Access to this full-text is provided by PLOS.
Content available from PLOS ONE
This content is subject to copyright.
RESEARCH ARTICLE
Next-generation sequencing of the human
TRPV1 gene and the regulating co-players
LTB4R and LTB4R2 based on a custom
AmpliSeq™panel
Dario Kringel
1
, Marco Sisignano
1
, Sebastian Zinn
1
, Jo
¨rn Lo
¨tsch
1,2
*
1Institute of Clinical Pharmacology, Goethe - University, Frankfurt am Main, Germany, 2Fraunhofer
Institute of Molecular Biology and Applied Ecology - Project Group Translational Medicine and Pharmacology
(IME-TMP), Frankfurt am Main, Germany
*j.loetsch@em.uni-frankfurt.de
Abstract
Background
Transient receptor potential cation channel subfamily V member 1 (TRPV1) are sensitive to
heat, capsaicin, pungent chemicals and other noxious stimuli. They play important roles in
the pain pathway where in concert with proinflammatory factors such as leukotrienes they
mediate sensitization and hyperalgesia. TRPV1 is the target of several novel analgesics
drugs under development and therefore, TRPV1 genetic variants might represent promising
candidates for pharmacogenetic modulators of drug effects.
Methods
A next-generation sequencing (NGS) panel was created for the human TRPV1 gene and in
addition, for the leukotriene receptors BLT1 and BLT2 recently described to modulate
TRPV1 mediated sensitisation processes rendering the coding genes LTB4R and LTB4R2
important co-players in pharmacogenetic approaches involving TRPV1. The NGS workflow
was based on a custom AmpliSeq™panel and designed for sequencing of human genes on
an Ion PGM™Sequencer. A cohort of 80 healthy subjects of Western European descent
was screened to evaluate and validate the detection of exomic sequences of the coding
genes with 25 base pair exon padding.
Results
The amplicons covered approximately 97% of the target sequence. A median of 2.81 x 10
6
reads per run was obtained. This identified approximately 140 chromosome loci where
nucleotides deviated from the reference sequence GRCh37 hg19 comprising the three
genes TRPV1,LTB4R and LTB4R2. Correspondence between NGS and Sanger derived
nucleotide sequences was 100%.
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 1 / 16
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Kringel D, Sisignano M, Zinn S, Lo¨tsch J
(2017) Next-generation sequencing of the human
TRPV1 gene and the regulating co-players LTB4R
and LTB4R2 based on a custom AmpliSeq™panel.
PLoS ONE 12(6): e0180116. https://doi.org/
10.1371/journal.pone.0180116
Editor: Sidney Arthur Simon, Duke University
School of Medicine, UNITED STATES
Received: March 25, 2017
Accepted: June 11, 2017
Published: June 28, 2017
Copyright: ©2017 Kringel et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: Data can be accessed
at the BioProject database. Specific accession
numbers and URLs are included in Supporting
Information files S1 Table, S2 Table, and S3 Table.
Funding: This work has been funded by the
European Union Seventh Framework Programme
(FP7/2007 - 2013) under grant agreement no.
602919 (“GLORIA”, JL). Support of the laboratory
equipment was gained from the Landesoffensive
zur Entwicklung wissenschaftlich-o¨konomischer
Exzellenz (LOEWE), LOEWE-Zentrum fu¨r
Conclusions
Results suggested that the NGS approach based on AmpliSeq™libraries and Ion Personal
Genome Machine (PGM) sequencing is a highly efficient mutation detection method. It is
suitable for large-scale sequencing of TRPV1 and functionally related genes. The method
adds a large amount of genetic information as a basis for complete analysis of TRPV1 ion
channel genetics and its functional consequences.
Introduction
The transient receptor potential (TRP) family comprises several non-selective cation chan-
nels [1] enabling or inhibiting the transmembrane transport of several ions. Various mem-
bers of this ion channel family are expressed at nociceptors and via their excitation by
chemical, thermal or mechanical stimuli involved in the perception of pain [2]. This makes
them primary candidates for the discovery of novel analgesic drugs [3]. A query of the
Thomson Reuters “Drugs and Biologics Search Tool” (http://integrity.thomsonpharma.com)
in June 2016 indicated that by far the most frequently regarded TRP member in analgesic
drug development is TRP cation channel, subfamily V, member 1 (TRPV1 [4]) for which
more than 200 agonists or antagonists are currently under development, which bases on the
concept that endogenous agonists or sensitizers acting on TRPV1 provide a major contribu-
tion to pathophysiological pain conditions [5,6]. The pharmacological modulation of this
mechanism employs (i) the approach of direct antagonism of the TRPV1 ion channel, (ii)
the exposure to agonists such as capsaicin that initially activates TRPV1 but upon prolonged
exposure induces a deactivation via a calcineurin-dependent channel dephosphorylation
and desensitization [7] and (iii) to prevent a sensitization and hyperactivation of the TRPV1
channel [8].
Given the importance of TRPV1 in pain and analgesic drug discovery and development,
TRPV1 genetics move into a focus of pharmacogenetic interest. A modulation of the effects of
TRPV1 targeting analgesics is supported by observations that intronic TRPV1 variants were
associated with insensitivity to capsaicin [9] while the coding TRPV1 variant rs8065080 was
associated with altered responses to experimentally induced pain [10]. Moreover, gain-of-
function mutations in TRPV1 have been associated with increased pain sensitivity [11], for
which TRPV1 antagonists would enable a specific pharmacogenetics-based personalized cure.
Hence, genetic variation of human TRPV1 is in a focus of pain and analgesic research. With
the broader availability of next generation sequencing (NGS) [12], a limitation to already
investigated variants has fallen in favor of unrestricted access to the whole genetic information
in agreement with the wider acceptance of whole genomic information as a valuable method
in clinical research [13].
In this report, the evaluation of a new NGS method based on a custom AmpliSeq™library
and Ion Torrent sequencing for the fast detection of genetic variations in the human TRPV1
gene is described. However, preclinical evidence indicates that leukotriene B4 mediates the
inflammation via TRPV1 [14] and that the nociceptive function of TRPV1 is modulated by the
activation of leukotriene receptors BLT1 and BLT2 [8] that are highly expressed in TRPV1
expressing dorsal root ganglion neurons. Both receptors form an antagonistic sensitizing sys-
tem and have opposing roles in TRPV1 sensitisation. This renders them important co-players
in pharmacogenetic approaches at analgesics aiming at modulation of the function of TRPV1.
To provide a comprehensive basis for pharmacogenetic assessments of TRPV1 modulators,
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 2 / 16
Translationale Medizin und Pharmakologie (JL) and
personnel support was received from the Else
Kro¨ner-Fresenius Foundation (EKFS), Research
Training Group Translational Research Innovation
– Pharma (TRIP, JL). The funders had no role in
study design, data collection and analysis, decision
to publish, or preparation of the manuscript.
Competing interests: The authors have declared
that no further conflicts of interest exist.
the present NGS panel was extended with human LTB4R and LTB4R2 genes that code for the
leukotriene receptors of present interest.
