ArticlePDF Available

Zonisamide ameliorates levodopa-induced dyskinesia and reduces expression of striatal genes in Parkinson model rats

Authors:

Abstract and Figures

To investigate the difference in results according to the mode of levodopa administration and the effect of zonisamide (ZNS), we analyzed the mRNA expression of dopaminergic and non-dopaminergic receptors in the striatum of Parkinson model rats in relation to the development of levodopa-induced dyskinesia (LID). Unilateral Parkinson model rats were subdivided into 4 groups and treated as follows: no medication (group N), continuous levodopa infusion (group C), intermittent levodopa injection (group I), and intermittent levodopa and ZNS injection (group Z). Two weeks after the treatment, LID was observed in group I and Z, but less severe in group Z. The level of both D1 and D2 receptor mRNAs was elevated in groups I and Z, but only D2 receptor mRNA expression was elevated in group C. Adenosine A2A receptor mRNA showed increased expression only in group I. The level of endocannabinoid CB1 receptor mRNA was elevated in groups N, C, and I, but not in group Z. Intermittent injection of levodopa caused LID, in association with elevated expression of D1 and A2A receptors. ZNS ameliorated the development of LID and inhibited up-regulation of A2A and CB1 receptors. Modulation of these receptors may lead to therapeutic approaches for dyskinesia.
Content may be subject to copyright.
Please
cite
this
article
in
press
as:
Oki,
M.,
et
al.,
Zonisamide
ameliorates
levodopa-induced
dyskinesia
and
reduces
expression
of
striatal
genes
in
Parkinson
model
rats.
Neurosci.
Res.
(2017),
http://dx.doi.org/10.1016/j.neures.2017.04.003
ARTICLE IN PRESS
G Model
NSR-4033;
No.
of
Pages
6
Neuroscience
Research
xxx
(2017)
xxx–xxx
Contents
lists
available
at
ScienceDirect
Neuroscience
Research
jo
ur
nal
homepage:
www.elsevier.com/locate/neures
Zonisamide
ameliorates
levodopa-induced
dyskinesia
and
reduces
expression
of
striatal
genes
in
Parkinson
model
rats
Mitsuaki
Okia,
Satoshi
Kanekoa,,
Satoshi
Morisea,
Norihiro
Takenouchib,
Takanori
Hashizumec,
Ayako
Tsugea,
Masataka
Nakamuraa,
Reika
Watea,
Hirofumi
Kusakaa
aDepartment
of
Neurology,
Kansai
Medical
University,
Osaka,
Japan
bDepartment
of
Microbiology,
Kansai
Medical
University,
Osaka,
Japan
cLaboratory
of
Drug
Metabolism
&
Pharmacokinetics,
Faculty
of
Pharmacy,
Osaka
Ohtani
University,
Osaka,
Japan
a
r
t
i
c
l
e
i
n
f
o
Article
history:
Received
1
February
2017
Received
in
revised
form
29
March
2017
Accepted
12
April
2017
Available
online
xxx
Keywords:
Parkinson’s
disease
Levodopa-induced
dyskinesia
Zonisamide
Adenosine
Endocannabinoid
a
b
s
t
r
a
c
t
To
investigate
the
difference
in
results
according
to
the
mode
of
levodopa
administration
and
the
effect
of
zonisamide
(ZNS),
we
analyzed
the
mRNA
expression
of
dopaminergic
and
non-dopaminergic
receptors
in
the
striatum
of
Parkinson
model
rats
in
relation
to
the
development
of
levodopa-induced
dyskinesia
(LID).
Unilateral
Parkinson
model
rats
were
subdivided
into
4
groups
and
treated
as
follows:
no
medi-
cation
(group
N),
continuous
levodopa
infusion
(group
C),
intermittent
levodopa
injection
(group
I),
and
intermittent
levodopa
and
ZNS
injection
(group
Z).
Two
weeks
after
the
treatment,
LID
was
observed
in
group
I
and
Z,
but
less
severe
in
group
Z.
The
level
of
both
D1
and
D2
receptor
mRNAs
was
elevated
in
groups
I
and
Z,
but
only
D2
receptor
mRNA
expression
was
elevated
in
group
C.
Adenosine
A2A
receptor
mRNA
showed
increased
expression
only
in
group
I.
The
level
of
endocannabinoid
CB1
receptor
mRNA
was
elevated
in
groups
N,
C,
and
I,
but
not
in
group
Z.
Intermittent
injection
of
levodopa
caused
LID,
in
association
with
elevated
expression
of
D1
and
A2A
receptors.
ZNS
ameliorated
the
development
of
LID
and
inhibited
up-regulation
of
A2A
and
CB1
receptors.
Modulation
of
these
receptors
may
lead
to
therapeutic
approaches
for
dyskinesia.
©
2017
Elsevier
Ireland
Ltd
and
Japan
Neuroscience
Society.
All
rights
reserved.
1.
Introduction
Dopaminergic
replacement
therapy
is
a
basic
strategy
for
the
treatment
of
Parkinson’s
disease
(PD).
The
development
of
motor
complications
such
as
wearing-off
and
dyskinesia
along
with
the
disease
progression
has
a
negative
impact
on
the
quality
of
life
of
PD
patients
(Chapuis
et
al.,
2005),
and
it
also
interferes
with
the
treatment.
It
has
been
clinically
noticed
that
the
mode
of
levodopa
administration
should
be
continuous
rather
than
intermittent
to
delay
or
reduce
the
development
of
dyskinesia
(Olanow
et
al.,
2006;
Stocchi
et
al.,
2008).
Intermittent
administration
of
high-
dose
levodopa
to
animal
models
induces
dyskinesia
more
strongly
than
continuous
or
low-dose
administration
(Tsironis
et
al.,
2008).
Many
non-dopaminergic
neurotransmitters
have
been
implicated
Corresponding
author.
E-mail
address:
kanekosa@takii.kmu.ac.jp
(S.
Kaneko).
in
modulation
of
the
basal
ganglia
function,
and
they
have
emerged
as
promising
targets
for
novel
treatments.
To
investigate
the
difference
in
results
according
to
the
effect
of
the
mode
of
levodopa
administration
on
the
mechanism
of
levodopa-induced
dyskinesia
(LID)
development,
we
analyzed
the
mRNA
expression
of
dopaminergic
and
non-dopaminergic
recep-
tors
in
the
striatum
of
PD
model
rats
in
relation
to
LID.
The
target
mRNAs
chosen
were
those
of
dopamine
D1
(Drd1)
and
D2
(Drd2)
receptors,
neuropeptides
prodynorphin
(Pdyn)
and
pre-
proenkephalin
(Penk),
the
adenosine
A2A
(A2A)
receptor,
and
the
endocannabinoid
CB1
(CB1)
receptor.
We
also
investigated
the
molecular
mechanism
for
the
effect
of
zonisamide
(ZNS),
which
is
known
not
to
worsen
dyskinesia
clinically
in
PD
patients
(Murata
et
al.,
2007),
on
LID
development
and
expression
of
these
target
mRNAs
in
response
to
intermittent
levodopa
administration.
http://dx.doi.org/10.1016/j.neures.2017.04.003
0168-0102/©
2017
Elsevier
Ireland
Ltd
and
Japan
Neuroscience
Society.
All
rights
reserved.
