Axin2-expressing cells differentiate into reparative odontoblasts via autocrine Wnt/β-catenin signaling in response to tooth damage

Abstract

In non-growing teeth, such as mouse and human molars, primary odontoblasts are long-lived post-mitotic cells that secrete dentine throughout the life of the tooth. New odontoblast-like cells are only produced in response to a damage or trauma. Little is known about the molecular events that initiate mesenchymal stem cells to proliferate and differentiate into odontoblast-like cells in response to dentine damage. The reparative and regenerative capacity of multiple mammalian tissues depends on the activation of Wnt/β-catenin signaling pathway. In this study, we investigated the molecular role of Wnt/β-catenin signaling pathway in reparative dentinogenesis using an in vivo mouse tooth damage model. We found that Axin2 is rapidly upregulated in response to tooth damage and that these Axin2-expressing cells differentiate into new odontoblast-like cells that secrete reparative dentine. In addition, the Axin2-expressing cells produce a source of Wnt that acts in an autocrine manner to modulate reparative dentinogenesis.

Full text

1
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
www.nature.com/scientificreports
Axin2-expressing cells dierentiate
into reparative odontoblasts via
autocrine Wnt/β-catenin signaling
in response to tooth damage
Rebecca Babb, Dhivya Chandrasekaran, Vitor Carvalho Moreno Neves & Paul T. Sharpe
In non-growing teeth, such as mouse and human molars, primary odontoblasts are long-lived post-
mitotic cells that secrete dentine throughout the life of the tooth. New odontoblast-like cells are only
produced in response to a damage or trauma. Little is known about the molecular events that initiate
mesenchymal stem cells to proliferate and dierentiate into odontoblast-like cells in response to
dentine damage. The reparative and regenerative capacity of multiple mammalian tissues depends
on the activation of Wnt/β-catenin signaling pathway. In this study, we investigated the molecular
role of Wnt/β-catenin signaling pathway in reparative dentinogenesis using an in vivo mouse tooth
damage model. We found that Axin2 is rapidly upregulated in response to tooth damage and that these
Axin2-expressing cells dierentiate into new odontoblast-like cells that secrete reparative dentine.
In addition, the Axin2-expressing cells produce a source of Wnt that acts in an autocrine manner to
modulate reparative dentinogenesis.
e complex structural composition of adult mammalian teeth provides a hard-outer barrier that protects the
inner dental pulp from being exposed to the external environment. is barrier consists of two mineralised tis-
sues, an outer layer of enamel and an inner thicker layer of dentine. If this mineralised barrier is damaged due to
a trauma or dental caries, the dental pulp has the ability to produce a form of tertiary dentine called reactionary
dentine by stimulation of specialised cells known as primary odontoblasts located at the periphery of the pulp
chamber that are responsible for dentine secretion1–3. In non-growing teeth, such as molars, primary odontoblasts
can be lost if the dentine is breeched and the pulp is exposed. A second generation of odontoblast-like cells that
originate from mesenchymal stem cells (MSCs) in the pulp can replace lost primary odontoblasts. e newly
dierentiated odontoblast-like cells secrete a form of tertiary dentine called reparative dentine, (also referred
to as a dentine bridge) to seal the site of exposure and maintain pulp vitality. Continuously growing teeth, such
as rodent incisors produce new dentine throughout life as an adaptation to the self-sharpening at their tips4.
e continuous turnover of odontoblasts and pulp cells in the incisor is supported by mesenchyme stem cells
(MSCs) that reside in a neurovascular niche at their proximal ends5–7. Unlike incisors, little is known about
the molecular events that initiate MSCs to proliferate and dierentiate into odontoblast-like cells in response to
dentine damage in molars. e canonical Wnt/β-catenin signaling pathway is important for stem cell renewal,
proliferation and dierentiation8, 9. Activation of Wnt/β-catenin signaling causes β-catenin to accumulate in the
cytoplasm and translocate to the nucleus where it activates downstream target genes. During tooth development,
Wnt/β-catenin signaling is required at various stages of tooth morphogenesis10. Wnt responsive genes, such as
Axin2 are expressed in dierentiating odontoblasts, implicating Wnt/β-catenin signaling in odontoblast develop-
ment and maturation11–13. Inactivation of β-catenin expression during tooth development leads to the disruption
of odontoblast dierentiation and root formation whereas, the overexpression of β-catenin results in excessive
dentine production from mature odontoblasts14, 15. Limited information is available concerning the importance
of Wnt/β-catenin signaling in the generation of new odontoblast-like cells in postnatal teeth. e reparative and
regenerative capacity of multiple mammalian tissues depends on the activation of Wnt/β-catenin signaling path-
way and both epithelial and mesenchymal stem cells depend on this pathway being active to drive tissue renewal
and repair16. Several studies have shown that tissue specic stem cells involved in tissue regeneration and repair
Centre for Craniofacial and Regenerative Biology, Dental Institute, Kings College London, London, UK.
