- Access to this full-text is provided by Springer Nature.
- Learn more
Download available
Content available from BMC Complementary and Alternative Medicine
This content is subject to copyright. Terms and conditions apply.
R E S E A R C H A R T I C L E Open Access
Effects of Karela (Bitter Melon; Momordica
charantia) on genes of lipids and
carbohydrates metabolism in experimental
hypercholesterolemia: biochemical,
molecular and histopathological study
Dalia Yossri Saad
1,2
, Mohamed Mohamed Soliman
1,3*
, Ahmed A. Baiomy
2,4
, Magdy Hassan Yassin
5,6
and Hanan Basiouni El-Sawy
7
Abstract
Background: Hypercholesterolemia is a serious diseases associated with type-2 diabetes, atherosclerosis,
cardiovascular disorders and liver diseases. Humans seek for safe herbal medication such as karela (Momordica
charantia/bitter melon) to treat such disorders to avoid side effect of pharmacotherapies widely used.
Methods: Forty male Wistar rats were divided into four equal groups; control group with free access to food and
water, cholesterol administered group (40 mg/kg BW orally); karela administered group (5 g /kg BW orally) and mixture
of cholesterol and karela. The treatments continued for 10 weeks. Karela was given for hypercholesterolemic rats after
6 weeks of cholesterol administration. Serum, liver and epididymal adipose tissues were taken for biochemical,
histopathological and genetic assessments.
Results: Hypercholesterolemia induced a decrease in serum superoxide dismutase (SOD), catalase, reduced glutathione
(GSH) and an increase in malondialdehyde (MDA) levels that were ameliorated by karela administration.
Hypercholesterolemia up regulated antioxidants mRNA expression and altered the expression of carbohydrate
metabolism genes. In parallel, hypercholesterolemic groups showed significant changes in the expression of PPAR-alpha
and gamma, lipolysis, lipogenesis and cholesterol metabolism such as carnitine palmitoyltransferase-1 (CPT-1). Acyl CoA
oxidase (ACO), fatty acids synthase (FAS), sterol responsible element binding protein-1c (SREBP1c), 3-hydroxy-3-
methylglutaryl coenzyme A reductase (HMG-CoAR) and cholesterol 7α-hydroxylase (CYP7A1) at hepatic and adipose
tissue levels. Interestingly, Karela ameliorated all altered genes confirming its hypocholesterolemic effect.
Histopathological and immunohistochemical findings revealed that hypercholesterolemia induced hepatic tissue
changes compared with control. These changes include cholesterol clefts, necrosis, karyolysis and sever congestion of
portal blood vessel. Caspase-3 immunoreactivity showed positive expression in hepatic cells of hypercholesterolemic rats
compared to control. All were counteracted and normalized after Karela administration to hypercholesterolemic group.
Conclusion: Current findings confirmed that karela is a potential supplement useful in treatment of
hypercholesterolemia and its associated disorders and is good for human health.
Keywords: Carbohydrate, Gene expression, Hypercholesterolemia Karela, Lipids
* Correspondence: mohamedsoliman8896@yahoo.com
1
Medical Laboratory Department, Faculty of Applied Medical Sciences, Taif
University, Turabah, Saudi Arabia
3
Department of Biochemistry, College of Veterinary Medicine, Benha
University, Moshtohor, P.O. 13736, Benha, Egypt
Full list of author information is available at the end of the article
© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319
DOI 10.1186/s12906-017-1833-x
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Background
Metabolic syndrome has become the most prevalent
worldwide epidemic diseases in recent decades. A recent
national health survey conducted in mainland China re-
vealed that 60 million people are obese and 200 million
are overweight [1]. As known, liver is the functional tis-
sue that controls the production of triglycerides (TGs)
and glucose for use by other tissues, all are regulated by
lipogenesis and gluconeogenesis [2]. Studies have dem-
onstrated that excessive lipid accumulation in the liver is
associated with oxidative stress and hepatic mitochon-
drial dysfunction [3, 4]. High-fat diet induced overpro-
duction of reactive oxygen species in adipose tissue and
liver [5].
Obesity, hypertriglyceridemia, and/or hypercholester-
olemia are the common causes for many diseases such
as cardiovascular [6] and liver diseases [7]. Rat fed with
high cholesterol diet can be used as model of the human
obesity syndrome [8]. The liver is the first organ to
metabolize the ingested cholesterol and it is affected by
oxidative stress that results from an imbalance between
the production of free radicals and effectiveness of
antioxidant systems [9]. Rats fed high cholesterol diet
showed several abnormalities in liver sections such as
cholesterol clefts, hepatotoxicity and fatty liver [10, 11].
Hypercholesterolemia, hypertension, disorders in glu-
cose metabolism, smoking, aging, and social stress are
the main risk factors for cardiovascular diseases [12].
Studies conducted showed that the incidence of cardio-
vascular events increased with increasing serum choles-
terol levels [13]. Therefore, the normalization of serum
cholesterol levels is important for preventing cardiovas-
cular diseases and its associated disorders and alteration
in lipids and carbohydrate metabolism. Lowering of
serum lipid levels through dietary or drug therapy seems
to be associated with a decrease in the risk of vascular
disease and related complications [14, 15].
Karela, the fruit of which is known as Momordica
charantia, bitter gourd or bitter melon, is a common ed-
ible vegetable in Asia. Approximately 93.2% of karela is
water, and protein and lipids account for 18.02% and
0.76% of its dried weight, respectively [16]. Physiological
benefits, including hypoglycemia, hypolipidemia, anti-
virus and anti-carcinogenic effects have been reported
[17, 18]. It has been shown that karela reduced high fat
diet induced obesity, hyperlipidemia, hyperglycemia, in-
sulin resistance, and fatty liver in mice [19]. Karela has
been used for the treatment of diabetes throughout the
world [20, 21].
Karela’s hypoglycemic effect has been demonstrated in
type 1 and type 2 diabetic rodents [22, 23]. Also, it de-
creases the levels of total cholesterol (TC), triglycerides,
and phospholipids in streptozotocin-induced diabetic
rats [24]. Phytochemical studies revealed the presence of
alkaloid, flavonoids, sterols, anthraquinones, and phe-
nols, which represented the main active components in
karela leaves [25]. It has been found that the ethyl acet-
ate extract of karela activates both PPARαand PPAR γ
[26] which are ligand-activated transcription factors be-
longing to the nuclear receptor superfamily. They play a
key role in the control of lipid and glucose homeostasis
as transcriptional factors regulating genes encoding
enzymes involved in these processes [27].
