Available via license: CC BY-NC 4.0
Content may be subject to copyright.
Journal of Pharmacy and Nutrition Sciences, 2017, 7, 73-80 73
ISSN: 2223-3806 / E-ISSN: 1927-59 51/17 © 2017 Lifescience Global
Effects of Antrodia Camphorata Mycelia Extract Containing
Antroquinonol on Lowering Low-Density Lipoprotein Cholesterol:
A Randomized Double-Blind Study
Miles Chih-Ming Chena, Pei-Ni Chena, Howard Hao-Yu Chenga, Wayne Ching-Cheng Weia,
Ryuji Takedab,*, Mitsuko Moric and Kiichiro Mochidad
aDivision of Clinical Research, Golden Biotechnology Corp., Danshui Dist., 251, New Taipei City, Taiwan,
R.O.C.
bDepartment of Nutritional Sciences for Well-being, Faculty of Health Sciences for Welfare, Kansai University
of Welfare Sciences, 582-0026 Asahigaoka 3-11-1, Kashiwara city Osaka, Japan
cTokyo Branch of the Oriental Occupational Health Association, Oriental Ueno Health Checkup Center,
Basement Floor 1, Suzunoya Building, 1-20-11, Ueno, Taito-shi, Tokyo, Japan
dRCT Japan Inc., Shibuya 2-21-1 8F, Shibuya Hikarie Building, Shibuya Ward, Tokyo, Japan
Abstract: Objective: Antrodia camphorata is a type of true fungus that grows only on Cinnamomum camphora trees,
also known as Cinnamomum kanehirae (“kashi”) in Taiwan. Antroquinonol is a characteristic component of A.
camphorata mycelia extract and was previously shown to exhibit antitumor action and lower blood cholesterol (total
cholesterol and low-density lipoprotein [LDL] cholesterol) in cellular and animal models. So, This study examined the
ability of A. camphorata mycelia extr act to reduce LDL cholesterol in humans.
Methods: We conducted a randomized double-blind trial in 26 subjects with either borderline LDL cholesterol (120–139
mg/dL; n = 11) or mildly elevated LDL cholesterol (140–159 mg/dL; n = 15). Participants ingested tablets containing
either 25 mg of A. camphorata mycelia extract (antroquinonol: 0.68 mg; n = 14) or a placebo (n = 12) for 12 w eeks.
Results: The test group showed a significant reduction in LDL cholesterol when compared with the placebo group after
12 weeks of tablet ingestion (p < 0.05), demonstratin g the effects of A. camphorata mycelia extract on LDL cholesterol.
A. camphorata mycelia extract also tended to reduce total cholesterol when compared with the placebo (p < 0.10). The
borderline LDL c holesterol and mildly elevated LDL cholesterol subgroups showed a significant reduction in LDL
cholesterol in subjects who ingested A. camphorata mycelia extract compared with those who ingested the placebo,
again demonstra ting th e LDL ch olesterol-lower ing eff ect of the extract.
Conclusion: A. camphorata mycelia extract lowers LDL cholesterol in individuals with somewhat high LDL cholesterol
levels.
This clinical trial was registered with the University Hospital Medical I nformati on Network (UMIN no. # 000019670).
Keywords: Antrodia camphorate, Antroquinonol, LDL-cholesterol, LDL receptor genes, randomized placebo-
controlled double-blind study.