Please
cite
this
article
in
press
as:
Oki,
M.,
et
al.,
Zonisamide
ameliorates
levodopa-induced
dyskinesia
and
reduces
expression
of
striatal
genes
in
Parkinson
model
rats.
Neurosci.
Res.
(2017),
http://dx.doi.org/10.1016/j.neures.2017.04.003
ARTICLE IN PRESS
G Model
NSR-4033;
No.
of
Pages
6
2
M.
Oki
et
al.
/
Neuroscience
Research
xxx
(2017)
xxx–xxx
2.
Materials
and
methods
2.1.
Preparation
of
unilateral
Parkinson’s
model
rats
and
drug
administration
Adult
female
Sprague-Dawley
rats
(Japan
SCL,
Inc.
Shizuoka,
Japan)
of
220–250
g
body
weight
were
anesthetized
and
placed
in
a
stereotaxic
instrument
(SR-5R-HT,
Narishige,
Tokyo,
Japan).
All
animal
experiments,
approved
by
the
institutional
experimental
animal
usage
committee,
were
in
accordance
with
Guidelines
for
Proper
Conduct
of
Animal
Experiments,
Science
Council
of
Japan.
6-
hydroxydopamine
(6-OHDA)
was
stereotaxically
injected
into
the
left
medial
forebrain
bundle
(stereotaxic
coordinates
from
bregma:
anterior
3.7
mm,
lateral
1.7
mm,
depth
from
brain
surface
7.8
mm:
(Paxinos
and
Watson,
2007)
via
a
26-gauge
needle
(Microsyringe
MS-N10AOC,
Ito
Corporation,
Shizuoka,
Japan).
Six
l
of
6-OHDA-
HBr
(Sigma-Aldrich,
MO,
USA)
(3
g/l
of
6-OHDA-HBr
with
0.02%
ascorbic
acid
in
saline)
was
slowly
injected
over
a
6-min
period.
Two
weeks
after
the
injection
of
6-OHDA,
the
apomorphine-
induced
behavioral
test
was
performed
to
evaluate
the
success
of
the
operation.
Namely,
10
min
after
the
intraperitoneal
injection
(0.5
mg/kg)
of
apomorphine-HCl
(Tocris
Bioscience,
MO,
USA),
the
rats
were
placed
in
a
hemispheric
bowl.
More
than
20
rotations
towards
the
contralateral
side
from
the
operated
side
over
5
min
was
judged
as
a
positive
result.
Successfully
operated
rats
were
subdivided
into
4
groups
and
treated
for
2
weeks
as
follows:
1)
no
medication
(group
N,
n
=
13),
2)
continuous
levodopa
infusion
(group
C,
n
=
7),
3)
intermittent
levodopa
injection
(group
I,
n
=
7),
and
4)
intermittent
levodopa
and
ZNS
injection
(group
Z,
n
=
7)
(Fig.
1).
Levodopa
methyl
ester
hydrochloride
(Santa
Cruz
Biotech-
nology,
Inc.
TX,
USA)
was
always
combined
with
benserazide
hydrochloride
at
a
4:1
ratio
(Sigma-Aldrich)
and
dissolved
in
phys-
iological
saline
with
L-ascorbic
acid
(Sigma-Aldrich,
0.2
mg/ml)
as
an
antioxidant.
ZNS
was
dissolved
in
physiological
saline
contain-
ing
10%
DMSO.
ZNS
was
provided
by
Sumitomo
Dainippon
Pharma
Co.
Ltd.,
Osaka,
Japan.
For
continuous
levodopa
infusion,
ALZET
osmotic
mini-
pumps
(Model
2ML4,
DURECT
Corp.
CA,
USA)
containing
levodopa/benserazide
(24/6
mg/kg/day)
were
implanted
subcu-
taneously
under
anesthesia
and
infusion
was
continued
for
2
weeks
(Lebel
et
al.,
2010).
For
intermittent
levodopa
injection,
levodopa/benserazide
(12/3
mg/kg)
was
injected
subcutaneously
twice
daily
(at
0900
and
1700)
for
2
weeks.
For
intermittent
levodopa
and
ZNS
injection,
levodopa/benserazide
(12/3
mg/kg)
and
zonisamide
(26
mg/kg
solution)
were
injected
subcutaneously
twice
daily
(at
0900
and
1700)
for
2
weeks
(Wallingford
et
al.,
2008).
Plasma
concentrations
of
zonisamide
in
blood
from
a
tail
vein
were
measured
by
HPLC
after
1
and
2
weeks
of
treatment.
2.2.
Evaluation
of
LID
LID
of
each
rat
in
group
C,
I,
and
Z
was
evaluated
after
the
last
administration
of
levodopa
after
2
weeks
of
treatment.
Amplitude
and
severity
of
axial
and
forelimb
abnormal
involuntary
move-
ments
were
scored
at
every
20
min
after
levodopa
administration
for
180
min
(Winkler
et
al.,
2002).
2.3.
Tissue
preparation
After
evaluation
of
LID,
animals
were
decapitated
under
deep
anesthesia.
Brains
were
removed
and
quickly
frozen
on
pow-
dered
dry
ice.
Frozen
brains
were
coronally
sectioned
by
cryostat
at
1
mm
thickness
(coordinates,
0.24-1.2
mm
anterior
to
bregma;
(Paxinos
and
Watson,
2007)).
Approximately
0.7
mg
of
brain
tis-
sues
at
lateral
striatum
on
both
sides
were
punched
out
by
use
of
an
18-G
non-bevel-tipped
needle
(Terumo,
Tokyo,
Japan).
The
tis-
sues
were
digested
with
RNase-free
proteinase
K,
and
total
RNAs
were
extracted
by
using
a
NucleoSpin
RNA
kit
(Macherey-Nagel,
Düren,
Germany).
Random
hexamer
was
used
to
generate
cDNA
fragments.
The
remaining
tissue
was
sectioned
and
stained
with
rabbit
anti-
tyrosine
hydroxylase
(TH)
antibody
(AB152,
Chemicon,
MA,
USA)
to
confirm
homogeneity
of
dopaminergic
denervation.
2.4.
Gene
expression
analyses
Primers
and
real-time
RT-PCR
settings
for
neuropeptides
pro-
dynorphin
and
preproenkephalin,
dopamine
D1
and
D2
receptors,
adenosine
A2A
receptor,
and
endocannabinoid
CB1
receptors
are
listed
in
the
Table
1.
Expression
of
mRNAs
on
the
operated
and
unoperated
sides
was
quantitated
in
duplicate
by
performing
real-
time
PCR
using
SYBR
Green
(Takara
Bio
Inc.
Shiga,
Japan).
The
hypoxanthine
phosphoribosyltransferase
1
gene
was
used
as
an
internal
control.
2.5.
Statistical
analyses
The
Wilcoxon
signed-rank
test
was
used
to
compare
the
expres-
sion
difference
of
mRNAs
between
operated
and
unoperated
sides.
The
Mann-Whitney
U
test
was
used
for
the
evaluation
of
LID.
3.
Results
The
mean
and
standard
deviation
of
apomorphine-induced
rotation
test
for
group
N,
C,
I
and
Z
were
49
±
23.4,
56.3
±
12.5,
49.9
±
19.4,
and
60.9
±
34.9,
respectively,
and
there
was
no
statis-
tically
significant
difference
by
Mann-Whitney
U
test
(Fig.
2A).