Methods
DNA template preparation and amplification
The investigation followed the Declaration of Helsinki on Biomedical Research Involving
Human Subjects and was approved by the Ethics Committee of the Medical Faculty of the
Goethe-University, Frankfurt, Germany. All participating subjects had provided informed
written consent. Genomic DNA was available from venous blood samples drawn from a ran-
dom sample of 80 healthy volunteers of Western European descent according to self-assign-
ment. DNA was extracted from 200 μl blood on a BioRobot EZ1 workstation applying the
blood and body fluid spin protocol provided in the EZ1 DNA Blood 200 μl Kit (Qiagen, Hil-
den, Germany).
Exomic genotyping was performed for the TRPV1 gene (NCBI ID 7442), located on chro-
mosome 17 and encoding for the TRPV1 ion channel and for the LTB4R and LTB4R2 genes
(NCBI IDs 1241 and 56413), both located on chromosomes 14 and encoding for leukotriene
B4 receptors BLT1 and BLT2. A multiplex PCR amplification strategy for the coding genes
sequences was accomplished online (Ion Ampliseq™Designer; http://www.ampliseq.com) to
amplify the target region specified above (for primer sequences, see S1 Table) with 25 base pair
exon padding. After comparison of several primer design options, the design providing the
maximum target sequence coverage was chosen. The ordered amplicons covered 97.02% of
the target sequence. A total of 10 ng DNA per sample were used for the target enrichment by a
multiplex PCR and each DNA pool was amplified with the Ion Ampliseq™Library Kit in con-
junction with the Ion Ampliseq™“custom Primer Pool”—protocols according to the manufac-
turer procedures (Life Technologies, Darmstadt, Germany).
After each pool had undergone 17 PCR cycles, the PCR primers were removed with FuPa
Reagent and the amplicons were ligated to the sequencing adapters with short stretches of
index sequences (barcodes) that enabled sample multiplexing for subsequent steps (Ion
Xpress™Barcode Adapters Kit; Life Technologies). After purification with AMPure XP beads
(Beckman Coulter, Krefeld, Germany), the barcoded libraries were quantified with a Qubit
1
2.0 Fluorimeter (Life Technologies, Darmstadt, Germany) and normalized for DNA concen-
tration to a final concentration of 20 pmol/L using the Ion Library Equalizer™Kit (Life Tech-
nologies, Darmstadt, Germany). Equalized barcoded libraries from 11 to 40 samples at a time
were pooled. To clonally amplify the library DNA onto the Ion Sphere Particles (ISPs; Life
Technologies, Darmstadt, Germany), the library pool was subjected to emulsion PCR by using
an IT OneTouch template kit on an IT OneTouch system (Life Technologies, Darmstadt, Ger-
many) following the manufacturer’s protocol.
Sequencing
Enriched ISPs which carried many copies of the same DNA fragment were subjected to
sequencing on an Ion 318 Chip to sequence pooled libraries with eleven to twelve samples.
The 318 chip was chosen (instead of the low-capacity 314 or the middle-capacity 316 chip) to
obtain a high sequencing depth of coverage which was averagely of 50x which means that,
each base has been sequenced 50 times, when 40 samples were loaded. Sequencing was
performed using the sequencing kit (Ion PGM 200 Sequencing Kit; Life Technologies, Darm-
stadt, Germany) as per the manufacturer’s instructions with the 200-bp single-end run
configuration.
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 3 / 16
Bioinformatics generation of sequence information
The raw data (unmapped BAM-files) from the sequencing runs were processed using Torrent
Suite Software (Version 4.4.2, Life Technologies, Darmstadt, Germany) to generate read align-
ments which are filtered by the software into mapped BAM-files using the reference genomic
sequence (hg19) of target genes. Variant calling was performed with the Torrent Variant Caller
Plugin using as key parameters: minimum quality = 10, minimum coverage = 20, and mini-
mum coverage on either strand = 3. The annotation of called variants was done using the Ion
Reporter Software (Version 5.0; Life Technologies, Darmstadt, Germany) and the variant clas-
sification tool of the SNP and Variation Suite software (Version 8.4.4; Golden Helix, Bozeman,
MT, USA) for the VCF (variant call format) files that contained the nucleotide reads and the
GenomeBrowse
1
software (Version 2.0.4, Golden Helix, Bozeman, MT, USA) to map the
sequences to the reference sequences GRCh37 g1k (dated February 2009).
On the basis of the observed allelic frequency, the expected number of homozygous and
heterozygous carriers of the respective SNP (single nucleotide polymorphism) was calculated
using the Hardy-Weinberg equation. Indicating that the study sample corresponded to a ran-
dom sample of subjects, Fisher’s exact test [15] was used as proposed previously [16]. Only var-
iants within the Hardy-Weinberg equilibrium were retained. The SNP and Variation Suite
software (Version 8.4.4; Golden Helix, Bozeman, MT, USA) was used for the analysis of
sequence quality, coverage and for variant identification.
Method validation
Method validation was accomplished by means of Sanger sequencing [17,18] in an indepen-
dent external laboratory (Eurofins Genomics, Ebersberg, Germany). For the detected variant
type, i.e., single nucleotide polymorphisms (SNV), nucleotide insertions (Ins) and nucleotide
deletions (Del), the variant with the highest frequency of the rare allele was chosen for external
sequencing: 17:3493769-SNV, 17:3496181_Ins, 17:3512619_Del. In addition, the variant
17:3480447-SNV, which is the functional rs8065080 SNP previously associated with altered
pain sensitivity [10], was added accommodating the present context of analgesics’ pharmaco-
genetic. Amplification of the respective DNA segments was done using PCR primer pairs (for-
ward, reverse) of (i) 5´-CCATGTTGCGTCTCTCGATG-3´ and 5´-CAACCCGTTATTTCCT
GTTCCCA-3´ (ii) 5´- CTCAGAGGTGAGCAGGCCTAGC -3´ and 5´- AAGGCCAGGATGCT
TGACAGATG -3´, (iii) 5´- AAGGCACAAGACTCTGGAAGAAT-3´ and 5´- CGAGTTTGGG
AAGCAGTCGTAT-3´ and (iv) 5´- ACCCAGTGCCTTCTCATTCAG-3´ and 5´- CACGTT
CTCAAGACGCATCC-3´.Results of Sanger sequencing were aligned with the genomic
sequence and analyzed using Chromas Lite
1
(Version 2.1.1, Technelysium Pty Ltd, South
Brisbane, Australia) and the GenomeBrowse
1
(Version 2.0.4, Golden Helix, Bozeman, MT,
USA) was used to compare the sequences obtained with NGS or Sanger techniques.
Results
The NGS assay of human TRPV1,LTB4R2 and LTB4R genes was established on 80 genomic
DNA samples obtained from a random selection of healthy subjects of Caucasian ethnicity.
As proposed previously [19], only exons and their boundary sequences for which read-
depths >20 for each nucleotide could be obtained were considered as successfully analyzed.
Applying this criterion, complete or nearly complete coverage of the relevant sequences was
obtained (Table 1; for details on missing variants, see S2 Table). The sequencing of the whole
cohort required two separate runs with each 40 patients’ samples. Coverage statistics (Table 1)
were comparable between both runs and were in the range of accepted quality criteria [20–22].
During the runs, a median of 2.81 10
6
reads per run was generated. The mean depth was near
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 4 / 16
from 200 reads, the mean read length evaluated 198 bases and average chip loading was 66%
(Fig 1). To ensure a high density of ISPs on a chip and hence, a high sequencing output,
the chip loading value should be 60%. The observed NGS results agreed with the results
obtained with conventional sequencing of random samples (Fig 2). In all validation samples,
the correspondence between NGS and Sanger derived nucleotide sequences was 100%, all of
the tested nucleotide variants could be verified.