This study aimed to examine the effect of karela on
experimental hypercholesterolemia at the biochemical,
molecular and cellular levels using semi-quantitative
PCR analysis and immunohistochemistry.
Methods
Materials and kits
Ethidium bromide and agarose were purchased from
Sigma-Aldrich, St. Louis, MO, USA). The Wistar albino
rats were purchased from King Fahd center for Scientific
Research, King Abdel-Aziz University, Jeddah, Saudi
Arabia. Serologic kits for HDLC, Cholesterol and triglyc-
erides (TG) HUMAN Gesellschaft für Biochemica und
Diagnostica mbH (Wiesbaden, Germany). The deoxyribo-
nucleic acid (DNA) ladder was purchased from MBI,
Fermentas, Thermo Fisher Scientific, USA. Qiazol for
RNA extraction and oligo dT primer were purchased from
QIAGEN (Valencia, CA, USA). Kits for antioxidants such
as superoxide dismutase (SOD), catalase, reduced glutathi-
one (GSH) and malondialdehyde (MDA) were bought
from Bio-diagnostic Co., Dokki, Giza, Egypt.
Animals and experimental design
Ethical Committee Office of the scientific Deans of Taif
University, Saudi Arabia approved all procedures of this
study for the project #4860–437-1. Forty male Wistar
rats, 2 months old (200–222 g) were used for this study.
Animals were kept under observation for 2 weeks to
ensure complete acclimatization before the onset of the
experiment. The animals were kept at equal light–dark
cycle (12/12 h) with free access to food and water. Four
groups each containing 10 healthy Wistar rats were used
for the study as follows: Group 1, served as negative
control with free access to food and water. Group 2
served as positive hypercholesterolemic group and was
given orally cholesterol in a dose of 40 mg/kg body
weight daily for 6 weeks. Group 3 was administered or-
ally Karela in a dose of 5 g/kg body weight daily based
on a previous study [28]. Group 4 administered orally
cholesterol in a dose of 40 mg/kg body weight daily for
10 weeks plus karela in a dose of 5 g/ kg bw daily at
week 6 and continued for 4 weeks later. Dose of choles-
terol was used based on the finding of Co and To [29].
After 10 weeks, rats were inhaled dimethyl ether and
decapitated after overnight fasting. Liver and adipose
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 2 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
tissue were preserved in Bouin’s solution for histopa-
thological examination and in Qiazol reagent for RNA
extraction for gene expression.
Karela preparation and administration
Fresh karela fruits (Bitter melon) was purchased from
commercial local markets in Taif governate (Panda,
Taif), Saudi Arabia. The plant fruits was identified by
botanist in College of Science, Taif University, Saudi
Arabia. Karela was washed thoroughly with water, and
dried after cutting into small pieces, dried and powdered
using a blender. The dose used was 5 g /kg BW by intra-
gastric tube based on previous reports [28].
Assay of biochemical parameters
Glucose was measured colormetrically using commercial
available kits. Antioxidants such as superoxide dismutase,
SOD, GSH, MDA and catalase were measured spectro-
photometrically using commercial ELISA kits based on
manufacturer’s instruction manual. Serum triacylglycerol,
total cholesterol and high density lipoproteins-cholesterol
(HDLC) were measured spectrophotometrically according
to the manufacturer’s protocol.
Histopathological and Immunohistochemical examination
The collected specimens of liver were fixed in 10% buff-
ered neutral formalin solution and then routinely proc-
essed. Paraffin sections of 5 μm thickness were prepared,
stained with Hematoxylin and eosin stain (H&E) as
described before [30]. By using avidin-biotin-peroxidase
method, the liver samples were embedded in paraffin
and cut into 3 μm sections. Samples were mounted on
positively charged slides for caspase 3 immunohis-
tochemical examination. Sections were dewaxed, rehy-
drated and autoclaved at 95 °C for 20 min in antigen
retrieval buffer (10 mM citrate buffer, pH 6). After wash-
ing with phosphate buffered saline (PBS), endogenous
peroxidase was blocked using 3% H
2
O
2
in methanol for
15 min. A primary rat specific antibody for caspase 3
(cat.no. RB 1197 B0, B1; Thermo Fisher Scientific Inc)
was diluted in PBS (1:100), and incubated for 30 min.
The slides were then rinsed three times with PBS.
Horseradish peroxidase conjugated goat anti mouse IgG
secondary antibody (Cat # 32230; Thermo Fisher Scien-
tific Inc.) was incubated for 30 min with tissue sections.
Extra rinsing for 3 times with PBS was done. Samples
were visualized after 10 min from adding metal enhanced
diaminobenzidine (DAB) substrate (Sigma-Aldrich, St.
Louis, MO, USA) as a working solution (Thermo Fisher
Scientific Inc.) as stated before [31]. The immune re-
activity score was used to evaluate the intensity of
immunohistochemical staining and the proportion of
the stained cells [31].