TH
immunoreactivity
in
the
lesioned
side
of
the
stratum
was
uniformly
decreased
in
all
animals
which
were
positive
for
apomorphine-induced
rotation
test
(Fig.
2B).
LID
was
not
observed
in
group
C.
On
the
other
hand,
LID
appeared
20
min
after
levodopa
administration,
peaked
at
80
min
and
lasted
up
to
140
min
in
group
I.
LID
was
also
developed
in
group
Z,
but
it
was
less
severe
and
lasted
for
a
shorter
period
of
time
than
those
in
group
I.
Especially,
the
mean
forelimb
AIMs
score
of
group
Z
at
140
min
was
significantly
lower
than
that
of
group
I
(Fig.
2C).
The
trough
plasma
concentration
of
ZNS
reached
to
15–20
g/ml
after
1
week,
and
remained
in
the
same
range
after
2
weeks.
The
expression
of
Pdyn
mRNA
was
decreased,
whereas
that
of
Penk
mRNA
was
increased
on
the
operated
side
in
group
N.
Pdyn
mRNA
expression
was
not
changed,
but
Penk
mRNA
expression
was
increased
in
group
C.
Pdyn
mRNA
was
increased,
but
Penk
mRNA
was
not
changed,
in
group
I
or
Z
(Fig.
3A).
The
expression
of
dopamine
receptors
was
not
changed
in
group
N.
The
expression
of
D1
receptor
was
not
changed,
but
that
of
D2
receptor
was
increased
in
group
C.
The
expression
of
both
D1
and
D2
receptors
was
increased
in
groups
I
and
Z
(Fig.
3B).
Adenosine
A2A
receptor
expression
was
increased
only
in
group
I,
and
it
was
not
changed
in
group
N,
C
or
Z
(Fig.
3C).
The
expression
of
endocannabinoid
CB1
receptor
was
increased
in
groups
N,
C
and
I,
but
it
was
not
changed
in
group
Z
(Fig.
3D).
4.
Discussion
All
animals
in
groups
I
and
Z
developed
LID,
whereas
LID
did
not
appear
in
group
C
as
well
as
in
group
N.
Considering
that
Pdyn
mRNA
expression
was
decreased
in
group
N
but
not
in
group
C
(Fig.
3A),
dopaminergic
stimulation
by
continuous
levodopa
infusion
in
this
study
was
not
insufficient.
Therefore,
pul-
satile
dopaminergic
stimulation
by
intermittent
levodopa
injection
Please
cite
this
article
in
press
as:
Oki,
M.,
et
al.,
Zonisamide
ameliorates
levodopa-induced
dyskinesia
and
reduces
expression
of
striatal
genes
in
Parkinson
model
rats.
Neurosci.
Res.
(2017),
http://dx.doi.org/10.1016/j.neures.2017.04.003
ARTICLE IN PRESS
G Model
NSR-4033;
No.
of
Pages
6
M.
Oki
et
al.
/
Neuroscience
Research
xxx
(2017)
xxx–xxx
3
Fig.
1.
Time
schedule
of
the
experiments.
Two
weeks
after
stereotaxic
injection
of
6-OHDA,
the
apomorphine-induced
behavioral
test
was
performed
to
evaluate
success
of
the
operation.
Positive
rats
were
subdivided
into
4
groups
and
treated
as
shown.
After
2
weeks
of
treatment,
LID
was
evaluated:
and
then
the
rats
were
sacrificed.
appears
to
have
induced
dyskinesia
in
groups
I
and
Z.
This
result
is
consistent
with
our
clinical
experience
on
dyskinesia
induction
in
patients
with
PD
and
suggests
that
the
present
experimental
sys-
tem
is
a
valuable
model
to
study
LID.
However,
LID
was
less
severe
in
group
Z
compared
with
group
I,
in
agreement
with
the
clinical
effect
of
ZNS
on
PD
patients
(Murata
et
al.,
2007),
(Murata
et
al.,
2015).
The
expression
of
Pdyn
and
Penk
mRNAs
is
differentially
regulated
by
dopamine.
Increased
dopaminergic
input
results
in
increased
Pdyn
and
decreased
Penk
expression.
Conversely,
decreased
dopaminergic
input
results
in
decreased
Pdyn
and
increased
Penk
levels.
Expression
of
Pdyn
and
Penk
mRNAs
indi-
cates
the
activity
of
medium
spiny
neurons
(MSNs)
of
direct
and
indirect
pathways,
respectively
(Gerfen
et
al.,
1990).
Accord-
ing
to
the
changes
in
expression
levels
of
these
neuropeptides,
the
indirect
pathway
was
predominant
in
the
operated
side
of
rats
in
groups
N
and
C.
On
the
other
hand,
the
direct
pathway
predominated
on
the
operated
side
of
intermittently
injected,
LID-
expressing
rats
in
groups
I
and
Z.
In
the
striatum,
the
dopamine
D1
receptors
are
expressed
selec-
tively
by
direct
pathway
MSNs,
whereas
the
dopamine
D2
receptors
are
expressed
by
those
in
the
indirect
pathway.
The
expression
level
of
dopamine
D2
receptor
mRNA
was
not
changed
in
group
N,
but
it
was
elevated
in
groups
C
and
I
regardless
of
the
mode
of
levodopa
administration.
It
was
also
elevated
in
group
Z.
On
the
other
hand,
the
mRNA
expression
of
the
dopamine
D1
receptor
was
not
increased
in
group
N
or
C,
but
was
elevated
in
groups
I
and
Z.
The
D1
receptor
is
primarily
in
a
low-affinity
state,
whereas
the
D2
one
shows
high
affinity
for
dopamine
(Richfield
et
al.,
1989).
Continuous
levodopa
infusion
could
have
been
sufficient
to
stim-
ulate
the
high-affinity
D2
receptors
but
not
sufficient
to
stimulate
the
low-affinity
D1
receptors.
Intermittent
levodopa
injection
pro-
vokes
pulsatile
elevation
of
dopamine
in
the
operated
striatum
(Miller
and
Abercrombie,
1999),
which
might
be
enough
to
stimu-
late
low-affinity
dopamine
D1
receptors
and
increase
D1
receptor
mRNA
expression.
Moreover,
increased
D1
receptor
expression
might
be
related
to
predominant
direct
pathway
and
LID
expression
in
intermittently
injected
rats.
Table
1
Primers
and
real-time
RT-PCR
settings
for
each
gene.