Following elimination of nucleotides agreeing with the standard human genome sequence
GRCh37 g1k (dated February 2009), the result of the NGS consisted of a vector of nucleotide
Table 1. AmpliSeq™amplicons and coverage details of the human LTB4R2,LTB4R and TRPV1 NGS assay.
Gene Chr*Chr start Chr end Amplicons Total bases Covered bases Coverage Sum (total, covered, %)
LTBR42 Chr14 34634693 34635880 8 1187 1187 1.000 3520, 3427, 98.3%
34636968 34637111 1 143 143 1.000
34636968 34637134 1 166 166 1.000
34637238 34637442 2 204 204 1.000
34637191 34637442 2 251 251 1.000
34637578 34637848 2 270 251 0.930
34637518 34637848 2 330 256 0.776
34634693 34635880 8 1187 1187 1.000
LTBR4 Chr14 34637238 34637442 2 204 204 1.000 5683, 5117, 97%
34637191 34637442 2 251 251 1.000
34637578 34637848 2 270 251 0.930
34637518 34637848 2 330 256 0.776
34634693 34635880 8 1187 1187 1.000
34637238 34637442 2 204 204 1.000
TRPV1 Chr17 24636968 24637111 1 143 143 1.000 23787, 21859, 98.8%
24636968 24637134 1 166 166 1.000
24637238 24637442 2 204 204 1.000
24637191 24637442 2 251 251 1.000
24636968 24637134 1 166 166 1.000
24637238 24637442 2 204 204 1.000
24637191 24637442 2 251 251 1.000
24636968 24637134 1 166 166 1.000
24637238 24637442 2 204 204 1.000
24637191 24637442 2 251 251 1.000
24636968 24637134 1 166 166 1.000
24637238 24637442 2 204 204 1.000
24637191 24637442 2 251 251 1.000
24637191 24637442 2 251 251 1.000
24636968 24637134 2 270 251 0.930
24637238 24637442 2 330 256 0.776
24637191 24637442 8 1187 1187 1.000
24636968 24637134 2 251 251 1.000
24637238 24637442 2 270 251 0.930
24637191 24637442 2 330 256 0.776
24636968 24637134 8 1187 1187 1.000
*: Chr: Chromosome.
https://doi.org/10.1371/journal.pone.0180116.t001
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 5 / 16
information about the LTB4R2,LTB4R and TRPV1 genes for each individual DNA sample
(Fig 3). This vector had a length equaling the set union of the number of chromosomal posi-
tions in which a non-reference nucleotide had been found in any probe of the actual cohort of
randomly chosen healthy subjects. Specifically, a total of 156 genetic variants was found, of
which 11, 28 and 117 were located in the LTB4R2,LTB4R and TRPV1 genes, respectively (Fig
3). Of the observed variants, 38 were located in coding parts of the genes (Table 2), 56 were
located in introns, 33 in the 3’-UTR, 16 in the 5’-UTR, 5 variants were assigned to both UTR’s
and 8 were located downstream. The nucleotidic and, if present, the resulting amino acid
exchanges, of the coding variants are listed in Table 2. The allelic frequencies corresponded
to those expected based on the Hardy-Weinberg equilibrium (Fisher’s exact tests: p
always >0.05) and, for variants with reported clinical functional association, the observed alle-
lic frequency was comparable to reported frequencies (Table 3). Most of the observed variants
were single nucleotide polymorphisms (n = 135; 9, 25 and 101 in the LTB4R2,LTB4R and
TRPV1 genes, respectively) whereas classified as mixed polymorphisms (n = 8), nucleotide
insertions (n = 6), nucleotide deletions (n = 5) or multinucleotide polymorphisms (n = 2) were
more rarely found in the present cohort.
Fig 1. Pseudo-color image of the Ion 318™v2 chip plate showing percent loading across the physical
surface. This sequencing run had a 70% loading, which ensures a high ISP density. Every 318 chip contains
more than 6 million wells and the color scale on the right side conduces as a loading indicator. Deep red
coloration stays for a 100% loading, which means that every well in this area contains an ISP (templated and
non-templated) whereas deep blue coloration implies that the wells in this area are empty.
https://doi.org/10.1371/journal.pone.0180116.g001
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 6 / 16
Discussion
An NGS assay for the exons and regulatory parts of the human genes coding for the TRPV1
ion channel and those coding for its recently associated co-players comprising the leukotriene
receptors BLT1 and BLT2 (LTB4R,LTB4R2). The NGS assay produced valid nucleotide
sequences corresponding to those obtained with the classical Sanger sequencing technique.
The NGS assay is suitable for small to large-scale experimental setups aiming at accessing the
information about any nucleotide in a study cohort, with a selection of those that differ from
the reference nucleotide.
TRPV1 ion channels mediate pain induced by noxious heat (>43˚C) [23]. A most striking
phenotype of Trpv1 –/– mice is a severe deficit of inflammation-induced thermal hyperalgesia
[24]. In addition to heat, TRPV1 expression is largely associated with small diameter primary
afferent nerve fibers, which are sensitive to various chemical excitants including protons (low
pH), capsaicin, lipoxygenase, resiniferatoxin, ethanol, N-arachidonoyl-dopamine and the
endogenous cannabinoid anandamide [3,25]. Based on evidence that TRPV1 channels are
necessary for the development of inflammatory hyperalgesia to thermal stimuli [24] their role
in pain has been acknowledged for more than two decades [24,26]. Currently, they are used as
target of capsaicin containing analgesics. However, TRPV1 remains a primary candidate for
the discovery of novel analgesic drugs [3] and approximately 200 modulators of this target are
currently under development (http://integrity.thomsonpharma.com). This establishes a strong
future pharmacogenetic context of TRPV1 considering the increasing acknowledgment that
the treatment of pain will benefit from individualized approaches including those based on the
patient’s genotype [8].
Research on the genetic variation of variants in human TRPV1 or leukotriene receptor genes
is an active topic that has already provided several clinically relevant functional associations. A
Fig 2. Alignment of the ion torrent sequence of the TRPV1 gene illustrated by Golden Helix Genome
Browse
®
readout versus the same sequence according to a Sanger electrophereogram. Highlighted is
the coding TRPV1 variant rs8065080 as a heterozygous mutation and a non-mutated wild type.
https://doi.org/10.1371/journal.pone.0180116.g002
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 7 / 16
query of the 156 genetic variants in various publicly available data sources (Online Mendelian
Inheritance in Man” (OMIM
1
) database at http://www.ncbi.nlm.nih.gov/omim, NCBI gene
index database at http://www.ncbi.nlm.nih.gov/gene; GeneCards at http://www.genecards.org
[27] and the “1000 Genomes Browser” at https://www.ncbi.nlm.nih.gov/variation/tools/
1000genomes; all accessed in May 2017) yielded 13 clinical associations (Table 3). The clinical
associations included a variety of pathologies such as pain, asthma or osteoarthritis. Specifically,
variants in both, TRPV1 and LTB4R have been associated with a higher susceptibility to bron-
chial asthma [28–32]. Moreover, TRPV1 variants have been associated with a higher risk of type
2 diabetes [33] or of functional dyspepsia [34]. Finally, of potential importance for a pharmaco-
genetic modulation of the effects of future analgesics, TRPV1 variants have been associated with
altered pain phenotypes in clinical or human experimental settings [10,35,36]. This fits to the
particular role of TRPV1 as a major target for novel analgesic drugs under development.
