin regulation could precede changes in opsin coding sequence
evolution.
© The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and
Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
!
2!
Introduction
Understanding the mechanisms underlying adaptive phenotypic divergence is one of the main
challenges of molecular evolutionary biology. The visual system of animals provides an excellent
model for approaching this issue for a number of reasons: it is highly diverse across organisms;
the molecular mechanisms underlying its diversity are relatively well known; and there is a clear
link between changes at the molecular level and their phenotypic consequences (Loew and
Lythgoe 1978; Chang et al. 1995; Yokoyama and Yokoyama 1996; Yokoyama 2000; Ebrey and
Koutalos 2001; Chinen et al. 2003; Hofmann and Carleton 2009; Carleton 2014; Enright et al.
2015; Dalton et al. 2017). Moreover, strong selection for tuning the visual system to the light
environment is expected given the crucial sensory role of vision for different activities including
foraging, predator avoidance, and mate choice. Particularly interesting are animals inhabiting
aquatic environments, especially freshwater habitats, given that these are among the most
spectrally diverse light environments due to the wavelength-specific absorption properties of water
combined with dissolved organic matter, suspended particles, and plankton scattering light at
various wavelengths (Cronin et al. 2014). Indeed, fishes have the most variation in spectral
sensitivities among all vertebrates, showing a strong correlation between visual sensitivities and
light environment (Loew and Lythgoe 1978; Levine and MacNichol 1979; Lythgoe 1984; Cummings
and Partridge 2001; Marshall et al. 2003; Bowmaker 2008; Cronin et al. 2014; Marshall et al.
2015).
Cichlid fishes are an interesting model system to the study of visual ecology and evolution
(Carleton 2009; Carleton et al. 2016), since they are one of the most species rich and colorful
lineages of vertebrates (Kocher 2004; Brawand et al. 2014; Henning and Meyer 2015). These fish
have undergone impressive phenotypic divergence, including visual sensitivity (Kocher 2004;
Salzburger 2009; Henning and Meyer 2014; Carleton et al. 2016). The visual system of African
cichlids is highly diverse, spanning most of the variation known from all fishes, and there is
compelling evidence that selection has shaped this diversity (Sugawara et al. 2002, 2005; Terai et
al. 2002; Carleton et al. 2005; Hofmann et al. 2009; Cronin et al. 2014; Carleton et al. 2016).
Vision is mediated by visual pigments, which are composed of an opsin protein and a light
absorbing retinal chromophore. These components are covalently bound, and variation in either of
them results in shifts of spectral sensitivity (Wald 1968; Yokoyama 2000). Eight opsin genes, one
rod-opsin that functions under dim-light conditions and seven cone opsin genes involved in color
vision, have been described from cichlids, which collectively have sensitivities that span from the
ultra-violet to the red part of the light spectrum (Carleton 2009; Escobar-Camacho et al. 2017). Of
these eight, five are hypothesized to have been present in the common ancestor of vertebrates:
the rod-opsin that functions under dim-light conditions (RH1) and four cone opsin genes that are
involved in color vision (SWS1, SWS2, RH2, LWS; Yokoyama and Yokoyama 1996; Terakita
2005). Two additional cone opsin gene duplications (SWS2aSWS2b and RH2ARH2B) increased
!
3!
the opsin repertoire in acanthopterygians (Carleton and Kocher 2001; Parry et al. 2005). A
subsequent duplication of RH2A (RH2A
a
RH2A
b
) occurred in cichlids (Parry et al. 2005).
Extensive research in the visual system of African cichlids has shown that multiple
mechanisms affect vision of these fish, including opsin gene expression and coexpression, opsin
coding sequence differences, chromophore usage, and ocular media transmittance (Carleton et al.
2016). Cichlid retinas are highly structured, with single cones expressing one of the short-
wavelength sensitive opsins (SWS1, SWS2b, or SWS2a) and double cones expressing one opsin
in each of the two cell members, either two mid-wavelength sensitive (RH2B, RH2A
a
or RH2A
b
,)
or one mid-wavelength and the long-wavelength opsin (LWS; Carleton and Kocher 2001; Spady et
al. 2006; Carleton et al. 2008; Hofmann et al. 2009; O’Quin et al. 2010). Thus, African cichlids
commonly express a combination of three cone opsins (Carleton et al. 2016; but see Parry et al.
2005; Dalton et al. 2015, 2017), resulting in large differences in spectral sensitivity among species
expressing different subsets (Carleton and Kosher 2001; Spady et al. 2006; Carleton et al. 2008;
Carleton 2009; Hofmann et al. 2009). This tuning mechanism underlies much of the variation
observed among cichlid species from Lake Malawi (Hofmann et al. 2009). In contrast, fine-tuning
of visual sensitivity is mostly achieved by amino acid substitution in the opsin protein, mainly in
sites directed into the chromophore-binding pocket (Carleton et al. 2005). This has been shown to
be an important tuning mechanism for the dim-light sensitive RH1 (Sugawara et al. 2005) and for
SWS1 and LWS that have sensitivities at opposite extremes of the visible spectrum (Terai et al.
2002, 2006; Seehausen et al. 2008; Hofmann et al. 2009; O’Quin et al. 2010; Miyagi et al. 2012).
Visual sensitivity can also be tuned by changing chromophore type, and this mechanism is
known to underlie some of the phenotypic variation between African cichlids that inhabit turbid
versus clear waters (Sugawara et al. 2005; Terai et al. 2006; Carleton et al. 2008; Miyagi et al.
2012). Two types of chromophores can be found in fish, 11-cis retinal derived from vitamin A1 and
3,4 didehydroretinal derived from vitamin A2. Switching from A1- to A2-derived chromophores
results in sensitivities shifting towards longer wavelengths (Wald 1961; Hárosi 1994; Cronin et al.
2014). Another way to alter sensitivity is to filter light passing the cornea and lens before reaching
the retina; and African cichlids are known to vary strongly in the clearness of the lenses (Hofmann
et al. 2010; O’Quin et al. 2010).
The study of the visual system of African cichlids has furthered our understanding of the
mechanisms involved in adaptive divergence (reviewed in Carleton et al. 2016). Yet, there remain
numerous unanswered questions regarding how this diversity has evolved that might be difficult to
address without exploring younger cichlid radiations (Carleton et al. 2016). One such question
concerns the likelihood of different mechanisms driving early stages of differentiation. Is early
divergence characterized by structural changes of opsin genes or by modifications in the pattern of
opsin expression? Does one tuning mechanism or the interaction of multiple mechanisms underlie
early spectral sensitivity divergence? The Midas cichlid fishes from Nicaragua (Amphilophus cf.
!
4!
citrinellus) provide an excellent system to address these questions, as they have recently
colonized new visual environments from known source populations and are ecologically divergent
in parallel along the benthic-limnetic axis within crater lakes (Elmer et al. 2014; Kautt et al. 2016a).
Nicaragua has a rich diversity of freshwater environments including the largest lakes in
Central America and a series of young (< 24,000 years) and completely isolated crater lakes that
are part of the Central American Volcanic Arc (Kutterolf et al. 2007). Midas cichlid populations of
the great lakes Managua and Nicaragua have recently (less than 2,000 generations ago) and
independently colonized multiple crater lakes (Barluenga et al. 2006; Barluenga and Meyer 2010;
Elmer et al. 2010; Elmer et al. 2014; Kautt et al. 2012, 2016a, 2016b). The newly colonized crater
lakes differ in many aspects from the great lakes, including a drastic difference in the light
environment. The great lakes are very turbid due to a high level of suspended particles whereas
crater lakes tend to have clearer waters (Cole 1976; Elmer et al. 2010). This is particularly true for
two of the oldest and deepest crater lakes, Apoyo and Xiloá. These crater lakes harbor small
Midas cichlid radiations along a benthiclimnetic axis of divergence (4 to 6 endemic species each;
Kautt et al. 2016a). Benthic and limnetic Midas cichlids might experience different light conditions.
Limnetic Midas cichlids forage in open water, a relatively homogenous light environment with a
broad spectral bandwidth (Sabbah et al. 2011). Benthic Midas cichlids forage in the littoral zone
where the light environment is likely shifted toward longer wavelength and with a narrower spectral
bandwidth (Sabbah et al. 2011). Thus, Midas cichlids are an excellent system to study the
evolution of sensitivities after the very recent colonization of, and speciation in a new light
environment.
So far, relatively little is known about the visual system of Neotropical cichlids. Early
microspectrophotometry (MSP) studies suggested that Neotropical cichlids have long wavelength
shifted spectral sensitivities (Muntz 1973; Loew and Lythgoe 1978; Levine and MacNichol 1979;
Kröger et al. 1999; Weadick et al. 2012). Opsin gene expression in Neotropical cichlids supports
these findings as these fish express a long wavelength sensitive palette of opsins (i.e., SWS2a,
RH2A and LWS, Escobar-Camacho et al. 2017). Interestingly, the most short-wavelength shifted
opsins in single cones (i.e., SWS1) and double cones (i.e., RH2B) were suggested to be lost or to
have become pseudogenized (Weadick et al. 2012; Fisher et al. 2015, Escobar-Camacho et al.
2017). Measures of lens transmittance in Neotropical cichlids show that the UV and violet parts of
the visible spectrum are often filtered out before reaching the retina (Muntz 1973). Finally, usage of
the A2-derived chromophore producing long-wavelength shifted sensitivities appears to be
common in Neotropical cichlids (Loew and Lythgoe 1978; Levine and MacNichol 1979; Weadick et
al. 2012). In combination, those results suggested that Neotropical cichlids might have a reduced
diversity in their visual system and the potential for adaptation to new light environments with
short-wavelength shifted spectra might be limited (Weadick et al. 2012).
!
5!
Based on our knowledge of the evolutionary history of the Midas cichlid species complex,
we aimed to understand the phenotypic and molecular consequences of colonization of new light
environments. First, we compared light irradiances between great and crater lakes to better predict
the expected phenotypic divergence in spectral sensitivities. Second, we used
microspectrophotometry to compare visual pigment sensitivity and lens spectral transmittance
measurements between different Midas cichlid species inhabiting great and crater lakes and
between benthic and limnetic ecomorphs within crater lakes. Finally, we explored the molecular
mechanisms underlying divergence in the visual sensitivity of Midas cichlids by studying the
evolution of opsin amino acid sequences, opsin gene expression, and chromophore usage.
Results
VARIATION IN THE VISUAL ENVIRONMENT IN NICARAGUAN LAKES
To determine the different photic environments experienced by Midas cichlids we took underwater
light measurements in a turbid great lake (Lake Managua) and two clear crater lakes (Lakes Apoyo
and Xiloá). These lakes differed in many aspects of their underwater light environment. Spectral
irradiance measurements in the turbid great lake showed that light attenuation was dramatically
higher than in the crater lakes, as expected due to their differences in turbidity (fig. 1). Therefore,
the photic environment was restricted to shallower waters in the turbid great lake, but it expanded
into deeper waters in the clear crater lakes. Moreover, light spectra differ among lakes. While long-
wavelengths were attenuated with depth similarly in crater lakes and the great lake, short-
wavelength light was better transmitted in crater lakes, resulting in a blue-shifted light spectrum
compared to that of the great lake (fig. 1). A useful measure to compare the light environments of
different lakes is λP50, the wavelength at which the total number of photons is divided in two equal
parts (McFarland and Munz 1975). Higher λP50 values suggest a light spectrum shifted towards
longer wavelengths, whereas lower λP50 values indicate short-wavelength shifted light
environments. In the turbid great lake, λP50 was 529 nm, but in the crater lakes it was shifted
towards shorter wavelengths (Apoyo λP50 = 504511; Xiloá λP50 = 505523). Thus, the underwater
photic environment of the crater lakes is richer both in bandwidth and intensity compared to the
great lake, providing a source of strong divergent selection on the visual system of aquatic
animals.
PHENOTYPIC DIVERSITY IN THE VISUAL SYSTEM OF MIDAS CICHLIDS
SPECTRAL SENSITIVITIES OF VISUAL PIGMENTS
To determine if the colonization of clear water crater lakes (i.e., a new photic environment) resulted
in adaptive phenotypic divergence in the visual system of Midas cichlids, we conducted
microspectrophotometry analyses (MSP) on retinas of specimens from a turbid great lake (Lake
Nicaragua) and two clear crater lakes (Lakes Apoyo and Xiloá). Additionally, to explore the
divergence between benthic and limnetic species within crater lakes, both ecomorphs were studied
!
6!
from the same two crater lakes (there are no limnetic species in the great lakes; supplementary
table S1, Supplementary Material online). The peaks of maximum absorbance (λmax) as well as
estimates of A1/A2 chromophore ratios of rod and cone photoreceptors were determined. Analysis
repeated with fish reared under common light conditions provided qualitatively similar results
(supplemental fig. S1, Supplemental Material online). Thus, we infer that the patterns described
below have a genetic basis.
Rod photoreceptors
Retina rod photoreceptor cells are particularly tuned to dim light conditions, which in aquatic
environments are characteristic of deep and murky waters (Bowmaker 1995, 2008). In Midas
cichlids, peaks of maximum sensitivity (λmax) from 101 rod cells (number of specimens NNicaragua = 2,
number of cells: nNicaragua = 9; NApoyo = 8, nApoyo = 35; NXiloá = 11, nXiloá = 57) ranged from 495 to 525
nm (fig. 2). All these were assigned to one spectral class based on the estimated pure-A1 visual
pigment (λA1 = 497 ± 1 nm, mean ± SD; fig. 2), suggesting various A1/A2 chromophore ratios. No
clear pattern of variation of rod photoreceptor sensitivity with lake of origin was found
(supplemental fig. S2, Supplemental Material online). However, λmax values in the limnetic species
of both clear crater lakes were less variable (Bartlett's k2 = 21.065, df = 4, P < 0.001) and with
mean λmax shifted toward shorter wavelengths than sympatric benthic species (Kruskal-Wallis
c
2 =
22.370, df = 1, P < 0.001; fig. 2).