INTRODUCTION
Dyslipidemia is a risk factor for coronary artery
diseases, such as arteriosclerosis. Arteriosclerosis can
result from low-density lipoprotein (LDL) entering the
arterial wall below the vascular endothelial cells. This
process is accompanied by the generation of oxidized
LDL, formation of foam cells, proliferation of smooth
muscle cells, and vascular wall calcification, ultimately
leading to the formation of atherosclerotic plaques that
can interrupt blood flow [1]. Many epidemiological
studies have reported that increases in total serum
cholesterol and LDL cholesterol levels greatly influence
*Address correspondenc e to th is author at t he Department of Nutritiona l
Sciences for W ell-being, Faculty of Health Sciences for Welfare, Kansa i
University of Welfare Sciences, 582-0026 Asahiga oka 3-11-1, Kashiwara city
Osaka, Japan; Tel: +81-72-976-0088; E-ma il: rtakeda@tamateyama.ac.jp
the onset of arteriosclerosis [2-5]. Attempts are being
made to improve cholesterol levels via dietary changes
and nutritional guidance [6, 7]. Many components in
foods, such as plant sterols [8, 9] and pine bark extract
[10], exhibit LDL cholesterol-lowering effects. In
February 2015, a scientific report for the general public
by the Dietary Guidelines Advisory Committee of the
United States Department of Agriculture [11], indicated
that conventional restrictions on cholesterol ingestion
should be eliminated because there was no clear
evidence linking the ingestion of cholesterol in food to
blood cholesterol levels. Similarly, the Japanese 2015
Dietary Reference Intake (DRI) levels do not restrict
cholesterol intake because there is insufficient
evidence of a correlation between the dietary intake of
cholesterol and blood cholesterol levels in healthy
74 Journal of Pharmacy and Nutrition Sciences, 2017, Vol. 7, No. 3 Chen et al.
individuals. However, the Japan Atherosclerosis
Society continues to issue alerts regarding the intake of
cholesterol by individuals with high LDL cholesterol
levels [12]. Lowering LDL cholesterol is thought to be
effective at reducing the risks for conditions such as
arteriosclerosis.
Antrodia camphorata is a type of true fungus that
grows only on Cinnamomum camphora trees, also
known as Cinnamomum kanehirae (“kashi”) in Taiwan
[13]. This fungus has been widely used in ancient folk
medicine as well as in foods and medicinal products. In
recent years, because C. kanehirae trees in Taiwan
have approached extinction, they have been widely
replaced by A. camphorata mycelia in foods through
advances in cultivation techniques. A. camphorata
mycelium was added to Japan’s “Non-medicinal
Product List” in 2015 following reform of the Food and
Drug Classification List after safety of its ingestion was
proven. Indeed, A. camphorata mycelium is now used
as a health food. The mycelium contains various
nutrients and bioactive components, such as
polysaccharides and triterpenoids. Golden Biotech
(New Taipei City, Taiwan) has used its own original
solid-state culture technology to cultivate high-quality
A. camphorata mycelia. This has allowed the
successful induction and extraction of low molecular
weight antroquinonol (M.W. 390) (Figure 1), which is
not present in normal A. camphorata mycelia.
Antroquinonol has been confirmed to exhibit antitumor
action and preventive effects against Alzheimer
disease, improve systemic lupus erythematosus (an
autoimmune disease), protect the liver, and reduce
fatigue in cellular and animal models [14-19].
O
O
O
OH
Figure 1: Structure of antroquinonol.
Although animal and cellular experiments showed
that A. camphorata mycelia extract exhibits various
physiological actions, little evidence is available
regarding its effect on humans. Therefore, we
conducted a randomized double-blind study to assess
the ability of A. camphorata mycelia extract to lower
LDL cholesterol and total cholesterol in individuals with
somewhat high levels of LDL cholesterol.
MATERIAL AND METHODS
Antrodia Camphorata Extract
A. camphorata mycelia extract is a supercritical
extraction of A. camphorata mycelia powder that
contains antroquinonol.
Test Material
The test material was a tablet containing 25 mg of
A. camphorata mycelia extract (antroquinonol: 0.68
mg). Subjects ingested one tablet per day. The placebo
was a tablet that did not contain A. camphorata mycelia
extract (Table 1). The two types of tablets could not be
distinguished by appearance or taste. Neither the test
material nor the placebo contained any other ingredient
that affected blood lipid or blood cholesterol levels.
Antroquinonol was isolated and characterized as
described in a previous study [13].
