ArticlePDF Available

Evaluating seasonality and pathogenicity of Aeromonas in Korea using environmental DNA

Authors:

Abstract and Figures

Fish are sensitive to environmental perturbations, and a common signal of an unbalanced ecosystem is fish disease and death. Recently in Inje County, Korea, finding dead fish has become a common situation. Our goal was to use environmental DNA (eDNA) approaches to look for geographic and seasonal patterns in the presence of Aeromonas in waterways. First, we cultured and identified bacteria from diseased fish and screened for virulence factors. Twelve of the 21 identified bacterial species are known fish pathogens, with Aeromonas veronii and A. hydrophila being most common (37/61 total strains). Focusing on A. veronii and A. hydrophila, we used an eDNA method to screen water samples from the major waterways. We discovered geographic and seasonal patterns-Aeromonas detection was highest in Inbuk Stream and lowest during the summer.
Content may be subject to copyright.
Asian Jr. of Microbiol. Biotech. Env. Sc. Vol. 18, No. (3) : 2016 : 605-613
© Global Science Publications
ISSN-0972-3005
*Corresponding author’s email: ywlim@snu.ac.kr
EVALUATING SEASONALITY AND PATHOGENICITY OF
AEROMONAS IN KOREA USING ENVIRONMENTAL DNA
JONATHAN J. FONG1,2, HAE JIN CHO1, MYUNG SOO PARK1 AND YOUNG WOON LIM1,*
1School of Biological Sciences, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826,
Republic of Korea
2Science Unit, Lingnan University, Tuen Mun, New Territories, Hong Kong
(Received 17 February, 2016; accepted 5 April, 2016)
Key words : Aeromonas hydrophila, Aeromonas veronii, eDNA, Fish pathogen, Inje County, Virulence factor
Abstract– Fish are sensitive to environmental perturbations, and a common signal of an unbalanced
ecosystem is fish disease and death. Recently in Inje County, Korea, finding dead fish has become a common
situation. Our goal was to use environmental DNA (eDNA) approaches to look for geographic and seasonal
patterns in the presence of Aeromonas in waterways. First, we cultured and identified bacteria from diseased
fish and screened for virulence factors. Twelve of the 21 identified bacterial species are known fish
pathogens, with Aeromonas veronii and A. hydrophila being most common (37/61 total strains). Focusing on
A. veronii and A. hydrophila, we used an eDNA method to screen water samples from the major waterways.
We discovered geographic and seasonal patterns—Aeromonas detection was highest in Inbuk Stream and
lowest during the summer.
INTRODUCTION
Freshwater ecosystems play important roles
transporting water and nutrients from land to sea,
supporting ecological communities, and providing
resources to humans (Bailey et al., 2004). Humans
depend on healthy water bodies for drinking water,
food, and recreation, but human activity itself
threatens water quality; these threats include
overexploitation, water pollution, habitat
destruction, flow modification, and invasive species
(Dudgeon et al., 2006). As poor water quality can
lead to human disease (e.g., Xiao et al., 2013), it is
important to monitor the health of freshwater
ecosystems. Fish are sensitive to environmental
perturbations, and a common signal of an
unbalanced ecosystem is fish death. Fish deaths can
disrupt ecosystems (disturbed food webs) and local
economies (cleanup costs, reduced tourism)
(Holmlund and Hammer, 1999). While fish deaths
can be natural, many are caused by human activity
(La and Cooke, 2011); the proximate cause can be a
combination of biotic (biotoxins, pathogens) and
abiotic (pollution, extreme temperature change)
factors (Haslour, 1979; Thronson and Quigg, 2008).
Fish disease and death are commonly caused by
bacterial pathogens, especially by species in the
genus Aeromonas (Austin and Austin, 2007). In
Aeromonas, there are two major groups—
psychrophilic, non-motile (A. salmonicida
subspecies) and mesophilic, motile (A. hydrophila
and A. veronii) (Janda and Abbott, 2010).
Psychrophilic, non-motile Aeromonas are known to
cause furunculosis (a highly contagious, lethal
disease characterized by ulcers on the skin) and
mass death in salmonid and other economically
important fish (Austin and Austin, 2007).
Mesophilic, motile Aeromonas cause stress-induced
diseases (septicemia and red-sore disease) in
freshwater fish (Beaz-Hidalgo and Figueras, 2012).
Environmental DNA (eDNA) approaches are a
powerful way to screen for Aeromonas. eDNA refers
to DNA that can be extracted from environmental
samples (air, soil, water) without first isolating the
target organism (Taberlet et al., 2012). Such methods
require less time (sampling in the field and
culturing in the laboratory), are non-invasive, and
are more sensitive to detection.
In South Korea, freshwater for the residents of
Seoul, the capital and largest city, comes from the
confluence of several rivers. At the headwaters of
one of these rivers (Soyang River) is Inje County.
606 FONG ET AL.
Inje’s streams are known for their clean water and
recreational fishing, but finding dead fish has
become a common occurrence. In this study, we first
use molecular methods to identify bacteria
associated with diseased fish and test for
pathogenicity. Next, we use eDNA approaches to
look for geographic and seasonal patterns of
Aeromonas in the waterways. As Aeromonas species
are both fish and human pathogens (Janda and
Abbott, 2010; Beaz-Hidalgo and Figueras, 2013),
these results are important to evaluate water quality
for ecosystem and human health.
MATERIALS AND METHODS
Sample collection and preparation
We did preliminary sampling to identify bacterial
species associated with diseased fish. In June 2013,
many dead or moribund fish of two species (Zacco
platypus [Temminck and Schlegel] and
Microphysogobio longidorsalis Mori) were found at the
upstream site of Inbuk Stream (site 1; Figure 1) in
Inje County, South Korea. To eliminate the
possibility of bacteria colonizing the fish after death,
we only collected moribund fish. At the site, we
found two moribund fish with abnormal swimming
and external symptoms. We collected and
transported the fish to the laboratory on ice (<5
hours) for immediate culturing. To prepare for
culturing bacteria, fish were rinsed with distilled
water to remove surface contaminants. From each
area with visible infection (body, eye, head, or fin), a
5×5 mm piece of tissue was dissected and put in a
microcentrifuge tube with 1 mL of distilled water.