Single-cone photoreceptors
Single cone cells are one of the two types of photoreceptors involved in color vision, and their
sensitivity peaks at wavelengths between 350 and 460 nm (UV to blue part of the spectrum;
Bowmaker 2008). MSP analysis on 42 single cones of Midas cichlids (NNicaragua = 2, nNicaragua = 12;
NApoyo = 6, nApoyo = 18; NXiloá = 4, nXiloá = 12) identified two spectral classes based on the predicted
λA1, one most sensitive in the violet (431 ± 4 nm) and one in the blue (450 ± 4 nm; fig. 2) part of the
light spectrum. All single cones from turbid great lake specimens were assigned to the blue
spectral class. In contrast, specimens within clear crater lakes Apoyo and Xiloá had single cones
assigned to the blue as well as the violet spectral classes (fig. 2). The range of λmax values for the
blue spectral class varied among lakes (F = 6.190, df = 2,6, P = 0.035; fig. 2), as in specimens
from crater lake Apoyo the sensitivity of cones assigned to this class appeared to be shifted toward
shorter wavelengths (λmax: 443 457) compared to those seen in crater lake Xiloá (λmax: 448 467
nm) and the great lake (λmax: 449 465 nm). No differences for the blue or in the violet spectral
class (Apoyo λmax: 431 442 nm; Xiloá λmax: 425 439 nm; fig. 2) were observed between morphs
within crater lakes.
Double-cone photoreceptors
Double cones are the second type of photoreceptor involved in color vision, consisting of two
cones fused together (Cronin et al. 2014). These have peaks of sensitivities in the mid and long
parts of the visible light spectrum (blue-green to red; Bowmaker 1995, 2008). We obtained 610
!
7!
MSP readings of double cones from Midas cichlids’ retinas identifying four spectral classes based
on the predicted λA1: a red (λA1 = 559 ± 2 nm; NNicaragua = 3, nNicaragua = 20; NApoyo = 5, nApoyo = 41;
NXiloá = 9, nXiloá = 37), a long-green (λA1 = 528 ± 2 nm; NNicaragua = 3, nNicaragua = 49; NApoyo = 10, nApoyo
= 142; NXiloá = 11, nXiloá = 136), a short-green (λA1 = 509 ± 1 nm; NNicaragua = 3, nNicaragua = 13; NApoyo =
9, nApoyo = 76; NXiloá = 11, nXiloá = 63), and a blue-green spectral class (λA1 = 476 ± 4 nm; NNicaragua =
2, nNicaragua = 4; NApoyo = 5, nApoyo = 12; NXiloá = 5, nXiloá = 17). In Midas cichlids’ red spectral class,
both the λmax (Kruskal-Wallis
c
2 = 22.295, df = 4, P < 0.001) and its associated variance (Bartlett's
k2 = 86.324, df = 4, P < 0.001; fig. 2) differed among species. Variance was higher in specimens
from the turbid great lake as these had extremely long-wavelength shifted cones (λmax: 558 623
nm) that were not observed in the clear crater lakes (fig. 2). No significant differences were
observed between ecomorphs in each crater lake.
Two spectral classes with sensitivities in the green part of the light spectrum (510 560
nm) were identified based on predicted λA1 values, a short-green and a long-green (fig. 2).
Interestingly, both of these were detected for most specimens examined. Within each of these two
spectral classes, specimens from the crater lakes had sensitivities shifted toward shorter
wavelengths than specimens from the turbid great lake (short-green: F = 5.800, df = 2,20, P = 0.
010; long-green: F = 6.500, df = 2,21, P = 0.006; fig. 2). No differences were detected when
comparing the limnetic and benthic species within the crater lakes.
A few double cones had visual pigments with sensitivities in the blue-green spectral class
(fig. 2). These had an extremely wide range of variation in λmax (469 505 nm), particularly in the
crater lakes (Bartlett's k2 = 6.283, df = 2, P = 0.043; fig. 2). Very few of these cones were observed
in turbid great lake specimens, and these had long wavelength-shifted sensitivities. Cones of this
class were more commonly seen in fish from the crater lakes, and these had both, long and
extremely short wavelength-shifted λmax values (fig. 2).
Collectively across lakes and species, the cones of adult Midas cichlids had six different
spectral classes that coincide with the expected λmax ranges of SWS2b (violet), SWS2a (blue),
RH2B (blue-green), RH2A (short- and long-green), and LWS (red). We found no evidence of
single-cones with maximum absorbance in the UV part of the spectrum (i.e. <400 nm, SWS1).
Remarkably, in addition to the short wavelength sensitive visual pigment of single cones at least
three different spectral classes were detected for double cones of single Midas cichlid specimens.
The presence of four different spectral channels confers these fish the potential for tetrachromatic
color vision, yet functional validation would be required to determine the roles of these channels in
chromatic or achromatic vision. Spectral sensitivities of the different photoreceptors were either
short wavelength shifted (blue, short-green, long-green and red spectral classes) or had reduced
variability (rod and blue-green) in the clear crater lakes compared to the turbid great lake. Little
divergence was observed among ecomorphs within the crater lakes.
A1/A2-DERIVED CHROMOPHORE USAGE IN MIDAS CICHLIDS
!
8!
Absorbance spectra from micro-spectrophotometric measures of photoreceptor outer segments
showed significant variation in A1/A2 chromophore ratios across Midas cichlid species (Kruskal-
Wallis
c
2 = 32.167, df = 4, P < 0.001; fig. 3a). Consistent with short wavelength shifted sensitivity
and less variation in sensitivities, Bonferroni corrected pairwise comparisons suggested that Midas
cichlids from the clear crater lakes use relatively less vitamin A2-derived chromophores than fish
from the turbid great lake. However, the benthic species from crater lake Xiloá showed vitamin A2-
derived chromophore usage not significantly different from those seen in specimens from the great
lake (fig. 3a; supplementary table S2, Supplementary Material online).
LENS TRANSMITTANCE
Ocular media, and in particular lenses, can selectively limit the wavelength of light reaching the
retina, thus affecting visual sensitivity (Losey et al. 2003). A large amount of variation was found in
lens transmittance (as T50, the wavelength of 50% transmission) for first generation laboratory
born individuals of five Midas cichlid species reared under common light conditions. However, lens
transmittance cut-offs were not continuously distributed but formed discrete groups (Hartigans' dip
test for unimodality D = 0.099, P = 0.003; fig. 4). One group was composed exclusively by Midas
cichlids from the turbid great lake Nicaragua, having lenses blocking UV light and part of the violet
light of the spectrum (T50 = 421.6, SD = 2.9, n = 10). A second group had UV-blocking but violet-
light-transmitting lenses and was composed of most of the fish from the clear crater lakes,
including both the limnetic (Apoyo T50 = 392.9, SD = 1.8, n = 4 and Xiloá T50 = 393.9, SD = 2.8, n
= 7) and benthic species from both lakes (Apoyo T50 = 389.9, SD = 0.4, n = 3 and Xiloá T50 =
380.4, SD = 3.0, n = 9). Interestingly, we found a third group including only two specimens of the
limnetic species from crater lake Apoyo that had UV-transmitting lenses (T50 = 352.3 and 353.6).
Thus, Midas cichlids from the clear crater lakes have shifted the lens transmittance toward shorter
wavelengths compared to the ancestral species from the turbid great lake.
MECHANISMS OF DIVERGENCE IN THE VISUAL SYSTEM OF MIDAS CICHLIDS
CODING SEQUENCE VARIATION OF MIDAS CICHLID OPSIN GENES
To determine the contribution of structural changes in opsin proteins to the phenotypic variation
observed in photoreceptorssensitivities (see SPECTRAL SENSITIVITIES OF VISUAL PIGMENTS above),
we sequenced rhodopsin and the seven cone opsins from 64 specimens of the Midas cichlid
species complex. Specimens from two species of Midas cichlids (A. citrinellus and A. labiatus)
from the two turbid great lakes (Nicaragua and Managua), and individuals from one benthic and
one limnetic species from the clear crater lakes Apoyo and Xiloá (A. astorquii and A. zaliosus in
the former, and A. xiloaensis and A. sagittae in the latter) were included. Opsin genes and their
inferred amino acid sequences were found to be highly similar across the analyzed species.
Collectively across rhodopsin and all seven cone opsins, we identified a total of 16 variable
nucleotide sites of which eight resulted in amino acid substitutions (table 1). In none of these cases
!
9!
were different alleles fixed in different species, but rather the alleles were segregating in one or
more of the Midas cichlid species.
The eight non-synonymous substitutions found were not homogeneously distributed across
opsin genes. Only one substitution was found in RH2A
b
and LWS, two in SWS1, and four in
RH2A
a
(none were found in RH1, SWS2a, SWS2b, and RH2B, table 1). Seven of these occurred
in transmembrane regions, but only one occurred in a site directed into the retinal-binding pocket:
A164S in LWS. We determined the frequency of alanine and serine at this position by genotyping a
larger number of A. citrinellus (great lake Nicaragua, n = 63), A. zaliosus (crater lake Apoyo, n =
24) and A. xiloaensis (crater lake Xiloá, n = 24) individuals using a PCR-RFLP approach since the
polymorphism generates cutting sites for different restriction enzymes (Ala = SatI, Ser = Fnu4HI).
This confirmed our previous result, finding that LWS segregates for these two alleles only in the
turbid great lake Nicaragua, but not in the species from the crater lakes.
Overall, given that no fixed differences across species were found, coding sequence
variation appears to have a minor impact on the divergence of Midas cichlids’ visual system. The
only possible exception is LWS, where the A164S substitution could explain some variation seen in
the great lake but not in the crater lakes. For other variable sites, mutagenesis experiments will be
needed to determine their contribution to divergence in visual sensitivity.
CONE OPSIN EXPRESSION IN MIDAS CICHLIDS
Using quantitative real-time PCR (qRT-PCR), we quantified opsin expression in retinas of 25 wild-
caught individuals of Midas cichlids, including specimens from the turbid great lake Managua and
of a limnetic and a benthic species from clear crater lakes Xiloá and Apoyo. The proportion of the
total cone opsin gene expression (Tall) comprised by each of the seven cone opsins (Ti; Carleton
and Kocher 2001; Fuller et al. 2004) is reported (fig. 5).
Significant differences were found in the expression of wild-caught fish from different lakes
(AMRPP=0.43, P=0.001). In the species from the turbid great lake LWS constituted more than 60%
of the total cone opsin expressed whereas RH2A
b
represented almost 24% of total opsin
expression. SWS2a was the only single cone opsin expressed (~15% of total expression; fig. 5a).
This pattern of opsin expression reflects the results of the MSP analyses showing that Midas
cichlids in the turbid great lake have visual sensitivities shifted toward longer wavelengths.
Opsin expression of clear crater lake Midas cichlids differed from that in the great lake in
two aspects. First, in the crater lakes fish expressed proportionally less LWS and more RH2A
b
than those in the great lake (fig. 5b-c). Second, in crater lake Apoyo some individuals expressed
the blue-green sensitive RH2B and the violet sensitive SWS2b gene (fig. 5c). Individuals
expressing SWS2b expressed only traces of SWS2a and vice versa, suggesting a trade-off
between single cone opsins (supplementary fig. S3, Supplementary Material online). No variation
was evident between species within each crater lake.
!
10!
In summary, opsin expression differences suggest shift in sensitivity towards shorter
wavelengths in fish from the clear crater lakes compared to a turbid great lake. This is achieved by
changes in the relative proportion of LWS and RH2A
b
expressed, and by the novel expression of
SWS2b and RH2B. These patterns of opsin expression were maintained in fish reared under
common light conditions (supplementary fig. S4, Supplementary Material online), suggesting a
genetic basis for the divergence between species.
OPSIN COEXPRESSION IN MIDAS CICHLIDS
To better understand the phenotypic consequences of differential opsin gene expression, we
performed triple fluorescent in situ hybridization (FISH) in laboratory reared Midas cichlids from a
great lake (A. citrinellus, Lake Nicaragua) and a clear crater lake representative species (A.
astorquii, Lake Apoyo), with a focus in double cones (8265 double cone members counted). The
retina of Midas cichlids from the turbid great lake was dominated by double cones expressing LWS
(>75% of double cones consistently across the retina), including multiple twin cones (fig. 6a-e).
Most of the rest of double cone members expressed RH2A
b
(17% - 24%; fig 6e). Two specimens
coexpressed LWS and RH2A
b
in the dorsal part of the retina and one of these also coexpressed
RH2B and LWS (fig 6e).
Retinas of A. astorquii differed in many aspects from those in A. citrinellus, and overall were
more variable (fig. 6j). Contrary to A. citrinellus, in A. astorquii most double cones had one member
expressing LWS and the second member expressing RH2A
b
(fig. 6f-j). Also, across all individuals
and retinal regions there was an average of 6% of cones coexpressing LWS and RH2A
b
(in some
cases representing up to 20% of the cones). Three specimens (all of them females) expressed
RH2B, either by itself or in combination with RH2A
b
or LWS (fig. 6f and j), which could explain
some of the variation seem in the blue-green spectral class (fig. 2).
SOURCES OF A1/A2-DERIVED CHROMOPHORE VARIATION IN MIDAS CICHLIDS
The enzyme Cyp27c1 mediates the conversion of vitamin A1 into vitamin A2 in the retinal pigment
epithelium and the level of vitamin A2 is strongly correlated with the expression of cyp27c1
(Enright et al. 2015). cyp27c1 expression in retinas of Midas cichlids is in agreement with the A2
proportions estimated in the MSP experiment. Those species showing higher levels of A2-derived
chromophore usage (fig. 3a) also had higher levels of cyp27c1 expression (fig. 3b; supplementary
fig. S5a, Supplementary Material online). In addition to significant differences in cyp27c1
expression level (Kruskal-Wallis c2 = 17.513, df = 4, P = 0.002), Midas cichlid species also differed
in their variance in expression (Bartlett's k2 = 11.337, df = 4, P = 0.023), with Midas cichlids from
the turbid great lake being significantly more variable than all other analyzed species (fig. 3b).
Bonferroni corrected pairwise comparisons suggested that cyp27c1 expression in the limnetic
species from both crater lakes was significantly lower than those seen in Midas cichlids from the
great lake (supplementary table S2, Supplementary Material online). All other pairwise
!
11!
comparisons were not significant after Bonferroni correction. Similar results in laboratory-reared
specimens suggest a genetic basis for the observed pattern of variation (supplementary fig. S5b,
Supplementary Material online). When comparing cyp27c1 coding sequence among species
showing high (i.e. A. citrinellus from great lake Nicaragua) and low (i.e., A. sagittae from crater lake
Xiloá and A. astorquii from crater lake Apoyo) levels of expression of this gene, we found almost
no variation. The exception was A. astorquii, in which two alleles (V540 and E540) were found.
Discussion
Our results suggest rapid and parallel adaptive evolution of Midas cichlid vision in response to the
colonization of a new light environment that occurred by taking advantage of different molecular
mechanisms (fig. 7). Midas cichlids have colonized crater lakes Apoyo and Xiloá from the great
lakes Nicaragua and Managua, respectively, less than 2000 generations ago (Kautt et al. 2016a).