RNA extraction, cDNA synthesis and RT-PCR analysis
Total RNA was extracted from liver and epididymal adi-
pose tissue samples (50 mg per sample) as stated before
[32]. In short, samples were flash frozen in liquid nitro-
gen and subsequently stored at −70 °C in 1 ml Qiazol
(QIAGEN, Valencia, CA, USA). Frozen samples were
homogenized using a Polytron 300 D homogenizer
(Brinkman Instruments, Westbury, NY, USA). Then,
0.3 ml chloroform was added to the homogenate. The
mixtures after shaking for 30 s, centrifuged at 4 °C and
16,400 x gfor 15 min. The supernatant was transferred
to new tubes. Equal volume of isopropanol was added to
the samples and centrifuged at 4 °C and 16,400 x gfor
15 min. The RNA pellets were washed with 70% ethanol,
briefly dries up, and then dissolved in diethylpyrocarbo-
nate (DEPC) water. RNA concentration and purity were
Table 1 PCR conditions and primer sequence for examined genes
mRNA expression Forward primer (5′-3′) Reverse primer (5′-3′) PCR cycles and Annealing
PEPCK (236 bp) TTTACTGGGAAGGCATCGAT TCGTAGACAAGGGGGCAC 30 cycles, 52 °C 1 min
PK (229 bp) ATTGCTGTGACTGGATCTGC CCCGCATGATGTTGGTATAG 30 cycles, 52 °C 1 min
ACO (633 bp) GCCCTCAGCTATGGTATTAC AGGAACTGCTCTCACAATGC 35 cycles, 52 °C 1 min
CPT-1 (628 bp) TATGTGAGGATGCTGCTTCC CTCGGAGAGCTAAGCTTGTC 35 cycles, 52 °C 1 min
PPAR γ(550 bp) CATTTCTGCTCCACACTATGAA CGGGAAGGACTTTATGTATGAG 33 cycles 52 °C 1 min
PPAR-α(680 bp) GAGGTCCGATTCTTCCACTG ATCCCTGCTCTCCTGTATGG 35 cycles, 58 °C 1 min
FAS (345 bp) CCAGAGCCCAGACAGAGAAG GACGCCAGTGTTCGTTCC 37 cycles, 61 °C 45 s
SREBP-1c (191 bp) GGAGCCATGGATTGCACATT AGGAAGGCTTCCAGAGAGGA 35 cycles, 58 °C 50 s
HMG-CoAR (467 bp) CCTGCTGCCATAAACTGGAT GCCATTACAGTGCCACACAC 31 cyc les58°C 1 min
GST (575 bp) GCTGGAGTGGAGTTTGAAGAA GTCCTGACCACGTCAACATAG 35 cycles, 55 °C 1 min
CYP7A1 (574 bp) CCTCCTGGCCTTCCTAAATC GTACCGGCAGGTCATTCAGT 30 cycles 58 °C 1 min
SOD (410 bp) AGGATTAACTGAAGGCGAGCAT TCTACAGTTAGCAGGCCAGCAG 33 cycles, 55 °C 1 min
GAPDH (309 bp) AGATCCACAACGGATACATT TCCCTCAAGATTGTCAGCAA 25 cycles, 52 °C 1 min
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 3 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
determined spectrophotometrically at 260 nm. The RNA
integrity was confirmed in 1.5% denaturated agarose gel
stained with ethidium bromide. The ratio of the 260/280
optical density of all RNA samples was 1.7–1.9. For
cDNA synthesis, a mixture of 3 μg total RNA and 0.5 ng
oligo dT primer (Qiagen Valencia, CA, USA) in a total
volume of 11 μl sterilized DEPC water was incubated in
the Bio-Rad T100™Thermal cycle at 65 °C for 10 min
for denaturation. Then, 2 μl of 10X RT-buffer, 2 μlof
10 mM dNTPs and 100 U Moloney Murine Leukemia
Virus (M-MuLV) Reverse Transcriptase (SibEnzyme. Ak,
Novosibirsk, Russia) were added and the total volume
was completed up to 20 μl by DEPC water. The mixture
was then re-incubated in BIO-RAD thermal cycler at
37 °C for one hour, then at 90 °C for 10 min to inactivate
the enzyme. For semi-quantitative RT-PCR analysis,
specific primers for examined genes (Table 1) were
designed using Oligo-4 computer program and synthe-
sized by Macrogen (Macrogen Company, GAsa-dong,
Geumcheon-gu. Korea). PCR was conducted in a final
volume of 25 μl consisting of 1 μl cDNA, 1 μlof10pM
of each primer (forward and reverse), and 12.5 μlPCR
master mix (Promega Corporation, Madison, WI, USA),
the volume was brought up to 25 μl using sterilized, de-
ionized water. PCR was carried out using Bio-Rad T100™
Thermal Cycle machine with the cycle sequence at 94 °C
for 5 min one cycle, followed by variable cycles (Table 1)
each of which consists of denaturation at 94 °C for one
minute, annealing at the specific temperature correspond-
ing to each primer (Table 1) and extension at 72 °C for
one minute with an additional final extension at 72 °C for
7 min. As a reference, expression of glyceraldehyde-3-
phosphate dehydrogenase (G3PDH) mRNA was examined
(Table 1). PCR products underwent electrophoresis on
1.5% agarose (Bio Basic, Markham, ON, Canada) gel
stained with ethidium bromide in TBE (Tris-Borate-
EDTA) buffer. PCR products were visualized under UV
light and photographed using gel documentation system.
The intensities of the bands from four different rats per
group and three independent experiments were quantified
densitometrically using Image J software version 1.47
(https://imagej.en.softonic.com/).
Statistical analysis
Data are expressed as Means ± standard error (SE). Data
were analyzed using analysis of variance (ANOVA)
and post hoc descriptive tests by SPSS software ver-
sion 11.5 for Windows (SPSS, IBM, Chicago, IL,
USA).with P< 0.05 regarded as statistically significant. Re-
gression analysis was performed using the same software.
Results
Effects of karela on changes in antioxidants induced by
hypercholesterolemia
Table 2 shows that experimental hypercholesterolemia
was associated with an increase in serum total choles-
terol levels, triglycerides and glucose. In parallel there
was a decrease in high density lipoproteins (HDL). Ad-
ministration of Karela normalized and ameliorated this
altered parameters and increased HDL levels (Table 2).
Hypercholesterolemia as seen in Table 3, significantly
increased the serum levels of malondialdehyde (MDA)
and decreased serum levels of super oxide dismutase
(SOD), reduced glutathione (GSH) and catalase. Admin-
istration of karela significantly improved the decrease in
antioxidant activity and normalized the increase in
MDA (Table 3). Of note, administration of karela to con-
trol rats induced high antioxidants potency.
Table 3 Protective effects of Karela extract on hypercholesterolemia induced changes in antioxidants levels in Wistar rats
SOD (U/ml) Catalase (U/ml) GSH (mg/dl) MDA (nmol/ml)
Control 347.9 ± 37.5 32.5 ± 4.4 0.4 ± 0.01 5.17 ± 0.3
Cholesterol 202.7 ± 25.4
*
20.23 ± 2.8
*
0.2 ± 0.02
*
37 ± 4. 2
*
Karela 566.3 ± 28.1
$
31.80 ± 8.3 0.8 ± 0.02
$
4. 6 ± 0.01
Karela + Cholesterol 286.7 ± 44.2
#
66.5 ± 7.2
#
h1.7 ± 0.07
#
16.7 ± 1.02
#
Values are means ± standard error (SEM) for 10 different rats per each treatment. Values are statistically significant at *p< 0.05 Vs. control, #p< 0.05 Vs.