The tubes were vortexed (~1 min) and 100 μL of the
liquid was spread on a trypticase soy agar (TSA,
Difco) plate to culture bacteria; three culture plates
were made for each tissue sample. Plates were
incubated at 30°C for three days. To obtain pure
cultures, all colonies from all plates were transferred
to individual TSA plates and incubated at 30°C for
three days. Genomic DNA was extracted from each
strain using a modified cetyltrimethyl ammonium
bromide (CTAB) protocol (Rogers and Bendich,
1994) by taking approximately 20 μL of bacterial
material directly from the culture plate. Stocks of
each strain were prepared for long-term storage by
placing bacterial material in 1 mL of sterilized 20%
glycerol and frozen at -80°C.
To investigate the geographic and seasonal
patterns of Aeromonas in the environment, we
collected water samples from eight sites along the
four major waterways—Inbuk Stream (sites 1, 2),
Buk Stream (sites 3, 4), Naerin Stream (sites 5, 6),
and Soyang River (sites 7,8)—at five times of the
year (June 2013, August 2013, October 2013, January
2014, March 2014), for a total of 40 samples (Figure
2). The three streams (Inbuk, Buk, Naerin) flow into
the Soyang River. Water was collected in sterile 2 L
bottles specialized for water sampling (#WBE002;
Y&K Healthcare, Korea) and transported on ice. For
DNA extraction of each sample, 1 L of water was
filtered using a 0.22 μm pore size, mixed cellulose
membrane filter (#GSWP04700, Merck Millipore,
USA). The filter was cut into smaller pieces with
sterile scissors and placed in a 15 mL conical
centrifuge tube (BD Falcon, USA) with 5 mL 2X
CTAB. The filter was ground with a plastic pestle
and genomic DNA was extracted using the modified
CTAB protocol (Rogers and Bendich, 1994).
Strain identification
Three molecular markers (16S ribosomal RNA [16S],
DNA gyrase subunit B [gyrB], and RNA polymerase
sigma 70 factor [rpoD]) were amplified and
sequenced to identify cultured strains to species.
The three markers were amplified using primers
and thermocycler conditions listed in Table 1. All
PCR reactions were performed on a C1000TM
thermal cycler (Bio-Rad, USA) using Maxime PCR
premix i- StarTaq (Intron Biotechnology Inc., Korea)
in a final volume of 20 mL containing 10 pmol of
each primer and 1 mL of DNA (~10ng/mL). PCR
products were visualized on a 1% agarose gel
stained with Loading Star (DyneBio, Korea) and
purified using the ExpinTM PCR Purification Kit
(GeneAll Biotechnology, Korea). DNA was
sequenced at Macrogen (Seoul, Korea) on an
ABI3700 automated DNA sequencer (Applied
Biosystems, USA) using PCR primers. Sequences
were assembled and proofread using Geneious
v5.3.6 (Drummond et al., 2010) and aligned using
MUSCLE v.3.8.31 (Edgar 2004).
Strains were identified using a two-step process.
First, all strains were identified by comparing 16S
sequences to the EzTaxon database. EzTaxon is a
curated database of 16S sequences from prokaryote
type strains (http://www.ezbioloud.net/eztaxon;
Kim et al., 2012). Next, identification of Aeromonas
strains was refined with a maximum likelihood
(ML) phylogenetic analysis of 16S, gyrB, and rpoD
using RAxML v.8.0.2 (Stamatakis, 2014). The
analysis was partitioned by gene (to account for
Evaluating Seasonality and Pathogenicity of Aeromonas in Korea Using Environmental DNA 607
different evolutionary rates between markers) and
performed using the combined rapid bootstrap and
ML search, GTR+G model of nucleotide
substitution, and 1000 bootstrap replicates.
Sequences for Aeromonas type strains were
downloaded from GenBank and included in the
analysis (Table 1); when multiple accession numbers
were available for a type strain, sequences were
assembled and the consensus sequence was used in
the analysis.
Virulence profiles of strains
To evaluate pathogenicity, we used a rapid PCR-
based method developed in Soler et al. (2002) to
screen all strains for the presence of five Aeromonas
virulence factors: lipase (lip), glycerophospholipid-
cholesterol acyltransferase (gcaT), aerolysin/
hemolysin (aer), serine protease (ser), and DNase
(Table 1). These virulence factors may be involved in
infection mechanisms and have been found in
pathogenic species of Aeromonas (Pemberton et al.,
1997). After visualization, two PCR products for
each virulence factor were sequenced to verify their
identity; PCR purification and DNA sequencing
followed the above protocols. We refer to the
combined result for virulence factors of a strain as
its virulence profile.
eDNA detection of Aeromonas and virulence
factors
For identifying geographic and seasonal patterns,
we used the eDNA-based method of Dorsch et al.
(1994) to screen water samples for the presence of A.
hydrophila and A. veronii using species-specific
primers (Table 1). Water samples were also screened
for the five Aeromonas virulence factors following
the previous protocol. Additionally, we measured
the water temperature at the time samples were
collected.
RESULTS
Strain identification
A total of 61 bacterial strains were recovered from
cultures of diseased fish tissues. 16S sequences
identified the majority of strains as Aeromonas (37
strains), while the remaining 24 strains were
identified as 16 species in 12 genera (Figure 1B). The
resolution of 16S for species identification in
Table 1. Information about primers used in this study.
