Generation of Targeted Knockout Mutants in Arabidopsis thaliana Using CRISPR/Cas9

Article (PDF Available) · January 2017with 808 Reads 
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
DOI: 10.21769/BioProtoc.2384
Cite this publication
  
1
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
Generation of Targeted Knockout Mutants in Arabidopsis thaliana Using CRISPR/Cas9
Florian Hahn, Marion Eisenhut, Otho Mantegazza and Andreas P. M. Weber*
Institute of Plant Biochemistry, Cluster of Excellence on Plant Science (CEPLAS), Center for Synthetic
Life Sciences (CSL), Heinrich Heine University, Düsseldorf, Germany
*For correspondence: Andreas.Weber@uni-duesseldorf.de
[Abstract] The CRISPR/Cas9 system has emerged as a powerful tool for gene editing in plants and
beyond. We have developed a plant vector system for targeted Cas9-dependent mutagenesis of genes
in up to two different target sites in Arabidopsis thaliana. This protocol describes a simple 1-week cloning
procedure for a single T-DNA vector containing the genes for Cas9 and sgRNAs, as well as the detection
of induced mutations in planta. The procedure can likely be adapted for other transformable plant
species.
Keywords: CRISPR/Cas9, Genome editing, Arabidopsis thaliana, Plants, Knockout
[Background] The CRISPR/Cas9 system (Cas9) provides a simple and widely applicable approach to
modify genomic regions of interest and has therefore become the tool of choice for genome editing in
plants and other organisms (Schiml and Puchta, 2016). The system relies on the bacterial Cas9
nuclease from Streptococcus pyogenes (Cas9), which can be directed by a short artificial single guide
RNA molecule (sgRNA) towards a genomic DNA sequence (Jinek et al., 2012), where it creates a double
strand break (DSB). These DSBs are then repaired by the innate DNA repair mechanism of the plant
cell. Here, two main pathways can be distinguished (Salomon and Puchta, 1998). (i) DNA molecules
with high homology to the DSB site can be used as repair template. This homology directed repair (HDR)
approach can be exploited to introduce specific sequences at the site of the DSB (Schiml et al., 2014;
Baltes and Voytas, 2015). However, due to low integration rates of these sequences, HDR mediated
gene editing in plants remains challenging. (ii) An easier and more efficient approach is the use of the
non-homologous end joining (NHEJ) repair pathway of the plant, which is the dominant repair pathway
in most plants, such as Arabidopsis thaliana (Arabidopsis). Since NHEJ is error-prone, small insertions
or deletions (indels) of a few base pairs (bp) occur often at the DSB site, leading to frameshift mutations
and gene knockouts (Pacher and Puchta, 2016). Here, we provide a detailed protocol for targeted gene
knockout in the model plant Arabidopsis including a simple 1-week cloning protocol for a plant vector
system containing the Cas9 and sgRNA, and then Arabidopsis transformation and detection of
mutations.
Materials and Reagents
1. 1.5 ml microcentrifuge tubes (SARSTEDT, catalog number: 72.690.001)
2. 200 µl PCR tubes (Labomedic, catalog number: 2081644AA)
  
2
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
3. Petri dishes (SARSTEDT, catalog number: 82.1472)
4. 2 ml microcentrifuge tubes (SARSTEDT, catalog number: 72.691)
5. 20 µl pipette tips (SARSTEDT, catalog number: 70.1116)
6. 200 µl pipette tips (SARSTEDT, catalog number: 70.760.012)
7. 1,000 µl pipette tips (SARSTEDT, catalog number: 70.762.010)
8. Agrobacterium tumefaciens (A. tumefaciens) strain GV3101::pMP90
9. Arabidopsis thaliana seeds (Col-0)
10. Vectors (see Figure 1)
Figure 1. Vector maps of pUB-Cas9 (A) and pFH6 (B). pFH6 is used to integrate the 20 bp
target sequence upstream of the sgRNA scaffold and under the control of the Arabidopsis U6-
26 RNA polymerase III promoter. The whole sgRNA cassette is then transferred via Gibson
  
3
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
cloning into the binary T-DNA vector pUB-Cas9 (contains the Cas9 gene under the control of
the Ubiquitin10 promoter) for plant transformation. Maps were generated using SnapGene
Viewer (http://www.snapgene.com/products/snapgene_viewer/).
a. Plant T-DNA Cas9 vector pUB-Cas9 (GenBank accession number KY080691), containing
a Chlamydomonas reinhardtii codon-optimized ubiquitously (UBIQUITIN10 promoter)
expressed Cas9 gene, a kanamycin resistance cassette for bacterial selection and a
hygromycin resistance cassette as plant selection marker (Hahn et al., [2017]; available at
Addgene, catalog number: 86556)
b. sgRNA subcloning vector pFH6 (GenBank accession number KY080689) containing the
Arabidopsis U6-26 promoter, the integration site for the 20 bp protospacer sequence, the
sgRNA scaffold and an ampicillin resistance cassette (Hahn et al. [2017]; available at
Addgene, catalog number: 86555)
Note: pFH6 contains an additional 9 bp fragment (GTCCCTTCG) between the 3’ end of the
U6-26 promoter and the protospacer integration site. In several experiments, we could show
that this does not affect gene editing activity. However, we have also cloned a new version
of the subcloning vector without the additional fragment (pFH6_new), which shows high
cleavage activity in preliminary experiments and can be obtained from us. This version only
contains an additional guanine (G) between the 3’ end of the U6-26 promoter and the
protospacer integration site, which allows the integration of any 20 bp protospacer without
restriction of G as first bp (compare e.g., Fauser et al. [2014]). The cloning strategy for
pFH6_new is analogous to the one described in this protocol, the only difference is that the
forward primer for cloning your 20 bp protospacer sequence contains a different overlap
and lacks the need for an initial G at the beginning (ATTG-N20, compare procedure section).
11. Competent Escherichia coli (E. coli) cells (e.g., Mach1TM competent cells, Thermo Fisher
Scientific, InvitrogenTM, catalog number: C862003)
12. BbsI-HF + CutSmart buffer (New England Biolabs, catalog number: R3539S)
13. Distilled H2O
14. Plasmid mini prep kit and agarose gel extraction kit (e.g., GeneMATRIX 3 in 1–Basic DNA
Purification Kit, Roboklon, catalog number: E3545)
15. T4 DNA ligase with 10x ligation buffer (New England Biolabs, catalog number: M0202S)
16. Ampicillin (Amp) (Carl Roth, catalog number: K029.2)
17. Primers (see Table 1)
  