Table 1: Composition of the Test and Placebo Tablets
Components
Test
Placebo
Antrodia camphorata extract
25 mg
0.0 mg
Antroquinonol
0.68 mg
0.00 mg
Energy
0.0745 kcal
0.0886 kcal
Water
1.000m g
0.175mg
Protein
0.075mg
0.05mg
Fat
2.88mg
0.80mg
Carbohydrates
20.55m g
22.63 mg
Sodium
0.002 mg
0.006 mg
Equivalent amount of table salt
0.0058mg
0.0156 mg
Cell Lines and Cell Culture
Human liver cancer cell line HepG2 cells were
obtained from the American Type Culture Collection
(Rockville, MD, USA). The cells were cultured at 37°C
in 5% CO2 in Minimum Essential Medium culture
medium supplemented with 10% fetal bovine serum
and 100 U/ml streptomycin and penicillin. For
treatment, cells were seeded in six-well plates at 6.25 ×
105 cells/well. On the following day, the medium was
changed to a serum-free medium and cells were
serum-starved for 24 h. Antroquinonol was dissolved in
dimethyl sulfoxide and diluted to the required
concentration in serum-free medium. Cultures were
then treated with diluted antroquinonol as indicated.
Effects o f Antro dia Camphorata Mycelia Extr act Con taining Antroq uinonol Journal of Pharmacy and Nutrition Sciences, 2017, Vol. 7, No. 3 75
RNA Extraction and Reverse Transcription PCR
After treatment, cells were washed with cold
phosphate-buffered saline and total RNA was extracted
using the RNeasy mini kit (Qiagen, Hilden, Germany).
Total RNA (1 µg) was reverse-transcribed into cDNA
using SuperScript® III Reverse Transcriptase
(Invitrogen, Illkirch, France) and oligo(dT)12–18
primers. Polymerase chain reaction (PCR) analysis
was performed using LDLR-specific primers (LDLRF: 5’
CTTTCAACACACAACAGCAGA 3’ and LDLRR: 5’
TGACAGGGCAAAGGCTAAC 3’) and GAPDH-specific
primers (GAPDHF: 5’ GGTATCGTGGAAGGACTCAT
3’ and GAPDHR: 5’ CCTTGCCCACAGCCTTG 3’). The
correct size of the amplified region for each primer was
verified using agarose gel electrophoresis. Data were
analyzed with PCR efficiency correction using Light
Cycler 480 Relative Quantification software v1.01
(Roche) based on relative standard curves
corresponding to the PCR amplification efficiencies of
LDLR and GAPDH genes.
Subjects
Subjects were Japanese men and women with
borderline or mildly elevated levels of LDL cholesterol
(120-159 mg/dL) [20]. The inclusion criterion was a
borderline (120-139 mg/dL) or mildly elevated (140-159
mg/dL) LDL cholesterol level based on the notes of
caution for applications of Japanese Foods for
Specified Health Uses [21]. Exclusion criteria were as
follows: 1) receiving medication; 2) heart or liver
dysfunction; 3) a borderline total cholesterol level of
200–239 mg/dL, LDL cholesterol level >160 mg/dL,
and high-density lipoprotein (HDL) cholesterol level ≤40
mg/dL; 4) aged younger than 20 years; and 5)
participation deemed inappropriate by the principal
investigator for medical reasons.
Ethics Review Board
The present study was conducted in accordance
with the guidelines of the Declaration of Helsinki, the
Ethical Guidelines for Biomedical Research Involving
Human Subjects, and notes of caution for applications
of Japanese Foods for Specified Health Uses. Prior to
commencement, the study was reviewed and approved
by the Oriental Ueno Medical Center Ethical Review
Board as conforming to the principles of the
Declaration of Helsinki [22]. The study purpose and
investigation procedure were explained in detail to the
subjects before the study commenced, and each
subject completed a consent form before participation.
This clinical trial was registered with the University
Hospital Medical Information Network (UMIN no. #
000019670).
Test Procedure
The present study had a randomized placebo-
controlled parallel design. The clinical study was
conducted between November 2015 and March 2016.
Screening tests were conducted for subjects who had
fasted for at least 8 hours before arriving at our hospital
(Figure 2). The principal investigator selected 26
subjects who met the inclusion criteria and for whom
the exclusion criteria did not apply. The selected
subjects were randomly assigned to either the test
group or the placebo group, and they ingested one
tablet per day for 12 weeks. At 4, 8, and 12 weeks after
starting ingestion, participants underwent blood tests
and blood lipid measurements at our hospital. No
dietary management was implemented during the test
period.