This event resulted in Midas cichlids experiencing a novel light environment in the crater lakes.
The most important differences found between the ancestral and derived environments are that in
the crater lakes light attenuation is lower, the light spectrum is broader and the overall visual
environment is shifted toward shorter wavelengths compared to the great lake (fig. 1). Given the
differences in the visual environments occupied by Midas cichlid species, we predicted phenotypic
divergence in visual sensitivity between fish from the great lakes and the crater lakes. We found
Midas cichlids to have a highly diverse visual system, both within and across species, with
particularly high levels of intraspecific variation in turbid great lake Midas cichlids. Importantly,
Midas cichlids from both crater lakes were found to have an overall shift in their visual sensitivities
toward shorter wavelengths when compared to the source populations from the great lakes in
agreement to the change observed in the photic environment (supplementary fig. S6,
Supplementary Material online). This shift could not be explained by a single mechanism, but
involved an integrated change that includes changes in lens transmittance, differential opsin gene
expression, opsin coexpression, and the use of various A1/A2 chromophore mixes. Because most
of the observed differences between species are maintained in laboratory-reared specimens
(supplementary figs. S1, S4 and S5, Supplementary Material online), these traits appear to have a
heritable basis.
THE VISUAL SYSTEM OF MIDAS CICHLIDS FROM THE GREAT LAKES
Midas cichlids from the turbid great lake Nicaragua (Amphilophus citrinellus) have lenses blocking
UV and partially violet light. Additionally, the MSP experiment showed that Midas cichlids from this
great lake have peaks of maximum sensitivity in the blue, the green and the red parts of the light
spectrum (fig. 2) that correspond with the observed expression of SWS2a, RH2A and LWS seen in
fish from the great lake Managua (fig. 5). Interestingly, the retinas of fish from the turbid lake
Nicaragua are dominated by double cones expressing LWS in both members (fig. 6). This
dominance of the long sensitive cones might be an adaptation to the dim-light conditions
experienced in the turbid great lake (fig. 1), as the long sensitive cones could be used for
!
12!
achromatic vision (Chiao et al. 2000; Cronin et al. 2014). The low genetic differentiation between
Midas cichlids from the two great lakes (Fst = 0.05; Kautt et al. 2016a) and the congruence of the
measures taken from specimens of both lakes (i.e., opsin expression and opsin sequences from
Lake Managua; and MSP, opsin expression, coexpression, opsin sequence and lens transmittance
from Lake Nicaragua) suggest that these two populations share a common phenotype.
The lens transmittance and photopigment sensitivities of Midas cichlids from the great lake
Nicaragua are in agreement with what is known for Neotropical cichlids. So far, there have been
few attempts to characterize lens transmittance and visual sensitivities in Neotropical cichlids (e.g.,
Muntz 1973; Loew and Lythgoe 1978; Levine and MacNichol 1979; Kröger et al. 1999; Weadick et
al. 2012, Escobar-Camacho et al. 2017). Yet, a clear picture emerges suggesting that in the
neotropics, cichlids tend to have lenses blocking UV and partially violet light, and blue sensitive
single cones, green and red sensitive double cones representing a long wavelength sensitive
palette of opsins (sensu Carleton et al. 2016). Thus, Midas cichlids from the great lakes have a
visual system similar to that seen in South American cichlids, but given the age of these lakes (i.e.,
Early Pleistocene; Kutterolf et al. 2007) this species likely had enough evolutionary time to fine
tune its visual system to the particular light conditions of the lakes. However, Midas cichlids depart
from the general pattern in two interesting ways: by showing a large degree of intraspecific
variation in visual sensitivity and by having at least four functionally visual pigments in cone cells.
INTRASPECIFIC VARIATION IN VISUAL SENSITIVITY IN MIDAS CICHLID FROM THE TURBID GREAT LAKES
Freshwater animals inhabiting turbid environments can adaptively shift their visual sensitivities
toward longer wavelengths without changing the opsin protein by using chromophores derived
from vitamin A2 rather than from vitamin A1 in their photopigments (Wald 1961; Hárosi 1994;
Cronin et al. 2014). Midas cichlids from the turbid great lakes use this mechanism to adjust their
visual sensitivity, although there was a great degree of variation among specimens (see fig. 3a). A
similar pattern was previously reported by Levine and MacNichol (1979), who analyzed ten Midas
cichlid individuals finding two discrete groups, one with mean lmax at 454, 532, and 562 nm and the
second at 463, 543, and 607 nm (for the single cones and the two members of double cones,
respectively). Although the origin of fish used by Levine and MacNichol (1979) is unclear, we
confirmed this variation among individuals from great lake Nicaragua (fig. 2). Since a similar
variation in the blue Acara (Aequidens pulcher) was found (Kröger et al. 1999), it suggests that this
high variability in A1/A2 might be a common pattern in Neotropical cichlids.
It has been recently shown that the enzyme Cyp27c1 is responsible for the conversion of
vitamin A1 into vitamin A2 in the retinal pigment epithelium (Enright et al. 2015). In zebrafish
(Danio rerio) the ratio of A1- to A2-derived chromophore covaries with the expression level of
cyp27c1 and knocking down this gene result in an inability of individuals to shift sensitivities toward
longer wavelengths by means of differential chromophore usage (Enright et al. 2015). Midas
cichlids from the turbid great lake show high intraspecific variation in the expression levels of
!
13!
cyp27c1 (fig. 3b), providing a likely molecular mechanism for the observed variation in A1/A2
chromophore usage.
Coding sequence variation could also explain some of the intraspecific variation seen in
turbid great lake Midas cichlid visual sensitivity. A164S in LWS was the only variable site directed
into the retinal binding pocket identified in this study (table 1). These allelic variants of LWS have
been found in several other organisms (e.g. Terai et al. 2006; Hofmann et al. 2009; Sandkam et al.
2015) and also as divergence among LWS paralogs (e.g. Asenjo et al. 1994; Ward et al. 2008;
Phillips et al. 2016). The replacement of alanine with serine at this site is known to result in λmax
shift towards longer wavelengths (+ 7nm; Asenjo et al. 1994). Measurements of absorption spectra
on reconstituted LWS proteins of African cichlids showed that this substitution produced the
expected λmax shifts only if combined with an A2-derived chromophore (Terai et al. 2006).
Interestingly, the 164A-164S allelic variants solely occur in the great lakes, where fish varied in
chromophore usage. The combination of 164S and A2-derived retinal in red-sensitive pigments is
proposed to be an adaptation to visual environments with a red-shifted light spectrum (Terai et al.
2006), as those experienced by fish in the great lakes. Yet, 164S is not fixed in Lake Nicaragua but
it is segregating in the population. It is possible that photic environment variation across the lake
favors the maintenance of the polymorphism (e.g., Terai et al. 2006).
FOUR FUNCTIONAL PHOTOPIGMENTS IN MIDAS CICHLID CONE CELLS
Functional analyses with MSP suggested that Midas cichlids have four different photopigments in
their cone cells. Most examined individuals had double cones corresponding to three different
spectral classes (a red, a long green, and a short green; fig. 2), that, in combination with the
spectral class of single cones confer them the potential for tetrachromatic color vision.
Remarkably, the fourth spectral class identified in Midas cichlid retinas appears to be the result of
the coexpression of RH2A
b
and LWS on the same double cone member, rather than the
expression of a different opsin gene. Combining the MSP, qPCR and FISH experiments, we
inferred that the red spectral class with λmax from 560 to 623 nm corresponds to photoreceptors
using LWS as the protein component of their visual pigments, and the short-green spectral class
ranging from 517 to 539 nm corresponds to photoreceptors using RH2Ab. The observed range of
sensitivities within these two spectral groups is explained by variations in A1 to A2 chromophore
proportions in visual pigments having predicted pure-A1 sensitivities at ~560 and ~510 nm,
respectively. Yet, there are several double cone members with λmax values between these two
groups that could not be assigned to either spectral class by just adjusting A1/A2 proportions.
These cones have to be classified into a new spectral class, the long-green, and FISH staining
suggests that this spectral class is the product of RH2A
b
and LWS coexpression in double cone
cells.
That the long-green spectral class is the product of coexpression begs the question, why
Midas cichlids do not use RH2A
a
based visual pigments as African cichlids do? This is intriguing
!
14!
given that the predicted protein coded by RH2A
a
appears be functional. Although speculative, it is
possible that gene conversion between RH2A paralogs (Escobar-Camacho et al. 2017) plays a
role, either because both paralogs are functionally very similar or because the regulatory
machinery has been affected by gene conversion. In addition, visual sensitivity curves deriving
from coexpression will be significantly different (wider) compared to their pure RH2A
a
counterpart,
effectively changing the sensitivity bandwidth of this color channel and, by varying coexpression
proportions, maintaining a flexible mechanism for spectral tuning. The function of coexpression in
Midas cichlids is unclear, but it may be related to increased contrast detection (Dalton et al. 2017).
Departures from trichromacy have been previously proposed for African cichlids based on
measurements of maximum sensitivity by MSP (e.g., Parry et al. 2005; Dalton et al. 2014) or
electroretinography (e.g., Sabbah et al. 2010), and by determining gene expression using qPCR
(e.g., Hofmann et al. 2009) and in situ hybridization (e.g., Dalton et al. 2014). Recently, Dalton et
al. (2017) showed that in the African cichlid Metriaclima zebra extensive regions of the retina could
have very high levels of coexpression, with an incidence of more than 90%. This would imply that
cones expressing only one opsin got almost completely replaced by cones showing coexpression.
Midas cichlids differ from this in that cones coexpressing two opsin are distributed in low number
across the retina, not replacing cones with only one opsin expressed, but coexisting with those.
Thus, this extensive coexpression pattern appears to be novel to Midas cichlids. It is not clear if
this is common in other Neotropical cichlids. It would be interesting to explore this issue in the
neotropical pike cichlid (C. frenata) given that it was reported to have a very long-shifted green
sensitive double cone member (~547 nm; Weadick et al. 2012).
ADAPTIVE CHANGES IN THE VISUAL SENSITIVITY OF CRATER LAKES MIDAS CICHLIDS
Midas cichlids from the crater lakes have a visual system that departs in several aspects from that
seen in fish from the great lakes, resulting in an overall shift in sensitivity toward shorter
wavelengths (fig. 7). The mechanisms underlying this shift include more transmissive ocular
media, and changes in the chromophore and the protein component of visual pigments. Although
this was apparent in species from both crater lakes, the biggest differences were observed in the
species from crater lake Apoyo. This was expected given that this crater lake is the oldest (Elmer
et al. 2010), had been occupied by Midas cichlids the longest (Kautt et al. 2016a), and it differs the
most in terms of photic environment from the great lakes (fig.1).
OCULAR MEDIA TRANSMITTANCE IN MIDAS CICHLIDS FROM THE CRATER LAKES
Eye lenses have become clearer in the crater lakes showing no overlap with the transmitting
values seen in fish from the great lakes. This includes two extreme cases of UV-transmitting
lenses in A. zaliosus, the limnetic species from crater lake Apoyo (fig. 4). Vertebrate lenses are
formed by concentric layers of translucent proteins called crystallins, belonging to three large
!
15!
protein families (Fernald 2006). Crystallin proteins differ in their refractive indexes, so changes in
crystallin usage across populations or developmental stages can result in variation in lens
transmittance (Sabbah et al. 2012; Wages et al. 2013; Mahendiran et al. 2014). Additionally,
Neotropical cichlids tend to deposit pigments in their lenses that work as filters for short-
wavelength light (Muntz 1973). Whereas having UV- and violet-blocking lenses might help reduce
the loss of contrast detection due to the scattering of short-wavelength light; bearing clearer lenses
in blue-shifted light environments could be adaptive, since it would allow fish to better utilize the
whole available light spectrum (Muntz 1982). This is supported by a positive correlation between
lens transmission and single cones sensitivity in African cichlids (Hofmann et al. 2010). Thus,
more short-wavelength transmitting lenses might be an adaptation to the light environment of clear
water crater lakes. Given that these differences are observed in laboratory-born specimens reared
under common conditions, we suggest that the use of different crystallin proteins or the deposition
of pigments in lenses resulting in the observed cut-offs does not strictly depend on diet or light
conditions, but also has a genetic component.
CONE OPSIN EXPRESSION IN MIDAS CICHLIDS FROM THE CRATER LAKES
There is evidence for genetically based differential opsin gene expression between Midas cichlids
from the ancestral population of the great lakes and the derived populations from crater lakes that
appears to be adaptive to the visual environment they experience (see fig. 1 and 5; supplementary
fig. S6, Supplementary Material online). Moreover, this variation in opsin expression is consistent
with the phenotypic variation determined by MSP (see fig. 2 and fig. 5). One way in which crater
lake Midas cichlids differ from great lake fish is in the proportional expression of different opsin.
Whereas LWS represents > 60% of the total expression in fish from the great lakes, it is
consistently below 50% in the crater lakes. The opposite pattern is seen when comparing the
expression of RH2A
b
. In Midas cichlids, this differential expression is translated into a higher
proportion of green sensitive cones (both, RH2Ab-based and LWS-RH2Ab coexpression-based
cones; fig. 6). It is apparent that one of the mechanisms used by Midas cichlids to improve vision in
the shorter wavelength shifted light environment of the crater lakes is to increase the number of
green-sensitive cones at the cost of fewer red-sensitive ones. Similar patterns of change in the
proportional expression of cone opsins have been found in other cichlids suggesting it as a
common mechanism of visual tuning (e.g., Carleton and Kocher 2001).
Also, Midas cichlids from the clear crater lakes have expanded their sensitivities toward the
shorter part of the spectrum. Violet sensitive single cones have not been reported before for
Neotropical cichlids, although they are commonly seen in African cichlids and correspond to a
change from SWS2a to SWS2b as the protein component of photopigments (Carleton and Kocher
2001; Hofmann et al. 2009; O’Quin et al. 2010). Midas cichlids from the great lakes express
exclusively SWS2a, RH2A
b
, and LWS. In the crater lakes, more distinctly in crater lake Apoyo
some specimens expressed the violet sensitive SWS2b instead of SWS2a in single cones, and
!
16!
expressed the green-blue sensitive RH2B in combination with other double cone opsins (fig. 6).
The expression of SWS2b and RH2B was coupled at the individual level (supplementary fig. S3,
Supplementary Material online), suggesting a general change in the pattern of expression.