cholesterol administered rats and $p< 0.05 Vs. control
Table 2 Protective effects of Karela on hypercholesterolemia induced changes in serum lipid levels in Wistar rats
HDLC (mg/dL) Cholesterol (mg/dL) TG (mg/dL) Glucose (mg/dL)
Control 30.8 ± 0.6 63.3 ± 4.1 30.5 ± 4.2 84.5 ± 2.3
Cholesterol 19.4 ± 0.7* 180.5 ± 6.6* 99.8 ± 7.4* 89 ± 10.2*
Karela 34.5 ± 0.9 54.5 ± 2.25 30.6 ± 1.78 76 ± 8.7
Karela + Cholesterol 38.32 ± 2.4# 81.2 ± 7.5# 55.3 ± 5.5# 69 ± 13.1#
Values are means ± standard error (SEM) for 10 different rats per each treatment. Values are statistically significant at *p< 0.05 Vs. control and #p< 0.05 Vs.
cholesterol administered rats
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 4 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Pathological and immunohistochemical changes in the
liver after karela administration to hypercholesterolemic
rats
The histological examination of liver in control and
karela administered rats had a normal architecture of
hepatic lobules with plates of polygonal hepatocytes
radially arranged around the central vein and separated
by blood sinusoids, the hepatocytes revealed an acido-
philic cytoplasm and rounded nuclei (Fig. 1a, b). In
hypercholesterolemic rats revealed loss of normal hep-
atic architecture with deposition of cholesterol crystals
are found in many radicular cysts forming cholesterol
clefts and necrosis of hepatocytes (Fig. 1c). Also, sever
congestion of portal blood vessel with extensive portal
Fig. 1 Photomicrograph of rat livers in the various groups: aControl group, showing the normal histological structure of hepatic lobule (L) with
centrally located euchromatic nucleus of hepatocyte (H) surround central vein (CV) (H&E; bar, 89 μm); bKarela administered group, shows normal
histological structure of hepatic lobule (L), hepatocyte (H) and central vein (CV) (H&E; bar, 14 μm); cCholesterol group, showing deposition of
cholesterol crystals in many radicular cysts forming cholesterol clefts (arrows) and necrosis (N) of hepatocytes (H&E; bar, 14 μm); dCholesterol
administered group, showing sever congestion of portal blood vessel (C) with extensive portal fibrosis (arrow) and hyperplasia of epithelial lining
of the bile duct (B) (H&E; bar, 89 μm); eCholesterol group, showing necrosis in hepatocytes (N) with karyolysis of hepatocytes nuclei (arrows)
(H&E; bar, 14 μm); and fCholesterol and Karela group, show apparent normal hepatic parenchyma with few cholesterol clefts (arrow), hepatic
lobule (L), hepatocyte (H), central vein (CV) (H&E; bar, 14 μm)
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 5 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
fibrosis, hyperplasia of epithelial lining of the bile duct and
karyolysis of hepatocytes nuclei (Fig. 1d, e). In liver of
hypercholesterolemic rats administered karela, liver
showed apparent normal hepatic parenchyma with few
cholesterol clefts (Fig. 1f). In Immunohistochemical
examination for caspase-3 expression in liver. The
control and karela administered rats showed negative
immunohistochemical staining for caspase-3 immuno-
reactivity (Fig. 2a, b). Liver of hypercholesterolemic
rats showed strong immunohistochemical staining of
caspase 3 (Fig. 2c). Liver of hypercholesterolemic rats
administered karela showed mild immunohistochemi-
cal staining of Caspase-3 (Fig. 2d).
Effects of karela on gene expression of antioxidants and
carbohydrate associated genes altered by
hypercholesterolemia
Figure 3, shows that hypercholesterolemia decreased sig-
nificantly glutathione-S-transferase (GST) and superoxide
dismutase mRNA expression in liver. Administration of
karela for cholesterol administered rats normalized mRNA
expression pattern compared to control rats. On the other
hand, hypercholesterolemia decreased pyruvate kinase
(PK) mRNA expression that were ameliorated when karela
co-administered for hypercholesterolemic rats (Fig. 4). In
contrast, karela down regulated phosphoenolpyruvate car-
boxykinase (PEPCK) that was upregulated in hypercholes-
terolemic rats (Fig. 4). Co-administration of karela with
cholesterol ameliorated this increase in PEPCK expression
in hypercholesterolemic rats.
Effects of karela on lipolysis and lipogenesis gene
expression altered by hypercholesterolemia
To examine the expression of genes for fatty acids oxi-
dation such as acyl CoA oxidase (ACO) and carnitine
palmitoyltransferase-1 (CPT-1), RT-PCR was carried
done on liver tissues. Figure 5, shows that karela alone
partially increased mRNA expression of ACO and
Fig. 2 Photomicrograph of immunohistochemical staining of Caspase 3 in liver of rat in examined groups: aControl group, showing negative
immunohistochemical staining of caspase 3 immunoreactivity (bar, 14.53 μm); bKarela administered rats, showing negative
immunohistochemical staining of Caspase 3 (bar, 14.51 μm); cCholesterol administered group, showing strong immunohistochemical staining
and immune reactivity of Caspase 3 (bar, 13.57 μm); dCholesterol and Karella treatment group, showing mild immunohistochemical staining of
Caspase 3 (bar, 13.56 μm)
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 6 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
CPT-1 while cholesterol administered rats showed
downregulation in their mRNA expression. When
karela co-administered with cholesterol it amelio-
rated this downregulation. In parallel, the enzyme
essential for fatty acids synthesis (fatty acids syn-
thase; FAS) showed a decrease in karela administered
rats and upregulated in hypercholesterolemic rats. It
was downregulated when karela co-administered with
cholesterol (Fig. 5). Next, we examined the expres-
sion of PPAR-αand PPAR-γin the liver and adipose
tissue respectively as a transcriptional regulator of
lipid metabolism and glucose homeostasis. As seen
in Fig. 6, Karela activated PPAR-αand PPAR-γex-
pression in liver and adipose tissue respectively that
were downregulated significantly in hypercholesterol-
emic groups.