Randomization
Subjects were allocated into a test group or a
placebo group using stratified randomization to prevent
any bias in blood LDL cholesterol levels between
groups. This allocation was conducted by someone not
otherwise involved in the study, using a computer-
generated table of random numbers. This person also
verified the indistinguishability of the test product and
placebo.
Statistical Analysis
All data were expressed as the mean ± SE.
Statistical analyses were conducted using SAS9.4
(SAS Institute) software. Student’s t-tests were used for
comparisons between groups. In addition to comparing
the changes in lipid levels between the test and
placebo groups, we also performed a stratified analysis
of changes in LDL cholesterol for the subgroups of
subjects with borderline and mildly elevated cholesterol
levels. Differences in treatment values with a p-value
<0.05 were considered statistically significant.
RESULTS
Table 2 shows the background data for the study
participants. There were 14 subjects in the test group
and 12 subjects in the placebo group. Table 3 shows
changes in blood lipids. Notably different trends for the
change in total cholesterol after 8 and 12 weeks of
ingestion were observed between the test and placebo
groups, showing that total cholesterol tended to
decrease in the test group (p < 0.10). The test group
76 Journal of Pharmacy and Nutrition Sciences, 2017, Vol. 7, No. 3 Chen et al.
Figure 2: Flowchart of study participants.
Table 2: Subject Characteristics
Overall
Borderline cholesterol
(120-139 mg/dL)
Midly elevat ed cho lester ol
(140-159 mg/dL)
Test group
Placebo group
Test group
Placebo group
Test group
Placebo group
n
14
12
6
5
8
7
Number of men
and women
(men/women)
8/6
9/3
5/1
4/1
3/5
5/2
Weight (kg)
73.64 ± 8.05
74.28 ± 8.17
76.95 ± 5.22
73.10 ± 7.14
71.16 ± 9.19
75.13 ± 9.29
BMI (kg/m2)
27.07 ± 1.32
26.93 ± 1.26
27.25 ± 1.57
26.76 ± 0.82
26.94 ± 1.21
27.04 ± 1.56
Total cholesterol
(mg/dL)
217.8 ± 12.2
220.7 ± 13.5
210.0 ± 8.1
210.6 ± 12.3
228.8 ± 10.9
223.0 ± 9.9
LDL cholesterol
(mg/dL)
142.0 ± 9.5
143.4 ± 11.1
133.7 ± 3.9
132.4 ± 4.3
148.3 ± 7.1
151.3 ± 6.4
HDL cholesterol
(mg/dL)
62.6 ± 13.2
54.2 ± 14.8
59.8 ± 17.6
61.8 ± 16.1
64.6 ± 9. 6
48.7 ± 12.0
Triglycerides
(mg/dL)
113.4 ± 64.3
133.6 ± 45.0
120.5 ± 90.3
117.4 ± 34.1
108.0 ± 42.0
145.1 ± 50.6
showed a significant reduction in LDL cholesterol after
12 weeks of ingestion (p < 0.05) and a significant
reduction in LDL cholesterol to HDL cholesterol (L/H)
ratio (p < 0.01) after 8 and 12 weeks of ingestion
compared with the placebo group. Interestingly, an
increase in serum HDL-C levels was observed in the
test group after 8 weeks of ingestion compared with the
placebo group (p < 0.05). No significant differences
Effects o f Antro dia Camphorata Mycelia Extr act Con taining Antroq uinonol Journal of Pharmacy and Nutrition Sciences, 2017, Vol. 7, No. 3 77
were noted for changes in triglyceride levels.
Arteriosclerotic indices differed significantly between
groups after 8 and 12 weeks of ingestion (p < 0.05),
indicating that ingestion of the test tablets lowered the
risk for cardiovascular diseases.
Results of the stratified analysis of LDL cholesterol
in subjects with borderline and mildly elevated
cholesterol levels are shown in Table 4, and changes in
low-density lipoprotein cholesterol levels (ΔLDL-C) are
shown in Figure 3. In subjects who ingested test
tablets, borderline cholesterol levels significantly
decreased (p < 0.05) after 8 weeks of ingestion.