4
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
Table 1. List of oligonucleotides
Primer name Sequence (5’3’)
FH41 aaacgacggccagtgccaGAATTGGGCCCGACGTCG
FH42 tactgactcgtcgggtacCAAGCTATGCATCCAACGCG
FH61 CTGCCCAACGAGAAGGTGC
FH179 TATTACTGACTCGTCGGGTA
FH201 AGTCGGACAGGCGGTTGATG
FH254 gcccaattcCAAGCTATGCATCCAACGCG
FH255 catagcttgGAATTGGGCCCGACGTCG
M13F GTAAAACGACGGCCAG
M13R CAGGAAACAGCTATGAC
18. 5x Green GoTaq Reaction buffer (Promega, catalog number: M791A)
19. dNTPs (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0192)
20. GoTaq G2 polymerase (Promega, catalog number: M7841) or other standard PCR polymerase
21. HindIII-HF + CutSmart buffer (New England Biolabs, catalog number: R3104S)
22. KpnI-HF + CutSmart buffer (New England Biolabs, catalog number: R3142S)
23. Phusion High-Fidelity polymerase (New England Biolabs, catalog number: M0530S) or other
proofreading polymerase
24. Gibson Assembly Cloning Kit (New England Biolabs, catalog number: E5510S)
25. Kanamycin sulfate (Kan) (Carl Roth, catalog number: T832.4)
26. Rifampicin (Rif) (Molekula, catalog number: 32609202)
27. Gentamycin sulfate (Gent) (Carl Roth, catalog number: 0233.3)
28. Hygromycin B (Hyg) (Carl Roth, catalog number: CP12.2)
29. T7 Endonuclease I (optional; New England Biolabs, catalog number: M0302S)
30. LB medium (agar plates and liquid), supplemented with 200 μg/ml ampicillin (see Recipes)
31. LB medium (agar plates and liquid), supplemented with 30 μg/ml kanamycin sulfate (see
Recipes)
32. YEP medium (agar plates and liquid), supplemented with 150 μg/ml rifampicin, 50 μg/ml
gentamycin sulfate, 50 μg/ml kanamycin (see Recipes)
33. ½ MS medium agar plates, supplemented with 33.3 μg/ml hygromycin B (see Recipes)
Equipment
1. Agarose gel electrophoresis equipment (e.g., VWR, Peqlab, model: PerfectBlueTM Gel System
Mini M, catalog number: 700-0434)
2. Bacteria plate incubators (28 °C, 37 °C, e.g., Memmert, model: IN55) and shaker (28 °C, 37 °C;
e.g., Eppendorf, New BrunswickTM, model: Innova® 44, catalog number: M1282-0002)
3. Heating blocks (e.g., Eppendorf, model: Thermomixer Compact, catalog number: T1317-1EA)
4. PCR cycler (e.g., Thermo Fisher Scientific, Applied BiosytemsTM, model: VeritiTM 96-well
Thermal Cycler, catalog number: 4375786)
5. 10 µl pipette (e.g., Pipetman Neo P10N, Gilson, catalog number: F144562)
  
5
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
6. 20 µl pipette (e.g., P20N, Gilson, catalog number: F144563)
7. 200 µl pipette (e.g., P200N, Gilson, catalog number: F144565)
8. 1,000 µl pipette (e.g., P1000N, Gilson, catalog number: F144566)
9. Plant growth chamber (e.g., CLF Plant Climatics, Percival Scientifici, model: AR-66L)
Software
1. SerialCloner
2. Cas-OFFinder
3. 4Peaks software
4. MUSCLE (Optional)
Procedure
A. Design of sgRNA sequence for gene knockout
The design of the sgRNA is possibly the most critical step of Cas9-mediated gene editing. Thus, the
Cas9 target site should be carefully selected. Several online tools (Heigwer et al., 2014; Lei et al.,
2014; Xie et al., 2014) assist with finding suitable target sites, however, we still choose most target
sites manually in standard molecular biology software (e.g., SerialCloner,
http://serialbasics.free.fr/Serial_Cloner.html). When choosing the target site, the following aspects
should be taken into account:
1. Search your gene of interest (GOI) for a GN19NGG sequence on both strands to find putative
target sites. The NGG is the Streptococcus pyogenes Cas9 protospacer adjacent motive (PAM),
which has to be present in the target locus for efficient binding of the Cas9 protein (Jinek et al.,
2012). The GN19 represents the 20 bp long protospacer motif, defining the target site where you
want to create mutations. This 20 bp sequence, which marks the 5’ end of your sgRNA molecule,
should start with a G, since this is a prerequisite for transcription of the sgRNA under the control
of the U6-26 promoter of Arabidopsis.
Note: If there is no suitable target sequence, you might just add the G as 21st bp, even if it does
not have a complementary base in the target locus. These sgRNAs might still lead to cleavage
at the target site (e.g., Hahn et al., 2017). However, we recommend using the canonical 20 bp
protospacer sequences if possible.
2. Choose a target site in an exon of your GOI, which is preferably close to the 5’ end of the coding
sequence, since mutations in this region are more likely to disrupt the protein’s function. If you
know highly important domains of the protein, such as nucleic acid binding sites, you might want
to create mutations in these regions.
3. Consider choosing several different target sites, since not all sgRNAs work equally well (Liang
et al., 2016). Additionally, you might want to use two sgRNAs at once (see cloning strategy) to
create large deletions, which might cause more drastic effects.
  