Gene
Sequence
(5
3)
Primer
GC%
Primer
TM
(C)
Amplicon
(bp)
Drd1
dopamine
receptor
D1
F-
CGTGATCAGCGTGGACAGGTA
57.1
64.5
86
R-
TCAGGATGAAGGCTGCTTTGG
52.4
64.8
Pdyn
prodynorphin
F-
GATCGGCCATCCTATCACCTG
57.1
63.9
146
R-
GGACCACGCCATTCTGTATCAC
54.5
63.8
Drd2
dopamine
receptor
D2
F-
AGCTCCAAGCGCCGAGTTA
57.9
63.4
128
R-
AAGGCAGGGTTGGCAATGATA
47.6
63.8
Penk
proenkephalin
F-
TGGCTACAGTGCAGGCAGA
57.9
61.8
199
R-
TTGTACATGTCGATGTTATCCCAAG
40
62.1
A2A
adenosine
A2a
receptor
F-
TCCTCACGCAGAGTTCCATCTTTA
45.8
64.4
100
R-
ACACCTGTCACCAAGCCATTGTA
47.8
63.8
CB1
endocannabinoid
receptor
1
F-
TGTCTCCCATTTCAAGCAAGGAG
47.8
64.8
142
R-
CATTCGAGCCCACGTAGAGGA
57.1
64.7
Hprt1
hypoxanthine
phophoribosyltransferase
1
F-
TCCTCATGGACTGATTATGGACA
43.5
61.6
132
R-
TAATCCAGCAGGTCAGCAAAGA
45.5
62.1
Component
Volume(l)
PCR
cycle
Temp
Time
cDNA
9.6
SYBR
Premix
Ex
Taq
GC
10
1
cycle
95 C
2
min
(Perfect
Real
Time) ®50
cycle
95 C
Primer
forward
(20
M)
0.2
60 C
60
s,
real
time
Primer
reverse
(20
M)
0.2
Melt
curve
65 C
10
s,
0.5 C
each
95 C
Total
20
Please
cite
this
article
in
press
as:
Oki,
M.,
et
al.,
Zonisamide
ameliorates
levodopa-induced
dyskinesia
and
reduces
expression
of
striatal
genes
in
Parkinson
model
rats.
Neurosci.
Res.
(2017),
http://dx.doi.org/10.1016/j.neures.2017.04.003
ARTICLE IN PRESS
G Model
NSR-4033;
No.
of
Pages
6
4
M.
Oki
et
al.
/
Neuroscience
Research
xxx
(2017)
xxx–xxx
Fig.
2.
(A)
The
mean
and
standard
deviation
of
apomorphine-induced
rotation
test
for
each
groups.
(B)
TH
immunoreactivity
in
the
lesioned
side
of
the
stratum
was
uniformly
decreased.
(C)
Evaluation
of
LID
in
groups
C,
I,
and
Z.
Amplitude
and
severity
of
axial
and
forelimb
abnormal
involuntary
movements
(AIMs)
were
scored
at
every
20
min
after
levodopa
administration
for
180
min.
Adenosine
A2A
receptors
are
exclusively
expressed
in
indirect
pathway
MSNs.
A2A
receptors
enhance
GABA
release
from
the
nerve
terminals
and
work
antagonistically
to
dopamine
D2
recep-
tors
in
indirect
pathway
MSNs
(Mori,
2014).
In
contrast
with
the
mRNA
expression
of
dopamine
D1
and
D2
receptors,
which
was
increased
in
both
groups
I
and
Z,
adenosine
A2A
receptor
was
increased
only
in
group
I,
which
developed
LID
strongly.
Expres-
sion
levels
of
the
A2A
receptor
were
stable
not
only
in
group
N
or
LID-free
group
C,
but
also
in
group
Z,
which
presented
mild
LID.
According
to
the
results
of
histopathological
(Calon
et
al.,
2004)
and
PET
(Mishina
et
al.,
2011;
Ramlackhansingh
et
al.,
2011)
stud-
ies,
adenosine
A2A
receptor
expression
is
increased
in
PD
patients
with
LID.
Considering
that
A2A
receptors
activate
indirect
pathway
MSNs,
the
elevated
expression
of
A2A
mRNA
receptor
might
be
a
compensatory
mechanism
against
the
predominant
direct
path-
way
and
LID
development,
but
not
a
cause
of
LID.
ZNS
ameliorated
LID
and
A2A
receptor
mRNA
up-regulation,
indicating
that
ZNS
inhibited
LID
development
and
a
compensatory
up-regulation
of
A2A
receptors.
Co-administration
of
ZNS
with
levodopa
may
have
a
prophylactic
effect
on
LID.
Endocannabinoid
CB1
receptors,
presynaptically
localized
in
glutamatergic
neurons
projecting
from
the
cerebral
cortex
to
MSNs
in
the
striatum,
regulate
presynaptic
glutamate
release.
When
the
glutamatergic
input
is
in
excess,
glutamate
will
spillover
and
stim-
Please
cite
this
article
in
press
as:
Oki,
M.,
et
al.,
Zonisamide
ameliorates
levodopa-induced
dyskinesia
and
reduces
expression
of
striatal
genes
in
Parkinson
model
rats.
Neurosci.
Res.
(2017),
http://dx.doi.org/10.1016/j.neures.2017.04.003
ARTICLE IN PRESS
G Model
NSR-4033;
No.
of
Pages
6
M.
Oki
et
al.
/
Neuroscience
Research
xxx
(2017)
xxx–xxx
5
Fig.
3.
Expression
levels
of
mRNA
for
each
gene.
(A)
prodynorphin
(Pdyn)
and
preproenkephalin
(Penk).
(B)
dopamine
D1
receptor
(Drd1)
and
D2
receptor
(Drd2).
(C)
adenosine
A2A
receptor
(A2A).
(D)
endocannabinoid
CB1
receptor
(CB1).
Expression
levels
of
mRNA
for
each
gene
on
the
control
side
(Co)
and
the
lesioned
side
(Le)
were
compared
for
each
group.
P
values
of
a
significant
increase
(*)
or
decrease
(**)
in
the
lesioned
side
are
indicated.
ulate
postsynaptically
localized
metabotropic
glutamate
receptors.
Then
endocannabinoids
are
synthetized
by
MSNs
and
act
as
a
retro-
grade
messenger
to
stimulate
presynaptic
CB1
receptors,
providing
protection
as
a
circuit
breaker
against
excess
presynaptic
activity
(Katona
and
Freund,
2008).
In
our
present
study,
the
expression
of
CB1
receptors
was
elevated
in
groups
N,
C,
and
I,
regardless
of
Please
cite
this
article
in
press
as:
Oki,
M.,
et
al.,
Zonisamide
ameliorates
levodopa-induced
dyskinesia
and
reduces
expression
of
striatal
genes
in
Parkinson
model
rats.
Neurosci.
Res.
(2017),
http://dx.doi.org/10.1016/j.neures.2017.04.003
ARTICLE IN PRESS
G Model
NSR-4033;
No.
of
Pages
6
6
M.
Oki
et
al.
/
Neuroscience
Research
xxx
(2017)
xxx–xxx
levodopa
administration
or
LID.
Therefore,
the
elevation
of
CB1
receptors
might
be
an
early
compensatory
mechanism
against
dopaminergic
denervation
in
operated
striatum
to
maintain
stabil-
ity
of
the
basal
ganglia
circuit.
Elevation
of
CB1
receptors
was
not
observed
in
group
Z,
suggesting
that
ZNS
acted
on
a
different
non-
dopaminergic
mechanism
to
inhibit
a
compensatory
up-regulation
of
CB1
receptors.
In
summary,
intermittent
injection
of
levodopa
caused
LID,
in
association
with
elevated
expression
of
D1
and
A2A
receptors.
ZNS
ameliorated
LID
development
and
inhibited
the
up-regulation
of
A2A
and
CB1
receptors.
Further
studies
are
needed
to
explore
the
precise
pathomechanisms
of
these
receptors
with
respect
to
LID
development,
but
modulation
of
expression
of
these
receptors
may
lead
to
therapeutic
approaches
for
the
prevention
or
amelioration
of
motor
complications
in
PD.
Conflict
of
interest
statement
The
authors
have
no
conflict
of
interest.
Acknowledgments
We
thank
Ms.
Yoshiko
Shimada
for
technical
assistance.