Effects of karela on genes regulate cholesterol
metabolism expression
Finally, we examined the effect of karela on genes associ-
ated with cholesterol metabolism such as sterol responsible
element binding protein-1c (SREBP-1c), 3-hydroxy-3-
methylglutaryl coenzyme A reductase (HMG-CoAR)
and cholesterol 7α-hydroxylase (CYP7A1). Karela alone
showed downregulation in SREBP-1c and HMG-CoAR
expression that were upregulated in cholesterol ad-
ministered rats (Fig. 7). Administration of karela to
hypercholesterolemic rats normalized significantly this
increase in mRNA expression of SREBP-1c and HMG-
CoAR. Regarding the expression of CYP7A1, Karela
showed partial increase in CYP7A1 and feeding cho-
lesterol alone induced more and clear stimulatory effect
in CYP7A1 mRNA compared to karela. When karela
Fig. 3 Protective effect of karela on changes in antioxidants expression induced by hypercholesterolemia in liver. Hypercholesterolemic rats were
administered karela for 4 consecutive weeks. Total RNA was extracted from liver tissues and the expressions of GST and SOD were analyzed by
semi-quantitative RT-PCR analysis. Values are means ± SE of 10 rats.
*
P< 0.05 Vs control group;
#
P< 0.05 VS hypercholesterolemic group. Upper
panels (a) are mRNA expression of examined genes. Lower columns (b) are densitometric analysis of gene expression for upper panels
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 7 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
administered to hypercholesterolemic rats an additive
upregulation effect was reported (Fig. 7).
Discussion
The present study interpret that karela has hypocholestero-
lemic effect through the reduction of hepatic oxidative
stress and apoptosis, regulation of genes associated with
glucose, lipid and cholesterol metabolism at biochemical,
cellular and molecular levels. Hypercholesterolemia showed
liver affection that presented by apoptosis. In liver diseases,
cell repair, inflammation, regeneration, and fibrosis may all
be triggered by apoptosis [33]. The liver is the first organ to
metabolize the ingested cholesterol and it is affected by oxi-
dative stress that results from an imbalance between the
production of free radicals and effectiveness of antioxidant
defense systems [9]. The present data revealed that rats fed
high cholesterol diet had abnormalities in liver sections
such as cholesterol clefts, necrosis of hepatocytes and con-
gestion of portal blood vessel. Previous reports showed that
high cholesterol diet causes hepatotoxicity and fatty liver
[10, 11] and increased apoptotic hepatocytes number [34].
The potential mechanisms for the beneficial effects of
Fig. 4 Protective effect of karela on changes in PK and PEPCK expression induced by hypercholesterolemia in liver. Hypercholesterolemic rats
were administered karela for 4 consecutive weeks. Total RNA was extracted from liver tissues and the expressions of PK and PEPCK were analyzed
by semi-quantitative RT-PCR analysis. Values are means ± SE of 10 rats.
*
P< 0.05 Vs control group;
#
P< 0.05 VS hypercholesterolemic group.
Upper panels (a) are mRNA expression of examined genes. Lower columns (b) are densitometric analysis of gene expression for upper panels
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 8 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
karela on fatty liver involve reducing inflammation, eli-
minating oxidative stress, and suppressing apoptosis as
confirmed here and in another study [19].
As known Chen and his team [35], are the first that
confirmed the anti-adiposity effect of karela, who subse-
quently showed a decrease triglycerides contents of liver
cells and muscle in rats fed high fat diet containing
freeze-dried bitter melon juice [36]. Recently, adipose
tissue has been recognized to serve as an energy storage,
and an endocrine organ by releasing adipokines into the
circulation to regulate both adipose tissue mass and the
functions of other tissues by affecting systemic lipid and
glucose metabolism [37]. The antiobesity effect of bitter
melon was confirmed [38]. Here, hypercholesterolemia
caused oxidative stress and decreased antioxidants levels
and expression in liver, and karela ameliorated this alter-
ations. In parallel, Wu and Ng [39] found that extracts
of bitter gourd grown in Taiwan, possessed higher
antioxidant and free radical-scavenging activities.
As known liver gluconeogenesis constitutes about 60–
97% of the hepatic glucose production. PEPCK is a key
rate-limiting enzyme of gluconeogenesis. High fat diet
consumption can upregulate PEPCK expression in mice
[40]. In our present study, the PEPCK expression in-
creased in hypercholesterolemic rats. Administration of
karela restored PEPCK expression to a level similar to
control group. Therefore, karela induced in hypercholes-
terolemic rats hypoglycemic effect by inhibiting hepatic
glucose production via a decrease in PEPCK expression
and without effect on PK mRNA (Fig. 4). Possibly, the
hypoglycemic effect of karela is due to inhibition of
glucose-6-phosphatase activity [41].
Nerurkar and his colleagues [42] reported in vitro
that karela inhibited human preadipocytes differentiation
Fig. 5 Protective effect of karela on changes in CPT-1, ACO and FAS expression induced by hypercholesterolemia in liver and adipose tissue.
Hypercholesterolemic rats were administered karela for 4 consecutive weeks. Total RNA was extracted from liver tissues and the expressions of
CPT-1, ACO and FAS were analyzed by semi-quantitative RT-PCR analysis. Values are means ± SE of 10 rats.
*
P< 0.05 Vs control group;
#
P< 0.05
VS hypercholesterolemic group. Upper panels (a) are mRNA expression of examined genes. Lower columns (b) are densitometric analysis of gene
expressions for upper panels
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 9 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
through down regulation in PPAR-γ, SREBP-1c, resistin
and upregulation in lipolysis. Among the factors that
affect lipogenesis are peroxisome proliferator activator
receptor-γ(PPAR-γ) and SREBP-1c. PPAR-γis the master
regulator of adipogenesis [43], while SREBP-1c is an
adipogenic transcription factors [44]. The balance between
adipogenesis and lipolysis is critical for the proper func-
tion of adipose tissue, which consecutively affects the
pathogenesis of obesity and its associated metabolic func-
tions (42). To treat obesity, you need multiple interventions
such as exercise programs, diet, behavioral modification
and pharmacotherapy. Karela showed clear results on
lipid metabolism through regulation of the key enzymes
essential for lipogenesis and lipolysis. It downregulated
the expression of FAS and increased the expression of
ACO and CPT-1. Our findings that karela suppressed
FAS and SREBP1c gene expression postulate that karela
might antagonize the transcriptional activity of lipo-
genic factors such as ADD1/SREBP-1c [44]. SREBP1c is
a regulator of lipid homeostasis, lipogenesis and sterol
biosynthesis. In our results SREBP1c was decreased by
karela and increased in hypercholesterolemic rats and
normalized when co-administered together. However,
Huang et al. [45], did not observe any effects on
SREBP-1c mRNA expression in the adipose tissue of
rats fed high fat diet and karela. They suggested that
karela possibly act at the protein levels or post-
transcriptionally to affect these genes [45].