Furthermore, changes in low-density lipoprotein
cholesterol (ΔLDL-C) levels significantly decreased (p
< 0.05) after 8 weeks of ingestion. In mildly elevated
cholesterol subjects, a significant reduction (p < 0.01)
was noted in LDL cholesterol after 4weeks and 12
weeks of ingestion. Furthermore, changes in low-
density lipoprotein cholesterol (ΔLDL-C) levels
significantly decreased (p < 0.05) after 12 weeks of
ingestion. Among subjects who ingested the test tablet,
a significantly larger reduction in serum LDL cholesterol
levels was observed in subjects having mildly elevated
cholesterol levels compared with subjects having
borderline cholesterol levels.
Although a few adverse effects, such as abdominal
distension and pain, were noted during the ingestion
period, no causal relationship between these
symptoms and the ingestion of test tablets was
identified, and no effects of long-term ingestion was
identified during the 12-week ingestion period. No
significant changes in aspartate aminotransferase,
alanine aminotransferase, or r-GT levels, which are
indices for liver function, were identified in the test
group during the 12-week ingestion period (data not
shown). Thus, it can be inferred that daily ingestion of
Table 3: Changes in Blood Lipid Levels
Item
Unit
Group
n
Before
ingestion
After 4 weeks
of ingestion
After 8 weeks
of ingestion
After 12 weeks
of ingestion
Total cholesterol
mg/dL
Test group
Placebo group
14
12
220.7 ± 3.6
217.8 ± 3.5
218.7 ± 4.8
227.6 ± 3.9M
217.2 ± 4.7
225.8 ± 3.7†
215.8 ± 3.3
225.0 ± 4.5
LDL cholesterol
(LDL-C)
mg/dL
Test group
Placebo group
14
12
142.0 ± 2.5
143.4 ± 3.2
137.4 ± 3.8
147.3 ± 5.0
136.6 ± 4.9
151.4 ± 3.5†
135.7 ± 2.6 *
148.6 ± 5.0
!
"
#
#
HDL cholesterol
(HDL-C)
mg/dL
Test group
Placebo group
14
12
63.6 ± 3. 5
54.2 ± 4. 3
61.4 ± 4. 2
54.8 ± 3. 9
64.6 ± 3.1
53.3 ± 3.5
!
"
#
#
63.2 ±2.7
55.2 ± 4. 4
L/H ratio (LDL-
C/HDL-C)
-
Test group
Placebo group
14
12
2.37 ± 0.52
2.69 ± 0. 14
2.37 ± 0. 24
2.87 ± 0. 16
2.19 ± 0.14
2.97 ± 0.20
!
"
#
##
2.19 ± 0.26
2.91 ± 0.10
!
"
#
#
Triglycerdes
mg/dL
Test group
Placebo group
14
12
113.4 ± 17.2
133.6 ± 13.0
113.9 ± 23.2
146.1 ± 20.0
93.8 ± 14.9
123.7 ± 12.5
94.7 ± 12.0
116.7 ± 14.1
Arteriosclerotic index
mg/dL
Test group
Placebo group
14
12
2.66 ± 0. 19
3.30 ± 0. 33
2.76 ± 0. 30
3.38 ± 0. 30
2.45 ± 0.17
3.40 ± 0.25
!
"
#
##
2.47 ± 0.12
3.34 ± 0.31
!
"
#
#
Mean ± standard er ror. LDL, low-density lipoprotein; HDL, high-density l ipoprotein.
*Results wer e compar ed with the level before ingest ion using paired Student’s t -test. † p < 0.1, *p < 0.05.
*Comparisons with the placebo grou p at each time po int were performed using unpaired Stu dent’s t-test. # p < 0.05, ## p < 0.01.
Table 4: Results of the Stratified Analysis of Changes in Low-Density Lipoprotein Cholesterol Levels
Item
Reference
value
Unit
Group
n
Before
ingestion
After 4 weeks of
ingestion
After 8 weeks
of ingestion
After 12 weeks
of ingestion
Borderline
cholesterol
120.139
mg/dL
Test group
Placebo
6
5
133.7 ± 1.6
132.4 ± 1.9
131.5 ± 7.2
136.0 ± 7.9
120.0 ± 5.6†
145.6 ± 5.7
!