This
work
was
performed
as
a
collaborative
study
with,
and
under
finan-
cial
support
from
Sumitomo
Dainippon
Pharma
Co.
Ltd.
This
work
was
also
supported
by
a
research
grant
(D2)
from
Kansai
Medical
University.
References
Calon,
F.,
Dridi,
M.,
Hornykiewicz,
O.,
Bedard,
P.J.,
Rajput,
A.H.,
Di
Paolo,
T.,
2004.
Increased
adenosine
A2A
receptors
in
the
brain
of
Parkinson’s
disease
patients
with
dyskinesias.
Brain
127,
1075–1084.
Chapuis,
S.,
Ouchchane,
L.,
Metz,
O.,
Gerbaud,
L.,
Durif,
F.,
2005.
Impact
of
the
motor
complications
of
Parkinson’s
disease
on
the
quality
of
life.
Mov.
Disord.
20,
224–230.
Gerfen,
C.R.,
Engber,
T.M.,
Mahan,
L.C.,
Susel,
Z.,
Chase,
T.N.,
Monsma
Jr.,
F.J.,
Sib-
ley,
D.R.,
1990.
D1
and
D2
dopamine
receptor-regulated
gene
expression
of
striatonigral
and
striatopallidal
neurons.
Science
250,
1429–1432.
Katona,
I.,
Freund,
T.F.,
2008.
Endocannabinoid
signaling
as
a
synaptic
circuit
breaker
in
neurological
disease.
Nat.
Med.
14,
923–930.
Lebel,
M.,
Chagniel,
L.,
Bureau,
G.,
Cyr,
M.,
2010.
Striatal
inhibition
of
PKA
prevents
levodopa-induced
behavioural
and
molecular
changes
in
the
hemiparkinsonian
rat.
Neurobiol.
Dis.
38,
59–67.
Miller,
D.W.,
Abercrombie,
E.D.,
1999.
Role
of
high-affinity
dopamine
uptake
and
impulse
activity
in
the
appearance
of
extracellular
dopamine
in
stria-
tum
after
administration
of
exogenous
L-DOPA:
studies
in
intact
and
6-hydroxydopamine-treated
rats.
J.
Neurochem.
72,
1516–1522.
Mishina,
M.,
Ishiwata,
K.,
Naganawa,
M.,
Kimura,
Y.,
Kitamura,
S.,
Suzuki,
M.,
Hashimoto,
M.,
Ishibashi,
K.,
Oda,
K.,
Sakata,
M.,
Hamamoto,
M.,
Kobayashi,
S.,
Katayama,
Y.,
Ishii,
K.,
2011.
Adenosine
A(2A)
receptors
measured
with
[C]TMSX
PET
in
the
striata
of
Parkinson’s
disease
patients.
PLoS
One
6,
e17338.
Mori,
A.,
2014.
International
Review
of
Neurobiology.
Adenosine
receptors
in
neu-
rology
and
psychiatry.
Preface.
Int.
Rev.
Neurobiol.
19,
xv–xvi.
Murata,
M.,
Hasegawa,
K.,
Kanazawa,
I.,
2007.
Zonisamide
improves
motor
function
in
Parkinson
disease:
a
randomized,
double-blind
study.
Neurology
68,
45–50.
Murata,
M.,
Hasegawa,
K.,
Kanazawa,
I.,
Fukasaka,
J.,
Kochi,
K.,
Shimazu,
R.,
2015.
Zonisamide
improves
wearing-off
in
Parkinson’s
disease:
a
randomized,
double-
blind
study.
Mov.
Disord.
30,
1343–1350.
Olanow,
C.W.,
Obeso,
J.A.,
Stocchi,
F.,
2006.
Drug
insight:
continuous
dopaminergic
stimulation
in
the
treatment
of
Parkinson’s
disease.
Nat.
Clin.
Pract.
Neurol.
2,
382–392.
Paxinos,
G.,
Watson,
C.,
2007.
The
Rat
Brain
in
Stereotaxic
Coordinates.
Academic
Press,
San
Diego.
Ramlackhansingh,
A.F.,
Bose,
S.K.,
Ahmed,
I.,
Turkheimer,
F.E.,
Pavese,
N.,
Brooks,
D.J.,
2011.
Adenosine
2A
receptor
availability
in
dyskinetic
and
nondyskinetic
patients
with
Parkinson
disease.
Neurology
76,
1811–1816.
Richfield,
E.K.,
Penney,
J.B.,
Young,
A.B.,
1989.
Anatomical
and
affinity
state
compar-
isons
between
dopamine
D1
and
D2
receptors
in
the
rat
central
nervous
system.
Neuroscience
30,
767–777.
Stocchi,
F.,
Tagliati,
M.,
Olanow,
C.W.,
2008.
Treatment
of
levodopa-induced
motor
complications.
Mov.
Disord.
23
(Suppl
3),
S599–612.
Tsironis,
C.,
Marselos,
M.,
Evangelou,
A.,
Konitsiotis,
S.,
2008.
The
course
of
dyskinesia
induction
by
different
treatment
schedules
of
levodopa
in
Parkinsonian
rats:
is
continuous
dopaminergic
stimulation
necessary?
Mov.
Disord.
23,
950–957.
Wallingford,
N.M.,
Sinnayah,
P.,
Bymaster,
F.P.,
Gadde,
K.M.,
Krishnan,
R.K.,
McK-
inney,
A.A.,
Landbloom,
R.P.,
Tollefson,
G.D.,
Cowley,
M.A.,
2008.
Zonisamide
prevents
olanzapine-associated
hyperphagia,
weight
gain,
and
elevated
blood
glucose
in
rats.
Neuropsychopharmacology
33,
2922–2933.
Winkler,
C.,
Kirik,
D.,
Bjorklund,
A.,
Cenci,
M.A.,
2002.
L-DOPA-induced
dyskinesia
in
the
intrastriatal
6-hydroxydopamine
model
of
parkinson’s
disease:
relation
to
motor
and
cellular
parameters
of
nigrostriatal
function.
Neurobiol.
Dis.
10,
165–186.
... Recently, Oki et al. (2017) reported that ZNS could ameliorate LID by modulating the expression of receptors. They designed different models of levodopa-ZNS administration in four groups, namely, intermittent ZNS and levodopa injection, intermittent levodopa injection, continuous levodopa infusion, and no medication. ...
Article
Full-text available
Zonisamide has been used as an add-on treatment in order to overcome the deficiencies of the general therapies currently used to resolve the motor complications and non-motor symptoms of Parkinson disease. Various trials have been designed to investigate the mechanism of action and treatment effects of zonisamide in this condition. Most clinical trials of zonisamide in Parkinson disease were from Japan. The vast majority of studies used changes in the Unified Parkinson’s Disease Rating Scale (UPDRS) scores and daily “OFF” time as primary endpoints. Based on adequate randomized controlled trials, zonisamide is considered a safe and efficacious add-on treatment in Parkinson disease. The most convincing proof is available for a dosage of 25–50 mg, which was shown to lead to a significant reduction in the UPDRS III score and daily “OFF” time, without increasing disabling dyskinesia. Furthermore, zonisamide may play a beneficial role in improving non-motor symptoms in PD, including impulsive–compulsive disorder, rapid eye movement sleep behavior disorder, and dementia. Among the various mechanisms reported, inhibition of monoamine oxidase-B, blocking of T-type calcium channels, modulation of the levodopa–dopamine metabolism, modulation of receptor expression, and neuroprotection are the most often cited. The mechanisms underlying neuroprotection, including modulation of dopamine turnover, induction of neurotrophic factor expression, inhibition of oxidative stress and apoptosis, inhibition of neuroinflammation, modulation of synaptic transmission, and modulation of gene expression, have been most extensively studied. This review focuses on structure, pharmacokinetics, mechanisms, therapeutic effectiveness, and safety and tolerability of zonisamide in patients with Parkinson disease.