To summarize, differential opsin expression is an important molecular mechanism in
adaptive phenotypic divergence of Midas cichlids visual system. By changing the relative
proportion of the different opsins expressed and by expressing other opsins (e.g., SWS2b and
RH2B), crater lake Midas cichlids have diverged from the ancestral population in the great lake in
the direction predicted based on the light environment differences (supplementary fig. S6,
Supplementary Material online).
CHROMOPHORE USAGE IN MIDAS CICHLIDS FROM THE CRATER LAKES
In the spectral classes common to Midas cichlids from the great lakes and the crater lakes, we
observed divergence in mean lmax and the associated variance (fig. 2). This is most evidently in
red-sensitive receptors where lmax estimates were limited to the yellow in fish from the crater lakes,
but expanding into the red part of the spectrum in the great lake specimens. In other spectral
classes the differences are subtler, but there is still a clear trend for crater lake Midas cichlids to
have lmax shifted toward shorter wavelengths. This shift could be the result of structural changes in
the opsin protein (Yokoyama et al. 2008) or due to differential chromophore usage (Wald 1961;
rosi 1994). Given that only one amino acid substitution was identified in sites directed into the
binding pocket across all Midas cichlid opsins (see table 1), different usage of A1- and A2-derived
chromophores is the most plausible mechanism behind the observed variation in photoreceptor
sensitivity. This conclusion is supported by the significant decrease in A2-derived chromophore
usage seen in clear crater lake Midas cichlids compared to fish from the turbid great lakes. The
down-regulation of cyp27c1 expression in Midas cichlids from the crater lakes is the most likely
mechanism underlying the changes in chromophore usage (Enright et al. 2015; supplementary fig.
S5a, Supplementary Material online). Moreover, this variation is interpreted to have a genetic basis
given that the differences in cyp27c1 expression between species were maintained under
laboratory conditions (supplementary fig. S5b, Supplementary Material online).
An interesting exception to this general pattern was the benthic species from crater lake
Xiloá (A. xiloaensis) that showed high proportions of vitamin A2-derived chromophore usage and
high levels of cyp27c1 expression similar to the ancestral phenotype seen in great lake Midas
cichlids. This could be adaptive in Xiloá, as this lake departs less in the photic condition from great
lake Managua than crater lake Apoyo does. However, the down-regulation of LWS in A. xiloaensis
strongly departs from the ancestral phenotype. Thus, this species might be using a different
strategy to tune sensitivity to the new environment, but further studies are necessary to clarify this
issue. Nonetheless, we did not observe this in laboratory-reared individuals of A. xiloaensis,
suggesting that this phenotype might be plastic (supplementary fig. S4 and S5, Supplementary
!
17!
Material online). This highlights the multitude of mechanism that this extremely closely related set
of species is capable of using during repeated adaptation to the crater lake environments.
MECHANISMS OF ADAPTATION TO DIVERGENT VISUAL ENVIRONMENTS IN MIDAS CICHLIDS
There is much debate about the relative importance of changes in coding sequence and of gene
expression as the molecular mechanisms underlying phenotypic diversification (Hoekstra and
Coyne 2007; Carroll 2008; Stern and Orgogozo 2008; Elmer and Meyer 2011; Rosemblum et al.
2014). Evidence supporting the importance of amino acid substitutions for phenotypic evolution
has steadily accumulated for many decades, establishing it as an important mechanism of
diversification (Hoekstra and Coyne 2007; Stern and Orgogozo 2008). On the other hand, the
importance of regulatory processes for phenotypic divergence has become strongly supported
more recently, as new molecular techniques resulted in the accumulation of new evidence (Wray
2007; Carroll 2008; Stern and Orgogozo 2008; Kratochwil and Meyer 2015). Changes in
expression of cone opsins and cyp27c1, the gene responsible for changes in chromophore usage,
seem to contribute the most to the observed variation in visual sensitivity. In contrast, structural
changes might play only a limited role in vision tuning of Midas cichlids. Surely, amino acid
substitutions are not unimportant for the phenotypic evolution of vision, as there is compelling
evidence for its role in divergence in sensitivity, both, among paralogs (e.g., Yokoyama 2000) and
among homologs when comparing different populations or species (e.g. Terai et al. 2002, 2006;
Sugawara et al. 2005; Migayi et al. 2012; Torres-Dowdall et al. 2015). Yet, in Midas cichlids
structural changes might become more relevant in later stages of diversification as genetic
variation in coding sequence would be expected to take time to appear by de novo mutations in
young and initially small populations.
We presented evidence that the visual system of Midas cichlids has rapidly and adaptively
evolved since the colonization of crater lakes, a few thousand generations ago (Kautt et al. 2016a;
fig. 7). The observed changes in visual sensitivity are the result of a combination of different
mechanisms including changes in the ocular media and in both, the opsin protein and the light
absorbing chromophore components of photopigments. Previous research has shown that all
these mechanisms can independently tune visual sensitivity in African cichlids (reviewed in
Carleton 2009; Carleton et al. 2016). Here, we showed that all these underlying mechanisms
respond extremely rapidly and in an integrated way to adapt these fishes to changed light
conditions that their ancestors experienced due to the colonization of the clear water crater lakes.
Despite the divergence in visual sensitivity of crater lake Midas cichlids compared to the great lake
ancestral populations, we did not find striking differences in sensitivity within the small radiations in
each crater lake. Yet, in the limnetic species from Apoyo we observed a trend to have sensitivities
shifted toward shorter wavelengths compared to the benthic species that suggests that differences
might be accumulating.
!
18!
The Midas cichlid species complex is only one of the many fish species that colonized
Nicaraguan crater lakes from the source populations in the great lakes Managua and Nicaragua
(Elmer et al. 2010; Kautt et al. 2016a). Yet, it is clearly the most abundant species in these lakes
(Dittmann et al. 2012) and the only lineage that has radiated in the crater lakes, resulting in a
species complex composed of at least 13 species (Barluenga et al. 2006, 2010; Elmer et al. 2010;
Recknagel et al. 2013; Kautt et al. 2016a). The reasons why this species has become dominant in
terms of biomass and has diversified but other species that colonized the crater lakes have not,
remain largely unclear (Franchini et al. 2017). Uncovering the molecular mechanisms contributing
to the adaptation of Midas cichlids to the novel conditions experienced in the crater lakes, such as
a short-wavelength shifted light environment, is fundamental to progress in our understanding of
this system.
Material and Methods
UNDERWATER LIGHT MEASUREMENTS
Underwater light measurements were taken at one site in Lake Managua, 4 sites in Lake Xiloá,
and 7 sites in Lake Apoyo, characterized by different bottom structure (rocky outcrops, boulders
covered in algal material, Chara beds, sandy bottoms). Underwater spectral irradiance was
measured with an Ocean Optics USB2000 connected to a 15m UV-VIS optical fiber fitted with a
cosine corrector, just under the surface and at 2m depth, orienting the probe upwards (for
downwelling light) and towards four orthogonal directions horizontally (sidewelling light). The four
horizontal measurements were averaged to derive a single measurement of side-welling light at
depth. Downwelling irradiance is presented in the main text; sidewelling irradiance is presented in
supplementary fig. S7 (Supplementary Material online). We calculated the total quantal flux for
each irradiance integrating each spectral measurement in the range (350-700nm) relevant to
cichlid vision. Following McFarland and Munz (1975), we derived λP50, i.e. the wavelength that
halves the total number of photons in the selected range of visible spectrum and that identifies the
spectral region with the highest abundance of quanta.
RETINAL MICROSPECTROPHOTOMETRY MEASUREMENTS
We conducted microspectrophotometry (MSP) in wild-caught Midas cichlids from great lake
Nicaragua (n = 5), crater lake Apoyo (n = 10), and crater lake Xiloá (n = 12; species identities,
number of rods and cones analyzed per species, mean peak of maximum absorption, and A1%
are noted in supplementary table S1; Supplementary Material online) and in laboratory reared
Midas cichlids from great lake Nicaragua (n = 2), crater lake Apoyo (n = 4), and crater lake Xiloá (n
= 8). Analyses followed standard methods (Loew 1994; Losey et al. 2003; Fuller et al. 2003).
Before conducting MSP, fish were maintained under dark conditions for a minimum of four hours
and then euthanized with an overdose of MS-222 followed by cervical dislocation. The eyes were
!
19!
rapidly enucleated under dim red light, and the retinas removed and maintained in phosphate-
buffered saline (pH 7.2) with 6% sucrose. Small pieces of the retina were placed on a cover slide,
fragmented to isolate individual photoreceptors, and sealed with a second cover slide and Corning
High Vacuum grease. We used a single-beam, computer-controlled MSP, with a 100-W quartz
iodine lamp that allowed for accurate absorption measurements down to 340 nm (Loew 1994;
Losey et al. 2003). Peak of maximum absorption max) of photoreceptors was obtained by fitting
A1- or A2 templates to the smoothed, normalized absorbance spectra (Lipetz and Cronin 1988;
Govardovskji et al. 2000). We used the criteria for data inclusion into the analysis of λmax described
in Loew (1994) and Losey et al. (2003).
We conducted statistical comparisons at two levels. First, to test for the effect of
colonization of clear water crater lakes on the visual system of Midas cichlids, we considered lake
of origin as explanatory variable, ignoring species or ecomorphs within crater lakes. Second, to
test for the effect of microhabitat (i.e. limnetic versus benthic) we only used data from the crater
lakes, where both ecomorphs are found, and included lake of origin and ecomorph as explanatory
variables in the statistical model. In both cases, we first conducted a Bartlett’s k2 test of
homoscedasticity within each spectral class to determine if there were differences in variance
among groups. This was interpreted as a test for variation in A1- to A2-derived chromophore
usage as we found little structural variation in opsin proteins that could explain variation within
spectral class (see Results: Coding Sequence Variation of Midas Cichlid Opsin Genes above). If
the Bartlett’s k2 test did not reject homoscedasticity, we conducted a linear mixed model using λmax
values for individual photoreceptors within each spectral class as response variable, lake of origin
as explanatory variable, and specimen as a random variable. When testing for the effect of
microhabitat, ecomorph and its interaction with lake of origin were also included as explanatory
variables. If the Bartlett’s k2 test suggested heteroscedasticity, we used a non-parametric Kruskal-
Wallis test. All analyses were conducted in R (R Core Team 2014). Significant results are reported
in the main text, non-significant tests are reported in supplemental table S3 (Supplemental Material
online)
OCULAR MEDIA TRANSMISSION
We measured ocular media transmission in laboratory-reared individuals of A. citrinellus from great
lake Nicaragua (n = 10), the limnetic A. zaliosus (n = 6) and the benthic A. astorquii (n = 3) from
crater lake Apoyo, and the limnetic A. sagittae (n = 7) and the benthic A. amarillo (n = 9) from
crater lake Xiloá. All fish were euthanized using an overdose of MS-222 and subsequent cervical
dislocation. The eyes were enucleated, carefully hemisected, and the corneas and lenses were
placed on a black paper with a small hole. A pulsed xenon lamp (PX-2, Ocean Optics) was
directed through the hole and transmission was measured with an USB2000+UV-VIS-ES
spectrometer (Ocean Optics). For each specimen, three measures of transmission were obtained
from each of the two eye ocular media. As previously reported for cichlids (Hofmann et al. 2010;
!
20!
O’Quin et al. 2010), we found that the lenses are the limiting ocular media, so we subsequently
measured only lens transmission. We calculated lens transmission (T50) following Hofmann et al.
(2010), measuring the wavelength of maximum slope (i.e., inflection point in the sigmoid curve)
within the range of 300 to 700 nm. This method was shown to be less sensitive to departures from
perfect sigmoid shape than methods that determine T50 as the halfway point between the
minimum transmission and that of maximum transmission, and both are highly correlated
(Hofmann et al. 2010). Using this last method did not produce a qualitative difference in our
results.
OPSIN CODING REGIONS AMPLIFICATION AND SEQUENCING
Genomic DNA was isolated using standard phenolchloroform extractions from a total of 64
specimens of Midas cichlids, including representatives of two species from each of the great lakes
Managua and Nicaragua, and two species from each of the crater lakes Apoyo and Xiloá (table 1).
Genomic sequences of all opsin genes were obtained by polymerase chain reaction (PCR) using
standard protocols. Primers were designed in PRIMER 3 (Rozen and Skaletsky 2000) using the A.
citrinellus draft genome as a template (Elmer et al. 2014; primer list and PCR conditions in
supplementary table S4; Supplementary Material online). Samples were sequenced bi-directionally
and using internal primers on a 3130xl Genetic Analyzer. Sequence editing and assembly was
performed using SeqMan II (DNAstar).
ANALYSES OF OPSIN AND CYP27C1 GENE EXPRESSION
We measured cone opsin and cyp27c1 expression in wild-caught (WC) and laboratory-reared (LR)
individuals of A. citrinellus (nWC = 6 from Lake Managua; nLR = 8 from Lake Nicaragua), the limnetic
A. zaliosus (nWC = 6; nLR = 4) and the benthic A. astorquii (nWC = 6; nLR = 4) from crater lake Apoyo,
and the limnetic A. sagittae (nWC = 4; nLR = 4) and the benthic A. xiloaensis (nWC = 4; nLR = 4) from
crater lake Xiloá. All fish were sacrificed using an overdose of MS-222 and subsequent cervical
dislocation. The eyes were rapidly enucleated and the retinas removed and stored in RNAlater
(Sigma-Aldrich, USA) until RNA extraction. RNA was extracted using a commercial kit (RNeasy
Mini Kit, Qiagen) and RNA concentrations were measured using the Colibri Microvolume
Spectrometer, (Titertek Berthold, Germany). Total RNA was reverse transcribed with the first-
strand cDNA synthesis kit (GoScriptTM Reverse Transcription System, Promega, Madison,
Wisconsin).
Gene expression levels were quantified using Quantitative Real-Time PCR (qPCR). Real-
Time reactions were run in a CFX96TM Real-Time System (Bio-Rad Laboratories, Hercules,
California) using specifically designed primers (supplementary table S4; Supplementary Material
online). Amplification efficiencies were determined for each primer pair. Standard PCR and Sanger
sequencing of PCR products were performed for each opsin gene to check for specificity of
amplification. Expression levels of genes were quantified with three technical replicates and mean
Ct values were used for further analyses. Quantitative Real-Time PCR was performed under
!
21!
standard conditions following the manufacturer’s protocol (GoTaq qPCR Master Mix, Promega,
Madison, Wisconsin). Proportional opsin expression was determined for each specimen by
calculating the proportion of each opsin (Ti) relative to the total opsin expression (Tall) after Fuller et
al. (2004) using the following equation:
!"