Correspondence and requests for materials should be addressed to P.T.S. (email: paul.sharpe@kcl.ac.uk)
Received: 13 February 2017
Accepted: 24 April 2017
Published: xx xx xxxx
OPEN

www.nature.com/scientificreports/
2
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
can be identied by genetically-labelled Wnt responsive genes17–21. It has previously been shown that elevated
Wnt signaling enhances reparative dentinogenesis in Axin2LacZ/LacZ mice22. We have shown that delivery of small
molecule inhibitors of GSK3 activity (Wnt/β-catenin signaling antagonists) directly to exposed pulps promotes
the production of reparative dentine in vivo23. In this study, we take advantage of genetically-modied mice to
investigate the molecular role of Wnt/β-catenin signaling in the reparative dentinogenesis process. Our study has
revealed that Axin2-expressing cells dierentiate into new odontoblast-like cells that secrete reparative dentine.
In addition, Axin2-expressing cells produce a source of Wnt ligands that acts in an autocrine manner to modulate
reparative dentinogenesis.
Methods
Mouse and animal information. All animals used in this study were handled in accordance with UK
Home Oce Regulations project license 70/7866 and personal license I6517C8EF. Experimental procedures were
approved by the King’s College Ethical Review Process. Axin2LacZ/LacZ, Axin2CreERT2, Rosa26-mTmG ox/+ (/+) and pCag-
CreERT2Wntless(Wls)ox-ox (/) were obtained from the Jackson Laboratory. TCF/Lef:H2B-GFP reporter mice
were a kind gi from Anna-Katerina Hadjantonakis24. To induce genetic recombination, adult mice (6 weeks)
were injected intraperitoneally with tamoxifen dissolved in corn oil/10% (vol/vol) ethanol, corresponding to
specic doses per gram body weight (0.1 mg of tamoxifen per gram of body weight). Axin2CreERT2 mice received
one dose of tamoxifen or corn oil (WT) on the day of tooth damage and another two doses over the next two con-
secutive days. Wls/ and Axin2CreERT2, Rosa26-mTmG /+; Wls/ mice received one dose of tamoxifen or corn oil (WT)
over three consecutive days and tooth damage was performed 5 days post last tamoxifen or corn oil injection.
Tooth damage protocol. Mice were anaesthetised with a solution made with Hypnorm (Fentanyl/uan-
isone - VetaPharma Ltd.), sterile water and Hypnovel (Midazolam - Roche) in the ratio 1:2:1 at the rate of 10 ml/
kg intraperitonially. e oral cavity was opened with a mouth retractor to expose the molars. e superior rst
molars were cleaned using a sterile cotton plug soaked in phosphate buered saline (PBS). A cavity was drilled in
the centre of the superior rst molar using a carbide bur (FG1/4) coupled to a high speed hand piece (Kavo Super
Torque LUX 2 640B). Drilling was stopped when the pulp was visible under the dentine roof and a 27 G3/4 needle
was used to expose the pulp chamber. Mineral Trioxide Aggregate (MTA; Maillefer, Dentsply) was applied to the
exposed pulp and the cavity was sealed with glass ionomer Ketac™ Cem radiopaque (3 M ESPE). Post-op, the
mice were given Vetergesic (Buprenorphine – Ceva) at the rate of 0.3 mg/kg intraperitonially as analgesic. e
animals were sacriced aer at various time points post-damage.
Dental pulp extraction. Dental pulp tissue was extracted from superior rst molars collected from CD-1
P21 mice according to the experiment time course post-damage. A 21G needle was used as an elevator to extract
teeth from the alveolar bone. e extracted teeth were placed in ice cold PBS and a 23 scalpel blade was used to
separate the tooth at the crown-root junction to expose the pulp chamber. e pulp was gently removed from the
pulp chamber and the root canal using a 0.6 mm straight tip tweezer. e pulp was stored in RNAlater (Sigma) at
−80 °C. For each condition, dental pulp tissue was pooled from at least 10 teeth and repeated in triplicate.
Real-time qPCR analysis. Total RNA was extracted from the dental pulp using TRIzol (Invitrogen) as rec-
ommended by the manufacturer’s instructions. e RNA was reverse transcribed using random primers (M-MLV
Reverse Transcriptase kit, Promega) according to the manufacturer’s instructions. Gene expression was then
assayed by real-time qPCR using Kappa Syber Fast (Kappa Biosystems) on a Rotor-Gene Q cycler (Qiagen) system.
Beta-actin primers (Forward - GGCTGTATTCCCCTCCATCG, Reverse - CCAGTTGGTAACAATGCCTGT)
were used for the housekeeping gene, Axin2 primers (Forward -TGACTCTCCTTCCAGATCCCA, Reverse
-TGCCCACACTAGGCTGACA) were used as the read-out of Wnt activity and for Gpr177 (Wls) expression,
Forward – TCTAATGGTGACCTGGGTGTC and Reverse – TTCCAGCTCAGTGCCATACC primers were used.
Reactions were performed in triplicate and relative changes to housekeeping gene were calculated by the 2− ΔΔCT
method.