Fig. 6 Protective effect of karela on changes in PPAR-αand PPAR-γexpression induced by hypercholesterolemia in liver and adipose tissue. Hypercho-
lesterolemic rats were administered karela for 4 consecutive weeks. Total RNA was extracted from liver tissues and the expressions PPAR-αand PPAR-γ
were analyzed by semi-quantitative RT-PCR analysis. Values are means ± SE of 10 rats.
*
P< 0.05 Vs control group;
#
P< 0.05 VS hypercholesterolemic
group. Upper panels (a) are mRNA expression of examined genes. Lower columns (b) are densitometric analysis of gene expression for upper panels
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 10 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Cholesterol homeostasis is achieved through the regu-
lation of cholesterol biosynthesis, the conversion of chol-
esterol to bile acids, and their excretion. Cholesterol
homeostasis are regulated by HMG-CoAR and CYP7A1
[46]. HMG-CoAR is the rate-limiting enzyme in the
synthesis of cholesterol, whereas CYP7A1 is the rate-
limiting enzyme in the synthesis of bile acids from chol-
esterol via the classical pathway [47] Furthermore,
CYP7A1 is partially regulated at the transcriptional level
by the hepatic liver X receptor-α(LXRα) and farnesoid
X receptor [48, 49]. LXRαis a transcription factor acti-
vated by the oxidized forms of cholesterol, serving as
sensor of excessive intracellular cholesterol accumula-
tion [48]. Farnesoid X receptor is a bile acid receptor
and acts as the major hepatic bile acid sensor that regu-
late bile acid synthesis and transport. Moreover, more
than 95% of the bile acids is reabsorbed in the distal
ileum and carried back to the liver the body. Thus,
hepatic LXRαand FXR play an important role in regu-
lating cholesterol homeostasis through modulation of
the biosynthesis of bile acids. Compared to hypercholes-
terolemic rats, we reported that Karela group increased
CYP7A1 gene expression (Fig. 7) and decreased the
serum TC level (Table 2). These results suggest that
karela exerts its hypocholesterolemic activity by decreas-
ing the reabsorption of bile acids in the intestine and
facilitating the conversion of cholesterol to bile acids via
up-regulation of CYP7A1 [28]. Moreover, Matsui et al.,
Fig. 7 Protective effect of karela on changes in SREBP1c, HMG-CoAR and CYP7A1 expression induced by hypercholesterolemia in liver.
Hypercholesterolemic rats were administered karela for 4 consecutive weeks. Total RNA was extracted from liver tissues and the expressions of
SREBP1c, HMG-CoAR and CYP7A1 were analyzed by semi-quantitative RT-PCR analysis. Values are means ± SE of 10 rats.
*
P< 0.05 Vs control group;
#
P< 0.05 VS karela group and
$
P< 0.05 Vs hypercholesterolemic group. Upper panels (a) are mRNA expression of examined genes. Lower columns
(b) are densitometric analysis of gene expression for upper panels
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 11 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
[28] concluded that the upregulation in CYP7A1 in
karela administered groups is independent on LXR-α
expression in examined hepatic tissues. Karela altered
the HMGR mRNA level (Fig. 7), suggesting that the
decreased serum cholesterol level in the karela group is
dependent on regulation of hepatic cholesterol synthesis.
Finally, it can be concluded from previous reports that
karela suppressed the effect of small heterodimer partner
(SHP) that is implicated in bile acids biosynthesis, and this
suppression enhanced the action of CYP7A1 through liver
receptor homologue-1 (LRH-1). Therefore, this increase
in CYP7A1 is the cause for the decrease in serum choles-
terol levels (increase catabolism of blood cholesterol to
bile acids in the liver) as reported in this study.
Conclusion
This study demonstrated that karela altered hepatic and
adipose tissue expression of genes associated with lipids
and carbohydrate metabolism to improve blood cholesterol
levels and hypercholesterolemia. It ameliorated the al-
teration induced by cholesterol on hepatic cell architecture,
apoptosis and oxidative stress. Furthermore, our study
showed that the karela-induced hypocholesterolemic effect
through its action on promotion of conversion of choles-
terol to bile acids through activation of CYP7A1, PPAR up-
regulation and down regulation of FAS, SREBP1c and
HMG-CoAR in liver and adipose tissue. Our findings rec-
ommends the usage of karela as functional foods that has
beneficial effects on human health.
Abbreviations
ACO: Acyl CoA oxidase; cDNA: complementary deoxyribonucleic acid;
CPT-1: Carnitine palmitoyltransferase-1; CYP7A1: Cholesterol 7α-hydroxylase;
DAB: Diaminobenzidine; DEPC: Diethylpyrocarbonate; DNA: Deoxyribonucleic
acid; EDTA: Ethylenediamine tetra acetic acid; FAS: Fatty acid synthase;
GAPDH: Glyceraldhyde-3-phosphate dehydrogenase; GOT: Glutamate
oxalacetate transaminase; GPT: Glutamate pyruvate transaminase; GSH: Reduced
glutathione; GST: Glutathione-S-transferase; H and E: Hematoxylin and eosin;
HMG-CoAR: 3-hydroxy-3-methylglutaryl coenzyme A reductase; LRH-1: Liver
receptor homologue-1; LXRα: Liver X receptor-α; M-Mul V: Moloney Murine
Leukemia Virus; NBF: Neutral buffered formalin; PEPCK: Phosphoenolpyruvate
carboxykinase; PK: Pyruvate kinase; PPAR-α: Peroxisome proliferator-activated re-
ceptor alpha; PPAR-γ: Peroxisome proliferator-activated receptor gamma;
RNA: Ribonucleic acid; RT-PCR: Reverse transcription polymerase chain reaction;
SE: Standard error; SHP: Small heterodimer partner; SOD: Superoxide dismutase;
SREBP-1c: Sterol responsible element binding protein-1c; TBE: Tris-borate-EDTA;
TC: Total cholesterol
Acknowledgements
We greatly appreciate the contributions of authors to finish this study and Deans
of Scientific Research Affairs, Taif University, Saudi Arabia for financial support.
Funding
The current study and findings were supported by the Deans of Research affairs,
Taif University, Saudi Arabia for project # 4860–437-1 for Dalia Yousri Saad.