Winter and colleagues recently created an overview of site-directed mutagenesis studies on
Trpv1 receptor in rodents [37]. Their study summarized information about several mutated
Fig 3. LTB4R2,LTB4R and TRPV1 genetic pattern of 80 healthy volunteers of Caucasian ethnicity. The mosaic plot shows the occurrence of variants
(lines) per DNA sample (columns) as vectors of a length corresponding to the number of gene loci in which a non-reference nucleotide was found in any
sample of the whole cohort. The vectors are composed of information about the number of non-reference alleles found at the respectivelocus in the
respective sample, color codes as white, 0 non-reference alleles = wild type genotype, yellow, heterozygous, and red, 2 non-reference alleles). The bar plot
on the top shows the number of variant alleles found in the cohort.
https://doi.org/10.1371/journal.pone.0180116.g003
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 8 / 16
sites along the Trpv1, which influenced the effect or binding of different compounds like ago-
nists, antagonists, and channel blockers and alter the responsiveness to heat and influence the
regulation of the receptor function. Of peculiar interest is the c-terminus part of the receptor,
because it contained several mutations implicated in binding of capsaicin. To reference this
information to our study, we took out an alignment blast with http://www.uniprot.org/blast/,
which is a search tool to find regions of local similarity between sequences and can be used to
Table 2. A list of variants found in the coding parts of the LTB4R2,LTB4R and TRPV1 genes in a random sample of 80 healthy volunteers of Cauca-
sian ethnicity.
Gene Variant Chr*Position Classification Exon Coding Protein
LTB4R2 14:24779946-SNV 14 24779946 Nonsyn SNV 2 c.76T>C p.Phe26Leu
14:24779959-SNV 14 24779959 Nonsyn SNV 2 c.89C>T p.Ala30Val
14:24779961-SNV 14 24779961 Nonsyn SNV 2 c.91G>A p.Ala31Thr
14:24779994-SNV 14 24779994 Nonsyn SNV 2 c.124G>A p.Val42Met
14:24780010-Del 14 24780010 Frameshift Del 2 c.140_164del p.Ala51fs
14:24780503-SNV 14 24780503 Synonymous 2 c.633C>T p.=
14:24780847-SNV 14 24780847 Nonsyn SNV 2 c.977A>G p.Glu326Gly
LTB4R 14:24784911-SNV 14 24784911 Synonymous 2 c.54T>C p.=
14:24785083-SNV 14 24785083 Nonsyn SNV 2 c.226C>T p.His76Tyr
14:24785633-SNV 14 24785633 Nonsyn SNV 2 c.776T>C p.Val259Ala
14:24785784-SNV 14 24785784 Synonymous 2 c.927C>T p.=
TRPV1 17:3474927-SNV 17 3474927 Synonymous 14 c.2238C>T p.=
17:3475435-SNV 17 3475435 Nonsyn SNV 13 c.2212G>T p.Asp738Tyr
17:3475459-SNV 17 3475459 Nonsyn SNV 13 c.2188G>A p.Gly730Arg
17:3475490-SNV 17 3475490 Synonymous 13 c.2157G>A p.=
17:3476990-SNV 17 3476990 Synonymous 12 c.2040C>T p.=
17:3477000-SNV 17 3477000 Nonsyn SNV 12 c.2030A>G p.Asn677Ser
17:3480432-SNV 17 3480432 Nonsyn SNV 11 c.1768G>A p.Gly590Arg
17:3480447-SNV 17 3480447 Nonsyn SNV 11 c.1753A>G p.Ile585Val
17:3480910-SNV 17 3480910 Synonymous 10 c.1695T>C p.=
17:3483785-SNV 17 3483785 Nonsyn SNV 9 c.1513A>G p.Thr505Ala
17:3486702-SNV 17 3486702 Nonsyn SNV 8 c.1406C>T p.Thr469Ile
17:3486703-SNV 17 3486703 Nonsyn SNV 8 c.1405A>T p.Thr469Ser
17:3489068-SNV 17 3489068 Synonymous 7 c.1377T>C p.=
17:3491499-SNV 17 3491499 Nonsyn SNV 6 c.1207A>G p.Ser403Gly
17:3493200-SNV 17 3493200 Nonsyn SNV 5 c.945G>C p.Met315Ile
17:3494361-SNV 17 3494361 Synonymous 3 c.501C>T p.=
17:3494388-SNV 17 3494388 Synonymous 3 c.474T>C p.=
17:3494533-SNV 17 3494533 Synonymous 2 c.399G>A p.=
17:3494562-SNV 17 3494562 Stopgain 2 c.370C>T p.Gln124*
17:3494603-SNV 17 3494603 Nonsyn SNV 2 c.329T>C p.Leu110Pro
17:3495374-SNV 17 3495374 Nonsyn SNV 1 c.271C>T p.Pro91Ser
17:3495391-SNV 17 3495391 Nonsyn SNV 1 c.254A>G p.Gln85Arg
17:3495407-SNV 17 3495407 Nonsyn SNV 1 c.238C>T p.Pro80Ser
17:3495456-SNV 17 3495456 Synonymous 1 c.189C>T p.=
17:3495550-SNV 17 3495550 Nonsyn SNV 1 c.95G>T p.Arg32Met
17:3495607-SNV 17 3495607 Nonsyn SNV 1 c.38C>T p.Ala13Val
17:3495618-SNV 17 3495618 Nonsyn SNV 1 c.27G>C p.Leu9Phe
*: Chr: Chromosome.
https://doi.org/10.1371/journal.pone.0180116.t002
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 9 / 16
infer functional and evolutionary relationships between sequences revealed that TRPV1 is
highly conserved. With the present NGS assay, several functional SNPs could be identified in
the coding area of TRPV1; one variant (17:3477000-SNV) was located in exactly the c-terminus
area mentioned above. On this basis, the impact of this variant on nociception can be prospec-
tively studied.
A pharmacogenetic modulation of the effects of TRPV1-targeting analgesics is supported
by evidence of associations of rare and of common variants in the human TRPV1 gene with
pain-related clinical phenotypes. Based upon the direction of change of each phenotype and
cumulative changes in each SNP, three functional categories of TRPV1 variants were proposed:
gain of function (hTRPV1 Q85R, P91S, and T469I), loss of function (I585V), and mixed
(M315I) [38]. These in vitro results support clinical observations of TRPV1 genotypic effects. A
Korean subject who was insensitive to capsaicin and displayed mRNA and protein expression
levels of TRPV1 reduced by 50% from average subjects was found to carry seven intronic
TRPV1 single nucleotide polymorphisms (SNPs) [9]. Similarly, women carrying a coding
TRPV1 variant were found to be less sensitive to cold [10]. The association possibly involves
interactions among TRP channels [39] based on evidence that TRPA1 channels are often co-
expressed with heat (>43˚C [4]) gated TRPV1 [40,41]) and the channels act in concert.