"
#
#
132.0 ± 6.0
139.6 ± 8.6
Mildly
elevated
cholesterol
140-159
mg/dL
Test group
Placebo
8
7
148.3 ± 2.5
151.3 ± 2.4
141.8 ± 3.7
155.4 ± 4.9
!
"
#
#
147.0 ± 4.1
155.6 ± 4.0
138.0 2.2 *
155.0 ± 5.1
!
"
#
##
Mean ± standard er ror.
*Results wer e compar ed with the level before ingest ion using paired Student’s t -test. † p < 0.1, *p < 0.05.
*Comparisons with the placebo group at each time point were performed using unpaired Student’s t-test. # p < 0.05, ## p < 0.01.
78 Journal of Pharmacy and Nutrition Sciences, 2017, Vol. 7, No. 3 Chen et al.
A. camphorata mycelia extract over 12 weeks had no
adverse effects on liver function.
DISCUSSION
The findings of our present study indicate that
ingestion of A. camphorata mycelia extract containing
antroquinonol lowered LDL cholesterol in healthy
subjects with somewhat high plasma LDL cholesterol
concentrations. These effects were noted in subjects
having both borderline and mildly elevated LDL
cholesterol levels, indicating that A. camphorata
mycelia extract is widely effective in individuals with
somewhat high LDL cholesterol levels. In the body,
more than half of LDL cholesterol catabolism takes
place via a receptor-mediated pathway. An
apolipoprotein, ApoB-100, which is virtually the only
protein in the LDL particle, binds with LDL receptors in
cells before the LDL particle is taken up into the cell
and metabolized. A. camphorata mycelia extract
containing antroquinonol has been shown in a cellular
experiment to increase the expression of LDL receptor
genes (Figure 4), suggesting that the activation of the
LDL receptor results in LDL cholesterol-lowering
effects. A recent study indicated that a crude extract of
A. camphorata reduced total lipids in the liver and
plasma [23]. From this, it was inferred that a crude
extract of A. camphorata containing antroquinonol
might have high potency for the management of
plasma lipid disorders. Our present study showed that
ingesting A. camphorata mycelia extract containing
antroquinonol also reduced LDL cholesterol levels in
plasma. Notably, the ingestion of A. camphorata
mycelia extract containing antroquinonol significantly
reduced LDL cholesterol levels; thus, it appears that
antroquinonol is at least one of the functional
components of the A. camphorata mycelia extract
responsible for its LDL cholesterol-lowering effects.
Figure 4: Effect of antroquinonol on LDLR gene expression
in HepG2 cells. Real-time quantification of the LDLR mRNA
level in HepG2 cells treated with 20 µM antroquinonol for 0,
0.5, 1, 2, 4, and 6 h. Data are presented as the mean ± SEM
of at least three independent experiments. * p < 0.05, ** p <
0.01 compared with the respective basal.
CONCLUSIONS
The present study investigated the LDL cholesterol-
lowering effects of A. camphorata mycelia extract
containing antroquinonol in subjects with somewhat
Figure 3: Changes in low-density lipoprotein cholesterol (ΔLDL-C). The graphs compare the groups taking the placebo and 25
mg of A. camphorata mycelia extract for 4, 8, and 12 weeks (W) for all subjects (n = 26), borderline cholesterol subjects (n =
11), and mildly elevated cholesterol subjects (n = 15). * p < 0.05 compared with the placebo.
Effects o f Antro dia Camphorata Mycelia Extr act Con taining Antroq uinonol Journal of Pharmacy and Nutrition Sciences, 2017, Vol. 7, No. 3 79
borderline and mildly elevated LDL cholesterol levels.
Our findings indicate that taking the extract over
several weeks significantly lowered LDL cholesterol
levels. A stratified analysis also showed that LDL
cholesterol was reduced in subjects with both
borderline cholesterol and mildly elevated cholesterol
levels. These results suggest that ingestion of A.
camphorata mycelia extract containing antroquinonol is
effective for improving LDL cholesterol levels in
individuals with somewhat borderline and mildly
elevated LDL cholesterol levels.