Target Primer Sequence Amplicon Annealing Reference
gene name (5’—3’) size (bp) temp (°C)
16S 27F AGAGTTTGATCMTGGCTCAG ~1400 55 Lane 1991
1492R CGGTTACCTTGTTACGACTT
hydrophilaaGAAAGGTTGATGCCTAATACGTA ~600 64
veroniiaGAGGAAAGGTTGGTAGCTAATAA ~600 64 Dorsch et al. 1994
reverseaCGTGCTGGCAACAAAGGACAG
gyrB gyrB3F TCCGGCGGTCTGCACGGCGT 1100 55 Yanez et al. 2003
gyrB14R TTGTCCGGGTTGTACTCGTC
rpoD 70 Fs ACGACTGACCCGGTACGCATGTA ~820 58 Yamamoto et al.
70 Rs ATAGAAATAACCAGACGTAAGTT 2000
lipase lip-F CAYCTGGTKCCGCTCAAG 247 56 Soler et al. 2002
lip-R GTRCCGAACCAGTCGGAGAA
gcaT GCAT-f CTCCTGGAATCCCAAGTATCAG 237 56 Soler et al. 2002
GCAT-r GGCAGGTTGAACAGCAGTATCT
Aerolysin/ aer-F CCTATGGCCTGAGCGAGAAG 431 56 Soler et al. 2002
Hemolysin aer-R CCAGTTCCAGTCCCACCACT
Serine Serine-F CACCGAAGTATTGGGTCAGG 350 60 Soler et al. 2002
protease Serine-R GGCTCATGCGTAACTCTGGT
DNase Exu-F RGACATGCACAACCTCTTCC 323 54 Soler et al. 2002
Exu-R GATTGGTATTGCCYTGCAAS
aThese names were chosen in our study—no names for primers in original paper.
608 FONG ET AL.
Aeromonas is low, so additional analyses were
needed. The phylogenetic analysis of 16S, gyrB, and
rpoD identified five Aeromonas species (Figure 3);
data could not resolve the difference between the
two A. hydrophila subspecies (A. hydrophila and A. h.
ranae), so the name “A. hydrophila group” was used
for these strains. In total, we identified 21 species in
13 genera, with 12 species being known fish
pathogens (Table 2). Aeromonas veronii was the most
common species (23 strains). Strains of A. hydrophila
group and A. veronii were the only species isolated
from all infected tissues (Table 2). All sequences
Table 2. Virulence profiles of Aeromonas strains isolated from diseased fish tissues. All non-Aeromonas strains were
negative for all virulence factors. lip–lipase, gcaT–glycerophospholipid-cholesterol acyltransferase, aer
aerolysin, ser–serine protease.
Virulence Factors Isolate Nos.
lip gcaT aer ser DNase Species (SFCFD20130614-)
++ + + + Aeromonas hydrophila group 1, 2, 79
Aeromonas piscicola 63
Aeromonas veronii 16, 17, 28, 29, 30, 32, 33, 34, 47
++ + + - Aeromonas sobria 67
Aeromonas veronii 66
++ + - + Aeromonas hydrophila group 104
Aeromonas veronii 5, 12, 13, 21, 22, 56, 57, 60, 71
++ + - - Aeromonas sobria 49
++ - - + Aeromonas allosaccharophila 81
+- + + - Aeromonas sobria 75
+- + - + Aeromonas veronii 68
-++ - + Aeromonas hydrophila group 96
Aeromonas veronii 15
-++ + - Aeromonas sobria 69
-++ - - Aeromonas sobria 53
+- - - - Aeromonas veronii 14
-- - - - Aeromonas hydrophila group 102
Aeromonas sobria 76
Aeromonas veronii 99
Fig. 1. A) Diseased fish used for culturing: (top and middle) Zacco playtypus (Temminck and Schlegel) and (bottom)
Microphysoglobio longidorsalis Mori. White arrows point to areas of infection. B) Identification of the 61 bacterial
strains to genus (# of species/ # of strains).
Evaluating Seasonality and Pathogenicity of Aeromonas in Korea Using Environmental DNA 609
were submitted to GenBank (KP115684–KP115781,
KP939278–KP939307; Table 2).
Virulence profiles of strains
The five virulence factors were only found in
Aeromonas strains (Table 2). Of the 37 Aeromonas
strains, 34 screened positive for at least one
virulence factor. Factors lip, gcaT, aer, and DNase
were found in a majority of the strains (>70%), while
ser was less common (~45%). Virulence profiles (the
combination of virulence factors present) were not
characteristic of a species— strains of different
species had the same virulence profile, and multiple
virulence profiles were found in a species. Single
strains of A. hydrophila group, A. sobria, and A.
veronii screened negative for all five virulence
factors (Table 2). Representative sequences of
virulence factors were submitted to GenBank
(KP939272-KP939277; Table 2).
eDNA detection of Aeromonas and virulence
factors
Results of eDNA screening for A. hydrophila, A.
veronii, and virulence factors are in Fig. 2.
Geographically, A. hydrophila and A. veronii were
present at all eight sites, but lowest in Naerin Stream
(sites 5 and 6, 11/20 samples) and highest in Inbuk
Stream (sites 1 and 2, 18/20 samples)(Fig. 2).
Seasonally, A. hydrophila and A. veronii were both
absent at a majority of sites (sites 1, 3, 4, 5, and 6) in
summer (August). Overall, A. veronii (32/40
samples) was more common than A. hydrophila (26/
40 samples) (Figure 2). All of the five virulence
factors were found in water samples, but some more
prevalent than others; lip was most common (30/40
samples), while DNase was least common (2/40
Fig. 2. Water sampling sites along the waterways of Inje County, South Korea (numbered 1-8). At each site, the results
are shown for screening Aeromonas hydrophila, A. veronii, and five virulence factors. Arrows indicate the direction
of water flow. The small, inset map of Korea shows the path of the major rivers flowing to the capital, Seoul.