Tissue processing and histological staining. Teeth were fixed in 4% paraformaldehyde (PFA) for
24-hours at 4 °C, washed with PBS and decalcified in 19% EDTA, pH 8 for 4 weeks. Decalcified teeth were
dehydrated through a graded series of ethanol, cleared in xylene and infused with wax at 60 °C in a Leica
ASP300 tissue processor. Samples were embedded in wax and 8 μm sections were cut using a microtome (Leica
RM2245, blade angle 5°). Sections were mounted on TrubondTM 380 slides (Electron Microscopy Sciences). For
Masson’s Trichrome staining, sections of adult teeth were deparanised in Neo-Clear and rehydrated through
a series of graded ethanol. Sections were stained with Weigert’s Haematoxylin for 10 minutes, followed by 1%
Biebrich-Scarlet-Acid Fuchsin solution for 15 minutes, dierentiated in a mix of 5% phosphomolybdic acid and
5% phosphotungstic acid for 15 minutes and stained with 2.5% Aniline Blue solution for 10 minutes. Following
staining, sections were dierentiated in 1% acetic acid, dehydrated through 90% and 100% ethanol, cleared in
Neo-Clear and permanently mounted in Neo-Mount.
Immunohistochemistry. Sections of adult teeth were deparanised in xylene and rehydrated in graded
ethanol. To reduce endogenous peroxidase activity, sections were quenched with 3.5% hydrogen peroxide in PBS
for 5 minutes and blocked with 10% goat serum in PBS with 0.1% Tween20 (PBST). No antigen retrieval was
performed. e Primary antibodies were applied overnight at 4 °C. Proliferating cell nuclear antigen (PCNA,
Abcam, ab18197) and green uorescent protein (GFP, Abcam, ab13970) antibodies were used at 1:200 and 1:500,
respectively in PBST containing 5% goat serum. Aer washing the sections with PBST they were incubated with
appropriate biotinylated secondary antibody, then horseradish peroxidase (HRP)-conjugated streptavidin-biotin
antibody and washed with PBST. Immunoreactivity was visualised with ImmPACT DAB HRP Substrate (Vector

www.nature.com/scientificreports/
3
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
Laboratories) or MenaPath green chromogen kit (Bio SB). Sections were counterstained with hematoxylin, dehy-
drated in graded ethanol, cleared in xylene and mounted in DPX. Sections were viewed in light-eld using a
Zeiss microscope (Axioskope 2 plus) and captured with an AxioCam HRC (Zeiss) using Axiovision soware. For
immunouorescent co-staining, PCNA and GFP antibodies were used at 1:200 and 1:500, respectively in PBST
containing 5% goat serum. Aer washing the sections with PBST they were incubated with Alexa Fluor® 647 to
detect GFP and Alexa Fluor® 568 to detect PCNA and counterstained with Hoechst (40 μg/ml) in PBS before
mounting with Citiuor. Immunouorescence was visualised with a Leica TCS SP5 laser confocal microscope.
In situ hybridisation and Immunouorescence. In situ hybridisation for dentine sialo-phosphoprotein
(Dspp) was performed on paran sections following standard procedures under RNase-free conditions25. Dspp
was detected using TSA biotin system (PerkinElmer) in combination with the TSA Plus Cyanine 3.5 detection
kit (PerkinElmer). Aer in situ hybridisation, slides were blocked with 10% goat serum in PBST, incubated with
anti-GFP antibody (Abcam, ab13970, 1:200) in PBST with 5% goat serum overnight at 4 °C. Sections were washed
with PBST, incubated with Alexa Fluor® 647 secondary antibody and counterstained with Hoechst (40 μg/ml) in
PBS before mounting with Citiuor. Immunouorescence was visualised with a Leica TCS SP5 laser confocal
microscope.
Figure 1. Time course of reparative dentinogenesis in molar tooth damage model. Masson’s Trichrome staining
of a superior rst molar 1 day post-damage (A) and in situ hybridisation analysis of Dspp expression in a
superior rst molar 1 day post-damage (B). Masson’s Trichrome staining of a superior rst molar 5 days post-
damage (C) and in situ hybridisation analysis of Dspp expression in a superior rst molar 5 days post-damage
(D). Masson’s Trichrome staining of a superior rst molar 14 days post-damage (E) and in situ hybridisation
analysis of Dspp expression in a superior rst molar 14 days post-damage (F). All damage was performed in
CD-1 mice and representative sagittal sections are shown from four independent experiments. Scale bars are
equivalent to 100 μm and an arrow indicates the site of damage.

www.nature.com/scientificreports/
4
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
Statistical Analysis. A two tailed unpaired Student’s t-test using GraphPad prism soware was used to
determine signicance, a P-value < 0.05 was considered statistically signicant. At least four independent experi-
ments were performed for statistical analysis of dental pulp tissues described in the gure legends. Statistical data
was presented as mean ± s.e.m.
Data Availability. e datasets generated during and/or analysed during the current study are available from
the corresponding author on reasonable request.