TRPV1 can oligomerize with other TRP family subunits including TRPV3 and TRPA1 [42–
44] and the heteromerization can affect the calcium signaling pathways of TRPA1 homomers
[44]. While heat hyperalgesia was initially attributed solely to TRPV1, currently TRPA1 and
TRPV1 are regarded to be regulated downstream of PLC-coupled bradykinin (BK
2
) receptors
[45] contributing together to hypersensitivity to heat [46]. Hence, this evidence supports a pos-
sible pharmacogenetic importance. Further evidence about functional associations of TRPV1
gene variants has been raised in Spanish Caucasian migraine patients in whom the presence of
the TRPV1 rs222741 variant conferred a disease risk [47].
Table 3. A list of human variants of the LTB4R and TRPV1 genes, found in the present random sample of 80 healthy volunteers of Caucasian eth-
nicity, for which functional associations in clinical or human experimental settings have been reported.
Gene Variant dbSNP
#
accession number Allelic frequency [%] (CI*)
Present cohort*HAPMAP
CEU
Known clinical association Reference
LTB4R 14:24786060-SNV rs1046587 46.2 (38.7–54) 47.4 Asthma susceptibility [28]
14:24786293-SNV rs4981503 28.1 (21.7–35.4) - Asthma susceptibility [29]
TRPV1 17:3469853-SNV rs4790522 49.4 (41.7–57) 56.2 Bronchial asthma susceptibility [30,31,66]
Susceptibility to cough [67]
Altered pain sensitivity [35]
17:3480447-SNV rs8065080 33.7 (26.9–41.4) 35.8 Altered cold pain sensitivity [10]
Painful knee osteoarthritis [36]
Altered salt taste perception [68]
Higher risk of type 2 diabetes [33]
17:3486702-SNV rs224534 30 (23.4–37.5) 33.5 Sickle cell pain [69]
17:3493200-SNV rs222747 25.6 (19.5–32.9) 18.3 Functional dyspepsia [34]
Me
´nière’s disease [70]
17:3495391-SNV rs55916885 1.2 (0.3–4.4) - Cerebellar hypoplasia [71]
*: CI denotes 95% binomial confidence intervals of the allelic frequencies are given in parentheses after the observed frequency.
#
: Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.
Available from: http://www.ncbi.nlm.nih.gov/SNP/ [72]
https://doi.org/10.1371/journal.pone.0180116.t003
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 10 / 16
The addition of leukotriene B4 (LTB4) receptors to the TRPV1 gene panel anticipates a pos-
sible pharmacogenetic role in TRPV1 targeting analgesics resulting from recent evidence
about a co-expression of the receptors at nociceptive neurons and functional their interplay
[8]. LTB4 is a potent proinflammatory agent and its signaling pathway involves two distinct G
protein coupled receptors of which BLT1 is a high-affinity and BLT2 a low-affinity LTB4
receptor [48]. The interaction of LTB4 at these receptors is a contributing factor in the patho-
genesis of inflammatory diseases [49]. Studies involving the targeted deletion of murine BLT1
and the effect of antagonizing LTB4 receptors in inflammatory models have highlighted the
therapeutic potential of BLT receptors with regard to inflammatory diseases [49]. LTB4 has
also been shown to activate the TRPV1 channel [50,51] which leads to excitation of nocicep-
tors and evokes pain-related behaviors [25]. While variants in the two LTB4 receptors
potentially affect TRPV1 modulation based analgesic therapies, evidence about functional
polymorphisms in these genes is sparse. Studies have suggested a role of polymorphisms over-
reaching leukotriene pathway genes in determining leukotriene production and susceptibility
to allergic disorders, such as inflammatory cell chemotaxis and asthma [52]. Both receptor
genes were shown to be polymorphic, in addition, LTB4R and LTB4R2 show splice variations
at multiple regions, however, the functional significance has yet to be determined [53].
The present NGS method is suitable for large-scale sequencing of an extended set of human
genes involving the main target, TRPV1, and recently identified co-players, LTB4R and
LTB4R2. By covering almost, the complete relevant coding and regulatory parts of these genes,
the method includes all variants studied so far for functional associations and adds a large
amount of genetic information as a basis for complete analysis of human TRPV1 ion channel
genetics and its functional consequences. The assay aimed at the complete coding and regula-
tory information of the selected genes, which regards the increasing acknowledgment of the
insufficiency of addressing a limited selection of published functional genetic variants in pro-
viding a satisfactory genetic diagnosis of the clinical phenotype. Research interest in the com-
plete genomic information dates back to the seventies of last century when the selective
incorporation of chain-terminating dideoxynucleotides by DNA polymerase during in vitro
DNA replication had been introduced [17,18]. Techniques significantly improved during the
last decades with the development of contemporary machines in the late 1990s re-leased to the
market around the year 2005. The term “next generation” DNA sequencing refers to high-
throughput technologies capable of parallel analyzes of large numbers of different DNA
sequences in a single reaction [54]. NGS has been attributed the potential to accelerate bio-
medical research [12,55,56].
Currently, two commercial NGS platforms are widely used for diagnostic purposes: the
MiSeq/HiSeq/NextSeq (Illumina, Hayward, CA, USA) and the Ion Torrent PGM (Life Tech-
nologies, Carlsbad, CA, USA). Both platforms combine conceptually similar workflows, start-
ing with the creation of the genetic sample, which commences library preparation involving
fragmentation of genomic DNA, purifying to uniform and desired fragment size and ligation
to sequencing adapters specific to the platform. Differences apply to the reaction biochemistry
and the way how the sequencing information is read [54]. In the present ion semiconductor
sequencing method, libraries are immobilized to beads and amplified in microdroplets of
aqueous solution and oil using emulsion PCR. Individual nucleotide bases are incorporated
via DNA polymerase, which in the case of success triggers the release of a proton. The semi-
conductor chip that acts as a pH meter [57] providing the final readout. Alternative techniques
use the detection of light instead, i.e., from optical fluorescence signals in the case of successful
nucleotide incorporation the DNA nucleotide sequence is assembled. The different techniques
differ with respect to the obtained throughput and accuracy, but multiple studies have shown
that both NGS platforms provide reliable sequencing results in routine clinical diagnostics
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 11 / 16
[58–61] and a recent study came up with a 100% concordance between NGS and an alternative
diagnostic approach in mutant allele detection [62].
The high throughput and comprehensive information about DNA sequences are presently
reflected in the assay costs. The sequencing of the TRPV1,LTB4R and LTB4R2 receptor genes
of 80 patients required €1,500 for the AmpliSeq™custom panel, €5,880 for library prepara-
tion, €980 for template preparation and €1,400 for sequencing. In addition, approximately €
600 were spent for consumables and laboratory supplies. With 40 barcoded samples loaded on
two chips, respectively, analysis costs for a single patient’s gene sequence were approximately
€130. NGS costs are expected to quickly fall in near future [63]. However, despite this rapid
technological progress, the analysis of the generated large data sets remains challenging [64].
As the sequencing process is only the beginning of the procedure, the analysis of the resulting
“big data” requires substantial computational power, bioinformatics expertise and “up to date”
databases of genomic variations. NGS technologies seem to shift the workload essentially away
from the laboratory sample preparation toward various data analysis processes.
We report a NGS assay based on AmpliSeq™libraries and Ion Personal Genome Machine
(PGM) suitable for large-scale sequencing of TRPV1 and functionally related genes. While the
aim of assay development had the pharmacogenetics of TRPV1-targeting novel analgesics in
mind, the roles of TRPV1 and the two LTB4 receptors are not restricted to this setting. By con-
trast, the expression of TRPV1 is also observed in non-neuronal sites such as the epithelium of
bladder and lungs and in hair cells of the cochlea. At these sites, TRPV1 serves as a potential
drug target for treating various diseases such as cystitis, asthma and hearing loss [65].