!#$$
%&' &&' ( )"*+,-**
&' &&' ( )"*+,-**
Ei represents the primer efficiency for primer i and Cti is the critical cycle number for gene i (the
proportional expression values of the seven cone opsins add up to 1 for each specimen). cyp27c1
expression was normalized using the geometric mean of two selected housekeeping genes (ldh2
and imp2) using the following equation:
./"% 0 )"
&+,1234+,-*
Non-parametric Multi-Response Permutation Procedures (MRPP) tests (Mielke et al. 1981)
were used to compare cone opsin expression among species and between wild-caught and
laboratory-reared specimens. Pairwise comparisons between wild-caught and laboratory-reared
specimens within each species were also conducted and significant differences were found only
for the benthic species of crater lake Xiloá (A. xiloaensis; supplementary table S5; Supplementary
Material online). Kruskal Wallis tests were used to compare expression of cyp27c1 among species
and between wild-caught and laboratory-reared specimens. As with opsin gene expression, using
pairwise comparisons we only found differences in cyp27c1 due to rearing condition for A.
xiloaensis (supplementary table S2; Supplementary Material online).
ANALYSES OF OPSIN GENE COEXPRESSION
We performed triple FISH (fluorescent in situ hybridization) in five laboratory reared individuals per
species of a Midas cichlid from a turbid great lake (A. citrinellus) and one from a clear crater lake
(A. astorquii). All samples were probed for all three cone opsin genes. Probes for RH2B, RH2A
and LWS were cloned into the pGEMT or pGEMTE vector systems (Promega #A3600 and
#A3610) using primers: RH2B-FW ATGGCATGGGATGGAGGACTTG; RH2B-RV
GAAACAGAGGAGACTTCTGTC; RH2A-FW TGGGTTGGGAAGGAGGAATTG; RH2A-RV
ACAGAGGACACCTCTGTCTTG; LWS-FW ATGGCAGAAGAGTGGGGAAA; LWS-RV
TGCAGGAGCCACAGAGGAGAC.
The fluorescent in situ hybridization was performed as described (Woltering et al. 2009)
with modifications enabling triple fluorescent instead of single colorimetric detection. Briefly, eyes
were rapidly enucleated and retinas fixed in 4% PFA in PBS overnight and stored in methanol at -
20 °C until further use. Duration of tissue bleaching in 1.5% H2O2 in methanol and Proteinase K
treatment were decreased to three minutes each. Probes with three different detection labels were
synthesized using DIG-labeling mix (Roche #11277073910), Fluorescein labeling mix (Roche
#116855619910), custom made DNP labeling mix 10x [DNP-11-UTP (Perkin Elmer
#NEL555001EA) 3.5mM combined with UTP 6.5mM, CTP 10mM, GTP 10mmM, ATP 10mM
(ThermoFischer #R0481)]. Antibody incubation was performed overnight at 4°C using anti-
!
22!
Fluorescein-POD (Roche #11426346910), anti-DIG-POD (Roche #11207733910) and anti-DNP-
HRP (Perkin Elmer #FP1129). To amplify fluorescent signal, we used tyramide signal amplification
(TSA) for each of the different labels; TSA plus-Fluorescein (Perkin Elmer #NEL753001KT), TSA
plus-Cyanine 3 (Perkin Elmer #NEL753001KT), and TSA plus-Cyanine 5 (Perkin Elmer
#NEL745001KT). Antibody incubation and corresponding signal amplification were performed
sequentially. Prior to incubation with the next antibody, POD activity of the previous one was
deactivated in 100 mM glycine solution (pH 2.0) for 15 minutes followed by 15 washes for 10
minutes each in TBS-T and once overnight. Before mounting, retinas were cleared in 70 % glycerol
overnight at 4 °C.
Expression levels were quantified in four quadrants of the retina divided as dorsal-nasal,
dorsal-temporal, ventral-nasal and ventral-temporal. Per retinal region, five sampling areas were
randomly chosen and in each all the cones in a frame of 55 x 55 µm were examined for RH2B,
RH2A and LWS expression and for coexpression genes within one member of a double cone. This
assured that more than 200 double cone members were characterized in each region for each fish.
Acknowledgments
We are thankful to the members of the Meyer lab, particularly Sina Rometsch for helping with
samples, Ralf Schneider for helping with ocular media analyses, and Gonzalo Machado-Schiaffino
and Andreas Kautt for fruitful discussions. We especially thank Ellis Loew for allowing us to use his
microspectrophotometer and for advice on data analysis. We appreciate the assistance of Kenneth
McKaye during the collection of specimens for microspectrophotometry. MARENA granted permits
for fieldwork and collections (DGPN/DB-IC-004-2013). Laboratory reared fish were euthanized
under University of Konstanz permit (T13/13TFA). This work was supported by the European
Research Council through ERC-advanced (grant number 293700-GenAdap to A.M), the Deutsche
Forschungsgemeinschaft (grant number 914/2-1 to J.T.D.), the EU FP7 Marie Curie Zukunftskolleg
Incoming Fellowship Programme, University of Konstanz (grant number 291784 to J.T.D.), and the
Young Scholar Fund of the University of Konstanz (grant number FP 794/15 to J.T.D.).
!
23!
References
Asenjo AB, Rim J, Oprian DD. 1994. Molecular determinants of human red/green color
discrimination. Neuron. 12:1131-1138.
Barluenga M, Meyer A. 2010. Phylogeography, colonization and population history of the Midas
cichlid species complex (Amphilophus spp.) in the Nicaraguan crater lakes. BMC Evol Biol.
10:326.
Barluenga M, Stolting KN, Salzburger W, Muschick M, Meyer A. 2006. Sympatric speciation in
Nicaraguan crater lake cichlid fish. Nature 439:719-723.
Bowmaker JK. 1995. The visual pigments of fish. Prog Retin Eye Res. 15:1-31.
Brawand D, Wagner CE, Yang IL, Malinsky M, Keller I, Fan S, Simakov O, Ng AY, Lim ZW,
Bezault E, et al. 2014. The genomic substrate for adaptive radiation in African cichlid fish.
Nature 513:375-381.
Carleton KL. 2009. Cichlid fish visual systems: mechanisms of spectral tuning. Integr Zool. 4:75-
86.
Carleton KL. 2014. Visual photopigment evolution in speciation. In: Hunt DM, Hankins MW, Collin
SP, Marshall NJ, editors. Evolution of visual and non-visual pigments. New York (NY):
Springer. p. 241-267.
Carleton KL, Dalton BE, Escobar-Camacho D, Nandamuri SP. 2016. Proximate and ultimate
causes of variable visual sensitivities: insights from cichlid fish radiations. Genesis 54:299-
325.
Carleton KL, Kocher TD. 2001. Cone opsin genes of African cichlid fishes: tuning spectral
sensitivity by differential gene expression. Mol Biol Evol. 18:1540-1550.
Carleton KL, Parry JWL, Bowmaker JK, Hunt DM, Seehausen O. 2005a. Colour vision and
speciation in Lake Victoria cichlids of the genus Pundamilia. Mol Ecol. 14:4341-4353.
Carleton KL, Spady TC, Streelman JT, Kidd MR, McFarland WN, Loew ER. 2008. Visual
sensitivities tuned by heterochronic shifts in opsin gene expression. BMC Biol. 6:22.
Carroll SB. 2008. Evo-devo and an expanding evolutionary synthesis: a genetic theory of
morphological evolution. Cell 134:2536
Chang BSW, Crandall KA, Carulli JP, Hartl DL. 1995. Opsin phylogeny and evolution: A model for
blue shifts in wavelength regulation. Mol Phylogenet Evol. 4:31-43.
Chiao CC, Vorobyev M, Cronin TW, Osorio D. 2000. Spectral tuning of dichromats to natural
scenes. Vision Res. 40:3257-3271.
Chinen A, Hamaoka T, Yamada Y, Kawamura S. 2003. Gene duplication and spectral
diversification of cone visual pigments of zebrafish. Genetics 163:663-675.
Cole GA. 1976. Limnology of the Great Lakes of Nicaragua. In: Thorson TB, editor. Investigations
of the ichthyology of Nicaraguan lakes. Lincoln (NE): University of Nebraska Press. p. 9-15.
Cronin TW, Johnsen S, Marshall NJ, Warrant EJ. 2014. Visual Ecology. Princeton (NJ): Princeton
University Press.
!
24!
Cummings ME, Partridge J. 2001. Visual pigments and optical habitats of surfperch
(Embiotocidae) in the California kelp forest. J Comp Physiol A 187:875-989.
Dalton BE, Loew ER, Cronin TW, Carleton KL. 2014. Spectral tuning by opsin coexpression in
retinal regions that view different parts of the visual field. Proc Biol Sci 281:20141980.
Dalton BE, de Busserolles F, Marshall NJ, Carleton KL. 2017. Retinal specialization through
spatially varing cell densities and opsin coexpression in cichlid fish. J Exp Biol. 220:266-
277.
Dittmann MT, Roesti M, Indermaur A, Colombo M, Gschwind M, Keller I, Kovac R, Barluenga M,
Muschick M, Salzburger W. 2012. Depth-dependent abundance of Midas Cichlid fish
(Amphilophus spp.) in two Nicaraguan crater lakes. Hydrobiologia 686:277-285.
Ebrey T, Koutalos Y. 2001. Vertebrate photoreceptors. Prog Retin Eye Res. 20:49-94.
Elmer KR, Fan S, Kusche H, Spreitzer M-L, Kautt AF, Franchini P, Meyer A. 2014. Parallel
evolution of Nicaraguan crater lake cichlid fishes by non-parallel routes. Nat Commun.
5:6168.
Elmer KR, Kusche H, Lehtonen TK, Meyer A. 2010. Local variation and parallel evolution:
morphological and genetic diversity across a species complex of Neotropical crater lake
cichlid fishes. Philos Trans R Soc Lond B. 365:1769-1782.
Elmer KR, Meyer A. 2011. Adaptation in the age of ecological genomics: insights from parallelism
and convergence. Trends Ecol. Evol. 26:298306
Enright JM, Toomey MB, Sato SY, Temple SE, Allen JR, Fujiwara R, Kramlinger VM, Nagy LD,
Johnson KM, Xiao Y, How MJ. 2015. Cyp27c1 red-shifts the spectral sensitivity of
photoreceptors by converting vitamin A1 into A2. Curr Biol. 25:3048-3057.
Escobar-Camacho D, Ramos E, Martins C, Carleton KL. 2017. The opsin genes of amazonian
cichlids. Mol Ecol 26:1343-1356.
Fernald RD. 2006. Casting a genetic light on the evolution of eyes. Science 313:1914-1918.
Fisher KJ, Recupero DL, Schrey AW, Draud MJ. 2015. Molecular evidence of long wavelength
spectral sensitivity in the reverse sexually dichromatic convict cichlid (Amatitlania
nigrofasciata). Copeia 103:546-551.
Franchini P, Monné Parera D, Kautt AF, Meyer A. 2017. quaddRAD: A new high-multiplexing and
PCR duplicate removal ddRAD protocol produces novel evolutionary insights in a non-
radiating cichlid lineage. Mol Ecol. Accepted Author Manuscript. doi:10.1111/mec.14077
Fuller RC, Carleton KL, Fadool JM, Spady TC, Travis J. 2004. Population variation in opsin
expression in the bluefin killifish, Lucania goodei: a real-time PCR study. J Comp Physiol A.
190:147-154.
Fuller RC, Fleishman LJ, Leal M, Travis J, Loew E. 2003. Intraspecific variation in retinal cone
distribution in the bluefin killifish, Lucania goodei. J Comp Physiol A. 189:609-616.
Govardovskii VI, Fyhrquist N, Reuter T, Kuzmin DG, Donner K. 2000. In search of the visual
pigment template. Vis Neurosci. 17:509-528.
!
25!
rosi FI. 1994. An analysis of two spectral properties of vertebrate visual pigments. Vision Res.
34:1359-1367.
Henning F, Meyer A. 2014. Evolutionary genomics of cichlid fishes: Explosive speciation and
adaptation in the postgenomic era. Annu. Rev. Genomics Hum. Genet. 15: 417-441.
Hoekstra HE, Coyne JA. 2007. The locus of evolution: Evo devo and the genetics of adaptation.
Evolution 61:995-1016.
Hofmann CM, Carleton KL. 2009. Gene duplication and differential gene expression play an
important role in the diversification of visual pigments in fish. Integr Comp Biol 49:630-643.
Hofmann CM, O'Quin KE, Justin Marshall N, Carleton KL. 2010. The relationship between lens
transmission and opsin gene expression in cichlids from Lake Malawi. Vision Res 50:357-
363.
Hofmann CM, O’Quin KE, Marshall NJ, Cronin TW, Seehausen O, Carleton KL. 2009. The eyes
have it: Regulatory and structural changes both underlie cichlid visual pigment diversity.
PLoS Biol 7:e1000266.
Kautt AF, Elmer KR, Meyer A. 2012. Genomic signatures of divergent selection and speciation
patterns in a ‘natural experiment’, the young parallel radiations of Nicaraguan crater lake
cichlid fishes. Mol Ecol. 21:4770-4786.
Kautt AF, Machado-Schiaffino G, Meyer A. 2016a. Multispecies outcomes of sympatric speciation
after admixture with the source population in two radiations of Nicaraguan crater lake
cichlids. PLoS Genet. 12:e1006157.
Kautt AF, Machado-Schiaffino G, Torres-Dowdall J, Meyer A. 2016b. Incipient sympatric speciation
in Midas cichlid fish from the youngest and one of the smallest crater lakes in Nicaragua
due to differential use of the benthic and limnetic habitats? Ecol Evol. 6:5342-5357.
Kocher TD. 2004. Adaptive evolution and explosive speciation: the cichlid fish model. Nature Rev
Genet. 5:288-298.
Kratochwil CF, Meyer A. 2015. Evolution: tinkering within gene regulatory landscapes. Curr Biol.
25:R285-288.
Kröger RH, Bowmaker JK, Wagner HJ. 1999. Morphological changes in the retina of Aequidens
pulcher (Cichlidae) after rearing in monochromatic light. Vision Res. 39:2441-2448.
Kutterolf S, Freundt A, Perez W, Wehrmann H, Schmincke HU. Late Pleistocene to Holocene
temporal succession and magnitudes of highly-explosive volcanic eruptions in west-central
Nicaragua. J Volcanol Geotherm Res. 163:55-82.
Levine JS, MacNichol EF. 1979. Visual pigments in teleost fishes: effects of habitat, microhabitat,
and behavior on visual system evolution. Sens Processes 3:95-131.