Figure 2. Pulp cells proliferate in response to damage. Immunohistochemical staining of proliferating cells
with a PCNA antibody in an undamaged molar at low (A) and high magnication (A’). Immunohistochemical
staining of proliferating cells with a PCNA antibody in a damaged superior rst molar 3 days post-damage at
low (B) and high magnication (B’). All damages were performed in CD-1 mice and representative sagittal
sections are from four independent experiments. Scale bars are equivalent to 100 μm, an arrow indicates a pulp
exposure. Quantication of the PCNA positive cells (C) was performed on three high-powered elds on at least
four specimens per group, *p = <0.05.
Figure 3. Wnt/β-catenin signaling is activated in proliferating cells in response to tooth damage.
Immunohistochemical staining of TCF/Lef (Wnt reporter) cells with a GFP antibody in an undamaged (A) and
damaged superior rst molar 3 days post-damage (B) from TCF/Lef:H2B-GFP reporter mice. Real-time qPCR
analysis of Axin2 gene expression in dental pulp tissue extracted from undamaged and damaged maxillary rst
molars (C), n = 4, *p = <0.05. Immunohistochemical staining of TCF/Lef:H2B-GFP cells with a GFP antibody
(D), proliferating cells with a PCNA antibody (E) and merged image (F) in a damaged superior rst molar 3
days post-damage from TCF/Lef:H2B-GFP reporter mice. Representative sagittal sections are shown from
four independent experiment’s. Scale bars are equivalent to 100 μm. e dentine-pulp interface is outlined by a
white dashed line drawn from the light eld image. An arrow indicates pulp exposure and arrow heads indicate
examples of double stained cells.

www.nature.com/scientificreports/
5
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
Results
Time course of reparative dentinogenesis in tooth damage model. To determine the timescale of
reparative dentinogenesis in our model, damaged teeth were stained with Masson’s Trichrome to visualise dentine
production, in situ hybridisation detection of Dspp gene was performed to identify odontoblasts26, 27 and immu-
nohistochemical staining PCNA was preformed to detect proliferating cells.
In situ hybridisation detection of Dspp showed primary odontoblasts located at the periphery of the dental
pulp expressed Dspp, however no Dspp expression was detected at the site of exposure at 1 day post-damage, due
to loss of local primary odontoblasts (Fig.1A,B). Dspp expression was observed at the site of exposure 5 days
post-damage and some reparative dentine was visible (Fig.1C,D). By 14 days post-damage, a dentine bridge
was formed and Dspp expression is localised underneath the dentine bridge (Fig.1E,F). Immunohistochemical
detection of PCNA in undamaged molars showed that there is little if any proliferation in the pulp chamber
(Fig.2A). When molars were damaged, dental pulp cells began to proliferate underneath the site of damage by
2 days post-damage, with proliferation peaking at 3 days and returning to resting levels by 14 days post-damage
(Fig.2B,C).
Collectively, these data demonstrate that cells of the dental pulp proliferate then differentiate into new
odontoblast-like cells that secrete reparative dentine in response to damage.
Wnt/β-catenin signaling is activated in proliferating cells in response to tooth damage. We
next wanted to investigate the role of Wnt/β-catenin signaling in reparative dentinogenesis process. Axin2LacZ
reporter mice have been widely used to visualise Wnt active cells in vivo22. We observed diusely stained Axin2
positive cells scattered under the site of exposure in damaged teeth from Axin2LacZ reporter mice (Supplementary
Figure1). It was not possible to assess if Axin2 cells were proliferating in damaged teeth from Axin2LacZ reporter
mice as the LacZ staining was not compatible with immunohistochemistry. We thus used TCF/Lef:H2B-GFP
reporter mice that allow the visualisation of Wnt active cells since β-catenin is a transcriptional cofactor for TCF/
Lef that is upstream regulator of Axin2.
Immunohistological staining of undamaged molars from TCF/Lef:H2B-GFP mice with a GFP antibody
showed that some primary odontoblasts had strong staining at the periphery of the pulp cusp (Fig.3A). Following
damage, Wnt active cells at the periphery of the top of the cusp were lost due to pulp exposure and Wnt active were
now detected throughout the pulp tissue under the site of exposure 3 days post-damage (Fig.3B). Furthermore,
real-time qPCR analysis of Axin2 expression from extracted dental pulps showed that Axin2 expression was
initially reduced, presumably as a result of the loss of Wnt active primary odontoblasts 1 day post-damage, then
signicantly increased by 3 days post-damage (Fig.3C). Immunouorescent co-staining of damaged molars from
TCF/Lef:H2B-GFP mice with GFP and PCNA antibodies, showed that some Wnt positive cells were proliferating
3 days post-damage (Fig.3D–F).