Article
Full-text available
Parkinson’s disease (PD) is the second leading neurodegenerative disease that is characterized by severe locomotor abnormalities. Levodopa (L-DOPA) treatment has been considered a mainstay for the management of PD; however, its prolonged treatment is often associated with abnormal involuntary movements and results in L-DOPA-induced dyskinesia (LID). Although LID is encountered after chronic administration of L-DOPA, the appearance of dyskinesia after weeks or months of the L-DOPA treatment has complicated our understanding of its pathogenesis. Pathophysiology of LID is mainly associated with alteration of direct and indirect pathways of the cortico-basal ganglia-thalamic loop, which regulates normal fine motor movements. Hypersensitivity of dopamine receptors has been involved in the development of LID; moreover, these symptoms are worsened by concurrent non-dopaminergic innervations including glutamatergic, serotonergic, and peptidergic neurotransmission. The present study is focused on discussing the recent updates in molecular mechanisms and therapeutic approaches for the effective management of LID in PD patients.
Article
Dopamine replacement therapy with l-DOPA is the most efficacious symptomatic treatment for Parkinson's disease, but its utility is limited by the development of motor fluctuations and abnormal involuntary movements (dyskinesia) in a majority of the patients. These complications are attributed to the combined effects of dopaminergic degeneration and non-physiological reinstatement of dopamine transmission by the standard oral medications. There is substantial evidence that this altered state of dopamine transmission causes pathophysiological changes to a variety of non-dopaminergic neurotransmitter systems in the brain. This evidence has prompted an interest in developing drugs that target non-dopaminergic receptors for the purpose of improving l-DOPA-induced dyskinesia and/or motor fluctuations. We here review all the most important categories of non-dopaminergic targets that have been investigated so far, but with a particular focus on modulators of glutamatergic and serotonergic transmission, which continue to inspire significant efforts towards clinical translation. In particular, we discuss both the experimental rationale and the clinical experience thus far gained from studying 5-HT1A and 5-HT1B receptor agonists, NMDA and AMPA receptor antagonists, mGluR5 negative allosteric modulators, mGluR4 positive allosteric modulators, and adenosine A2a receptor antagonists. We also review compounds with complex pharmacological properties that are already used clinically or about to enter an advanced phase of clinical development (amantadine, safinamide, zonisamide, pridopidine, mesdopetam). We conclude with an outlook on possible directions to address unmet needs and improve the chance of successful translation in this therapeutic area.
Article
Full-text available
Epilepsy is a chronic disease of the central nervous system characterized by an electrical imbalance in neurons. It is the second most prevalent neurological disease, with 50 million people affected around the world, and 30% of all epilepsies do not respond to available treatments. Currently, the main hypothesis about the molecular processes that trigger epileptic seizures and promote the neurotoxic effects that lead to cell death focuses on the exacerbation of the glutamate pathway and the massive influx of Ca2+ into neurons by different factors. However, other mechanisms have been proposed, and most of them have also been described in other neurodegenerative diseases, such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, or multiple sclerosis. Interestingly, and mainly because of these common molecular links and the lack of effective treatments for these diseases, some antiseizure drugs have been investigated to evaluate their therapeutic potential in these pathologies. Therefore, in this review, we thoroughly investigate the common molecular pathways between epilepsy and the major neurodegenerative diseases, examine the incidence of epilepsy in these populations, and explore the use of current and innovative antiseizure drugs in the treatment of refractory epilepsy and other neurodegenerative diseases.
Article
Full-text available
Introduction Although phase 2 and 3 clinical trials in Japan showed that zonisamide improved wearing off in patients with Parkinson's disease (PD), no studies to date have evaluated whether zonisamide improves wearing off in patients with PD without exacerbating dyskinesia. Therefore, we examined this hypothesis in a post hoc analysis of pooled data from the previous phase 2 and 3 trials. Methods Both trials evaluated zonisamide 25 mg and 50 mg versus placebo during a 12-week treatment period. In our analysis, primary efficacy variables were adjusted mean change in wearing off (evaluated as change in “off” time) and dyskinesia from baseline to 12 weeks. Dyskinesia was evaluated using Unified Parkinson's Disease Rating Scale (UPDRS) part 4 items 32 (4-32; duration of dyskinesia) and 33 (4-33; disability of dyskinesia) score. Criteria outcomes included rates of patients meeting specific criteria based on off time plus UPDRS part 4-32 or 4-33. Results A total of 212 patients were included in this analysis. Zonisamide 50 mg significantly reduced off time and UPDRS part 4-33 score at week 12 versus placebo without increasing UPDRS part 4-32 score. The proportion of patients receiving zonisamide 50 mg who met the criterion “Off time decreased and UPDRS part 4-33 score did not increase” was significantly higher than that of patients receiving placebo. Conclusion Zonisamide improves wearing off without exacerbating dyskinesia in Japanese patients with PD. Moreover, zonisamide 50 mg may improve dyskinesia. Further studies are needed to prospectively determine the benefits and clinical relevance of zonisamide on dyskinesia.
Article
Glutamate, GABA, acetylcholine, dopamine, and serotonin interact with each other to regulate the flow of neural information in the striatum. Serotonin type 1A receptor (5HT1A) is primarily expressed on glutamatergic nerve terminals, and 5HT1B is expressed on GABAergic medium spiny neurons (MSNs). Zonisamide (ZNS) reportedly improves the off period without worsening levodopa-induced dyskinesia (LID) in patients with advanced Parkinson's disease. In this study, LID model rats were prepared by administrating levodopa to unilaterally 6-OHDA-lesioned rats. We analyzed changes in serotonergic neurotransmission of LID model rats to elucidate the relationship between LID and the serotonergic system and pathomechanism of the anti-dyskinetic effects of ZNS. Abnormal involuntary movements (AIMs) were most severe in intermittently levodopa-treated rats but milder in rats intermittently medicated with levodopa and ZNS. Continuously levodopa-infused rats or intermittently ZNS-injected rats did not develop AIMs, and no differences in the expression of brain-derived neurotrophic factor, 5-HT transporter, 5HT1A, and 5HT1B mRNA between the lesioned striatum and normal side were observed. Expression of 5HT1B mRNA was elevated in the lesioned striatum of intermittently levodopa-treated rats, but this elevation was normalized by concomitant use of ZNS. The severity of AIMs was correlated with the ratio of 5HT1B to 5HT1A mRNA expression in the lesioned striatum, indicating that the anti-LID effect of ZNS is based on inhibition via 5HT1B receptors to direct pathway MSNs sensitized by intermittent levodopa treatment. Selectively acting serotonergic drugs, especially those that lower the 5HT1B to 5HT1A ratio, are promising new therapeutic agents to attenuate LID development.