CONFLICT OF INTEREST
This study was funded by Golden Biotechnology
Corp. Miles Chih-Ming Chena, Pei-Ni Chena, Howard
Hao-Yu Chenga, Wayne Ching-Cheng Weia are
employees of Golden Biotechnology Corp.
ABBREVIATIONS
LDL = low-density lipoprotein
HDL = high-density lipoprotein
LDLR = low-density lipoprotein receptor
UMIN = University Hospital Medical Information
Network
REFERENCES
[1] Ross R. The pathogenesis of atherosclerosis: A perspective
for the 1990s. Nature 1993; 362: 801-9.
https://doi.org/ 10.1038/362801a0
[2] Scandinavian. Simvastatin. Survival. Study. Group.
Randomized trial of cholesterol lowering in 4444 patients with
coronary heart disease: The Scandinavian Simvastatin
Survival Study. Lancet 1994; 344: 1383-9.
[3] Gordon T, Kannel WB, Castelli WP, Dawber TR.
Lipoproteins, cardiovascular disease, and death: The
Framingham st udy. Arch Intern Med 1981; 141: 1 128-31.
https://doi.org/ 10.1001/archinte.1981.003400 90024008
[4] Stamler J, Wentworth D, Neaton JD. Is relationship between
serum cholesterol and risk of premature death from coronary
heart disease continuous and graded? Findings in 356, 222
primary screeners of t he Mult iple Risk Fact or Intervention
Trial (MRFIT). JAMA 1986; 256: 2823-8.
https://doi.org/ 10.1001/jama.1986.033 80200061022
[5] Pooling. Project. Research. Group. R elationship of blood
pressure, serum cholesterol, smoking habit, relative weight
and ECG abnormalities to incidence of major coronary
events: Final report of the pooling project. J Chronic Dis
1978; 31: 201-6.
https://doi.org/ 10.1016/0021-9681(78)90073-5
[6] Iso H, N aito Y, Sato S, K itamura A, Okamura T, Sankai T,
Shimamoto T, Iida M, Komachi Y. Serum triglycerides and
risk of coronary heart disease among Japanese men and
women. Am J Epidemiol 2001; 153(5): 490-9.
https://doi.org/ 10.1093/aje/153.5.490
[7] Imano H, N oda H, Kitamura A, Sato S , Kiyama M, Sankai T,
Ohira T, Nakamura M, Yamagishi K, Ikeda A, Shimamoto T,
Iso H. Low-density lipoprotein cholesterol and risk of
coronary heart disease among Japanese men and women:
the Circulatory Risk in C ommunities Study (CIRCS). Prev
Med 20 11; 52(5): 381-6.
https://doi.org/ 10.1016/j.ypmed.2011. 02.019
[8] Salen G, Ahrens EH Jr., Grundy SM. Metabolism of beta-
sitosterol in man. J Clin Invest 1970; 49: 952-67.
https://doi.org/ 10.1172/JCI106315
[9] Lees AM, Mok HY, Lees RS, McCluskey MA. Grundy SM,
Plant sterols as cholesterollowering agents: Clinical trials in
patients with hypercholesterolemia and studies of sterol
balance. Atherosclerosis 1977; 28: 325-38.
https://doi.org/ 10.1016/0021-9150(77)90180-0
[10] Kusaba N, Ikeguchi M, Takagaki K. Effect of Tablet
Containing Pine Bark Extract on serum Lipid level
Randomized, Double Blind, Placebo Controlled Parallel
Study. Pharmacometrics 2015; 89(3/4): 69-73.