Supporting information
S1 Table. A list of PCR primer used for the NGS assay.
(DOCX)
S2 Table. A list of missed parts from the gene panel.
(DOCX)
S3 Table. The accession numbers of the original data at the BioProject database.
(DOCX)
Author Contributions
Conceptualization: DK JL MS SZ.
Data curation: DK JL.
Formal analysis: JL DK.
Funding acquisition: JL.
Investigation: DK JL.
Methodology: DK JL MS SZ.
Project administration: JL.
Resources: JL.
Supervision: JL.
Validation: DK JL MS SZ.
Visualization: JL DK.
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 12 / 16
Writing – original draft: JL DK.
Writing – review & editing: DK JL MS SZ.
References
1. Montell C. Drosophila TRP channels. Pflu¨gers Archiv: European journal of physiology. 2005; 451:19–
28. https://doi.org/10.1007/s00424-005-1426-2 PMID: 15952038
2. Clapham DE. TRP channels as cellular sensors. Nature. 2003; 426(6966):517–24. https://doi.org/10.
1038/nature02196 PMID: 14654832
3. Patapoutian A, Tate S, Woolf CJ. Transient receptor potential channels: targeting pain at the source.
Nat Rev Drug Discov. 2009; 8(1):55–68. https://doi.org/10.1038/nrd2757 PMID: 19116627
4. Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D. The capsaicin receptor: a
heat-activated ion channel in the pain pathway. Nature. 1997; 389(6653):816–24. https://doi.org/10.
1038/39807 PMID: 9349813
5. Szallasi A, Cortright DN, Blum CA, Eid SR. The vanilloid receptor TRPV1: 10 years from channel clon-
ing to antagonist proof-of-concept. Nat Rev Drug Discov. 2007; 6(5):357–72. https://doi.org/10.1038/
nrd2280 PMID: 17464295
6. Julius D. TRP channels and pain. Annual review of cell and developmental biology. 2013; 29:355–84.
https://doi.org/10.1146/annurev-cellbio-101011-155833 PMID: 24099085
7. Docherty RJ, Yeats JC, Bevan S, Boddeke HW. Inhibition of calcineurin inhibits the desensitization of
capsaicin-evoked currents in cultured dorsal root ganglion neurones from adult rats. Pflugers Arch.
1996; 431(6):828–37. PMID: 8927498
8. Zinn S, Sisignano M, Kern K, Pierre S, Tunaru S, Jordan H, et al. The leukotriene B4 receptors BLT1
and BLT2 form an antagonistic sensitizing system in peripheral sensory neurons. J Biol Chem. 2017;
292(15):6123–34. https://doi.org/10.1074/jbc.M116.769125 PMID: 28242764
9. Park JJ, Lee J, Kim MA, Back SK, Hong SK, Na HS. Induction of total insensitivity to capsaicin and
hypersensitivity to garlic extract in human by decreased expression of TRPV1. Neurosci Lett. 2007; 411
(2):87–91. https://doi.org/10.1016/j.neulet.2006.10.046 PMID: 17110039
10. Kim H, Neubert JK, San Miguel A, Xu K, Krishnaraju RK, Iadarola MJ, et al. Genetic influence on vari-
ability in human acute experimental pain sensitivity associated with gender, ethnicity and psychological
temperament. Pain. 2004; 109(3):488–96. https://doi.org/10.1016/j.pain.2004.02.027 PMID: 15157710
11. Boukalova S, Touska F, Marsakova L, Hynkova A, Sura L, Chvojka S, et al. Gain-of-function mutations
in the transient receptor potential channels TRPV1 and TRPA1: how painful? Physiological research /
Academia Scientiarum Bohemoslovaca. 2014; 63 Suppl 1:S205–13.
12. Metzker ML. Sequencing technologies—the next generation. Nat Rev Genet. 2010; 11(1):31–46.
https://doi.org/10.1038/nrg2626 PMID: 19997069
13. Frank M, Prenzler A, Eils R, Graf von der Schulenburg JM. Genome sequencing: a systematic review of
health economic evidence. Health economics review. 2013; 3(1):29. https://doi.org/10.1186/2191-
1991-3-29 PMID: 24330507
14. Vigna SR, Shahid RA, Nathan JD, McVey DC, Liddle RA. Leukotriene B4 mediatesinflammation via
TRPV1 in duct obstruction-induced pancreatitis in rats. Pancreas. 2011; 40(5):708–14. https://doi.org/
10.1097/MPA.0b013e318214c8df PMID: 21602738
15. Fisher RA. On the Interpretation of Chi Square from Contingency Tables, and the Calculation of P. Jour-
nal of the Royal Statistical Society. 1922; 85(1):87–94.
16. Emigh TH. A comparison of tests for Hardy-Weinberg equilibrium. Biometrics. 1980; 36(4):627–42.
PMID: 25856832
17. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. ProcNatlAcadS-
ciUSA. 1977; 74(12):5463–7.
18. Sanger F, Coulson AR. A rapid method for determining sequences in DNA by primed synthesis with
DNA polymerase. J Mol Biol. 1975; 94(3):441–8. PMID: 1100841
19. Tarabeux J, Zeitouni B, Moncoutier V, Tenreiro H, Abidallah K, Lair S, et al. Streamlined ion torrent
PGM-based diagnostics: BRCA1 and BRCA2 genes as a model. 2014;(1476–5438 (Electronic)).
20. Millat G, Chanavat V, Rousson R. Evaluation of a new NGS method based on a custom AmpliSeq
library and Ion Torrent PGM sequencing for the fast detection of genetic variations in cardiomyopathies.
Clin Chim Acta. 2014; 433:266–71. https://doi.org/10.1016/j.cca.2014.03.032 PMID: 24721642
21. Concolino P, Costella A, Minucci A, Scaglione GL, Santonocito C, Salutari V, et al. A preliminary Quality
Control (QC) for next generation sequencing (NGS) library evaluation turns out to be a very useful tool
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 13 / 16
for a rapid detection of BRCA1/2 deleterious mutations. Clin Chim Acta. 2014; 437:72–7. https://doi.org/
10.1016/j.cca.2014.06.026 PMID: 25007954
22. Glotov AS, Kazakov SV, Zhukova EA, Alexandrov AV, Glotov OS, Pakin VS, et al. Targeted next-gener-
ation sequencing (NGS) of nine candidate genes with custom AmpliSeq in patients and a cardiomyopa-
thy risk group. Clin Chim Acta. 2015; 446:132–40. https://doi.org/10.1016/j.cca.2015.04.014 PMID:
25892673
23. Tominaga M, Caterina MJ, Malmberg AB, Rosen TA, Gilbert H, Skinner K, et al. The cloned capsaicin
receptor integrates multiple pain-producing stimuli. Neuron. 1998; 21(3):531–43. PMID: 9768840
24. Davis JB, Gray J, Gunthorpe MJ, Hatcher JP, Davey PT, Overend P, et al. Vanilloid receptor-1 is essen-
tial for inflammatory thermal hyperalgesia. Nature. 2000; 405(6783):183–7. https://doi.org/10.1038/
35012076 PMID: 10821274
25. Szallasi A, Bı
´ro
´T, Szabo
´T, Modarres S, Petersen M, Klusch A, et al. A non-pungent triprenyl phenol of
fungal origin, scutigeral, stimulates rat dorsal root ganglion neurons via interaction at vanilloid receptors.