6
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
4. Search for putative off-target sites to avoid knocking out genes that share the 20 bp target site
or highly similar sites. For this purpose, we use the Cas-OFFinder program (Bae et al., 2014),
which is available at http://www.rgenome.net/cas-offinder/. Here, we use the following settings:
PAM-Type: SpCas9 from Streptococcus pyogenes: 5’-NRG-3’ (R = A or G)
Target genome: Arabidopsis thaliana (TAIR 10)
Mismatch number: 3
After searching for your 20 bp target site in the reference genome, the program displays all
similar sites with up to 3 mismatches. If you have more than one hit with zero mismatches (one
is always your GOI), you should choose a different target site. If you have 1-3 mismatches, you
should take into account that Cas9 might also mutagenize these sites, especially if these
mismatches are at the 5’ end of the 20 bp sequence (Semenova et al., 2011). Even though the
affinity for Cas9 will be lower than to your GOI and plants seem to be in general less affected
by off targeting (Feng et al., 2014), we recommend careful sequencing of these off target site in
the knockout plants to ensure the absence of mutations in these genes.
5. Consider using a 20 bp target site that also contains a recognition site of a commercially
available restriction enzyme. The target site of the restriction enzyme should span the site of
Cas9 cleavage (3 bp in front of the PAM). This will allow you to use the restriction enzyme length
polymorphism assay to detect mutations in your GOI.
B. Subcloning of 20 bp protospacer sequence into pFH6
1. An overview how to perform the subcloning of the protospacer sequence into pFH6 is given in
Figure 2.
2. Order forward and reverse primers for your candidate target sequence N20 with overlaps for
cloning and dilute them to a final concentration (f.c.) of 10 μM.
Forward primer: TTCG-GN19
Reverse primer: AAAC-N19 (reverse complement) C (see Figure 2)
  
7
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
Figure 2. Subcloning of protospacer sequence in pFH6. The 20 bp protospacer sequence
can be integrated between the sgRNA scaffold and the U6-26 promoter (U6p) by ligation of
dimerized primers into BbsI-digested pFH6 vector.
3. Pipette 10 μl of each primer dilution into a 1.5 ml microcentrifuge tube and mix.
4. Heat primer mix to 98 °C, 10 min, then 55 °C, 10 min, afterwards slowly cool down to RT (e.g.,
by switching off the heating block). By doing so, a double stranded DNA including your
protospacer sequence (= annealed primers) will be generated.
5. Digest pFH6 with BbsI-HF for 3 h at 37 °C.
pFH6 3 μg
10x CutSmart buffer 5 μl
ddH2O to 49 μl
BbsI-HF (20 U/μl) 1 μl
  
8
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
6. Run the restriction digest on an agarose gel and extract the vector backbone (3,612 bp) from
the gel using the GeneMATRIX 3 in 1–Basic DNA Purification Kit.
7. Ligate annealed primers with digested pFH6 at 4 °C overnight.
pFH6 backbone 300 ng
Annealed primers 1 μl
10x ligation buffer 2 μl
ddH2O to 19 μl
T4 DNA ligase 1 μl
8. Transform competent MachI E. coli cells with the ligation reaction and spread the transformed
cells on LB agar plates supplemented with Amp.
Note: Usually, plating 100 μl of the transformation mixture is sufficient. Protocols for
transformation of E. coli cells are provided from the authors upon request.
9. Verify eight E. coli colonies by colony PCR using primer M13R and your protospacer primer
TTCG-N20 with the following setup:
5x Green GoTaq Reaction buffer 4 μl
M13R (10 μM) 1 μl
TTCG-N20 (10 μM) 1 μl
dNTPs (10 mM each) 0.4 μl
ddH2O 13.4 μl
GoTaq G2 polymerase (5 U/μl) 0.2 μl
Pick half of a colony with a pipette tip and suspend it in the
PCR reaction.
Use the other half of the colony for inoculation.
PCR program:
Initial denaturation 95 °C 2 min
Denaturation 95 °C 30 sec
Annealing 51 °C 30 sec 35 cycles
Elongation 72 °C 15 sec
Final elongation 72 °C 5 min
Storage 20 °C
Note: We recommend using pFH6 as negative control. We have sometimes observed fragments
at the expected band size (281 bp) in the negative control since the protospacer primer might
partly bind to the BbsI-sites. However, positive colonies usually have a much stronger PCR
product signal and can therefore be distinguished from negative clones.
10. Inoculate positive colony in LB medium supplemented with Amp and grow overnight.
11. Purify the plasmid using the GeneMATRIX 3 in 1–Basic DNA Purification Kit.
  
9
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
12. Sequence the plasmid and verify the sequence of the protospacer insertion using primer M13R
(Table 1).
C. Cloning of final plant T-DNA Cas9 vector using Gibson Assembly
1. An overview how to clone the final plant T-DNA Cas9 vector is given in Figure 3.
Figure 3. Generation of a plant T-DNA vector with all necessary components for Cas9
induced mutagenesis. The sgRNA cassette including the 20 bp target site is amplified from
pFH6 and integrated into KpnI/HindIII-digested pUB-Cas9 via Gibson Assembly. The resulting
vector contains the sgRNA cassette as well as the Cas9 gene under the control of the
UBIQUITIN10 promoter (UB10p), and the hygromycin (Hyg) resistance gene as selection
marker. RB, right T-DNA border; PolyT, polythymidine transcription terminator; NLS, nuclear
localization signal; NosTm, nopaline synthase terminator; CaMV35S, Cauliflower Mosaic Virus
2x35S promoter; 35STm, 35S terminator; LB, left T-DNA border.
  