Odontoblast-like cells are descendants of Wnt active cells. To investigate the fate of Wnt active cells
we used Axin2CreERT2; Rosa26 mT-mGox/+ mice to lineage trace the progeny of Axin2-expressing cells. In these mice,
cells that express Axin2 are permanently labelled with GFP during the tamoxifen administration period, allowing
Figure 4. Odontoblast-like cells are descendants of Wnt active cells. Immunohistochemical staining of Axin2-
expressing cells with GFP in a damaged superior rst molar 3 days post-damage (A) and 14 days post-damage
at low (B) and high magnication (B’). Immunouorescent staining of Axin2-expressing cells with GFP (C), in
situ hybridisation analysis of dspp expression (D) and merged image (E) of damaged superior rst molar from
Axin2CreERT2; Rosa26-mT-mG ox/+ mice 5 days post-damage. Representative sagittal sections are shown from four
independent experiment’s. Scale bars are equivalent to 100 μm. e dentine-pulp interface is outlined by a white
dashed line drawn from the light eld image. An arrow indicates pulp exposure; arrow heads indicate examples
of double stained cells and asterisk indicates the formation of a dentine bridge.

www.nature.com/scientificreports/
6
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
fate mapping of labelled cells and their descendants. We administered tamoxifen immediately aer tooth damage
and for the next two days meaning only cells that express Axin2 in this period will be permanently labelled.
Immunohistochemical detection of GFP showed a few Axin2-labelled cells at the site of damage 3 days
post-damage (Fig.4A) and an increase in the number of Axin2-labelled cells were detected 14 days post-damage
beneath the dentine bridge (Fig.4B,B’). is data suggests that a population of pulp cells are expressing Axin2
in response to damage and these labelled cells are undergoing a proliferative expansion. Furthermore, some of
the Axin2-expressing cells were in close association with the newly formed dentine bridge and had characteristic
morphology of odontoblasts. ese data demonstrate that Axin2-expressing cells can dierentiate into reparative
odontoblast-like cells. Moreover, immunouorescent staining of Axin2-labeled cells with GFP and co-detection
of Dspp by in situ hybridisation, revealed that some Axin2-labeled cells co-expressed Dspp 5 days post-damage
underneath the site of exposure (Fig.4C–E). is data suggests that reparative odontoblasts are descendants of
Axin2-expressing cells.
Inhibition of Wnt signaling impairs reparative dentinogenesis. It has previously been shown that
elevating Wnt signaling enhances reparative dentinogenesis in vivo22. is was shown using Axin2LacZ/LacZ mice
that are a model for elevated Wnt/β-catenin signaling since these mice lack functional copies of both Axin2
alleles, a negative regulator of Wnt signaling. We also conrmed these ndings using our molar damage model
and additionally compared reparative dentine formation by elevated Wnt/β-catenin activity with that from a com-
monly used clinical capping agent, MTA (mineral trioxideaggregate) (Supplementary Figure2). In addition, we
investigated whether impairing Wnt/β-catenin signaling aected reparative dentinogenesis. Gpr177 (Wls)ox/ox
(/) mice do not express the Wls gene that encodes a sorting receptor required for Wnt secretion, thus cells cannot
release Wnts to activate Wnt/β-catenin signaling. Real-time qPCR conrmed that the expression of the Wls gene
was drastically reduced in the dental pulp tissue of Wls/ mice 5 days post-tamoxifen compared to WT mice
(Fig.5A). Masson’s Trichrome staining of damaged molars from Wls/ showed that reparative dentinogenesis
does not occur in the absence of Wnt signaling since no dentine bridge was formed in response to damage by 14
days post-damage compared to WT (Fig.5B,C).
However, we did observe resorption pits in the pulp chamber and the presence of TRAP positive cells in
damaged molars, suggesting the presence of osteoclasts (Supplementary Figure3). We also observed resorption
pits on the roots of undamaged molars (Supplementary Figure3). To overcome this pathology, we crossed Wls/
mice with Axin2CreERT2 mice to specically delete Wls in Axin2-expressing cells, thus only preventing these cells
from secreting Wnts. Masson’s Trichrome staining of damaged molars from Axin2CreERT2; Wls/ mice showed that
reparative dentinogenesis was severely impaired 14 days post-damage (Fig.5D). No resorption pits were observed
in undamaged or damaged teeth of Axin2CreERT2; Wls/ mice. Additionally, cell proliferation in response to pulp
exposure was signicantly reduced in damaged molars of Axin2CreERT2; Wls/ mice compared to WT 14 days post
damage (Fig.5E).
Discussion
To study the molecular mechanisms of reparative dentinogenesis, we established a controlled molar-damage
model in vivo. e damage (100 μm in diameter) was created occlusally in the centre of the superior rst molar
Figure 5. Inhibition of Wnt signaling in Axin2-expressing cells impairs reparative dentinogenesis. Real-time
qPCR analysis of Wls gene expression in dental pulp tissue extracted from WT and Wls/ mice teeth 5 days
post-damage (A) Masson’s Trichrome staining of a damaged superior rst molar from WT mice (B), Wls/
mice (C) and Axin2CreERT2;Wls/ mice 14 days post-damage (D). Representative sagittal sections are shown,
scale bars are equivalent to 100 μm, an arrow indicates the site of damage and an asterisk indicates a dentine
bridge. Quantication of PCNA positive cells in damaged superior rst molar from WT and Axin2CreERT2; Wls/
mice post-damage (E), n = 4, *p = <0.05.