[11] USDA. Scientific Report of the 2015 D ietary Guidelines
Advisory Committee 2015. http://www.health.gov/
dietaryguidelines/2015-scientific-report/
[12] Japan. Atherosclerosis. Society. Opinion of the Japan
Atherosclerosis Society Regarding the ACC/AHA Guidelines
2014. homepage: http://ww w.j-ather o.org/outline/
guideline _lifestyle.htm.l
[13] Lee TH , Lee CK, Tsou WL, Liu SY, Kuo MT, Wen WC. A new
cytotoxic agent from solid-state fermented mycelium of
Antrodia camphorata. Planta Med 2007; 73: 1412-1415.
https://doi.org/ 10.1055/s-2007-990232
[14] Chang WH, Chen MC, Cheng IH. Antroquinonol Lowers
Brain Amyloid-β Levels and Improves Spatial Learning and
Memory in a Transgenic Mouse Model of Alzheimer's
Disease. Sci Rep 2015; 5: 15067.
https://doi.org/ 10.1038/srep15067
[15] Yang SM, Ka SM, Hua KF, Wu TH, Chuang YP, Lin YW,
Yang FL, Wu SH, Yang SS, Lin SH, Chang JM, Chen A.
Antroquinonol mitigates an accelerated and progressive IgA
nephropathy model in mice by activating the Nrf2 pathway
and inhibiti ng T c ells and NLRP3 inflammasome. Free Radic
Biol Med 2013; 61: 285-97.
https://doi.org/ 10.1016/j.freer adbiomed.2013.03.024
[16] Tsai PY, Ka SM, Chao TK, Chang JM, Lin SH, Li CY, Kuo
MT, Chen P, Chen A. Antroquinonol reduces oxidative str ess
by enhancing the Nrf2 signaling pathway and inhibits
inflammat ion and sclerosis in focal segmental
glomerulosclerosis mice. Free Radic Biol Med 2011; 50(11):
1503-16.
https://doi.org/ 10.1016/j.freer adbiomed.2011.02.029
[17] Kumar KJ, Chu FH, Hsieh HW, Liao JW, Li WH, Lin JC,
Shaw JF, Wang SY. Antroquinonol from ethanolic extract of
mycelium of Antrodia cinnamomea protects hepatic cells
from ethanol-induced oxidativ e stress throug h Nrf-2
activation. J Ethnophar macol 2011; 136(1): 1 68-77.
https://doi.org/ 10.1016/j.jep.2011.04.030
[18] Tsai PY, Ka SM, Chang JM, Lai JH, Dai MS, Jheng HL, Kuo
MT, Chen P, Chen A. Antroquinonol differentially modulates
T cell activity and r educes interleukin-18 production, but
enhances Nrf2 activ ation, in murine accelerated s evere lupus
nephritis. Arthritis Rheum 2012; 64(1): 232-42.
https://doi.org/ 10.1002/art.33 328
[19] Chang JM, Lee YR, Hung LM, Liu SY, Kuo MT, Wen WC,
Chen P. An Extract of Antrodia camphorata Mycelia
Attenuates the Progression of Nephritis in Systemic Lupus
Erythematosus-Prone N ZB/W F1 Mice. Evid Based
Complement Alternat Med 2011; 2011: 465894.
https://doi.org/ 10.1093/ecam/n en057
[20] Japan Atherosclerosis Society (JAS) Guidelines for
Prevention of Atherosclerotic Cardiovascular Diseases 2012.
80 Journal of Pharmacy and Nutrition Sciences, 2017, Vol. 7, No. 3 Chen et al.
[21] Consumer. Affairs. Agency. Government of Japan., 2014.
Notification No. 259.
[22] World. Medical. Association. World Medical Association
Declaration of Helsinki: ethical principles for medical
research involving human subjects. JAMA 2013; 310(20):
2191-4.
https://doi.org/ 10.1001/jama.2013.281 053
[23] Kuo YH, Lin CH, Shih CC. Dehydroeburicoic Acid from
Antrodia camphorate Prevents the Diabetic and Dyslipidemic
State via Modulation of Glucose Transporter 4, Peroxisome
Proliferator-Activat ed Receptor α Expression a nd AMP-
Activated Protein Kinase Phosphorylation in High-Fat-Fed
Mice. I nt J Mol Sci 201 6; 17(6): p ii: E8 72.
https://doi.org/ 10.3390/ijms17 060872
Received on 24-03-2017 Accepted on 18-04-2017 Published on 14-07-2017
DOI: https://doi.org/10.6000/1927-5951.2017.07.03.1
© 2017 Chen et al.; Licensee Lifescience Global.
This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License
(http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted, non-commercial use, distribution and reproduction in
any medium, provided the work is properly cited.