10
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
2. Digest vector pUB-Cas9 with HindIII-HF and KpnI-HF for 3 h at 37 °C.
pUB-Cas9 3 μg
10x CutSmart buffer 5 μl
ddH2O to 48 μl
KpnI-HF (20 U/μl) 1 μl
HindIII-HF (20 U/μl) 1 μl
Note: Efficient digestion of the pUB-Cas9 plasmid is critical for further cloning steps. In case you
have problems in the subsequent cloning steps, try to digest pUB-Cas9 with a fresh batch of
enzymes and longer incubation times.
3. Run out the restriction digest reaction on an agarose gel and extract the vector backbone
(14,097 bp) from the gel using the GeneMATRIX 3 in 1–Basic DNA Purification Kit.
4. Amplify the sgRNA cassette (expected size: 771 bp) from pFH6 with target sequence using
primer FH41 and FH42 (Table 1) and Phusion High-Fidelity polymerase and the following setup:
5x Phusion HF-buffer 10 μl
FH41 (10 μM) 2.5 μl
FH42 (10 μM) 2.5 μl
dNTPs (10 mM each) 1 μl
ddH2O 33 μl
pFH6 with target sequence (100 ng/μl) 0.5 μl
Phusion DNA polymerase (2 U/μl) 0.5 μl
PCR program:
Initial denaturation 98 °C 30 sec
Denaturation 98 °C 15 sec
Annealing 69 °C 30 sec 35 cycles
Elongation 72 °C 20 sec
Final elongation 72 °C 5 min
Storage 20 °C
5. Run out the PCR reaction on an agarose gel and extract the sgRNA cassette (771 bp) from the
gel using the GeneMATRIX 3 in 1–Basic DNA Purification Kit.
6. Assemble the pUB-Cas9 backbone and the sgRNA cassette to generate the final vector pUB-
Cas9-@GOI using Gibson Assembly Master Mix according to the manufacturer’s instruction
with an incubation time of 1 h.
Note: We propose a nomenclature for the final constructs, where the target gene is marked by
the @-sign. A vector designed against the GL1 gene of Arabidopsis would therefore be called
pUB-Cas9-@GL1 (Hahn et al., 2017).
  
11
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
7. Transform competent E. coli cells with the Gibson reaction mixture and spread the transformed
cells on LB agar plates supplemented with Kan.
Note: New England Biolabs provides highly competent E. coli cells in the Gibson Assembly
Cloning Kit. However, we also used competent E. coli cells produced in our lab. Since these are
usually less competent, we recommend plating all transformed cells on the LB agar plate. A
protocol for generation of competent MachI E. coli can be found in Sambrook and Russell (2006).
8. Verify eight positive colonies by colony PCR using primer M13F and FH179 (Table 1) with the
following setup:
5x Green GoTaq Reaction buffer 4 μl
M13F (10 μM) 1 μl
FH179 (10 μM) 1 μl
dNTPs (10 mM each) 0.4 μl
ddH2O 13.4 μl
GoTaq G2 polymerase (5 U/μl) 0.2 μl
Pick half of a colony with a pipette tip and suspend it
in the PCR reaction.
Use the other half of the colony for inoculation.
PCR program:
Initial denaturation 95 °C 2 min
Denaturation 95 °C 30 sec
Annealing 52 °C 30 sec 35 cycles
Elongation 72 °C 45 sec
Final elongation 72 °C 5 min
Storage 20 °C
Note: Expected product size is 779 bp, pUB-Cas9 vector can be used as negative control.
9. Inoculate positive colony into LB medium supplemented with Kan and let grow overnight.
10. Purify the plasmid using the GeneMATRIX 3 in 1–Basic DNA Purification Kit.
11. Sequence the plasmid for verification of protospacer sequence insertion using primer FH179
and M13F (Table 1).
Note: The vector system also allows cloning of two different sgRNAs into the pUB-Cas9 vector
backbone to induce large deletions in the target genome or to destroy two genes at once.
Therefore, both protospacer sequences have to be cloned separately into pFH6 as described.
Then, the first sgRNA cassette has to be amplified from its subcloning pFH6-construct using the
primers FH41 and FH254 (Table 1). The second sgRNA cassette has to be amplified with FH42
and FH255 (Table 1), using the PCR conditions described above. Using the Gibson Assembly
Master Mix, both cassettes can be integrated into KpnI-HF/HindIII-HF-digested pUB-Cas9 in a
single step. As two fragments are integrated into the digested vector, the amount of colonies is
  
12
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
usually lower compared to the integration of one fragment. However, the proportion of correctly
assembled vectors is comparable. The colony PCR can be performed with the same primers
but using a longer elongation time (1.5 min), since the PCR reaction amplifies both sgRNA
cassettes (expected product size: 1,512 bp). Sequencing should be performed as described
above.
All cloning steps are summarized in Table 2:
Table 2. Timetable for cloning of plant T-DNA Cas9 vector for targeted gene knockout
D. Arabidopsis transformation with pUB-Cas9-@GOI
1. Transform competent A. tumefaciens cells with 1 μg of pUB-Cas9-@GOI and spread the
transformed cells on YEP agar plates supplemented with Rif/Gent/Kan.
Note: Protocols for generation of competent A. tumefaciens cells and transformation of A.
tumefaciens cells are described elsewhere (Hofgen and Willmitzer, 1988).
2. After two days of growth at 30 °C, verify plasmid presence in at least three colonies by colony
PCR using primer FH61 and FH201 (Table 1). In order to verify colony, pick half of a colony with
a pipette tip and suspend cells in a 1.5 ml microcentrifuge tube containing 100 μl ddH2O. Heat
to 98 °C for 10 min and use 2 μl as DNA template for the PCR. Streak the other half of the
colony on a fresh YEP agar plate supplemented with Rif/Gent/Kan. Grow cells at 30 °C for one
day and then store at 4 °C. For the colony PCR, use the following setup:
  