Br J Pharmacol. 1999; 126(6):1351–8. https://doi.org/10.1038/sj.bjp.0702440 PMID: 10217528
26. Szallasi A, Blumberg PM. Vanilloid (Capsaicin) receptors and mechanisms. Pharmacol Rev. 1999; 51
(2):159–212. PMID: 10353985
27. Rebhan M, Chalifa-Caspi V, Prilusky J, Lancet D. GeneCards: integrating information about genes, pro-
teins and diseases. Trends Genet. 1997; 13(4):163. PMID: 9097728
28. Tulah AS, Parker SG, Moffatt MF, Wardlaw AJ, Connolly MJ, Sayers I. The role of ALOX5AP, LTA4H
and LTB4R polymorphisms in determining baseline lung function and COPD susceptibility in UK smok-
ers. BMC Med Genet. 2011; 12:173. https://doi.org/10.1186/1471-2350-12-173 PMID: 22206291
29. Tulah AS, Beghe B, Barton SJ, Holloway JW, Sayers I. Leukotriene B4 receptor locus gene characteri-
sation and association studies in asthma. BMC Med Genet. 2012; 13:110. https://doi.org/10.1186/
1471-2350-13-110 PMID: 23167751
30. Chen CL, Li H, Xing XH, Guan HS, Zhang JH, Zhao JW. Effect of TRPV1 gene mutation on bronchial
asthma in children before and after treatment. Allergy and asthma proceedings: the official journal of
regional and state allergy societies. 2015; 36(2):e29–36.
31. Ren YF, Li H, Xing XH, Guan HS, Zhang BA, Chen CL, et al. Preliminary study on pathogenesis of bron-
chial asthma in children. Pediatr Res. 2015; 77(4):506–10. https://doi.org/10.1038/pr.2015.11 PMID:
25585038
32. Wang MY, Cummock MD, Yu Y, Trivedi RA. An analysis of the differences in the acute hospitalization
charges following minimally invasive versus open posterior lumbar interbody fusion. J Neurosurg Spine.
2010; 12(6):694–9. https://doi.org/10.3171/2009.12.SPINE09621 PMID: 20515357
33. Park S, Zhang X, Lee NR, Jin HS. TRPV1 Gene Polymorphisms Are Associated with Type 2 Diabetes
by Their Interaction with Fat Consumption in the Korean Genome Epidemiology Study. J Nutrigenet
Nutrigenomics. 2016; 9(1):47–61. https://doi.org/10.1159/000446499 PMID: 27287034
34. Triantafyllou K, Kourikou A, Gazouli M, Karamanolis GP, Dimitriadis GD. Functional dyspepsia suscep-
tibility is related to CD14, GNB3, MIF, and TRPV1 gene polymorphisms in the Greek population. Neuro-
gastroenterol Motil. 2017; 29(1).
35. Kim H, Mittal DP, Iadarola MJ, Dionne RA. Genetic predictors for acute experimental cold and heat pain
sensitivity in humans. J Med Genet. 2006; 43(8):e40. https://doi.org/10.1136/jmg.2005.036079 PMID:
16882734
36. Valdes AM, De Wilde G, Doherty SA, Lories RJ, Vaughn FL, Laslett LL, et al. The Ile585Val TRPV1 var-
iant is involved in risk of painful knee osteoarthritis. Ann Rheum Dis. 2011; 70(9):1556–61. https://doi.
org/10.1136/ard.2010.148122 PMID: 21616913
37. Winter Z, Buhala A, Otvos F, Josvay K, Vizler C, Dombi G, et al. Functionally important amino acid resi-
dues in the transient receptor potential vanilloid 1 (TRPV1) ion channel—an overview of the current
mutational data. Mol Pain. 2013; 9:30. https://doi.org/10.1186/1744-8069-9-30 PMID: 23800232
38. Wang S, Joseph J, Diatchenko L, Ro JY, Chung MK. Agonist-dependence of functional properties for
common nonsynonymous variants of human transient receptor potential vanilloid 1. Pain. 2016; 157
(7):1515–24. https://doi.org/10.1097/j.pain.0000000000000556 PMID: 26967694
39. Clapham DE, Runnels LW, Strubing C. The TRP ion channel family. Nat Rev Neurosci. 2001; 2(6):387–
96. https://doi.org/10.1038/35077544 PMID: 11389472
40. Malin S, Molliver D, Christianson JA, Schwartz ES, Cornuet P, Albers KM, et al. TRPV1 and TRPA1
function and modulation are target tissue dependent. J Neurosci. 2011; 31(29):10516–28. https://doi.
org/10.1523/JNEUROSCI.2992-10.2011 PMID: 21775597
41. Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, Hricik TR, et al. ANKTM1, a TRP-like channel
expressed in nociceptive neurons, is activated by cold temperatures. Cell. 2003; 112(6):819–29. PMID:
12654248
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 14 / 16
42. Cheng W, Yang F, Takanishi CL, Zheng J. Thermosensitive TRPV channel subunits coassemble into
heteromeric channels with intermediate conductance and gating properties. J Gen Physiol. 2007; 129
(3):191–207. https://doi.org/10.1085/jgp.200709731 PMID: 17325193
43. Cheng W, Yang F, Liu S, Colton CK, Wang C, Cui Y, et al. Heteromeric heat-sensitive transient receptor
potential channels exhibit distinct temperature and chemical response. J Biol Chem. 2012; 287
(10):7279–88. https://doi.org/10.1074/jbc.M111.305045 PMID: 22184123
44. Ho KW, Ward NJ, Calkins DJ. TRPV1: a stress response protein in the central nervous system. Ameri-
can journal of neurodegenerative disease. 2012; 1(1):1–14. PMID: 22737633
45. Bautista DM, Jordt SE, Nikai T, Tsuruda PR, Read AJ, Poblete J, et al. TRPA1 mediates the inflamma-
tory actions of environmental irritants and proalgesic agents. Cell. 2006; 124(6):1269–82. https://doi.
org/10.1016/j.cell.2006.02.023 PMID: 16564016
46. Guimaraes MZP, Jordt SE. TRPA1: A Sensory Channel of Many Talents. In: Liedtke WB, Heller S, edi-
tors. TRP Ion Channel Function in Sensory Transduction and Cellular Signaling Cascades. Frontiers in
Neuroscience. Boca Raton (FL) 2007.