610 FONG ET AL.
samples; Figure 2). Generally, virulence factors were
recovered at a lower rate than Aeromonas species.
Average water temperature across sites showed the
expected seasonal variation—high in the summer
(June: 23.4°C, August: 23.2°C) and low in the
autumn and winter (October: 10.6°C, January: 1.3°C,
March: 4.5°C).
DISCUSSION
Identification of bacteria
From the 61 isolated strains, we identified 13
bacterial genera (Fig. 1). Eight of these genera
contain species that are fish pathogens: Aeromonas
(Janda and Abbott, 2010), Bacillus (Goodwin et al.,
1994), Carnobacterium (Leisner et al., 2007), Citrobacter
(Jeremic et al., 2003), Lelliottia (previously
Enterobacter; El-Sayyad et al., 2010), Pseudomonas
(Lopez et al., 2012), Shewanella (Kozinaska and
Pekala, 2004), and Staphylococcus (Kusuda and
Sugiyama, 1981). The five Aeromonas species were
most commonly isolated (37 total strains, Figure 1),
of which A. veronii was dominant (23 strains). We
focused on Aeromonas species because they were the
most common, known fish pathogens, and isolated
from all infected fish tissues (Table 2). One of the
Aeromonas species identified, A. piscicola, is of
particular interest because this is its first record since
its description (Beaz-Hidalgo et al., 2009). We
isolated one strain (SFCFD20130614-63) from the
infected fin of a freshwater minnow (Z. platypus).
Previously, A. piscicola was only known from Spain,
isolated from both wild (Salmo salar L., Oncorhynchus
mykiss [Walbaum]) and farm-raised fish (Carassius
auratus L.) that showed signs of disease (Beaz-
Hidalgo et al., 2009).
Virulence profiles of bacteria
The five virulence factors we screened for are mostly
Aeromonas-specific (with ser and gcaT also present in
some Vibrio species; Chacon et al., 2003). Our results
were the same, with virulence factors only screening
positive in Aeromonas strains (Table 2). In the past,
virulence factors have been used to identify
Aeromonas strains; Beaz-Hidalgo et al. (2010) used
gcaT to help identify Aeromonas, as it was present in
100% of Aeromonas strains and absent in non-
Aeromonas strains. In our study, gcaT was absent in
six Aeromonas strains (Table 2). Chacon et al. (2003)
had similar findings, with gcaT absent in three
environmental and one clinical Aeromonas samples.
Fig. 3. Partitioned maximum likelihood phylogenetic
analysis of the concatenated dataset of 16S
ribosomal DNA (16S), DNA gyrase subunit B
(gyrB), and RNA polymerase sigma 70 factor
(rpoD) used to identify Aeromonas species. Thick
branches indicate clades with bootstrap support
greater than 70. Identified species are highlighted,
and strains isolated in this study are in bold font
(Complete strain numbers have “SFCFD20130614-
” preceding the number). Subspecies of A.
hydrophila could not be distinguished, so they are
collectively referred to as “Aeromonas hydrophila
group”. All other Aeromonas species in the
phylogeny are type strains.
Evaluating Seasonality and Pathogenicity of Aeromonas in Korea Using Environmental DNA 611
These results demonstrate that virulence factors can
complement an identification based on other data,
but may lead to misidentification if it is the only
data used. As in other studies (e.g., Bin Kingombe et
al., 1999), virulence profiles varied between and
within species. A total of 12 virulence profiles were
found for Aeromonas strains, with different species
having the same profile, and strains of the same
species being different (Table 2). This includes
strains of three species (A. hydrophila group, A.
sobria, and A. veronii) that screened negative for all
tested virulence factors (Table 2).
Patterns in Aeromonas detection
Aeromonas veronii was more common in waterways
(32 samples) compared to A. hydrophila (26 samples).
In all but one sample (site 7, October), whenever A.
hydrophila was detected, A. veronii was also detected
(Fig. 2). As this pattern matches the higher
proportion of A. veronii strains isolated from the
diseased fish, A. veronii is probably more common in
the waterways of Inje County. PCR detection of A.
veronii and A. hydrophila from eDNA was more
sensitive than for virulence factors; many virulence
factors were absent when A. veronii and A. hydrophila
were present. Although this may be due to different
virulence profiles of strains (A. hydrophila had four
different profiles, A. veronii seven different profiles;
Table 2), we believe gene copy number also
influences this result—Aeromonas species have up to
six copies of 16S (Morandi et al., 2005), while
(unknown for all genes and all species) A. hydrophila
is known to have only one copy of aer (Yu et al.,
2008). Gene copy number should be considered
when choosing a genetic marker for eDNA studies.
Using eDNA, we uncovered a geographic pattern
in Aeromonas presence across sites Aeromonas
detection was lowest in Naerin Stream and highest
in Inbuk Stream. Of the 20 PCR reactions performed
to detect A. hydrophila and A. veronii along a
waterway, only 11 were positive at Naerin Stream,
compared to 18 at Inbuk Stream (Figure 2). High
bacteria levels in aquatic habitats are often linked to
organic or chemical compounds from fish farms
(feed waste, feces; Gowen and Bradbury, 1987) or
land-based farms (fertilizers; Alabaster, 1982). In the
mountainous area around Inbuk Stream, there are
several highland farms. Such farms use high
amounts of chemical fertilizers (~450 kg ha-1 year-1;
Kim et al., 2001), which may impact the prevalence
of bacteria in the water. Aeromonas detection
decreased in summer (August)—at 5/8 of the sites,
neither A. hydrophila nor A. veronii were detected
(Fig. 2). This pattern was found in other studies
(Hazen, 1979; Hazen and Esch, 1983) and attributed
to an increase in water temperature, which may
increase mortality, predation by zooplankton, and/
or competition for nutrients. This effect of higher
temperatures on Aeromonas was not seen in our
study, as the average water temperature in June
(23.4°C) and August (23.2°C) were similar, but
Aeromonas levels differed—high in June, low in
August.