Authors’contributions
Conceived and designed the experiments: MMS, DYS. Performed
Experiments: MMS DYS, MYH. Analyzed data: MMS. Biochemical Assays: MMS.
Histopathology: AAB, DYS. Gene expression: MMS, HBE. Data interpretations:
DYS and MYH. Revision of manuscript: MMS, AAB and MYH. All authors read
and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
All authors signed and agree to publish the paper.
Ethical approval
Ethical Committee Office of the scientific Deans of Taif University, Saudi
Arabia approved all procedures of this study for the project #4860–437-1.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Author details
1
Medical Laboratory Department, Faculty of Applied Medical Sciences, Taif
University, Turabah, Saudi Arabia.
2
Biology Department, Faculty of Science,
Cairo University, Cairo, Egypt.
3
Department of Biochemistry, College of
Veterinary Medicine, Benha University, Moshtohor, P.O. 13736, Benha, Egypt.
4
Biology Department, Faculty of Science, Taif University, Turabah, Saudi
Arabia.
5
Reproductive Diseases Department, Animal Reproduction Research
Institute (ARRI), Al-Haram, Giza, Egypt.
6
Medical Microbiology Department,
Faculty of Applied Medical Sciences, Taif University, Turabah, Saudi Arabia.
7
Department of Nutrition and Clinical Nutrition, Faculty of Veterinary
Medicine, Kafrelsheikh University, Cairo, Egypt.
Received: 12 April 2017 Accepted: 8 June 2017
References
1. Fan JG, Farrell GC. Epidemiology of non-alcoholic fatty liver disease in
China. J Hepatol. 2009;50:204–10.
2. Czech MP. Obesity notches up fatty liver. Nat Med. 2013;19:969–71.
3. Pessayre D. Role of mitochondria in non-alcoholic fatty liver disease.
J Gastroenterol Hepatol. 2007;22(1):20–7.
4. Venturini D, Simao AN, Scripes NA, Bahls LD, Melo PA, Belinetti FM, et al.
Evaluation of oxidative stress in overweight subjects with or without
metabolic syndrome. Obesity (Silver Spring). 2012;20:2361–6.
5. Matsuzawa-Nagata N, Takamura T, Ando H, Nakamura S, Kurita S, Misu H,
et al. Miyamoto K (): increased oxidative stress precedes the onset of high-
fat diet-induced insulin resistance and obesity. Metabolism. 2008;57:1071–7.
6. Artham SM, Lavie CJ, Milani RV, Ventura HO. The obesity paradox: impact of
obesity on the prevalence andprognosis of cardiovascular
diseases,“Postgraduate Med 2008; 120 (2):34–41.
7. Bellentani SG, Saccoccio F. Masutti F, Crocè LS, Brandi G, Sasso F, Cristanini
G, Tiribelli C. Prevalence of andrisk factors for hepatic steatosis in northern
Italy. Ann Intern Med 2000; 132(2):112–117.
8. Das SK, Balakrishnan V, Mukherjee S. Vasudevan. Evaluation of blood
oxidative stress-related parameters inalcoholic liver disease and non-
alcoholic fatty liver disease Scand J Clin Lab Invest. 2008;68(4):323–34.
9. Lum H, Roebuck K.A. Oxidant stress andendothelial cell dysfunction. Am
J Physiol Cell Physiol 2001; 280: 719–741.
10. Hirako S, Kim HJ, Shimizu S, Chiba H. Matsumoto A. Low dose fish oil
consumption prevents hepatic lipid accumulation in high cholesterol diet
fed mice. J Agric Food Chem 2011; 59: 13353–13359.
11. Wang X, Hasegawa J, Kitamura Y, Wang Z, Matsuda A, Shinoda W, et al. Effects
of hesperidin on the progression of hypercholesterolemia and fatty liver
induced by high-cholesterol diet in rats. J Pharmacol Sci. 2011;117:129–38.
12. Ota T. Chemokine systems link obesity to insulin resistance. Diabetes Metab
J. 2013;37:165–72.
13. Yusuf S, Anand S. Cost of prevention. The case of lipid lowering. Circulation.
1996;93:1774–6.
14. Betteridge J. Lipid disorders in diabetes mellitus, in: J.C. Pickup, G.
Williams (Eds.), Text Book of Diabetes, second ed., Blackwell Science,
London 1997; 55:1–31.
15. Brown GB, Xue-Qiao Z, Sacco DE, Alberts JJ. Lipid lowering and plaque
regression. New insights into prevention of plaque disruption and clinical
events in coronary disease. Circulation. 1993;87:1781–91.
16. Yuwai KE, Sundar Rao K, Kaluwin C, Jones GP, Rivett DE. Chemical composition
of Momordica charantia L. fruits. J Agric Food Chem. 1991;39:1762–3.
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 12 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
17. Eckel RH, Grundy SM, Zimmet PZ. The metabolic syndrome. Lancet. 2005;
365:1415–28.
18. Sharabi Y, Eldad A. Nonalcoholic fatty liver disease is associated with
hyperlipidemia and obesity. Am J Med. 2000;109:171.
19. Xu J, Cao K, Li Y, Zou X, Chen C, Szeto I, et al. Bitter gourd inhibits the
development of obesity-associated fatty liver in C57BL/6 mice fed a high-fat
diet. J Nutr. 2014;144(4):475–83.
20. Krawinkel MB. Keding GB bitter gourd (Momordica charantia): a dietary
approach to hyperglycemia. Nutr Rev. 2006;64:331–7.
21. Yeh GY, Eisenberg DM, Kaptchuk TJ, Phillips RS. Systematic review of herbs
and dietary supplements for glycemic control in diabetes. Diabetes Care.
2003;26:1277–94.
22. Ahmed I, Adeghate E, Sharma AK, Pallot DJ. Singh J. Effects of Momordica
charantia fruit juice on islet morphology in the pancreas of the
streptozotocin-diabetic rat. Diabetes Res Clin Pract 1998; 40: 145–151.
23. Miura T, Itoh C, Iwamoto N. Hypoglycemic activity of the fruit of the
Momordica charantia in type 2 diabetic mice. J Nutr Sci Vitaminol. 2001;
47:340–4.
24. Keller AC, Ma J, Kavalier A, He K, Brillantes AM, Kennelly EJ. Saponins from
the traditional medicinal plant Momordica charantia stimulate insulin
secretion in vitro. Phytomedicine. 2011;19:32–7.