47. Carreno O, Corominas R, Fernandez-Morales J, Camina M, Sobrido MJ, Fernandez-Fernandez JM,
et al. SNP variants within the vanilloid TRPV1 and TRPV3 receptor genes are associated with migraine
in the Spanish population. Am J Med Genet B Neuropsychiatr Genet. 2012; 159b(1):94–103. https://
doi.org/10.1002/ajmg.b.32007 PMID: 22162417
48. Yokomizo T, Kato K, Hagiya H, Izumi T, Shimizu T. Hydroxyeicosanoids bind to and activate the low
affinity leukotriene B4 receptor, BLT2. J Biol Chem. 2001; 276(15):12454–9. https://doi.org/10.1074/
jbc.M011361200 PMID: 11278893
49. Tager AM, Luster AD. BLT1 and BLT2: the leukotriene B(4) receptors. Prostaglandins Leukot Essent
Fatty Acids. 2003; 69(2–3):123–34. PMID: 12895595
50. Craib SJ, Ellington HC, Pertwee RG, Ross RA. A possible role of lipoxygenase in the activation of vanil-
loid receptors by anandamide in the guinea-pig bronchus. Br J Pharmacol. 2001; 134(1):30–7. https://
doi.org/10.1038/sj.bjp.0704223 PMID: 11522594
51. Hwang SW, Oh U. Hot channels in airways: pharmacology of the vanilloid receptor. Current opinion in
pharmacology. 2002; 2(3):235–42. PMID: 12020463
52. Duroudier NP, Tulah AS, Sayers I. Leukotriene pathway genetics and pharmacogenetics in allergy.
Allergy. 2009; 64(6):823–39. https://doi.org/10.1111/j.1398-9995.2009.02015.x PMID: 19416143
53. Tulah AS, Beghe
´B, Barton SJ, Holloway JW, Sayers I. Leukotriene B4 receptor locus gene characteri-
sation and association studies in asthma. BMC Med Genet. 2012; 13:110. https://doi.org/10.1186/
1471-2350-13-110 PMID: 23167751
54. Rizzo JM, Buck MJ. Key principles and clinical applications of "next-generation" DNA sequencing. Can-
cer Prev Res (Phila). 2012; 5(7):887–900.
55. Mardis ER. Next-generation DNA sequencing methods. Annu Rev Genomics Hum Genet. 2008;
9:387–402. https://doi.org/10.1146/annurev.genom.9.081307.164359 PMID: 18576944
56. Shendure J, Ji H. Next-generation DNA sequencing. Nature biotechnology. 2008; 26(10):1135–45.
https://doi.org/10.1038/nbt1486 PMID: 18846087
57. Rothberg JM, Hinz W, Rearick TM, Schultz J, Mileski W, Davey M, et al. An integrated semiconductor
device enabling non-optical genome sequencing. Nature. 2011; 475(7356):348–52. https://doi.org/10.
1038/nature10242 PMID: 21776081
58. de Leng WW, Gadellaa-van Hooijdonk CG, Barendregt-Smouter FA, Koudijs MJ, Nijman I, Hinrichs
JW, et al. Targeted Next Generation Sequencing as a Reliable Diagnostic Assay for the Detection of
Somatic Mutations in Tumours Using Minimal DNA Amounts from Formalin Fixed Paraffin Embedded
Material. PLoS One. 2016; 11(2):e0149405. https://doi.org/10.1371/journal.pone.0149405 PMID:
26919633
59. Sie D, Snijders PJ, Meijer GA, Doeleman MW, van Moorsel MI, van Essen HF, et al. Performance of
amplicon-based next generation DNA sequencing for diagnostic gene mutation profiling in oncopathol-
ogy. Cell Oncol (Dordr). 2014; 37(5):353–61.
60. Lin MT, Mosier SL, Thiess M, Beierl KF, Debeljak M, Tseng LH, et al. Clinical validation of KRAS,
BRAF, and EGFR mutation detection using next-generation sequencing. Am J Clin Pathol. 2014; 141
(6):856–66. https://doi.org/10.1309/AJCPMWGWGO34EGOD PMID: 24838331
61. McCourt CM, McArt DG, Mills K, Catherwood MA, Maxwell P, Waugh DJ, et al. Validation of next gener-
ation sequencing technologies in comparison to current diagnostic gold standards for BRAF, EGFR and
KRAS mutational analysis. PLoS One. 2013; 8(7):e69604. https://doi.org/10.1371/journal.pone.
0069604 PMID: 23922754
62. Portier BP, Kanagal-Shamanna R, Luthra R, Singh R, Routbort MJ, Handal B, et al. Quantitative
assessment of mutant allele burden in solid tumors by semiconductor-based next-generation
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 15 / 16
sequencing. Am J Clin Pathol. 2014; 141(4):559–72. https://doi.org/10.1309/AJCP1JUGQMW7ZNTL
PMID: 24619758
63. Lohmann K, Klein C. Next generation sequencing and the future of genetic diagnosis. Neurotherapeu-
tics: the journal of the American Society for Experimental NeuroTherapeutics. 2014; 11(4):699–707.
64. Norton N, Li D, Hershberger RE. Next-generation sequencing to identify genetic causes of cardiomyop-
athies. Current opinion in cardiology. 2012; 27(3):214–20. https://doi.org/10.1097/HCO.
0b013e328352207e PMID: 22421630
65. Brito R, Sheth S, Mukherjea D, Rybak LP, Ramkumar V. TRPV1: A Potential Drug Target for Treating
Various Diseases. Cells. 2014; 3(2):517–45. https://doi.org/10.3390/cells3020517 PMID: 24861977
66. Wang Q, Bai X, Xu D, Xu D, Li H, Fang J, et al. [TRPV1 UTR-3 polymorphism and susceptibility of child-
hood asthma of the Han Nationality in Beijing]. Wei Sheng Yan Jiu. 2009; 38(5):516–21. PMID:
19877503
67. Smit LA, Kogevinas M, Anto JM, Bouzigon E, Gonzalez JR, Le Moual N, et al. Transient receptor poten-
tial genes, smoking, occupational exposures and cough in adults. Respir Res. 2012; 13:26. https://doi.
org/10.1186/1465-9921-13-26 PMID: 22443337
68. Dias AG, Rousseau D, Duizer L, Cockburn M, Chiu W, Nielsen D, et al. Genetic variation in putative salt
taste receptors and salt taste perception in humans. Chem Senses. 2013; 38(2):137–45. https://doi.org/
10.1093/chemse/bjs090 PMID: 23118204
69. Jhun EH, Yao Y, He Y, Mack AK, Wilkie DJ, Molokie RE, et al. Prevalence of pain-related single nucleo-
tide polymorphisms in patients of African origin with sickle cell disease. Pharmacogenomics. 2015; 16
(16):1795–806. https://doi.org/10.2217/pgs.15.126 PMID: 26555434
70. Vrabec JT, Liu L, Li B, Leal SM. Sequence variants in host cell factor C1 are associated with Meniere’s
disease. Otol Neurotol. 2008; 29(4):561–6. https://doi.org/10.1097/MAO.0b013e318168d23b PMID:
18520591
71. Gulsuner S, Tekinay AB, Doerschner K, Boyaci H, Bilguvar K, Unal H, et al. Homozygosity mapping
and targeted genomic sequencing reveal the gene responsible for cerebellar hypoplasia and quadrupe-
dal locomotion in a consanguineous kindred. Genome Res. 2011; 21(12):1995–2003. https://doi.org/
10.1101/gr.126110.111 PMID: 21885617
72. Sherry ST, Ward MH, Kholodov M, Baker J, Phan L, Smigielski EM, et al. dbSNP: the NCBI database of
genetic variation. Nucleic Acids Res. 2001; 29(1):308–11. PMID: 11125122
Human TRPV1,LTB4R and LTB4R2 gene next-gereration sequening
PLOS ONE | https://doi.org/10.1371/journal.pone.0180116 June 28, 2017 16 / 16
Content uploaded by Jörn Lötsch
Author content
All content in this area was uploaded by Jörn Lötsch on Jun 29, 2017
Content may be subject to copyright.