13
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
5x GoTaq Green Reaction buffer 4 μl
FH61 (10 μM) 1 μl
FH201 (10 μM) 1 μl
dNTPs (10 mM each) 0.4 μl
ddH2O 11.4 μl
DNA template 2 μl
GoTaq G2 polymerase (5 U/μl) 0.2 μl
PCR program:
Initial denaturation 95 °C 2 min
Denaturation 95 °C 30 sec
Annealing 60 °C 30 sec 35 cycles
Elongation 72 °C 1 min
Final elongation 72 °C 5 min
Storage 20 °C
Note: Expected product size is 1,003 bp.
3. Transform Arabidopsis plants using Agrobacterium-mediated T-DNA transfer with the floral
dipping method (Clough and Bent, 1998).
Note: Per construct, we usually transform four pots with five Arabidopsis plants, each. We
recommend removing of all present siliques before transformation to avoid excessive screening
for transformation events afterwards.
4. Select the T1 generation plants for successful T-DNA insertion events on ½ strength MS agar
plates supplemented with Hyg. Verify the integration of the T-DNA by isolating leaf genomic DNA
(gDNA) and subsequent PCR using primers FH61/FH201with the parameters described before.
Note: A detailed protocol for plant gDNA extraction by isopropanol precipitation can be found
elsewhere (Weigel and Glazebrook, 2009).
E. Detection of Cas9 induced mutations
The Cas9 protein in our vector system is transcribed under the control of the UBIQUITIN10 promoter
of Arabidopsis, which allows Cas9 expression in nearly all tissues of the plant (Norris et al., 1993).
Since the editing mechanisms of the Cas9 system work independently in each plant cell, T1
generation plants are usually chimeras with distinct genotypes in different cells. Only if mutations
occur in germline cells, can progeny plants arise that have a uniform genotype. This is usually the
prerequisite for further analyses. Therefore (and due to the limited amount of plants available in the
T1 generation), screening approaches for detection of mutations should be applied to T2 or following
generations. We recommend screening descendants of three to four independent transformed lines,
since mutation efficiencies might vary between different lines due to the integration site of the T-
  
14
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
DNA cassette. To choose promising T1 lines for further screening, we also searched for mutational
events in the T1 generation. We suggest to screen the plants for mutation in this way:
1. Amplify the genomic region around the Cas9 cutting site in your GOI300-500 bp upstream
and downstream) with gene specific primers from leaf gDNA using Phusion polymerase.
5x Phusion HF- buffer 10 μl
Forward primer (10 μM) 2.5 μl
Reverse primer (10 μM) 2.5 μl
dNTPs (10 mM each) 1 μl
ddH2O 32.5 μl
Leaf gDNA 1 μl
Phusion DNA polymerase (2 U/μl) 0.5 μl
PCR program:
Initial denaturation 98 °C 2 min
Denaturation 98 °C 15 sec
Annealing variable 30 sec 35 cycles
Elongation 72 °C 30 sec/kb
Final elongation 72 °C 5 min
Storage 20 °C
2. Run out the PCR products on an agarose gel and extract your GOI from the gel using the
GeneMATRIX 3 in 1–Basic DNA Purification Kit.
3. Sequence PCR product with Sanger sequencing. When Cas9 was active and mutations
occurred at least in a part of the leaf cells, the sequencing histogram will show a mixture of WT
sequence and mutated sequences (Figure 4).
Figure 4. Exemplary sequencing result histogram of amplified target gene from chimeric
leaf gDNA. Double peaks appear at the site of Cas9 cleavage (3 bp in front of the PAM motive
NGG) pointing to mutation events in the GOI in a part of the leaf cells.
  
15
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
The efficiency of the Cas9 system varies considerably as its mutagenic effect relies on various
aspects, such as: the plant species, Cas9 and sgRNA expression levels, and the sequence of
the target loci (Bortesi and Fischer, 2015; Paul and Qi, 2016). Therefore, it is difficult to predict
how many plants have to be screened to identify a heritable mutation. We recommend starting
screening 30 plants per line. Screening for mutations in the T2 generation can be performed by
amplification and Sanger sequencing of your GOI as described before. As this can become
costly, several methods enable detecting mutations on genomic level without sequencing.
4. If you expect a specific phenotype due to the knockout of your gene, the easiest way to screen
for mutations is a visual screen in the first place. These phenotypes can be changes in anatomy
or survival of plants on selection medium. Plants that show a phenotype are then analyzed on
genomic level as described above.
5. If you target two sites in your GOI at the same time, a simultaneous cleavage with two sgRNAs
can result in large deletions, which can already be detected during the PCR amplification of your
GOI (Figure 5A). Larger deletions can in theory also occur using one sgRNA, however, we
usually discovered small indels in the range of a few bp, which usually cannot be detected by
PCR product size difference using agarose gel electrophoresis.
Note: If you expect that only few cells contain the expected mutation (e.g., in chimeric plants),
you can improve the PCR amplification efficiency of the mutant alleles by digesting unmutated
gDNA with a restriction enzyme that cuts between the two sgRNA target sites before PCR
amplification of your GOI.
Figure 5. Summary of methods that allow the detection of induced mutations after
amplification of the GOI with a forward (FW) and reverse (RV) primer (green arrows). A.
  
16
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
Usage of two sgRNAs can induce larger deletions in the GOI, which can be detected by PCR
amplicon size difference between WT and mutated GOI (goi). B. If a restriction site (red letters)
is present in the mutagenic region 3 bp in front of the PAM site (bold, underlined), mutations
(blue X) lead to cleavage resistant PCR amplicons. C. The T7 Endonuclease assay allows
cleavage of heteroduplexes, which are produced by imperfect DNA pairing due to mutations on
one strand of the DNA amplicon (red asterisk).
6. The restriction fragment length polymorphism (RFLP) assay is an elegant method to detect bp
exchanges or small indels in your GOI. The advantage of this method is that heterozygous,
biallelic and homozygous mutations can be detected (Figure 5B). The RFLP assay relies on the
disruption of a restriction enzyme target site by Cas9 induced mutations. Therefore, the
restriction enzyme target site should span the region at 3 bp in front of the PAM motive. For
detection of mutations, the GOI is amplified with gene specific primers as described above. The
PCR amplicon is then digested with the restriction enzyme of choice according to the
manufacturer’s instructions. The sizes of the restriction fragments are analyzed by agarose gel
electrophoresis. For the RFLP assay, amplify your GOI as described before. Separate the PCR
products on an agarose gel and extract the PCR product from the gel using the GeneMATRIX
3 in 1–Basic DNA Purification Kit. Digest the PCR product with the suitable restriction enzyme
according to the manufacturer’s instruction.
Notes:
a. WT gDNA should be used as negative control.
b. In case you have a homozygous or a heterozygous mutation in your GOI, you either get
only the undigested PCR amplicon or a mixture of undigested and digested PCR bands.
c. It can be favorable if your PCR product contains more than one cleavage site of your
restriction enzyme (which are not targeted by the Cas9) as it provides you with an internal
control that the digest itself worked.
d. If you have already detected mutations in your T1 plants by sequencing, you can use the
sequenced PCR product as positive control for this assay.
e. If you expect only small amounts of mutant alleles (e.g., in chimeric plants), you can enrich
these amplicons by digesting the gDNA with the restriction enzyme before PCR
amplification of your GOI. In this case, no other cut sites besides the one in the sgRNA
target site should be present between your primer annealing sites.
7. The T7 endonuclease assay and the Surveyor assay allow detection of small indels and bp
exchanges in your target site (Figure 5C). First, the GOI is PCR amplified using a proofreading
DNA polymerase. The PCR amplicon is then denatured and reannealed. In this step, ssDNA
strands containing a mutation will anneal to DNA strands that do not contain a mutation, leading
to non-perfectly matching dsDNA strands. These heteroduplexes are then recognized and
cleaved by the T7 Endonuclease I or the Surveyor Nuclease. The restriction fragment pattern is
analyzed by agarose gel electrophoresis. The advantage of these methods is that they do not
  