Lipetz LE, Cronin TW. 1988. Application of an invariant spectral form to the visual pigments of
Crustaceansimplications regarding the binding of the chromophore. Vision Res. 28:1083
1093.
!
26!
Loew ER. 1994. A 3rd, ultraviolet-sensitive, visual pigment in the Tokay-Gecko (Gekko gekko).
Vision Res. 34:1427-1431.
Loew ER, Lythgoe JN. 1978. The ecology of cone pigments in teleost fishes. Vision Res. 18:715-
722.
Losey GS, McFarland WN, Loew ER, Zamzow JP, Nelson PA, Marshall NJ. 2003. Visual Biology
of Hawaiian Coral Reef Fishes. I. Ocular Transmission and Visual Pigments. Copeia
2003:433-454.
Mahendiran K, Elie C, Nebel JC, Ryan A, Pierscionek BK. 2014. Primary sequence contribution to
the optical function of the eye lens. Sci Rep. 4:5195.
Marshall J, Carleton KL, Cronin T. 2015. Colour vision in marine organisms. Curr Opin Neurobiol.
34:86-94.
Marshall NJ, Jennings K, McFarland WN, Loew ER, Losey GS. 2003. Visual biology of Hawaiian
coral reef fishes. III. Environmental light and an integrated approach to the ecology of reef
fish vision. Copeia 2003:467-480.
McFarland WN, Munz FW. 1975. Part II: The photic environment of clear tropical seas during the
day. Vision Res. 15:1063-1070.
Mielke PW, Berry KJ, Brockwell PJ, Williams JS. 1981. A class of nonparametric tests based on
multiresponse permutation procedures. Biometrika 68:720-724.
Miyagi R, Terai Y, Aibara M, Sugawara T, Imai H, Tachida H, Mzighani SI, Okitsu T, Wada A,
Okada N. 2012. Correlation between nuptial colors and visual sensitivities tuned by opsins
leads to species richness in sympatric Lake Victoria cichlid fishes. Mol Biol Evol. 29:3281-
3296.
Muntz WRA. 1973. Yellow filters and the absorption of light by the visual pigments of some
Amazonian fishes. Vision Res. 13:2235-2254.
Muntz WRA. 1982. Visual adaptations to different light environments in Amazonian fishes. Rev.
Can. Biol. Experiment. 41:35-46.
O’Quin KE, Hofmann CM, Hofmann HA, Carleton KL. 2010. Parallel evolution of opsin gene
expression in African cichlid fishes. Mol Biol Evol. 27:2839-2854.
Palczewski K, Kumasaka T, Hori T, Behnke CA, Motoshima H, Fox BA, Le Trong I, Teller DC,
Okada T, Stenkamp RE, Yamamoto M. 2000. Crystal structure of rhodopsin: AG protein-
coupled receptor. Science 289:739-745.
Parry JW, Carleton KL, Spady T, Carboo A, Hunt DM, Bowmaker JK. 2005. Mix and match color
vision: Tuning spectral sensitivity by differential opsin gene expression in Lake Malawi
cichlids. Curr Biol. 15:1734-1739.
Phillips GA, Carleton KL, Marshall NJ. 2016. Multiple genetic mechanisms contribute to visual
sensitivity variation in the Labridae. Mol Biol Evol. 33:201-215.
R Core Team. 2014. R: A language and environment for statistical computing. R Foundation for
Statistical Computing, Vienna, Austria. URL http://www.R-project.org/.
!
27!
Recknagel H, Kusche H, Elmer KR, Meyer A. 2013. Two new species of the Midas cichlid complex
from Nicaraguan crater lakes: Amphilophus tolteca and A. viridis. (Perciformes: Cichlidae).
Aqua 19:207-224.
Rosenblum EB, Parent CE, Brandt EE. 2014. The molecular basis of phenotypic convergence.
Annu. Rev. Ecol. Evol. Syst. 45:203–226.
Rozen S, Skaletsky H. 2000. Primer 3 on the WWW for general users and for biologist
programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols:
Methods in molecular biology. Totowa (NJ): Humana Press. p. 365-386.
Sabbah S, Gray SM, Boss ES, Fraser JM, Zatha R, Hawryshyn CW. 2011. The underwater photic
environment of Cape Maclear, Lake Malawi: Comparison between rock- and sand-bottom
habitats and implications for cichlid fish vision. J Exp Biol. 214:487500.
Sabbah S, Hui J, Hauser FE, Nelson WA, Hawryshyn CW. 2012. Ontogeny in the visual system of
Nile tilapia. J Exp Biol. 215:2684-2695.
Sabbah S, Laria RL, Gray SM, Hawryshyn CW. 2010. Functional diversity in the color vision of
cichlid fishes. BMC Biol. 8:133.
Salzburger W. 2009.The interaction of sexually and naturally selected traits in the adaptive
radiations of cichlid fishes. Mol Ecol. 18:169-185.
Sandkam B, Young CM, Breden F. 2015. Beauty in the eyes of the beholders: colour vision is
tuned to mate preference in the Trinidadian guppy (Poecilia reticulata). Mol Ecol. 24:596-
609.
Seehausen O, Terai Y, Magalhaes IS, Carleton KL, Mrosso HDJ, Miyagi R, van der Sluijs I,
Schneider MV, Maan ME, Tachida H, et al. 2008. Speciation through sensory drive in
cichlid fish. Nature 455:620-626.
Spady TC, Parry JW, Robinson PR, Hunt DM, Bowmaker JK, Carleton KL. 2006. Evolution of the
cichlid visual palette through ontogenetic subfunctionalization of the opsin gene arrays. Mol
Biol Evol. 23:1538-1547.
Stern DL, Orgogozo V. 2008. The loci of evolution: How predictable is genetic evolution? Evolution
62:21552177.
Sugawara T, Terai Y, Imai H, Turner GF, Koblmuller S, Sturmbauer C, Shichida Y, Okada N. 2005.
Parallelism of amino acid changes at the RH1 affecting spectral sensitivity among deep-
water cichlids from Lakes Tanganyika and Malawi. Proc Natl Acad Sci USA 102:5448
5453.
Sugawara T, Terai Y, Okada N. 2002. Natural selection of the rhodopsin gene during the adaptive
radiation of East African Great Lakes cichlid fishes. Mol Biol Evol. 19:1807-1811.
Terai Y, Mayer WE, Klein J, Tichy H, Okada N. 2002. The effect of selection on a long wavelength
sensitive (LWS) opsin gene of Lake Victoria cichlid fishes. Proc Natl Acad Sci USA
99:15501-15506.
!
28!
Terai Y, Seehausen O, Sasaki T, Takahashi K, Mizoiri S, Sugawara T, Sato T, Watanabe M,
Konijnendijk N, Mrosso HDJ, et al. 2006. Divergent selection on opsins drives incipient
speciation in Lake Victoria cichlids. PLoS Biol. 4:e433.
Terakita A. 2005. The opsins. Genome Biol. 6:213.
Torres-Dowdall J, Henning F, Elmer KR, Meyer A. 2015. Ecological and lineage-specific factors
drive the molecular evolution of rhodopsin in cichlid fishes. Molecular biology and evolution.
32:2876-82.
Wages P, Horwitz J, Ding L, Corbin RW, Posner M. 2013. Changes in zebrafish (Danio rerio) lens
crystallin content during development. Mol Vis. 19:408-417.
Wald G. 1961. The visual function of the vitamins A. Vitam Horm. 18:417-430.
Wald G. 1968. The Molecular Basis of Visual Excitation. Nature 219:800-807.
Ward MN, Churcher AM, Dick KJ, Laver CR, Owens GL, Polack MD, Ward PR, Breden F, Taylor
JS. 2008. The molecular basis of color vision in colorful fish: four long wave-sensitive
(LWS) opsins in guppies (Poecilia reticulata) are defined by amino acid substitutions at key
functional sites. BMC Evol Biol. 8:210.
Weadick CJ, Loew ER, Rodd FH, Chang BSW. 2012. Visual pigment molecular evolution in the
Trinidadian pike cichlid (Crenicichla frenata): a less colorful world for Neotropical cichlids?
Mol Biol Evol. 29:3045-3060.
Woltering JM, Vonk FJ, Müller H, Bardine N, Tuduce IL, de Bakker MA, Knöchel W, Sirbu IO,
Durston AJ, Richardson MK. 2009. Axial patterning in snakes and caecilians: evidence for
an alternative interpretation of the Hox code. Dev Biol. 332:82-89.
Wray GA. 2007.The evolutionary significance of cis-regulatory mutations. Nat Rev Genet. 8:206-
216.
Yokoyama S. 2000. Molecular evolution of vertebrate visual pigments. Prog Retin Eye Res.
19:385-419.
Yokoyama S, Yokoyama R. 1996. Adaptive evolution of photoreceptors and visual pigments in
vertebrates. Annu Rev Ecol Evol Syst. 27:543-567.
Yokoyama S, Tada T, Zhang H, Britt L. 2008. Elucidation of phenotypic adaptations: Molecular
analyses of dim-light vision proteins in vertebrates. Proc Natl Acad Sci USA 105:13480-
13485.
!
29!
Table 1. Non-synonymous nucleotide substitution observed in the Midas cichlid species complex. Amino acid replacement and location for each
non-synonymous substitution are indicated at the bottom of the table.
gene
SWS1
RH2Aa
RH2Aβ
LWS
A. labiatus
8
benthic
s
·
·
·
s
m
·
·
1 Nucleotide positions, the transmembrane helices (TM 1-5) and the extracellular interhelical loop (E-2) are defined and numbered based on the
bovine crystal structure of rhodopsin (Palczewski et al. 2000).
2 In all cases we observed different alleles segregating in the corresponding population. A IUPAC/IUB single-letter amino acid code (Leonard 2003)
is used to denote the nucleotides segregating at each position in the corresponding species (r: either a or g; s: either c or g; m: either a or c; k:
either g or t). A dot (·) represents implies no departure from the consensus.
!
30!
FIGURE LEGENDS
Figure 1. Difference in the photic environment of a great lake and the crater lakes.
Normalized downwelling irradiance is narrower at two meters deep in the turbid great lakes in
comparison to the clear crater lakes. Hence, a higher proportion of light in the blue and red
part of the spectrum penetrates in the crater lakes compared to the great lakes. The insert
shows the absolute downwelling irradiance at 2 meters in each lake, showing the differences
among lakes in light extinction with depth.
350 400 450 500 550 600 650 700
wavelength (nm)
0.2
0.4
0.6
0.8
1
Normalized downwelling irradiance at 2m
CL Apoyo
CL Xiloá
GL Managua
400 500 600 700
wavelength (nm)
1
2
3
4
Absolute irradiance
(µmol m s )
-2 -1
* *
!
31!
Figure 2. Individual level peaks of maximum absorbance (lmax ± SE) of visual pigments
determined by microspectrophotometry from wild-caught Midas cichlids from a turbid great
lake and to clear crater lakes. Unfilled symbols correspond to specimens of the benthic
ecomorph within each lake, whereas filled symbols correspond to limnetic specimens. Visual
pigments were assigned to different spectral classes (indicated by the vertical lines of
different colors) based on their estimated pure A1 peak of maximum absorbance (lA1). The
ranges of estimated lA1 are shown as shaded areas of the same color. From left to right,
these spectral classes correspond to the violet, blue, blue-green, rod, green (short), green
(long), and red previously identified in African cichlids (Carleton et al. 2009). The grey
shading separates samples from the different lakes.
420 440 460 480 500 520 540 560 580 600
λ max (nm)
Clear CL Apoyo Clear CL Xiloá Turbid great lake
!
32!
Figure 3. Distribution of estimated proportion of vitamin A2-derived chromophore usage in
Midas cichlids from the turbid great lake Nicaragua and two clear water crater lakes (a).
Estimates of A2-derived usage for the long-green spectral class were not included due to the
confounded effect of opsin coexpression. cyp27c1 expression relative to the geometric mean
of two housekeeping genes (ldh2 and inp2) in the same crater lakes and the turbid great lake
Managua (b). Horizontal lines are the mean for each group. Bonferroni corrected pair-wised
comparisons are reported in supplementary table S2, Supplementary Materials online.
Figure 4. Lens transmittance grouped into different categories. Example of these are shown
in (a). Histogram depicting the frequency of lens transmittance cut-offs (T50) of lab-reared
Midas cichlids (b). Over-imposed is a density kernel showing the bimodal distribution of T50.
count
0 100
0 15
10
10
10
10
10
10
10
Relative expression
limneticbenthiclimneticbenthic
Clear crater lake ApoyoClear crater lake XiloáTurbid great lake
b. cyp27c1 expression
1
-1
0
-2
-3
-4
-5
A2%
0 100 0 100 0 100 0 100
0 15
0 20
(n = 58)
0 20
(n = 128) (n = 56) (n = 38)
060
(n = 144)
limnetic speciesbenthic specieslimnetic species
benthic species
Clear crater lake ApoyoClear crater lake Xiloá
Turbid great lake
a. Estimated percentage of vitamin A2-derived chromophore usage
300 350 400 450 500 550
Wavelength (nm)
0
0.2
0.4
0.6
0.8
1
Lens transmission
GL Nicaragua
CL Xiloá benthic
CL Xiloá limnetic
CL Apoyo benthic
CL Apoyo limnetic
600
T50
340 360 380 400 420 440
Frequency
0 10
CL Apoyo (n= 7)
CL Xiloá (n= 16)
GL Nicaragua (n= 10)
0.000 0.005 0.010 0.015 0.020
Density
Hartigans' D = 0.099
P = 0.003
a. Examples of transmission curves b.
T50
distribution
2 4 6 8
!
33!
Figure 5. Proportion of the total opsin expression comprised by each of the different opsin
genes in wild-caught Midas cichlids from a turbid great lake (a), and two clear crater lakes (b,
c). Means are shown as horizontal bars. Black circles represent expression in specimens of
the limnetic ecomorph, white circles denote expression in specimens of the benthic species.
Figure 6. Triple fluorescent in situ hybridization staining of the retinas of two Midas cichlids
species, one from a turbid great lake (a-e) and one from a clear crater lake (f-j) across four
quadrants of the retina. Coexpression is common in specimens from both lakes, but the
frequency is higher in specimens from the clear crater lake (f-j). Details in (g) show examples
of coexpression of LWS and RH2Aβ (upper box) and RH2B and RH2Aβ (lower box).