www.nature.com/scientificreports/
7
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
crown to expose the dental pulp tissue with subsequent capping with mineral trioxide aggregate (MTA) and glass
ionomer restoration. We used MTA as it is a biocompatible material that releases calcium ions that are thought
to stimulate reparative dentine formation28–30. In endodontic procedures MTA is commonly used in vital pulp
therapy to treat exposed dental pulp31. In our model, we observed robust proliferation and dierentiation of a
population of cells into new odontoblast-like cells that secrete reparative dentine at the site of damage.
To investigate the role of Wnt/β-catenin signaling in reparative dentinogenesis we took advantage of genetic
mice models. Axin2LacZ and TCF/Lef:H2B-GFP reporter mice and real-time qPCR analysis of Axin2 expres-
sion, revealed that Wnt/β-catenin signaling was rapidly upregulated in response to damage. e upregulation of
Wnt/β-catenin signaling corresponded with the peak of cell proliferation in the reparative dentinogenesis process,
suggesting that Wnt/β-catenin signaling is mediating a proliferative expansion following damage. Furthermore,
proliferating Wnt responsive cells could be detected at the site of damage. Our genetic tracing results indicated
that Axin2-expressing cells undergo proliferative expansion following damage and some Axin2-expressing cells
dierentiate into odontoblast-like cells. At the end of the tracing period, the Axin2-expressing cells were in close
association with the dentine bridge and presented long processes that extend into the dentine, a characteristic
morphological feature of an odontoblast.
We confirmed that post-mitotic primary odontoblasts express Axin2 and that elevation of the level of
Wnt/β-catenin signaling enhances the production of reparative dentine in Axin2LacZ/LacZ mice22.
Interestingly, constitutive activation of the Wnt/β-catenin signaling did not promote primary odonto-
blasts to secrete reactionary dentine, but did enhance reparative dentinogenesis. Blocking Wnt/β-catenin sig-
naling prevented the formation of reparative dentine in response to damage. Specic blocking of the ability of
Axin2-expressing cells to release Wnts severely compromised the formation of reparative dentine. is nd-
ing indicates that Axin2-expressing cells are acting as their own source of Wnt ligands to drive reparative den-
tinogenesis via autocrine Wnt/β-catenin signaling. Autocrine Wnt/β-catenin signaling has been shown to be
Figure 6. Wnt/β-catenin signaling modulates reparative dentinogenesis. Pulp cells rapidly proliferate in response
to tooth damage shown by PCNA staining, with a signicant peak in proliferation occurring 3 days post-damage
and returning to baseline 14 days post-damage (Fig.2). New odontoblast-like cells are detected by DSPP expression
as early as 5 days post-damage and a dentine bridge is seen 14 days post-damage (Fig.1). Our data shows that pulp
exposure rst triggers proliferation, followed by odontoblast dierentiation and secretion of reparative dentine
to form a dentine bridge. Wnt reporter mice (TCF/Lef:H2B-GFP) demonstrated proliferating cells are Wnt
responsive 3 days post-damage (Fig.3). Real-time qPCR analysis of Axin2 expression demonstrated that Axin2 is
signicantly elevated 3 days post-damage, indicating that the Wnt responsive cells are Axin2 positive ((Fig.3C),
Supplementary Figure1). Lineage tracing of Axin2 cells in Axin2CreERT2, Rosa26 mTmG /+ mice demonstrated that these
cells undergo a proliferative expansion and dierentiate into odontoblast-like cells indicated by their co-expression
of Dspp 5 days post-damage, characteristic odontoblast morphology and close association with the dentine
bridge 14 days post-damage (Fig.4). Loss of Wnt signaling in Wls/ mice demonstrated that damaged teeth no
longer repair as a dentine bridge is absent 14 days post-damage compared to WT (Fig.5B). Moreover, specically
deleting Wls in Axin2-expressing cells in Axin2CreERT2; Wls/ mice severely impaired dentine bridge formation
14 days post-damage compared to WT (Fig.5D). is suggests that Axin2 cells are producing their own source of
Wnt to modulate their fate in an autocrine manner. Additionally, Wnt signaling is important for damage induced
proliferation as the number of proliferating cells are signicantly reduced in Axin2CreERT2; Wls/ compared to WT
at 3 and 5 days post-injury (Fig.5E).

www.nature.com/scientificreports/
8
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
the mechanism by which some regenerating tissues renew. Axin2-expressing cells are responsible for skin and
hair follicle renewal and these cells co-express Wnt ligands17, 20. Furthermore, we showed that preventing Axin-2
expressing cells from secreting Wnts decreased the expansion of proliferative cells post-damage. is suggests that
autocrine Wnt/β-catenin signaling stimulates cell proliferation in response to damage and provides an explana-
tion for why reparative dentinogenesis is impaired in Axin2CreERT2; Wlsox-ox mice.