CONCLUSION
From diseased fish in natural waterways of Korea,
we identified 21 bacteria species, 12 of which are
known fish pathogens. Although additional
histopathology data are needed to verify their role
in fish disease, Aeromonas species are potential
contributors, as they demonstrated potential
pathogenicity (screening positive for virulence
factors) and were dominant and present on the
diseased fish. One of these species, A. piscicola, is of
particular interest because this is the only the first
identification of this species after its initial
description. Using an eDNA approach, we detected
geographic and temporal patterns in the presence of
A. hydrophila and A. veronii. Geographically, both
species were more common in Inbuk stream, which
may be related to the presence of highland farms in
the region. Temporally, Aeromonas detection
decreased in the summer, although we could not
identify any causes for this pattern. As Aeromonas
species are both fish and human pathogens, these
results demonstrate a way evaluate water quality for
ecosystem and human health.
ACKNOWLEDGEMENTS
This project was funded by the Bioresource
Research Project of Inje County. We would like to
thank members of the Lim lab for comments on the
manuscript.
REFERENCES
Alabaster, J.S. 1982. Report of the EIFAC workshop on fish-
farm effluents. EIFAC Technical Papers. 41 : 166.
Austin, B. and Austin, D.A. 2007. Bacterial Fish Pathogens,
Disease of Farmed and Wild Fish, 4th ed. Springer-Praxis,
Chichester. p. 552.
Bailey, R.C., Norris, R.H. and Reynoldson, T.B. 2004.
Bioassessment of freshwater ecosystems
612 FONG ET AL.
fundamental themes, pp. 1–15. In Bioassessment of
Freshwater Ecosystems Using the Reference Condition
Approach. Kluwer Academic Publishers, Boston, USA.
Beaz-Hidalgo, R., Alperi, A., Bujan, N., Romalde, J.L. and
Figueras, M.J. 2010. Comparison of phenotypical and
genetic identification of Aeromonas strains isolated
from diseased fish. Systematic and Applied
Microbiology. 33 (3) : 149–153.
Beaz-Hidalgo, R., Alperi, A., Figueras, M.J. and Romalde,
J.L. 2009. Aeromonas piscicola sp. nov., isolated from
diseased fish. Systematic and Applied Microbiology. 32
(7) : 471–479.
Beaz-Hidalgo, R. and Figueras, M.J. 2012. Molecular
detection and characterization of furunculosis and
other Aeromonas fish infections. In: Health and
Environment in Aquaculture. INTECH, Rijeka. pp. 97–
132. In Carvalho, E.D., David, G.S. and Silva, R.J.
(eds.). Health and Environment in Aquaculture. InTech,
Rijeka, Croatia.
Beaz-Hidalgo, R. and Figueras, M.J. 2013. Aeromonas spp.
whole genomes and virulence factors implicated in
fish disease. Journal of Fish Diseases. 36 (4) : 371–388.
Bin Kingombe, C.I., Huys, G., Tonolla, M., Albert, M.J.,
Swings, J., Peduzzi, R. and Jemmi, T. 1999. PCR
detection, characterization, and distribution of
virulence genes in Aeromonas spp. Applied and
Environmental Microbiology. 65 (12) : 5293–5302.
Chacon, M.R., Figueras, M.J., Castro-Escarpulli, G., Soler,
L., and Guarro, J. 2003. Distribution of virulence
genes in clinical and environmental isolates of
Aeromonas spp. Antoine van Leeuwenhoek. 84 (4): 269–
278.
Dorsch, M., Ashbolt, N.J., Cox, P.T. and Goodman, A.E.
1994. Rapid identification of Aeromonas species using
16S rDNA targeted oligonucleotide primers: a
molecular approach based on screening of
environmental isolates. Journal of Applied Bacteriology.
77 (6) : 722–726.
Drummond, A.J., Ashton, B., Buxton, S., Cheung, M.,
Cooper, A., Heled, J., Kearse, M., Moir, R., Stones-
Havas, S., Sturrock, S., Thierer, T. and Wilson, A.
2010. Geneious v5.3, Available from http://
www.geneious.com.
Dudgeon, D., Arthington, A.H., Gessner, M.O., Kawabata,
Z.-I., Knowler, D.J., Leveque, C., Naiman, R.J., Prieur-
Richard, A. H., Soto, D., Stiassny, M.L.J. and Sullivan,
C.A. 2006. Freshwater biodiversity: importance,
threats, status and conservation challenges. Biological
Reviews. 81 (2) : 163–182.
Edgar, R.C. 2004. MUSCLE: multiple sequence alignment
with high accuracy and high throughput. Nucleic
Acids Research. 32 (5) : 1792–1797.
El-Sayyad, H.I., Zaki, V.H., El-Shebly, A.M. and El-Badry,
D.A. 2010. Studies on the effects of bacterial diseases
on skin and gill structure of Clarias gariepinus in
Dakahlia Province, Egypt. Annals of Biological
Research. 1 (4) : 106–118.
Goodwin, A.E., Roy, J.S.Jr., Grizzle, J.M. and Goldsby,
M.T.Jr. 1994. Bacillus mycoides: a bacterial pathogen
of channel catfish. Diseases of Aquatic Organisms. 18:
173–179.
Gowen, R.J. and Bradbury, N.B. 1987. The ecological
impact of salmonid farming in coastal waters: a
review. Oceanography and Marine Biology. 25 : 563–
575.
Haslour, S.G. 1979. Natural and pollution-caused fish kills
in Kansas during 1978. Transactions of the Kansas
Academy of Sciences. 82 (4) : 197–204.