SWS1 SWS 2b SWS2a RH2B RH2AβRH2AαLWSSWS1 SWS 2b SWS2a RH2B RH2AβRH2AαLWS
SWS1 SWS 2b SWS2a RH2B RH2AβRH2AαLWS
0
0.2
0.4
0.6
0.8
1
Proportional expression
mean
benthic species
limnetic species
a. Turbid great lake b. Clear Crater Lake Xiloá c. Clear Crater Lake Apoyo
!
34!
Figure 7. The visual system of Midas cichlids evolved in parallel in the two clear crater lakes
Apoyo and Xiloá after their colonization from the turbid great lakes Nicaragua and Managua,
respectively. Phenotypic changes in opsin expression, chromophore usage and lens
transmittance are mapped on a phylogenetic reconstruction modified from Kautt et al.
(2016a). In fish from both crater lakes, lenses became more transmissive and expression of
RH2A increased and that of LWS decreased. In all crater lake species, except for A.
xiloaensis, chromophore usage changed from mainly A2 to mainly A1.
... Natural selection is thought to have played a strong role driving phenotypic diversification by sorting this genetic diversity. This effect is most evident in the cases of parallel evolution that can be observed in the comparisons of the two small radiations of crater Lakes Xiloá and Apoyo (see Sect. 4.1;Elmer et al. 2010aElmer et al. , 2014Kautt et al. 2016a), but also in consistent phenotypic changes seen across multiple crater lakes (e.g., Torres-Dowdall et al. 2017b;Kautt et al. 2018). In the following, we present and discuss two such examples, one considering morphological adaptations to the geomorphological characteristics of crater lakes, and a second one about the physiological adaptation of the visual system to the new photic conditions experienced in those lakes. ...
... In fish from two crater lakes, lenses became more transmissive and expression of rh2a increased and that of lws decreased. In all crater lake species, except for A. xiloaensis, chromophore usage changed from mainly A2 to mainly A1, depicted in the figure as differences in font size (modified from Torres-Dowdall et al. 2017b) vitamin A1 and a second one from vitamin A2. Switching from A1 to A2 chromophore usage shifts the sensitivity of a visual pigment toward longer wavelengths within the same spectral class (Wald 1961;Hárosi 1994). ...
... This resulted in three changes in the visual pigments of crater lake Midas cichlids (Fig. 5b). First, opsins that were only expressed during early development in Midas cichlids from the great lakes, but not in adults, are retained in the adult phenotype of crater lake Midas cichlids Torres-Dowdall et al. 2017b). Midas cichlids, like other cichlid species (O'Quin et al. 2011;Carleton et al. 2016), undergo an ontogenetic shift in visual sensitivity due to differential patterns of opsin expression across ages. ...
Chapter
The Nicaraguan Midas cichlid species complex is a natural experiment where fish from a large source population from turbid and shallow great lakes very recently (<20,000 years ago) colonized eight small crater lakes. The colonizers experienced completely novel environments in the clear and deep calderas. So far, 13 Midas cichlid species have been described, but more genetic clusters were identified. Although some of these species arose in allopatry, many more evolved in the absence of barriers to gene flow within two crater lakes. They contain small radiations of four and six endemics, respectively. These radiations constitute one of the few generally accepted empirical examples for sympatric speciation making them an ideal system for studying repeated evolution of adaptations and speciation at different levels of biological organization, including the genome level. Diversification occurred repeatedly in parallel including body morphology, coloration, color perception, and trophic structures such as pharyngeal jaws and hypertrophied lips. Additionally, parallel speciation happened in the two small crater lake radiations, where ecomorphologically similar species evolved repeatedly. Genomic differentiation associated with oligogenic traits (e.g., hypertrophic lips and coloration) is shallow, remaining polymorphisms, but much higher for polygenic traits (e.g., body shape and pharyngeal jaw morphology) that distinguish new species.
... The fish eye has emerged as a compelling system to study adaptive evolution (Fuller and Claricoates 2011;Novales Flamarique 2013;Härer et al. 2017;Torres-Dowdall et al. 2017;Carleton et al. 2020;Zheng et al. 2021) and it is a major target of TH (Eldred et al. 2018;Volkov et al. 2020). The spectral sensitivity of the visual pigments in the photoreceptors of the retina is dependent on the interaction of their two constituent components: an opsin protein and a light This article is protected by copyright. ...
... Figure 1: Relative expression of cone opsins and cyp27c1. Expression of all six cone opsin genes (sws1 = 360nm, sws2b = 425nm, sws2a = 456nm, rh2b = 472nm, rh2a = 517nm, lws = 560nm; wavelengths of maximum sensitivities are derived from microspectrophotometry data from Torres-Dowdall et al. (2017); sensitivities are based on vitamin A1-derived chromophore usage) are shown in the left panel(means ± standard deviation). Cyp27c1 expression across treatments is shown in the right panel. ...
Article
Full-text available
Vision is critical for most vertebrates, including fish. One challenge that aquatic habitats pose is the high variability in spectral properties depending on depth and the inherent optical properties of the water. By altering opsin gene expression and chromophore usage, cichlid fish modulate visual sensitivities to maximize sensory input from the available light in their respective habitat. Thyroid hormone (TH) has been proposed to play a role in governing adaptive diversification in visual sensitivity in Nicaraguan Midas cichlids, which evolved in less than 4,000 generations. As suggested by indirect measurements of TH levels (i.e., expression of deiodinases), populations adapted to short wavelength light in clear lakes have lower TH levels than ones inhabiting turbid lakes enriched in long‐wavelength light. We experimentally manipulated TH levels by exposing two‐week‐old Midas cichlids to exogenous TH or a TH‐inhibitor and measured opsin gene expression and chromophore usage (via cyp27c1 expression). Whereas exogenous TH induces long‐wavelength sensitivity by changing opsin gene expression and chromophore usage in a concerted manner, TH‐inhibited fish exhibit a visual phenotype with sensitivities shifted to shorter‐wavelengths. Tinkering with TH levels in eyes results in concerted phenotypic changes that can provide a rapid mechanism of adaptation to novel light environments. This article is protected by copyright. All rights reserved
... The observed pattern suggests that may after a single event of colonization, the host along with its parasites were shaped by stochastic or deterministic factors in a similar way in each crater lake. Besides the asynchronous time of colonization of the crater lakes, they differ in the availability of niches and environmental variables Stauffer et al., 2008;Torres-Dowdall et al., 2017). The similarity of the parasite communities in each lake is in accordance with the spatial clustering of the Midas cichlid species complex defined by . ...
Thesis
Hosts and parasites are engaged in complex interactions of constant reciprocal adaptation, imposing strong selective forces to each other capable of altering their evolutionary trajectories. During the colonization of a new environment, hosts may lose parasites and maintain only a subset of their original diversity, generating new parasite assemblages. The exposure of hosts to contrasting parasite communities can impose different selective pressures among populations and trigger or accelerate the divergence of their hosts. The Midas cichlid is an excellent model to study the mechanisms driving speciation, both in sympatry and in allopatry, and the evolution of parallelisms. The replicated ecological framework and the temporal variation of the evolution within crater lakes, in addition to the recent or ongoing diversification, provide an overview of the initial conditions that caused divergence, and a glimpse to approach the mechanisms guiding the divergence in a continuum of speciation. In this study, we investigated the potential role of parasite mediated selection in the adaptive radiations of the Midas cichlids. If populations inhabiting different environments are exposed to different parasite communities, and these are temporally stable, this can fuel diversification. We characterized the parasite communities in the Midas cichlids, other coexisting cichlids, and non-cichlids over three consecutive years, in the two great lakes and five crater lakes in Nicaragua. The morphological and molecular analyses revealed a macroparasite fauna composed by 42 taxa, 37 of them infecting cichlids. Most of the parasites were already described in other Middle American cichlids. Parasite diversity includes species of platyhelminths, nematodes, copepods, branchiurans, hirudineans and oribatid mites. Among these parasites, three invasive species were reported for the first time. Furthermore, we described two new species. The large lakes had larger parasite diversity than the smaller and more isolated crater lakes. The Midas cichlid was infected by 22 parasite taxa, 18 shared with other cichlids. We found a core parasite fauna in the Midas cichlid composed by eight parasite taxa, which comprise distantly related groups, with contrasting life histories and degrees of host specificity. The overview of the parasite diversity in fishes from the Nicaraguan freshwater systems showed remarkable diversity but still, many gaps in the research. The parasite fauna comprises 101 taxa in 51 of the 114 fish species currently known in the country. We found that parasite communities are more similar among sympatric than allopatric Midas cichlid populations, forming unique assemblages within lakes, stable over time. We uncovered signs of abundant parallelisms between equivalent ecomorphotypes across crater lake radiations. The similarities were found when considering the infection profiles by individual parasite taxa, whose transmission strategies reflect the trophic parallelisms and life histories of their hosts. The species interactions within parasite assemblages displayed non aleatory co-occurrences, although non-parallel in equivalent host ecomorphotypes. The study presented in this thesis suggests that host-parasite interactions may have played a role on the Midas cichlid adaptive radiations since early stages of divergence. Furthermore, our results highlight the idea that the Midas cichlids and their parasites represent a promising model to explore the mechanisms triggering biodiversity.
... Due to vision's central role in predation avoidance, mate choice, and foraging, it is predicted to be under strong natural and/or sexual selection in many species (Endler 1992). Indeed, work in a variety of systems has indicated that shifts in visual system do evolve repeatedly (O'Quin et al. 2010;Rennison et al. 2016;Torres-Dowdall et al. 2017). These shifts have often been found to be largely genetically determined (e.g., Tobler et al. 2010;Rennison et al. 2016), although phenotypic plasticity can also induce large shifts (e.g., (Nandamuri et al. 2017;Kranz et al. 2018;Luehrmann et al. 2018)). ...
Article
Visual sensitivity and body pigmentation are often shaped by both natural selection from the environment and sexual selection from mate choice. One way of quantifying the impact of the environment is by measuring how traits have changed after colonization of a novel habitat. To do this, we studied Poecilia mexicana populations that have repeatedly adapted to extreme sulphidic (H2S containing) environments. We measured visual sensitivity using opsin gene expression, as well as body pigmentation for populations in four independent drainages. Both visual sensitivity and body pigmentation showed significant parallel shifts towards greater medium wavelength sensitivity and reflectance in sulphidic populations. Altogether we found that sulphidic habitats select for differences in visual sensitivity and pigmentation. Shifts between habitats may be both due to differences in the water’s spectral properties and correlated ecological changes.
Article
Full-text available
Cichlid fishes show remarkable variation in visual sensitivities through differential expression of seven cone opsin genes. Many species undergo spectral sensitivity shifts from shorter to longer wavelengths as they develop from larvae to adults. However, while some species retain larval-like short wavelength sensitivities, others show adult-like longer wavelength sensitivities throughout life. The riverine cichlid, Astatotilapia burtoni, shows a single cone progression from ultraviolet to violet to blue sensitivity, while their long wavelength double cones maintain green and red sensitivities throughout life. To identify mechanisms that regulate these sensitivities, we asked whether thyroid hormone (TH) or light environment can drive shifts. We find that developmental treatment with TH can speed shifts to longer wavelength sensitivity, but only in single cones. TH inhibition can short wavelength shift adult opsin expression. Exposure to light regimes containing UV wavelengths induce short wavelength shifts in single cones early in development. None of the treatments produces double cone shifts or significant expression of the shortest wavelength double cone opsin, rh2b, although we detect no cis-regulatory variation. This suggests that while single cones show both TH and light plasticity, A. burtoni double cones have lost this plasticity, perhaps through changes in trans-acting opsin regulation.
Article
Full-text available
Phenotypic plasticity allows organisms to rapidly adjust to environmental changes. Cichlid fish inhabit a wide range of light environments and show a large diversity in visual system properties, which makes them a good model system to address the role of phenotypic plasticity in visual adaptation. Cichlid retinal cone pigments consist of opsin proteins bound to Vitamin A1 or A2-derived chromophores. Plasticity in expression has been shown for cichlid opsin genes, but less is known about the contribution of cyp27c1, the enzyme that converts Vitamin A1 into A2,. Here, we studied both opsin and cyp27c1 expression patterns for three closely related cichlid species from different visual habitats in Lake Victoria, across different light treatments. We found differences in cyp27c1 as well as in opsin expression patterns between the three species. Experimental light treatments affected the developmental trajectory of cyp27c1 expression in one species and opsin expression in all three species. Within each species, we found large individual variation in cyp27c1 expression levels and no consistent association with opsin expression levels. These results indicate that visual system plasticity of even closely related species can be differentially mediated by opsin and cyp27c1 expression, possibly associated with species differences in visual niche.
Article
Vision is used by animals to find food and mates, avoid predators, defend resources, and navigate through complex habitats. Behavioural experiments are essential for understanding animals’ perception but are often challenging and time-consuming; therefore, using species that can be trained easily for complex tasks is advantageous. Picasso triggerfish, Rhinecanthus aculeatus, have been used in many behavioural studies investigating vision and navigation. However, little is known about the molecular and anatomical basis of their visual system. We addressed this knowledge gap here and behaviourally tested achromatic and chromatic acuity. In terms of visual opsins, R. aculeatus possessed one rod opsin gene (RH1) and at least nine cone opsins: one violet-sensitive SWS2B gene, seven duplicates of the blue-green-sensitive RH2 gene (RH2A, RH2B, RH2C1-5), and one red-sensitive LWS gene. However, only five cone opsins were expressed: SWS2B expression was consistent, while RH2A, RH2C-1 and RH2C-2 expression varied depending on whether fish were sampled from the field or aquaria. Levels of LWS expression were very low. Using fluorescent in situ hybridisation, we found SWS2B was expressed exclusively in single cones, whereas RH2A and RH2Cs were expressed in opposite double cone members. Anatomical resolution estimated from ganglion cell densities was 6.8 cycles per degree (cpd), which was significantly higher than values obtained from behavioural testing for black and white achromatic stimuli (3.9 cpd) and chromatic stimuli (1.7-1.8 cpd). These measures were twice as high as previously reported. This detailed information on their visual system will help inform future studies with this emerging focal species.