Our study shows that Wnt/β-catenin signaling is important for the lifespan of primary odontoblasts as well
as the generation of new odontoblast-like cells in response to tooth damage. We identify that Axin2 is expressed
in odontoblast-like cells and that Axin2-expressing cells may be the source of their own proliferative signals
in reparative dentinogenesis (Fig.6). e role for Wnt/β-catenin signaling in mature primary odontoblasts is
unclear. Overexpression of Wnt/β-catenin signaling in primary odontoblasts did not trigger the production of
excessive dentine in the absence of damage. is suggests that Wnt/β-catenin signaling is not enhancing the secre-
tory activity of odontoblasts. e ability of Wnt/β-catenin signaling to selectively enhance reparative dentinogen-
esis is intriguing and may suggest that Wnt/β-catenin signaling is working in synergy with other damage activated
signaling pathways (such as signaling molecules sequestered in dentine tubules that are released in response to
trauma and injury) to potentiate dentine production32, 33. Alternately, Wnt/β-catenin signaling may be increas-
ing the number of odontoblast-like cells, whereas primary odontoblast are unaected as they are post-mitotic.
Further studies to elucidate the dual roles of Wnt/β-catenin signaling in reactionary and reparative dentinogene-
sis could identify therapeutic strategies that actively promote stem cell driven tooth repair.
References
1. Goldberg, M. & Smith, A. J. Cells and Extracellular Matrices of Dentin and Pulp: A Biological Basis for epair and Tissue
Engineering. Critical Reviews in Oral Biology & Medicine 15, 13–27, doi:10.1177/154411130401500103 (2004).
2. Yu, T., Volponi, A. A., Babb, ., An, Z. & Sharpe, P. T. In Current Topics in Developmental Biology Vol. Volume 115 (ed. Chai, Yang)
187–212 (Academic Press, 2015).
3. Sloan, A. J. & Smith, A. J. Stem cells and the dental pulp: potential roles in dentine regeneration and repair. Oral Dis. 13, 151–157,
doi:10.1111/j.1601-0825.2006.01346.x (2007).
4. Pang, Y. W. Y. et al. Perivascular Stem Cells at the Tip of Mouse Incisors egulate Tissue egeneration. J. Bone Miner. Res. 31,
514–523, doi:10.1002/jbmr.2717 (2016).
5. Feng, J., Mantesso, A., De Bari, C., Nishiyama, A. & Sharpe, P. T. Dual origin of mesenchymal stem cells contributing to organ
growth and repair. Proceedings of the National Academy of Sciences 108, 6503–6508, doi:10.1073/pnas.1015449108 (2011).
6. Zhao, H. et al. Secretion of Shh by a Neurovascular Bundle Niche Supports Mesenchymal Stem Cell Homeostasis in the Adult Mouse
Incisor. Cell Stem Cell 14, 160–173, doi:10.1016/j.stem.2013.12.013 (2014).
7. auua, N. et al. Glial origin of mesenchymal stem cells in a tooth model system. Nature 513, 551–554, doi:10.1038/nature13536
(2014).
8. Visweswaran, M. et al. Multi-lineage dierentiation of mesenchymal stem cells – To Wnt, or not Wnt. e International Journal of
Biochemistry & Cell Biology 68, 139–147, doi:10.1016/j.biocel.2015.09.008 (2015).
9. ühl, S. J. & ühl, M. On the role of Wnt/β-catenin signaling in stem cells. Biochimica et Biophysica Acta (BBA) - General Subjects
1830, 2297–2306, doi:10.1016/j.bbagen.2012.08.010 (2013).
10. Liu, F. & Millar, S. E. Wnt/β-catenin Signaling in Oral Tissue Development and Disease. Journal of Dental Research 89, 318–330,
doi:10.1177/0022034510363373 (2010).
11. Lohi, M., Tucer, A. S. & Sharpe, P. T. Expression of Axin2 indicates a role for canonical Wnt signaling in development of the crown
and root during pre- and postnatal tooth development. Developmental Dynamics 239, 160–167, doi:10.1002/dvdy.22047 (2010).
12. Yoose, S. & Naa, T. Lymphocyte enhancer-binding factor 1: an essential factor in odontoblastic dierentiation of dental pulp cells
enzymatically isolated from rat incisors. Journal of Bone and Mineral Metabolism 28, 650–658, doi:10.1007/s00774-010-0185-0
(2010).
13. Zhang, Y. D., Chen, Z., Song, Y. Q., Liu, C. & Chen, Y. P. Maing a tooth: growth factors, transcription factors, and stem cells. Cell
Res 15, 301–316 (2005).
14. im, T.-H. et al. Constitutive stabilization of ß-catenin in the dental mesenchyme leads to excessive dentin and cementum
formation. Biochemical and Biophysical Research Communications 412, 549–555, doi:10.1016/j.bbrc.2011.07.116 (2011).
15. im, T. H. et al. β-catenin is equired in Odontoblasts for Tooth oot Formation. Journal of Dental Research 92, 215–221,
doi:10.1177/0022034512470137 (2013).
16. Clevers, H., Loh, . M. & Nusse, . An integral program for tissue renewal and regeneration: Wnt signaling and stem cell control.
Science 346, doi: 10.1126/science.1248012 (2014).
17. Lim, X. et al. Interfollicular epidermal stem cells self-renew via autocrine Wnt signaling. Science (New York, N.Y.) 342, 1226–1230,
doi:10.1126/science.1239730 (2013).