Hazen, T. 1979. Ecology of Aeromonas hydrophila in a South
Carolina cooling reservoir. Microbial Ecology. 5 (3) :
179–195.
Hazen, T.C. and Esch, G.W. 1983. Effect of effluent from a
nitrogen fertilizer factory and a pulp mill on the
distribution and abundance of Aeromonas hydrophila
in Albemarle Sound, North Carolina. Applied and
Environmental Microbiology. 45 (1) : 31–42.
Holmlund, C.M. and Hammer, M. 1999. Ecosystem
services generated by fish populations. Ecological
Economics. 29 (2) : 253–268.
Janda, J.M. and Abbott, S.L. 2010. The genus Aeromonas:
taxonomy, pathogenicity, and infection. Clinical
Microbiology Rev. 23 (1) : 35–73.
Jeremic, S., Jakic-Dimic, D. and Veljovic, L.J. 2003.
Citrobacter freundii as a cause of disease in fish. Acta
Veternaria Beograd. 53 (5-6) : 399–410.
Kim, O.S., Cho, Y.J., Lee, K., Yoon, S.H., Kim, M., Na, H.,
Park, S.C., Jeon, Y.S., Lee, J.H., Yi, H., Won, S. and
Chun, J. 2012. Introducing EzTaxon: a prokaryotic
16S rRNA gene sequence database with phylotypes
that represent uncultured species. International
Journal of Systematic and Evolutionary Microbiology. 62
(3) : 716–721.
Kim, B., Park, J., Hwang, G., Jun, M. and Choi, K. 2001.
Eutrophication of reservoirs in South Korea.
Limnology. 2 (3) : 223–229.
Kozinaska, A. and Pekala, A. 2004. First isolation of
Shewanella putrefaciens from freshwater fish–a
potential new pathogen of the fish. Bulletin of the
European Association of Fish Patologists. 24 (4) : 199.
Kusuda, R. and Sugiyama, A. 1981. Studies on the
characters of Staphylococcus epidermis isolated from
diseased fishes, 1: on the morphological, biological
and biochemical properties. Fish Pathogens 16 : 15–
24.
La, V.T. and Cooke, S.J. 2011. Advancing the science and
practice of fish kill investigations. Reviews in Fisheries
Science. 19 (1) : 21–33.
Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic acid
techniques in bacterial systematics. Chichester. pp. 115–
175. In Stacketbrandt, E. and Goodfellow, M. (eds.),
Nucleic acid techniques in bacterial systematics, John
Wiley and Sons, Chichester, UK.
Leisner, J.J., Laursen, B.G., Prevost, H., Drider, D., and
Dalgaard, P. 2007. Carnobacterium: positive and
negative effects in the environment and in foods.
FEMS Microbiology Review. 31 (5) : 592–613.
Lopez, J.R., Dieguez, A.L., Doce, A., De la Roca, E., De la
Herran, R., Navas, J.I., Toranzo, A.E. and Romalde,
Evaluating Seasonality and Pathogenicity of Aeromonas in Korea Using Environmental DNA 613
J.L. 2012. Pseudomonas baetica sp. nov., a fish pathogen
isolated from wedge sole, Dicologlossa cuneata
(Moreau). International Journal of Systematic and
Evolutionary Microbiology. 62 (4) : 874–882.
Morandi, A., Zhaxybayeva, O., Grogarten, J.P. and Graf,
J. 2005. Evolutionary and diagnostic implications of
intragenomic heterogeneity in the 16S rRNA gene
in Aeromonas strains. Journal of Bacteriology. 187 (18) :
6561–6564.
Pemberton, J.M., Kidd, S.P. and Schmidt, R. 1997. Secreted
enzymes of Aeromonas. FEMS Microbiology Letters.
152 : 1–10.
Rogers, S.O. and Bendich, A.J. 1994. Extraction of total
cellular DNA from plants, algae and fungi. In: Plant
Molecular Biology Manual. Kluwer Academic, Boston.
pp. 1–8. In Gelvin, S.B. and Schilperoot, R.A. (eds.),
Plant molecular biology manual, Kluwer Academic,
Boston, USA.
Soler, L., Figueras, M.J., Chacon, M.R., Vila, J., Marco, F.,
Martinez-Murica, A.J. and Guarro, J. 2002. Potential
virulence and antimicrobial susceptibility of
Aeromonas popoffii recovered from freshwater and
seawater. FEMS Immunology and Medical Microbiology.
32 (3) : 243–247.
Stamatakis, A. 2014. RAxML version 8: a tool for
phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics. 30 (9) : 1312–1313.
Taberlet, P., Coissac E., Hajibabei, M. and Rieseberg, L.H.
2012. Environmental DNA. Molecular Ecology.
21 (8) : 1789–1793.
Thronson, A. and Quigg, A. 2008. Fifty-five years of fish
kills in coastal Texas. Estuaries and Coasts. 31 (4) : 802–
813.
van der Schalie, W.H., Gardner, H.S.Jr., Bantle, J.A., De
Rosa, C.T., Finch, R.A., Reif, J.S., Reuter, R.H., Backer,
L.C., Burger, J., Folmar, L.C. and Stokes, W.S. 1999.
Animals as sentinels of human health hazards of
environmental chemicals. Environmental Health
Perspectives. 107 : 309–315.
Xiao, G., Wang, Z., Chen, J., Qiu, Z., Li, Y., Qi, J., Liu, W.,
and Shu, W. 2013. Occurrence and infection risk of
waterborne pathogens in Wanzhou watershed of the
Three Gorges Reservoir, China. Journal of
Environmental Science 25 (9) : 1913–1924.
Yamamoto, S., Kasai, H., Arnold, D.L., Jackson, R.W.,
Vivian, A. and Harayama, S. 2000. Phylogeny of the
genus Pseudomonas: intrageneric structure
reconstructed from the nucleotide sequences of gyrB
and rpoD genes. Microbiology. 146 (10) : 2385–2394.