Article
Adaptation to heterogeneous sensory environments has been implicated as a key parameter in speciation. Cichlid fish are a textbook example of divergent visual adaptation, mediated by variation in the sequences and expression levels of cone opsin genes (encoding the protein component of visual pigments). In some vertebrates including fish, visual sensitivity is also tuned by the ratio of Vitamin A1/A2-derived chromophores (i.e. the light-sensitive component of the visual pigment, bound to the opsin protein), where higher proportions of A2 cause a more red-shifted wavelength absorbance. Here, we explore variation in chromophore ratios across multiple cichlid populations in Lake Victoria, using as a proxy the expression of the gene Cyp27c1, which has been shown to regulate conversion of Vitamin A1- into A2 in several vertebrates.We focus on sympatric Pundamilia cichlids, where species with blue or red male coloration co-occur at multiple islands, but occupy different depths and consequently different visual habitats. In the red species, we found higher cyp27c1 expression in populations from turbid waters than from clear waters, but there was no such pattern in the blue species. Across populations, differences between the sympatric species in cyp27c1 expression had a consistent relationship with species differences in opsin expression patterns, but the red/blue identity reversed between clear and turbid waters. To assess the contribution of heritable versus environmental causes of variation, we tested whether light manipulations induce a change in cyp27c1 expression in the laboratory. We found that cyp27c1 expression was not influenced by experimental light conditions, suggesting that the observed variation in the wild is due to genetic differences. However, compared to other cichlid species, cyp27c1 is expressed at very low levels in Pundamilia suggesting that it may not be relevant for visual adaptation in this species. Conclusively, establishing the biological importance of this variation requires testing of actual A1/A2 ratios in the eye, as well as its consequences for visual performance. This article is protected by copyright. All rights reserved.
Article
Sensory systems evolve and enable organisms to perceive their sensory Umwelt, the unique set of cues relevant for their survival. The multiple components that comprise sensory systems — the receptors, cells, organs, and dedicated high-order circuits — can vary greatly across species. Sensory receptor gene families can expand and contract across lineages, resulting in enormous sensory diversity. Comparative studies of sensory receptor function have uncovered the molecular basis of receptor properties and identified novel sensory receptor classes and noncanonical sensory strategies. Phylogenetically informed comparisons of sensory systems across multiple species can pinpoint when sensory changes evolve and highlight the role of contingency in sensory system evolution.
Article
Full-text available
Vertebrates use cone cells in the retina for color vision and rod cells to see in dim light. Many deep-sea fishes have adapted to their environment to have only rod cells in the retina, while both rod and cone genes are still preserved in their genomes. As deep-sea fish larvae start their lives in the shallow, and only later submerge to the depth, they have to cope with diverse environmental conditions during ontogeny. Using a comparative transcriptomic approach in 20 deep-sea fish species from eight teleost orders, we report on a developmental cone-to-rod switch. While adults mostly rely on rod opsin (RH1) for vision in dim light, larvae almost exclusively express middle-wavelength-sensitive (“green”) cone opsins (RH2) in their retinas. The phototransduction cascade genes follow a similar ontogenetic pattern of cone—followed by rod-specific gene expression in most species, except for the pearleye and sabretooth (Aulopiformes), in which the cone cascade remains dominant throughout development, casting doubts on the photoreceptor cell identity. By inspecting the whole genomes of five deep-sea species (four of them sequenced within this study: Idiacanthus fasciola, Chauliodus sloani; Stomiiformes; Coccorella atlantica, and Scopelarchus michaelsarsi; Aulopiformes), we found that they possess one or two copies of the rod RH1 opsin gene, and up to seven copies of the cone RH2 opsin genes in their genomes, while other cone opsin classes have been mostly lost. Our findings hence provide molecular evidence for a limited opsin gene repertoire in deep-sea fishes and a conserved vertebrate pattern whereby cone photoreceptors develop first and rod photoreceptors are added only at later developmental stages.
Article
Full-text available
Understanding how speciation can occur without geographic isolation remains a central objective in evolutionary biology. Generally, some form of disruptive selection and assortative mating are necessary for sympatric speciation to occur. Disruptive selection can arise from intraspecific competition for resources. If this competition leads to the differential use of habitats and variation in relevant traits is genetically determined, then assortative mating can be an automatic consequence (i.e., habitat isolation). In this study, we caught Midas cichlid fish from the limnetic (middle of the lake) and benthic (shore) habitats of Crater Lake Asososca Managua to test whether some of the necessary conditions for sympatric speciation due to intraspecific competition and habitat isolation are given. Lake As. Managua is very small (<900 m in diameter), extremely young (maximally 1245 years of age), and completely isolated. It is inhabited by, probably, only a single endemic species of Midas cichlids, Amphilophus tolteca. We found that fish from the limnetic habitat were more elongated than fish collected from the benthic habitat, as would be predicted from ecomorphological considerations. Stable isotope analyses confirmed that the former also exhibit a more limnetic lifestyle than the latter. Furthermore, split-brood design experiments in the laboratory suggest that phenotypic plasticity is unlikely to explain much of the observed differences in body elongation that we observed in the field. Yet, neutral markers (microsatellites) did not reveal any genetic clustering in the population. Interestingly, demographic inferences based on RAD-seq data suggest that the apparent lack of genetic differentiation at neutral markers could simply be due to a lack of time, as intraspecific competition may only have begun a few hundred generations ago.
Article
Full-text available
The formation of species in the absence of geographic barriers (i.e. sympatric speciation) remains one of the most controversial topics in evolutionary biology. While theoretical models have shown that this most extreme case of primary divergence-with-gene-flow is possible, only a handful of accepted empirical examples exist. And even for the most convincing examples uncertainties remain; complex histories of isolation and secondary contact can make species falsely appear to have originated by sympatric speciation. This alternative scenario is notoriously difficult to rule out. Midas cichlids inhabiting small and remote crater lakes in Nicaragua are traditionally considered to be one of the best examples of sympatric speciation and lend themselves to test the different evolutionary scenarios that could lead to apparent sympatric speciation since the system is relatively small and the source populations known. Here we reconstruct the evolutionary history of two small-scale radiations of Midas cichlids inhabiting crater lakes Apoyo and Xiloá through a comprehensive genomic data set. We find no signs of differential admixture of any of the sympatric species in the respective radiations. Together with coalescent simulations of different demographic models our results support a scenario of speciation that was initiated in sympatry and does not result from secondary contact of already partly diverged populations. Furthermore, several species seem to have diverged simultaneously, making Midas cichlids an empirical example of multispecies outcomes of sympatric speciation. Importantly, however, the demographic models strongly support an admixture event from the source population into both crater lakes shortly before the onset of the radiations within the lakes. This opens the possibility that the formation of reproductive barriers involved in sympatric speciation was facilitated by genetic variants that evolved in a period of isolation between the initial founding population and the secondary migrants that came from the same source population. Thus, the exact mechanisms by which these species arose might be different from what had been thought before.
Article
Full-text available
Some vertebrate species have evolved means of extending their visual sensitivity beyond the range of human vision. One mechanism of enhancing sensitivity to long-wavelength light is to replace the 11-cis retinal chromophore in photopigments with 11-cis 3,4-didehydroretinal. Despite over a century of research on this topic, the enzymatic basis of this perceptual switch remains unknown. Here, we show that a cytochrome P450 family member, Cyp27c1, mediates this switch by converting vitamin A1 (the precursor of 11-cis retinal) into vitamin A2 (the precursor of 11-cis 3,4-didehydroretinal). Knockout of cyp27c1 in zebrafish abrogates production of vitamin A2, eliminating the animal's ability to red-shift its photoreceptor spectral sensitivity and reducing its ability to see and respond to near-infrared light. Thus, the expression of a single enzyme mediates dynamic spectral tuning of the entire visual system by controlling the balance of vitamin A1 and A2 in the eye.
Article
Full-text available
Coral reefs are one of the most spectrally diverse environments, both in terms of habitat and animal color. Species identity, sex, and camouflage are drivers of the phenotypic diversity seen in coral reef fishes, but how the phenotypic diversity is reflected in the genotype remains to be answered. The labrids are a large, polyphyletic family of coral reef fishes that display a diverse range of colors, including developmental color morphs and extensive behavioral ecologies. Here, we assess the opsin sequence and expression diversity among labrids from the Great Barrier Reef, Australia. We found that labrids express a diverse palette of visual opsins, with gene duplications in both RH2 and LWS genes. The majority of opsins expressed were within the mid-to-long wavelength sensitive classes (RH2 and LWS). Three of the labrid species expressed SWS1 (ultra-violet sensitive) opsins with the majority expressing the violet-sensitive SWS2B gene and none expressing SWS2A. We used knowledge about spectral tuning sites to calculate approximate spectral sensitivities (λmax) for individual species’ visual pigments, which corresponded well with previously published λmax values for closely related species (SWS1: 356–370 nm; SWS2B: 421–451 nm; RH2B: 452–492 nm; RH2A: 516–528 nm; LWS1: 554–555 nm; LWS2: 561–562 nm). In contrast to the phenotypic diversity displayed via color patterns and feeding ecology, there was little amino acid diversity within the known opsin sequence tuning sites. However, gene duplications and differential expression provide alternative mechanisms for tuning visual pigments, resulting in variable visual sensitivities among labrid species.
Article
The identification of thousands of variants across the genomes and their accurate genotyping are crucial for estimating the genetic parameters needed to address a host of molecular ecological and evolutionary questions. With rapid advances of massively parallel high-throughput sequencing technologies, several methods have recently been developed to access genome-wide data on population variation. One of the most successful and widely used techniques relies on the combination of restriction enzymes and sequencing-by-synthesis: Restriction-site Associated DNA sequencing (RADSeq). We developed a new, more time- and cost-efficient double-digest RAD paired-end protocol (quaddRAD) that simplifies and speeds up the identification of PCR duplicates and permits large-scale multiplexing. Assessing its performances on a technical dataset, we also applied the quaddRAD method on population samples of a Neotropical cichlid fish lineage (Archocentrus centrarchus) to assess its genetic structure and demographic history. While we identified allopatric inter-lake genetic divergence, most likely driven by drift, no signature of sympatric divergence was detected. This differs from what has been observed in Midas cichlids (Amphilophus citrinellus spp.), another cichlid lineage that inhabits the same lakes and shares a similar demographic history, but have evolved into small-scale adaptive radiations via sympatric speciation. We demonstrate that quaddRAD is a robust and efficient method for genotyping a massive number and widely overlapping set of loci with high accuracy. Furthermore, the results on A. centrarchus open new research avenues providing an ideal system to investigate genome-level mechanisms that could alter the speciation potential of different but closely related cichlid lineages. This article is protected by copyright. All rights reserved.
Chapter
Visual pigment sensitivities are known to vary across organisms and habitats. The sensory drive theory was formulated over 20 years ago to help explain how such sensory variation could contribute to divergent selection and speciation. Since then, there have been only a few examples that support the idea that visual pigment evolution contributes to speciation. Here, I discuss what is required to demonstrate that evolution of visual pigments (and visual sensitivities) play a role speciation. I then identify systems where visual pigments are unlikely to have a role, where they might play a role, and where they likely have driven speciation. This review concludes that more examples are needed to identify instances where visual pigment evolution contributes to speciation and to determine how frequently sensory drive is at work.
Article
Vision is a critical sense for organismal survival with visual sensitivities strongly shaped by the environment. Some freshwater fishes with a Gondwanan origin are distributed in both South American rivers including the Amazon, as well as African rivers and lakes. These different habitats likely required adaptations to murky and clear environments. In this study, we compare the molecular basis of Amazonian and African cichlid fishes' visual systems. We used next generation sequencing of genomes and retinal transcriptomes to examine three Amazonian cichlid species. Genome assemblies revealed six cone opsin classes (SWS1, SWS2B, SWS2A, RH2B, RH2A, LWS) and rod opsin (RH1). However, the functionality of these genes varies across species with different pseudogenes found in different species. Our results support evidence of an RH2A gene duplication event that is shared across both cichlid groups, but which was probably followed by gene conversion. Transcriptome analyses show that Amazonian species mainly express three opsin classes (SWS2A, RH2A and LWS) which likely are a good match to the long wavelength oriented light environment of the Amazon basin. Furthermore, analysis of amino acid sequences suggest that the short wavelength sensitive genes (SWS2B, SWS2A) may be under selective pressures in order to shift their spectral properties to a longer wavelength visual palette. Our results agree with the 'sensitivity hypothesis' where the light environment causes visual adaptation. Amazonian cichlid visual systems are likely adapting through gene expression, gene loss, and possibly spectral tuning of opsin sequences. Such mechanisms may be shared across the Amazonian fish fauna. This article is protected by copyright. All rights reserved.
Article
The distinct behaviors and varied habitats where animals live place different requirements on their visual systems. A trade-off exists between resolution and sensitivity, with these properties varying across the retina. Spectral sensitivity, which affects both achromatic and chromatic (colour) vision, also varies across the retina, though the function of this inhomogeneity is less clear. We previously demonstrated spatially varying spectral sensitivity of double cones in the cichlid fish Metriaclima zebra due to coexpression of different opsins. Here, we map the distributions of ganglion cells and cone cells and quantify opsin coexpression in single cones to show these also vary across the retina. We identify an area centralis with peak acuity and infrequent coexpression, which may be suited for tasks such as foraging and detecting male signals. The peripheral retina has reduced ganglion cell densities and increased opsin coexpression. Modeling of cichlid visual tasks indicates that coexpression might hinder colour discrimination of foraging targets and some fish colours. But, coexpression might improve contrast detection of dark objects against bright backgrounds, which might be useful for detecting predators or zooplankton. This suggests a trade off between acuity and colour discrimination in the central retina versus lower resolution but more sensitive contrast detection in the peripheral retina. Significant variation in the pattern of coexpression among individuals, however, raises interesting questions about the selective forces at work.
Article
Animals vary in their sensitivities to different wavelengths of light. Sensitivity differences can have fitness implications in terms of animals' ability to forage, find mates and avoid predators. As a result, visual systems are likely selected to operate in particular lighting environments and for specific visual tasks. This review focuses on cichlid vision, as cichlids have diverse visual sensitivities, and considerable progress has been made in determining the genetic basis for this variation. We describe both the proximate and ultimate mechanisms shaping cichlid visual diversity using the structure of Tinbergen's four questions. We describe 1) the molecular mechanisms that tune visual sensitivities including changes in opsin sequence and expression; 2) the evolutionary history of visual sensitivity across the African cichlid flocks; 3) the ontological changes in visual sensitivity and how modifying this developmental program alters sensitivities among species; and 4) the fitness benefits of spectral tuning mechanisms with respect to survival and mating success. We further discuss progress to unravel the gene regulatory networks controlling opsin expression and suggest that a simple genetic architecture contributes to the lability of opsin gene expression. Finally, we identify unanswered questions including whether visual sensitivities are experiencing selection, and whether similar spectral tuning mechanisms shape visual sensitivities of other fishes. This article is protected by copyright. All rights reserved.