17
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
require a restriction site within your gRNA target site. For details on this method, we refer to
detailed protocols of the Endonuclease suppliers (e.g.,
https://www.neb.com/protocols/2014/08/11/determining-genome-targeting-efficiency-using-t7-
endonuclease-i) and the experimental procedures of other research groups (Mao et al., 2013;
Xie and Yang, 2013; Qiu et al., 2004).
Note: These assays are not able to detect homozygous mutations as no heteroduplexes occur.
Data analysis
1. There is no specific requirement for large-scale data analysis to generate Cas9-mediated
knockout mutants. The mutagenic effect of the Cas9 system varies considerably depending on
the plant species, Cas9 and sgRNA expression levels, and the sequence of the target loci
(Bortesi and Fischer, 2015; Paul and Qi, 2016). Additionally, the Cas9 system produces chimeric
plants due to the possibility of independent mutation events in each cell. Therefore, statistical
analyses of mutation efficiencies are complicated and the results of one experiment might not
be transferable to another one, especially if a different sgRNA is used.
2. Sequencing data obtained from transformed plants can be compared to sequences from WT
plants using alignment tools like MUSCLE with default settings (Edgar, 2004). Sequencing
histograms can be analyzed using 4Peaks software.
Notes
1. All analyses on gDNA level (sequencing, RFLP-assay, T7 assay) rely on the gDNA of a single
leaf. If your knockout mutant does not display a visible phenotype and the Cas9 cassette is still
integrated into the plant genome, it is difficult to tell whether you are analyzing a chimeric
mutation only present in the leaf that you used for gDNA isolation or if your whole plant is already
mutagenized. You should therefore consider the following aspects.
a. Isolation of gDNA from several different leaves followed by GOI-amplification should result
in similar sequencing histograms.
b. The mutation should show a Mendelian inheritance pattern in the progeny generation.
c. Loss of the Cas9 T-DNA cassette by backcrossing and/or segregation should not affect the
mutation. The presence of the Cas9 T-DNA can be detected by PCR using primers
FH61/FH201 and plant gDNA as template.
Recipes
1. LB-medium
10 g/L Bacto-tryptone (BD)
5 g/L yeast extract (BD)
  
18
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
5 g/L NaCl (Fisher Scientific)
Optional: 15 g/L Bacto agar for plates (BD)
2. YEP-medium
10 g/L yeast extract (BD)
10 g/L Bacto-peptone (BD)
5 g/L NaCl
Optional: 15 g/L Bacto agar for plates (BD)
3. ½ MS-medium
2.2 g/L Murashige & Skoog medium (Duchefa Biochemie)
0.5 g/L MES (Carl Roth)
Adjust pH to 5.7 with KOH (Carl Roth)
Optional: 8 g/L plant agar for plates (Duchefa Biochemie)
Acknowledgments
This work was funded by the Cluster of Excellence on Plant Science (CEPLAS, EXC 1028) and the
HHU Center for Synthetic Life Sciences (CSL). We thank Peter Hegemann and André Greiner
(Humboldt-Universität zu Berlin) for providing us with Cas9 and sgRNA genes. We thank Holger
Puchta, Felix Wolter and Dr. Nadine Rademacher for helpful discussions. We thank Franziska
Kuhnert for critical reading of the manuscript. The protocol is adapted from Hahn et al. (2017).
References
1. Bae, S., Park, J., and Kim, J. S. (2014). Cas-OFFinder: a fast and versatile algorithm that
searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics
30(10): 1473-1475.
2. Baltes, N. J. and Voytas, D. F. (2015). Enabling plant synthetic biology through genome
engineering. Trends Biotechnol 33(2): 120-131.
3. Bortesi, L. and Fischer, R. (2015). The CRISPR/Cas9 system for plant genome editing and
beyond. Biotechnol Adv 33(1): 41-52.
4. Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J 16(6): 735-743.
5. Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res 32(5), 1792-1797.
6. Fauser, F., Schiml, S., and Puchta, H. (2014). Both CRISPR/Cas-based nucleases and nickases
can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J 79(2): 348-359.
7. Feng, Z., Mao, Y., Xu, N., Zhang, B., Wei, P., Yang, D. L., Wang, Z., Zhang, Z., Zheng, R., Yang,
L., Zeng, L., Liu, X. and Zhu, J. K. (2014). Multigeneration analysis reveals the inheritance,
  