Article
Parkinson’s disease (PD) is a progressive neurodegenerative disease due to the depletion of the neurotransmitter dopamine in basal ganglia. There is a scarcity of available therapies for motor and non-motor symptoms of PD. Zonisamide (ZNS) may be one such potential candidate to alleviate PD symptoms. It was serendipitously found to be useful for PD in a patient with both epilepsy and PD. Since then, there have been many clinical trials, case series, observational studies, and case reports published supporting the efficacy of ZNS in PD. This review focuses on the efficacy and usefulness of ZNS in various motor and non-motor symptoms of PD. A predefined inclusion and exclusion criteria were used for the search protocol and databases searched were PubMed, Cochrane Library, Ovid, and clinicaltrials.gov. Most of the randomized clinical trials used UPDRS III as the primary efficacy point and showed positive results favouring ZNS. This review shows that there is evidence of the efficacy of ZNS in motor symptoms as an adjunctive therapy to levodopa, but for non-motor symptoms, the evidence is lacking and needs further investigation.
Article
Full-text available
L-dopa-induced dyskinesia (LID) is the most frequent motor complication associated with chronic L-dopa treatment in Parkinson's disease (PD). Recent advances in the understanding of the pathophysiological mechanisms underlying LID suggest that abnormalities in multiple neurotransmitter systems, in addition to dopaminergic nigrostriatal denervation and altered dopamine release and reuptake dynamics at the synaptic level, are involved in LID development. Increased knowledge of neurobiological LID substrates has led to the development of several drug candidates to alleviate this motor complication. However, with the exception of amantadine, none of the pharmacological therapies tested in humans have demonstrated clinically relevant beneficial effects. Therefore, LID management is still one of the most challenging problems in the treatment of PD patients. In this review, we first describe the known pathophysiological mechanisms of LID. We then provide an updated report of experimental pharmacotherapies tested in clinical trials of PD patients and drugs currently under study to alleviate LID. Finally, we discuss available pharmacological LID treatment approaches and offer our opinion of possible issues to be clarified and future therapeutic strategies.
Chapter
Open image in new window Monoamine oxidases (MAOs) catalyze the oxidative deamination of different amines and neurotransmitters. The two different isozymes, MAO-A and MAO-B, are located at the outer mitochondrial membrane in different tissues. The enzymatic reaction involves formation of the corresponding aldehyde and releasing hydrogen peroxide (H2O2) and ammonia or a substituted amine depending on the substrate. MAO’s role in neurotransmitter metabolism made them targets for major depression and Parkinson’s disease, among other neurodegenerative diseases. Currently, these compounds are being studied for other diseases such as cardiovascular ones.
Article
Background We aimed to evaluate zonisamide therapy in patients with paroxysmal kinesigenic dyskinesia (PKD). Methods We retrospectively analyzed zonisamide therapy in 17 patients with PKD at Saitama Children’s Medical Center between November 1994 and April 2020. We collected information regarding sex, family history, previous history, age at onset, age at zonisamide therapy commencement, dyskinesia characteristics, brain magnetic resonance imaging, interictal electroencephalography, treatment lag, zonisamide efficacy, zonisamide dose, serum zonisamide concentration, and adverse effects. We evaluated PKD frequency at 6 months after zonisamide therapy commencement. Results Fourteen patients met the inclusion criteria with a median age of zonisamide therapy commencement of 12.8 (9.4–16.3) years old. Zonisamide therapy was effective in 13/14 (92.9%) patients: complete remission for > 3 months after zonisamide therapy (n = 7), decreased dyskinesia frequency by >90% (n = 4), dyskinesia frequency by 75-90% (n = 2), and no change of dyskinesia frequency (n = 1). The initial and maintenance zonisamide doses were 2.0 (1.4–3.8) and 2.0 (1.5–5.9) mg/kg/day, respectively. The median duration between zonisamide therapy commencement and dyskinesia decrease or cessation was 4 (1–60) days: 10/14 (71.4%) patients responded to zonisamide within 1 week after zonisamide therapy commencement. Regarding adverse effects, two patients presented with somnolence while one presented with reduced perspiration. There were no serious adverse events. Conclusions We suggest that zonisamide monotherapy is effective for patients with PKD as a first-line treatment. We can evaluate the efficacy of zonisamide therapy within 1 week. Since zonisamide lacks enzyme-inducing effects, unlike carbamazepine and phenytoin, zonisamide therapy may be useful for PKD treatment.
Article
Full-text available
Adenosine A(2A) receptors (A2ARs) are thought to interact negatively with the dopamine D(2) receptor (D2R), so selective A2AR antagonists have attracted attention as novel treatments for Parkinson's disease (PD). However, no information about the receptor in living patients with PD is available. The purpose of this study was to investigate the relationship between A2ARs and the dopaminergic system in the striata of drug-naïve PD patients and PD patients with dyskinesia, and alteration of these receptors after antiparkinsonian therapy. We measured binding ability of striatal A2ARs using positron emission tomography (PET) with [7-methyl-(11)C]-(E)-8-(3,4,5-trimethoxystyryl)-1,3,7-trimethylxanthine ([(11)C]TMSX) in nine drug-naïve patients with PD, seven PD patients with mild dyskinesia and six elderly control subjects using PET. The patients and eight normal control subjects were also examined for binding ability of dopamine transporters and D2Rs. Seven of the drug-naïve patients underwent a second series of PET scans following therapy. We found that the distribution volume ratio of A2ARs in the putamen were larger in the dyskinesic patients than in the control subjects (p
Article
Full-text available
The striatum, which is the major component of the basal ganglia in the brain, is regulated in part by dopaminergic input from the substantia nigra. Severe movement disorders result from the loss of striatal dopamine in patients with Parkinson's disease. Rats with lesions of the nigrostriatal dopamine pathway caused by 6-hydroxydopamine (6-OHDA) serve as a model for Parkinson's disease and show alterations in gene expression in the two major output systems of the striatum to the globus pallidus and substantia nigra. Striatopallidal neurons show a 6-OHDA-induced elevation in their specific expression of messenger RNAs (mRNAs) encoding the D2 dopamine receptor and enkephalin, which is reversed by subsequent continuous treatment with the D2 agonist quinpirole. Conversely, striatonigral neurons show a 6-OHDA-induced reduction in their specific expression of mRNAs encoding the D1 dopamine receptor and substance P, which is reversed by subsequent daily injections of the D1 agonist SKF-38393. This treatment also increases dynorphin mRNA in striatonigral neurons. Thus, the differential effects of dopamine on striatonigral and striatopallidal neurons are mediated by their specific expression of D1 and D2 dopamine receptor subtypes, respectively.
Article
Previously, we reported 50 mg/d zonisamide improved wearing-off without increasing dyskinesia in patients with Parkinson's disease (PD). To determine the efficacy of zonisamide for treatment of "off" time in PD patients, we conducted a multicenter, randomized, double-blind, parallel-group, placebo-controlled study in Japan. Patients with PD and wearing-off received placebo for 4 weeks and then were treated for 12 weeks with zonisamide 25 or 50 mg/d or placebo, in addition to their previous therapy. The primary endpoint was the change from baseline in daily "off" time as determined by patients' diaries at the final assessment. Secondary endpoints included changes from baseline in the total scores of the Unified Parkinson's Disease Rating Scale Parts I, II, III, and IV, the dyskinesia duration, and PDQ-39 score. Of 422 patients enrolled, 389 (131 for placebo, 130 for zonisamide 25 mg, and 128 for zonisamide 50 mg) were randomized, and 354 (120, 119, and 115, respectively) completed the study. The "off" time significantly reduced by 0.719 ± 0.179 h for zonisamide, 50 mg compared with placebo (0.011 ± 0.173 h, P = 0.005). Although the incidence of somnolence was higher for zonisamide (3.1% for zonisamide 25 mg, 6.3% for zonisamide 50 mg) than for placebo (2.3%), the incidences of the other adverse events, including dyskinesia or hallucination, for both zonisamide treatments were comparable to those for placebo. The study provides evidence that confirms the efficacy of zonisamide 50 mg/d for reduction in "off" time in PD patients with wearing-off phenomena. © 2015 International Parkinson and Movement Disorder Society. © 2015 International Parkinson and Movement Disorder Society.