Yanez, M.A., Catalan, V., Apraiz, D., Figueras, M.J. and
Martinez-Murica, A.J. 2003. Phylogenetic analysis of
members of the genus Aeromonas based on gyrB gene
sequences. International Journal of Systematic and
Evolutionary Microbiology. 53 (3) : 875–883.
Yu, C., Farrell, S.K., Robinson, B. and Chu, K. 2008.
Development and application of real-tine PCR assays
for quantifying total and aerolysin gene-containing
Aeromonas in source, intermediate, and finished
drinking water. Environmental Science and Technology
42 (4) : 1191–1200.
... River, Pond qPCR [13,37] ...
... River water qPCR [14] Yersinia ruckeri RAS ddPCR [37] ...
Article
Full-text available
Organisms release their nucleic acid in the environment, including the DNA and RNA, which can be used to detect their presence. eDNA/eRNA techniques are being used in different sectors to identify organisms from soil, water, air, and ice. The advancement in technology led to easier detection of different organisms without impacting the environment or the organism itself. These methods are being employed in different areas, including surveillance, history, and conservation. eDNA and eRNA methods are being extensively used in aquaculture and fisheries settings to understand the presence of different fish species and pathogens in water. However, there are some challenges associated with the reliability of results because of the degradation of nucleic acid by several factors. In aquaculture, there are several diseases and parasites detected with these methods. In this review, we discuss different aquaculture diseases and parasites detected with eDNA/eRNA approach and the fate of these nucleic acids when subjected to different water quality and environmental parameters. This review intends to help the researcher with the potential of eDNA/eRNA-based detection of pathogens in aquaculture; this will be useful to predict a potential outbreak before it occurs. Along with that, this paper intends to help people understand several factors that degrade and can hamper the detection of these nucleic acids.
... The gyrB sequence fragments for sequenced A. hydrophila isolates comprised 3 strains and were recovered in 3 clades ( Figure 11). Sequences of isolates from spotted bass (LN-Mp-1, LN-Mp-2) collected from Lake Nottely were recovered in a polytomy that included 11 A. hydrophila strains, of which they were identical to 9, including strains AH2, AH3, AH4, AH5, AH6, and AH8 isolated from zebrafish Danio rerio (Hamilton, 1822; Cypriniformes: Cyprinidae) in South Korea, strains SFCFD20130614-2 and 79 isolated from a pale chub Zacco platypus (Temminck & Schlegel, 1846) (Cypriniformes: Cyprinidae) mortality event in South Korea, and strain AhS633 isolated from a faecal sample in France (Figure 11) (Fong et al., 2016). Sequences of isolates from bluegill (BRL-Lm-1) and spotted bass (BRL-Mp-1) collected from Blue Ridge Lake differed by 21 nucleotides and by 16 and 25 nucleotides from isolates from Lake Nottely, respectively, with the isolate from were recovered together in a polytomy (Hossain et al., 2014;Rasmussen-Ivey et al., 2016). ...
Article
The aetiological agents of red sore disease (RSD) reportedly comprise a taxonomically ambiguous stalked ciliate (a species of Epistylis) and Aeromonas hydrophila. The taxonomic identity of each pathogen remains provisional: using supra-specific morphological features for the ciliate and culture-based methods that cannot delineate bacterial strain. On 7 and 9 November 2017 and 28 May 2020, biologists and anglers reported a local epizootic (Hiwassee and Chattahoochee river basins; Georgia) wherein some moribund fish presented RSD-like lesions. The ciliates were assigned to Epistylis by morphology. The ciliate is regarded as Epistylis cf wuhanensis, as nucleotide sequences from its small subunit ribosomal DNA were identical to those of Epistylis wuhanensis. The bacterium was identified as Aeromonas hydrophila by phenotypic markers and nucleotide sequences from the DNA gyrase subunit B; our sequences comprised 3 strains and phylogenetically were recovered sister to strains of Eurasian origin. Histological sections of lesions revealed effacement or partial deterioration of the epithelium covering scales, scale loss, haemorrhaging, necrosis, oedema, and extensive inflammatory infiltrate in the dermis. This is the first nucleotide sequence information for the symbionts implicated in RSD.
... New approaches to gathering information that can help to monitor disease risk need to be developed, as existing methods cannot provide the information required to meet this challenge. One area with the potential to provide useful information is eDNA (environmental DNA), as highlighted by work undertaken in Scotland (Peters et al., 2017) and elsewhere (Fong et al., 2016;Gomes et al., 2017;Polinski et al., 2017). Using such methods as eDNA allow for samples of sea water to be taken around fish farms to detect the extent to which disease vectors are released into the environment, and their temporal and spatial pervasiveness. ...
Technical Report
Full-text available
The ECCLR Committee is carrying out this work in advance of the Rural Economy and Connectivity (REC) Committee’s forthcoming inquiry on aquaculture in Scotland, the terms of reference for which will be considered in the coming weeks. The ECCLR Committee’s focus is the report commissioned by SPICe and undertaken by SAMS Research Services Ltd (SRSL). This report contains a review of literature on the environmental impacts of salmon farming in Scotland, the scale of the impacts and approaches to mitigating the impacts. This provides an update of the Scottish Government commissioned report: Review and synthesis of the environmental impacts of aquaculture, published in 2002.