19
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc Natl
Acad Sci U S A 111(12): 4632-4637.
8. Hahn, F., Mantegazza, O., Greiner, A., Hegemann, P., Eisenhut, M. and Weber, A. P. (2017).
An efficient visual screen for CRISPR/Cas9 activity in Arabidopsis thaliana. Front Plant Sci 8:
39.
9. Heigwer, F., Kerr, G. and Boutros, M. (2014). E-CRISP: fast CRISPR target site identification.
Nat Methods 11(2): 122-123.
10. Hofgen, R. and Willmitzer, L. (1988). Storage of competent cells for Agrobacterium
transformation. Nucleic Acids Res 16(20): 9877.
11. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A. and Charpentier, E. (2012). A
programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science
337(6096): 816-821.
12. Lei, Y., Lu, L., Liu, H. Y., Li, S., Xing, F. and Chen, L. L. (2014). CRISPR-P: a web tool for
synthetic single-guide RNA design of CRISPR-system in plants. Mol Plant 7(9): 1494-1496.
13. Liang, G., Zhang, H., Lou, D. and Yu, D. (2016). Selection of highly efficient sgRNAs for
CRISPR/Cas9-based plant genome editing. Sci Rep 6: 21451.
14. Mao, Y., Zhang, H., Xu, N., Zhang, B., Gou, F. and Zhu, J. K. (2013). Application of the CRISPR-
Cas system for efficient genome engineering in plants. Mol Plant 6(6): 2008-2011.
15. Norris, S. R., Meyer, S. E. and Callis, J. (1993). The intron of Arabidopsis thaliana polyubiquitin
genes is conserved in location and is a quantitative determinant of chimeric gene expression.
Plant Mol Biol 21(5): 895-906.
16. Pacher, M. and Puchta, H. (2016). From classical mutagenesis to nuclease-based breeding -
directing natural DNA repair for a natural end-product. Plant J.
17. Paul, J. W., 3rd and Qi, Y. (2016). CRISPR/Cas9 for plant genome editing: accomplishments,
problems and prospects. Plant Cell Rep 35(7): 1417-1427.
18. Qiu, P., Shandilya, H., D'Alessio, J. M., O'Connor, K., Durocher, J. and Gerard, G. F. (2004).
Mutation detection using Surveyor nuclease. Biotechniques 36(4): 702-707.
19. Salomon, S. and Puchta, H. (1998). Capture of genomic and T-DNA sequences during double-
strand break repair in somatic plant cells. EMBO J 17(20): 6086-6095.
20. Sambrook, J. and Russell, D. W. (2006). The inoue method for preparation and transformation
of competent E. coli: "ultra-competent" cells. CSH Protoc 2006(1).
21. Schiml, S., Fauser, F., and Puchta, H. (2014). The CRISPR/Cas system can be used as
nuclease for in planta gene targeting and as paired nickases for directed mutagenesis in
Arabidopsis resulting in heritable progeny. Plant J 80: 1139-1150.
22. Schiml, S. and Puchta, H. (2016). Revolutionizing plant biology: multiple ways of genome
engineering by CRISPR/Cas. Plant Methods 12: 8.
23. Semenova, E., Jore, M. M., Datsenko, K. A., Semenova, A., Westra, E. R., Wanner, B., van der
Oost, J., Brouns, S. J. and Severinov, K. (2011). Interference by clustered regularly interspaced
  