Article
To investigate striatal adenosine A2A receptor availability in patients with Parkinson disease (PD) with and without levodopa-induced dyskinesias (LIDs). While providing effective relief from the motor symptoms of PD, chronic levodopa use is associated with development of LIDs. A2A receptors are expressed on the bodies of indirect pathway medium spiny striatal neurons and on dopamine terminals and play a role in modulating dopamine transmission. A2A antagonists have antiparkinsonian activity by boosting levodopa efficacy. We aimed to study A2A receptor availability in patients with PD with and without LIDs using PET and [¹¹C]SCH442416, an A2A antagonist. Six patients with PD with and 6 without LIDs were studied withdrawn 12 hours from medication. Their PET findings were compared with 6 age-matched healthy controls. Using spectral analysis, [¹¹C]SCH442416 regional volumes of distribution (V(T)) were computed for the caudate, putamen, and thalamus and binding potentials (BP(ND)) reflecting the ratio of specific:nonspecific uptake were compared between groups. A2A binding in the caudate and putamen of subjects with PD with LIDs was far higher (p = 0.026 and p = 0.036, respectively) than that of subjects with PD without LIDs, which lay within the control range. Thalamic A2A availability was similar for all 3 groups. Patients with PD with LIDs show increased A2A receptor availability in the striatum. This finding is compatible with altered adenosine transmission playing a role in LIDs and provides a rationale for a trial of A2A receptor agents in the treatment of these motor complications.
Article
l-3,4-dihydroxyphenylalanine methyl ester hydrochloride (l-DOPA) is the gold standard for symptomatic treatment of Parkinson's disease (PD), but long-term therapy is associated with the emergence of abnormal involuntary movements (AIMS) known as l-DOPA-induced dyskinesias (LID). The molecular changes underlying LID are not completely understood. Using the 6-hydroxydopamine-lesioned rat model of PD, we showed that l-DOPA elicits profound alterations in the activity of three LID molecular markers, namely DeltaFosB, dopamine, cAMP-regulated phosphoprotein of 32 kDa (DARPP-32) and extracellular signal-regulated kinases 1 and 2 (ERK1/2), as well as in phosphorylation levels of the cytoskeletal-associated protein tau. These modifications are triggered by protein kinase A (PKA) activation and intermittent stimulation of dopamine receptors as they are totally prevented by intrastriatal injections of Rp-cAMPS, a PKA inhibitor, or by continuous administration of l-DOPA via subcutaneous mini-pump. Importantly, Rp-cAMPS does not modulate the positive effect of l-DOPA on locomotor deficits and significantly attenuates the emergence of AIMS in 6-hydroxydopamine hydrobromide-lesioned rats. Even if decreased PKA signalling in the striatum may represent a clinical challenge, these data provide novel evidence that PKA activation, through modification of striatal signalling and alterations of cytoskeletal constituents, plays a key role in the manifestation of LID.
Article
Chronic levodopa treatment for Parkinson's disease patients is frequently associated with the development of motor complications such as end-of-dose wearing-off and dyskinesias. In this review, we provide an overview of the strategies available for dealing with these problems. Medical management includes manipulation of levodopa dosing to establish the optimum treatment schedule, improving levodopa absorption, catechol-O-methyl transferase-inhibition (COMT), Monoamine oxidase-B (MAO-B) inhibition, dopaminergic agonists, amantadine, and continuous dopaminergic infusions. Surgical procedures and particularly deep brain stimulation are also reviewed. It should be noted that none of these treatments has been shown to provide anti-parkinsonian efficacy that is greater than what can be achieved with levodopa. We highlight the importance of initiating therapy with a treatment strategy that reduces the risk that a Parkinson's disease patient will develop motor complications in the first place. Key Words: Advanced PD, dyskinesias, motor fluctuations, levodopa, dopamine agonists, COMT inhibitors, MAO-B inhibitors.
Article
Cannabis sativa is one of the oldest herbal plants in the history of medicine. It was used in various therapeutic applications from pain to epilepsy, but its psychotropic effect has reduced its usage in recent medical practice. However, renewed interest has been fueled by major discoveries revealing that cannabis-derived compounds act through a signaling pathway in the human body. Here we review recent advances showing that endocannabinoid signaling is a key regulator of synaptic communication throughout the central nervous system. Its underlying molecular architecture is highly conserved in synapses from the spinal cord to the neocortex, and as a negative feed-back signal, it provides protection against excess presynaptic activity. The endocannabinoid signaling machinery operates on demand in a synapse-specific manner; therefore, its modulation offers new therapeutic opportunities for the selective control of deleterious neuronal activity in several neurological disorders.
Article
The anatomical distributions and affinity states of dopamine D1 and D2 receptors were compared in the rat central nervous system using quantitative autoradiography. [3H]SCH23390 and [3H]spiperone (in the presence of 100 nM mianserin) were used to label the D1 and D2 receptors, respectively. The densities of D1 and D2 receptors displayed a positive correlation among 21 brain regions (Pearson correlation coefficient, r = 0.80, P less than 0.001). The affinity states for the D1 and D2 receptors were found to be quite different from each other, and different from the results obtained by others using homogenate preparations. Both the D1 and D2 receptors were best modeled using a two-state model. In the absence of exogenous guanine nucleotides and using the nonselective agonist dopamine as the competitor, the D1 receptor was primarily in a low affinity agonist state (RH = 21 +/- 6%), whereas the D2 receptor was primarily in the high affinity agonist state (RH = 77 +/- 3%). In the presence of 10 microM guanylyl-imidodiphosphate or guanosine-5'-O-(2-thiophosphate) both the D1 and the D2 receptor were completely in a low affinity agonist state (RL = 100%). These affinity states were found both in the nucleus accumbens and olfactory tubercle using dopamine as the competitor and in the striatum using selective D1 or D2 agonists as competitors. Receptor occupancy of the D2 receptor with either an agonist or antagonist did not alter the affinity states of the D1 receptor, and conversely, receptor occupancy of the D1 receptor did not alter the affinity states of the D2 receptor. The correlation between densities of D1 and D2 receptors provides an anatomical framework for evaluating behavioral and electrophysiological evidence of an interaction between the two dopamine receptor subtypes. This interaction does not appear to be due to a sharing or coupling of G-proteins in such a way that binding to one dopamine receptor subtype alters the affinity state of the other receptor subtype. The differences between dopamine receptor distributions described by labeled agonists and antagonists may be due in part to differences in their affinity states. The low proportion of high affinity state D1 receptors may explain some of the difficulties in assigning specific behavioral roles to the D1 receptor.