Preprint
Full-text available
Organisms release their nucleic acid in the environment including the DNA and RNA which can be used to detect their presence. eDNA/eRNA techniques are being used in different sectors to identify organisms from soil, water, air, and ice since long. The advancement in technology led to easier detection of different organisms without impacting the environment and the organism itself. These methods are being employed in different areas including surveillance, history, and conservation. eDNA and eRNA methods are being extensively used in aquaculture and fisheries setting to understand the presence of different fish species and pathogens in water. However, there are some challenges associated with the reliability of the results because of the degradation of nucleic acid by several factors. In aquaculture there are several diseases and parasites detected with these methods. In this review we discuss different aquaculture diseases and parasites detected with eDNA/eRNA approach and the fate of these nucleic acids when subjected to different water quality and environmental parameters. This review intends to help the researcher about the potential of eDNA/eRNA based detection of pathogens in aquaculture; this will be useful to predict the potential outbreak before it occurs. Along with that this paper intends to make people understand several factors that degrade and can hamper the detection of these nucleic acids.
Article
Full-text available
Phylogenies are increasingly used in all fields of medical and biological research. Moreover, because of the next generation sequencing revolution, datasets used for conducting phylogenetic analyses grow at an unprecedented pace. RAxML (Randomized Axelerated Maximum Likelihood) is a popular program for phylogenetic analyses of large datasets under maximum likelihood. Since the last RAxML paper in 2006, it has been continuously maintained and extended to accommodate the increasingly growing input datasets and to serve the needs of the user community. I present some of the most notable new features and extensions of RAxML, such as, a substantial extension of substitution models and supported data types, the introduction of SSE3, AVX, and AVX2 vector intrinsics, techniques for reducing the memory requirements of the code and a plethora of operations for conducting post-analyses on sets of trees. In addition, an up-to-date, 50 page user manual covering all new RAxML options is available. The code is available under GNU GPL at https://github.com/stamatak/standard-RAxML. Alexandros.Stamatakis@h-its.org.
Article
During the period from July 1976 through September 1977, epizootics occurred among cultured yellowtail, Seriola quinqueradiata, and red sea bream, Chrysophrys major, in Kochi and Kagawa Prefecture. The typical symptoms of this disease were exophthalmos and occasionally congestion and swallen lesion on the caudal peduncle. Organisms could be isolated from diseased fishes. In the present paper, morphological, biological and biochemical characteristics of six organisms isolated from diseased yellowtail and red sea bream were examined and these organisms were classified by Baird-parker's biochemical subgrouping scheme. The organisms were gram-positive, non-motile, spherical cells of about 0.6-1.8 μm in diameter occurring singly, in pairs and irregular clusters. Catalase production and glucose fermentation were positive, oxidase and coagulase production were negative, and all organisms except one showed negative reactions in mannitol fermentation. On the basis of these characters, the organisms were identified as Staphylococcus epidermidis; moreover, three organisms isolated from yellowtail were classified as Baird-parker's (B-P) Staphylococcus subgroup II, V and VI, and three others from red sea bream were classified as B-P Staphylococcus subgroup II. © 1981, The Japanese Society of Fish Pathology. All rights reserved.
Article
The Three Gorges Reservoir (TGR), formed by China's Yangtze Three Gorges Project, is the largest lake in the world, but there is too little information available about fecal contamination and waterborne pathogen impacts on this aquatic ecosystem. During two successive 1-year study periods (July 2009 to July 2011), the water quality in Wanzhou watershed of the TGR was tested with regard to the presence of fecal indicators and pathogens. According to Chinese and World Health Organization water quality standards, water quality in the mainstream was good but poor in backwater areas. Salmonella, Enterohemorrhagic Escherichia coli (EHEC), Giardia and Cryptosporidium were detected in the watershed. Prevalence and concentrations of the pathogens in the mainstream were lower than those in backwater areas. The estimated risk of infection with Salmonella, EHEC, Cryptosporidium, and Giardia per exposure event ranged from 2.9 x 10(-7) to 1.68 x 10(-5), 7.04 x 10(-10) to 2.36 x 10(-7), 5.39 x 10(-6) to 1.25 x 10(-4) and 0 to 1.2 x 10(-3), respectively, for occupational divers and recreational swimmers exposed to the waters. The estimated risk of infection at exposure to the 95% upper confidence limit concentrations of Salmonella, Cryptosporidium and Giardia may be up to 2.62 x 10(-5), 2.55 x 10(-4) and 2.86 x 10(-3), respectively. This study provides useful information for the residents, health care workers and managers to improve the safety of surface water and reduce the risk of fecal contamination in the TGR.
Article
Bacillus mycoides was isolated from channel catfish Ictalurus punctatus during an epizootic in a commercial culture pond in Alabama, USA. During the epizootic, the fish had pale areas or ulcers on the dorsum and focal necrosis of epaxial muscle. Dissolved oxygen, ammonia, and other water characteristics were within normal ranges. Pathogens other than B. mycoides were not found in the moribund fish. Histologic examination of the lesions revealed necrotic muscle with chains of Gram-positive bacilli. Intramuscular injection of 1.6 x 10(4) colony forming units of B. mycoides into channel catfish caused lesions that resembled those in fish during the epizootic. Similar lesions developed after subcutaneous injection of B. mycoides, but intraperitoneal injection or application of B. mycoides to abraded skin did not result in lesions.
Article
Occurrences of fish kills are increasing in aquatic ecosystems worldwide, and have been attributed to natural phenomena, as well as human modification and pollution of terrestrial and aquatic environments. Despite contemporary research activities, the science of fish kill investigations is still rudimentary and has advanced little since the 1960s. Here, we highlight the complexity of fish kills and provide a critical commentary on the key challenges that must be overcome in order to advance the science of fish kill investigation. Such challenges include recognizing the potential for carry-over effects, biotic factors, and multiple stressors when conducting fish kill investigations. We recommend an interdisciplinary approach that includes recent innovations in field physiology, functional genomics, and greater reliance on fish health professionals. We also recommend additional efforts to develop databases for tracking fish kills, as well as more attempts to publish fish kill studies in the peer-reviewed literature. The recommendations that we provide will advance our ability to identify fish kill causes, and consequently allow us to implement preventative measures to reduce the frequency and magnitude of fish kills worldwide.