18. Wang, B., Zhao, L., Fish, M., Logan, C. Y. & Nusse, . Self-renewing diploid Axin2+ cells fuel homeostatic renewal of the liver.
Nature 524, 180–185, doi:10.1038/nature14863 (2015).
19. Maruyama, T., Jeong, J., Sheu, T.-J. & Hsu, W. Stem cells of the suture mesenchyme in craniofacial bone development, repair and
regeneration. Nat Commun 7, doi: 10.1038/ncomms10526 (2016).
20. Lim, X., Tan, S. H., Yu, . L., Lim, S. B. H. & Nusse, . Axin2 mars quiescent hair follicle bulge stem cells that are maintained by
autocrine Wnt/β-catenin signaling. Proceedings of the National Academy of Sciences 113, E1498–E1505, doi:10.1073/
pnas.1601599113 (2016).
21. Taase, H. M. & Nusse, . Paracrine Wnt/β-catenin signaling mediates proliferation of undierentiated spermatogonia in the adult
mouse testis. Proceedings of the National Academy of Sciences 113, E1489–E1497, doi:10.1073/pnas.1601461113 (2016).
22. Hunter, D. J. et al. Wnt Acts as a Prosurvival Signal to Enhance Dentin egeneration. J. Bone Miner. Res. 30, 1150–1159, doi:10.1002/
jbmr.2444 (2015).
23. Neves, V. C. M., Babb, ., Chandrasearan, D. & Sharpe, P. T. Promotion of natural tooth repair by small molecule GS3 antagonists.
Scientic Reports 7, 39654, doi:10.1038/srep39654 (2017).
24. Ferrer-Vaquer, A. et al. A sensitive and bright single-cell resolution live imaging reporter of Wnt/ß-catenin signaling in the mouse.
BMC Developmental Biology 10, 121, doi:10.1186/1471-213x-10-121 (2010).
25. Wilinson, D. G., Bhatt, S. & McMahon, A. P. E xpression pattern of the FGF-related proto-oncogene int-2 suggests multiple roles in
fetal development. Development 105, 131–136 (1989).
26. Butler, W. T. et al. Isolation, characterization and immunolocalization of a 53-Dal dentin sialoprotein (DSP). Matrix (Stuttgart,
Germany) 12, 343–351 (1992).
27. itchie, H. H., Hou, H., Veis, A. & Butler, W. T. Cloning and sequence determination of rat dentin sialoprotein, a novel dentin
protein. Journal of Biological Chemistry 269, 3698–3702 (1994).

www.nature.com/scientificreports/
9
Scientific RepoRts | 7: 3102 | DOI:10.1038/s41598-017-03145-6
28. D’Antò, V. et al. Effect of Mineral Trioxide Aggregate on Mesenchymal Stem Cells. Journal of Endodontics 36, 1839–1843,
doi:10.1016/j.joen.2010.08.010 (2010).
29. Zhao, X. et al. Mineral trioxide aggregate promotes odontoblastic dierentiation via mitogen-activated protein inase pathway in
human dental pulp stem cells. Molecular Biology Reports 39, 215–220, doi:10.1007/s11033-011-0728-z (2012).
30. Daltoé, M. O. et al. Expression of Mineralization Marers during Pulp esponse to Biodentine and Mineral Trioxide Aggregate.
Journal of Endodontics 42, 596–603, doi:10.1016/j.joen.2015.12.018 (2016).
31. Garcia-Godoy, F. & Murray, P. E. ecommendations for using regenerative endodontic procedures in permanent immature
traumatized teeth. Dental Traumatology 28, 33–41, doi:10.1111/j.1600-9657.2011.01044.x (2012).
32. Sadaghiani, L. et al. Growth Factor Liberation and DPSC esponse Following Dentine Conditioning. Journal of Dental Research 95,
1298–1307, doi:10.1177/0022034516653568 (2016).
33. Smith, A. J. et al. Dentine as a bioactive extracellular matrix. Arch. Oral Biol. 57, 109–121, doi:10.1016/j.archoralbio.2011.07.008
(2012).
Acknowledgements
Research was supported by the Medical Research Council and the NIHR GSTFT/KCL Biomedical Research
Centre. We thank Lucia Zaugg for her comments on the manuscript.
Author Contributions
P.S. and R.B. designed and interpreted the experiments. R.B. developed the tooth damage procedure, preformed
the experiments and analysed the data. D.C. provided animal support, helped develop and preformed the tooth
drilling. V.N. preformed the qPCR analysis of Axin2 expression. R.B. draed the paper and P.S. revised the
manuscript. All authors read and approved the nal manuscript. R.B. takes responsibility for the integrity of the
data analysis.
Additional Information
Supplementary information accompanies this paper at doi:10.1038/s41598-017-03145-6
Competing Interests: e authors declare that they have no competing interests.
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and
institutional aliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International
License, which permits use, sharing, adaptation, distribution and reproduction in any medium or
format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-
ative Commons license, and indicate if changes were made. e images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons license and your intended use is not per-
mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
© e Author(s) 2017