25. Annapoorani CA, Manimegalai K. Screening of medicinal plant Momordica
charantia leaf for secondary metabolites. Int J Pharm Res Dev. 2013;5:1–6.
26. Chao CY, Huang CJ. Bitter gourd (Momordica charantia) extract activates
peroxisome proliferator-activated receptorsand upregulates the expression
of the acyl CoA oxidase gene in H4IIEC3 hepatoma cells. J Biomed Sci.
2003;10:782–91.
27. Desvergne B, Wahli W. Peroxisome proliferator-activated receptors: nuclear
control of metabolism. Endocr Rev. 1999;20:649–88.
28. Xu J, Cao K, Li Y, Zou X, Chen C, Szeto IM, et al. Bitter gourd inhibits the
development of obesity-associated fatty liver in C57BL/6 mice fed a high-fat
diet. J Nutr. 2014;144(4):475–83.
29. CO O, TO O. Antihypercholesterolemic activity of ethanolic extract of
Buchholzia Coriacea in rats. Afr Health Sci. 2013;13(4):1084–90.
30. Bancroft JD, Gamble M. Theory and Practice of Histological Techniques. 6th
eds. Philadelphia: Churchill Livingstone/ Elsevier; 2008. p. 126–7.
31. Zarnescu O, Brehar FM, Chivu M, Ciurea AV. Immunohistochemical
localization of caspase-3, caspase-9 and Bax in U87 glioblastomaxenografts.
J Mol Histol. 2008;39:561–9.
32. Alkhedaide A, Soliman MM, Ibrahim ZS. Carbonated soft drinks alter
hepatic cytochrome P450 isoform expression in Wistar rats. Biomed
Rep. 2016;5(5):607–12.
33. Feldstein AE, Gores GJ. Apoptosis in alcoholic and nonalcoholic
steatohepatitis. Front Biosci. 2005;10(3):3093–9.
34. Jiang Y, Zhao M, An W. Increased hepaticapoptosis in high-fat diet-induced
NASH in rats may be associated with downregulation of hepaticstimulator
substance. J Mol Med. 2011;89:1207–17.
35. Chen Q, Chan LL, Li ET. Bitter melon (Momordica charantia) reduces
adiposity, lowers serum insulin and normalizes glucose tolerance in rats fed
a high fat diet. J Nutr. 2003;133:1088–93.
36. Chen,Q, Li ET. Reduced adiposity in bitter melon (Momordica charantia) fed
rats is associated with lower tissue triglyceride and higher plasma
catecholamines. Br J Nutr 2005; 93: 747–754.
37. Ahima RS, Flier JS. Adipose tissue as an endocrine organ. Trends Endocrinol
Metab. 2000;11:327–32.
38. Xu L, Xu Y, Wang S, Deng Q, Wu CQ, Chen XT, et al. Novel bitter melon
extracts highly yielded from supercritical extraction reduce the adiposity
through the enhanced lipid metabolism in mice fed a high fat diet. J Nut
Intermed Metab. 2016;6(2016):26e32.
39. Wu SJ, Ng LT. Antioxidant and free radical scavenging activities of wild
bitter gourd (Momordica charantia Linn. Var. Abbreviata Ser.) in Taiwan.
LWT-Food Science and Technol. 2008;41:323–30.
40. Shih CC, Shlau MT, Lin CH, Wu JB. Momordica charantia Ameliorates insulin
resistance and dyslipidemia with altered hepatic glucose production and
fatty acid synthesis and AMPK phosphorylation in high-fat-fed mice.
Phytother Res. 2014;28(3):363–71.
41. Shibib BA, Khan LA, Rahman R. Activity of Coccinia indica and Momordica
charantia in diabetic rats: depression of the hepatic gluconeogenic
enzymes glucose-6-phosphatase and fructose-1, 6-bisphosphatase and
elevation of both liver and red-cell shunt enzyme glucose-6-phosphate
dehydrogenase. Biochem J. 1993;292:267–70.
42. Nerurkar PV, Lee YK, Nerurkar VR. Momordica charantia (bitter melon)
inhibits primary human adipocyte differentiation by modulating adipogenic
genes. BMC Complement Altern Med. 2010;10:34.
43. Wakabayashi K, Okamura M, Tsutsumi S, Nishikawa NS, Tanaka T, Sakakibara
I, et al. The peroxisome proliferator-activated receptor gamma/retinoid X
receptor alpha heterodimer targets the histone modification enzyme
PR-Set7/Setd8 gene and regulates adipogenesis through a positive
feedback loop. Mol Cell Biol. 2009;29:3544–55.
44. Inoue J, Kumagai H, Terada T, Maeda M, Shimizu M, Sato R. Proteolytic
activation of SREBPs during adipocyte differentiation. Biochem Biophys Res
Commun. 2001;283:1157–61.
45. Huang HL, Hong YW, Wong YH, Chen YN, Chyuan JH, Huang CJ, et al. Bitter
melon (Momordica charantia L.) inhibits adipocyte hypertrophy and down
regulates lipogenic gene expression in adipose tissue of diet-induced obese
rats. Br J Nutr. 2008;99(2):230–9.
46. Pandak WM, Schwarz C, Hylemon PB, Mallonee D, Valerie K, Heuman DM.
Effects of CYP7A1 overexpression on cholesterol and bile acid homeostasis.
Am J Physiol Gastrointest Liver Physiol. 2001;281:878–89.
47. Sievanen E. Exploitation of bile acid transport systems in prodrug design.
Molecules. 2007;12:1859–89.
48. Gupta S, Pandak WM, Hylemon PB. LXRαis the dominant regulator of
CYP7A1 transcription. Biochem Biophys Res Commun. 2002;293:338–43.
49. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB. A
regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses
bile acid biosynthesis. Mol Cell. 2000;6:517–26.
• We accept pre-submission inquiries
• Our selector tool helps you to find the most relevant journal
• We provide round the clock customer support
• Convenient online submission
• Thorough peer review
• Inclusion in PubMed and all major indexing services
• Maximum visibility for your research
Submit your manuscript at
www.biomedcentral.com/submit
Submit your next manuscript to BioMed Central
and we will help you at every step:
Saad et al. BMC Complementary and Alternative Medicine (2017) 17:319 Page 13 of 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
Available via license: CC BY
Content may be subject to copyright.