20
www.bio-protocol.org/e2384
Vol 7, Iss 13, Jul 05, 2017
DOI:10.21769/BioProtoc.2384
short palindromic repeat (CRISPR) RNA is governed by a seed sequence. Proc Natl Acad Sci
U S A 108(25): 10098-10103.
24. Weigel, D. and Glazebrook, J. (2009). Quick miniprep for plant DNA isolation. Cold Spring Harb
Protoc 2009(3): pdb prot5179.
25. Xie, K. and Yang, Y. (2013). RNA-guided genome editing in plants using a CRISPR-Cas system.
Mol Plant 6(6): 1975-1983.
26. Xie, K., Zhang, J. and Yang, Y. (2014). Genome-wide prediction of highly specific guide RNA
spacers for CRISPR-Cas9-mediated genome editing in model plants and major crops. Mol Plant
7(5): 923-926.
ResearchGate has not been able to resolve any citations for this publication.
  • Article
    Full-text available
    The production of mutants of crop plants by the use of chemical or physical genotoxins has a long tradition. These factors induce the natural DNA repair machinery to repair damages in an error-prone way. In case of radiation, multiple double strand breaks (DSBs) are induced randomly in the genome, leading in very rare cases to a desirable phenotype. In recent years the use of synthetic, site directed nucleases (SDNs), also referred to as sequence specific nucleases (SSNs), like the CRISPR/Cas system, enabled scientists to use exactly the same naturally occurring DNA repair mechanisms for the controlled induction of genomic changes at predefined sites in plant genomes. As these changes are not necessarily associated with the permanent integration of foreign DNA, the obtained organisms per se cannot be regarded as genetically modified as there is no way to distinguish it from natural variants. This applies to changes induced by DSBs, as well as single strand breaks (SSBs), and involves repair by Non-Homologous End-Joining (NHEJ) and Homologous Recombination (HR). The recent development of SDN-based "DNA-free" approaches makes the discrimination between mutagenesis strategies in classical breeding indistinguishable from SDN-derived targeted genome modifications, even in regard to current regulatory rules. With the advent of the new SDN technologies, much faster and more precise genome editing becomes available at reasonable costs and potentially not requiring time consuming deregulation of newly created phenotypes. This review will focus on classical mutagenesis breeding and the application of newly developed SDNs in order to emphasize similarities in context of the regulatory situation for genetically modified crop plants. This article is protected by copyright. All rights reserved.
  • Article
    Full-text available
    The increasing burden of the world population on agriculture requires the development of more robust crops. Dissecting the basic biology that underlies plant development and stress responses will inform the design of better crops. One powerful tool for studying plants at the molecular level is the RNA-programmed genome editing system composed of a clustered regularly interspaced short palindromic repeats (CRISPR)-encoded guide RNA and the nuclease Cas9. Here, some of the recent advances in CRISPR/Cas9 technology that have profound implications for improving the study of plant biology are described. These tools are also paving the way towards new horizons for biotechnologies and crop development.
  • Article
    Full-text available
    The CRISPR/Cas9-sgRNA system has been developed to mediate genome editing and become a powerful tool for biological research. Employing the CRISPR/Cas9-sgRNA system for genome editing and manipulation has accelerated research and expanded researchers’ ability to generate genetic models. However, the method evaluating the efficiency of sgRNAs is lacking in plants. Based on the nucleotide compositions and secondary structures of sgRNAs which have been experimentally validated in plants, we instituted criteria to design efficient sgRNAs. To facilitate the assembly of multiple sgRNA cassettes, we also developed a new strategy to rapidly construct CRISPR/Cas9-sgRNA system for multiplex editing in plants. In theory, up to ten single guide RNA (sgRNA) cassettes can be simultaneously assembled into the final binary vectors. As a proof of concept, 21 sgRNAs complying with the criteria were designed and the corresponding Cas9/sgRNAs expression vectors were constructed. Sequencing analysis of transgenic rice plants suggested that 82% of the desired target sites were edited with deletion, insertion, substitution, and inversion, displaying high editing efficiency. This work provides a convenient approach to select efficient sgRNAs for target editing.
  • Article
    Full-text available
    The precise manipulation of plant genomes relies on the induction of DNA double-strand breaks by site-specific nucleases to initiate DNA repair reactions that are either based on non-homologous end joining (NHEJ) or homologous recombination (HR). Recently, the CRISPR/Cas system emerged as the most important tool for genome engineering due to its simple structure and its applicability to a wide range of organisms. Here, we review the current status of its various applications in plants, where it is used for the successful generation of stable mutations in a steadily growing number of species through NHEJ. Furthermore, tremendous progress in plant genome engineering by HR was obtained by the setup of replicon mediated and in planta gene targeting techniques. Finally, other complex approaches that rely on the induction of more than one DNA lesion at a time such as paired nickases to avoid off-site effects or controlled genomic deletions are beginning to be applied routinely.
  • Article
    Full-text available
    Targeted genome editing using artificial nucleases has the potential to accelerate basic research as well as plant breeding by providing the means to modify genomes rapidly in a precise and predictable manner. Here we describe the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) system, a recently-developed tool for the introduction of site-specific double stranded DNA breaks. We highlight the strengths and weaknesses of this technology compared with two well-established genome editing platforms: zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). We summarize recent results obtained in plants using CRISPR/Cas9 technology, discuss possible applications in plant breeding and consider potential future developments. Copyright © 2014. Published by Elsevier Inc.
  • Article
    Full-text available
    Synthetic biology seeks to create new biological systems, including user-designed plants and plant cells. These systems can be employed for a variety of purposes, ranging from producing compounds of industrial or therapeutic value, to reducing crop losses by altering cellular responses to pathogens or climate change. To realize the full potential of plant synthetic biology, techniques are required that provide control over the genetic code - enabling targeted modifications to DNA sequences within living plant cells. Such control is now within reach owing to recent advances in the use of sequence-specific nucleases to precisely engineer genomes. We discuss here the enormous potential provided by genome engineering for plant synthetic biology. Copyright © 2014 Elsevier Ltd. All rights reserved.
  • Article
    The CRISPR/Cas nuclease is becoming a major tool for targeted mutagenesis in eukaryotes by inducing double-strand breaks (DSBs) at preselected genomic sites that are repaired by non-homologous end-joining (NHEJ) in an error-prone way. In plants, it could be demonstrated that the Cas9 nuclease is able to induce heritable mutations in Arabidopsis thaliana and rice. Gene targeting (GT) by homologous recombination (HR) can also be induced by DSBs. Using a natural nuclease and marker genes, we previously developed an in planta GT strategy in which both a targeting vector and targeting locus are activated simultaneously via DSB induction during plant development. Here, we demonstrate that this strategy can be used for natural genes by CRISPR/Cas-mediated DSB induction. We were able to integrate a resistance cassette into the ADH1 locus of A. thaliana via HR. Heritable events were identified using a PCR-based genotyping approach, characterised by Southern blotting and confirmed on the sequence level. A major concern is the specificity of the CRISPR/Cas nucleases. Off-target effects might be avoided using two adjacent sgRNA target sequences to guide the Cas9 nickase to each of the two DNA strands, resulting in the formation of a DSB. By amplicon deep sequencing, we demonstrate that this Cas9 paired nickase strategy has a mutagenic potential comparable to that of the nuclease, while the resulting mutations are mostly deletions. We also demonstrate the stable inheritance of such mutations in A. thaliana.This article is protected by copyright. All rights reserved.
  • Article
    Full-text available
    Engineered nucleases can be used to induce site-specific double strand breaks (DSBs) in plant genomes. Thus, homologous recombination (HR) can be enhanced and targeted mutagenesis can be achieved by error-prone non-homologous end joining (NHEJ). Recently, the bacterial CRISPR/Cas9 system was used for DSB induction in plants to promote HR and NHEJ. Cas9 can also be engineered to work as a nickase inducing single-strand breaks (SSBs). Here we show that only the nuclease but not the nickase is an efficient tool for NHEJ-mediated mutagenesis in plants. We demonstrate the stable inheritance of nuclease-induced targeted mutagenesis events in the ADH1 and TT4 genes of Arabidopsis thaliana at frequencies from 2.5% up to 70.0%. Deep sequencing analysis revealed NHEJ-mediated DSB repair in about a third of all reads in T1 plants. In contrast, applying the nickase resulted in the reduction of mutation frequency by at least 740-fold. Nevertheless, the nickase is able to induce HR at similar efficiencies as the nuclease or the homing endonuclease I-SceI. Two different types of somatic HR mechanisms, recombination between tandemly arranged direct repeats as well as gene conversion using the information on an inverted repeat could be enhanced by the nickase to a similar extent as by DSB-inducing enzymes. Thus, the Cas9 nickase has the potential to become an important tool for genome engineering in plants. It should not only be applicable for HR-mediated gene targeting systems but also by the combined action of two nickases as DSB-inducing agents excluding off-target effects in homologous genomic regions.This article is protected by copyright. All rights reserved.