ArticlePDF Available

Characterizing bacterial communities in paper production-troublemakers revealed

Authors:

Abstract

Biofilm formation is a major cause of reduced paper quality and increased down time during paper manufacturing. This study uses Illumina next-generation sequencing to identify the microbial populations causing quality issues due to their presence in biofilms and slimes. The paper defects investigated contained traces of the films and/or slime of mainly two genera, Tepidimonas and Chryseobacterium. The Tepidimonas spp. found contributed on average 68% to the total bacterial population. Both genera have been described previously to be associated with biofilms in paper mills. There was indication that Tepidimonas spp. were present as compact biofilm in the head box of one paper machine and was filtered out by the paper web during production. On the other hand Tepidimonas spp. were also present to a large extent in the press and white waters of two nonproblematic paper machines. Therefore, the mere presence of a known biofilm producer alone is not sufficient to cause slimes and therefore paper defects and other critical factors are additionally at play. For instance, we identified Acidovorax sp., which is an early colonizer of paper machines, exhibiting the ability to form extracellular DNA matrices for attachment and biofilm formation.
MicrobiologyOpen. 2017;e487.    
|
 1 of 6
https://doi.org/10.1002/mbo3.487
www.MicrobiologyOpen.com
Received:3January2017 
|
  Revised:13March2017 
|
  Accepted:21March2017
DOI: 10.1002/mbo3.487
ORIGINAL RESEARCH
Characterizing bacterial communities in paper production—
troublemakers revealed
Anita Zumsteg | Simon K. Urwyler | Joachim Glaubitz
ThisisanopenaccessarticleunderthetermsoftheCreativeCommonsAttributionLicense,whichpermitsuse,distributionandreproductioninanymedium,
provided the original work is properly cited.
©2017TheAuthors.MicrobiologyOpenpublishedbyJohnWiley&SonsLtd.
OmyaInternationalAG,R&DMicrobiology,
Oftringen,Switzerland
Correspondence
AnitaZumsteg,OmyaInternationalAG,
Oftringen,Switzerland.
Email:anita.zumsteg@omya.com
Abstract
Biofilm formation is a major cause of reduced paper quality and increased down time
during paper manufacturing. This study uses Illumina next- generation sequencing to
identify the microbial populations causing quality issues due to their presence in bio-
films and slimes. The paper defects investigated contained traces of the films and/or
slimeofmainlytwogenera,Tepidimonas and Chryseobacterium. The Tepidimonas spp.
found contributed on average 68% to the total bacterial population. Both genera have
been described previously to be associated with biofilms in paper mills. There was in-
dication that Tepidimonas spp. were present as compact biofilm in the head box of one
paper machine and was filtered out by the paper web during production. On the other
hand Tepidimonas spp. were also present to a large extent in the press and white wa-
tersoftwononproblematicpapermachines.Therefore,themerepresenceofaknown
biofilm producer alone is not sufficient to cause slimes and therefore paper defects
andothercriticalfactorsareadditionallyatplay.Forinstance,weidentifiedAcidovorax
sp.,whichisanearlycolonizerofpapermachines,exhibitingtheabilitytoformextra-
cellularDNAmatricesforattachmentandbiofilmformation.
KEYWORDS
biofilms,diversity,indicators,metagenomics,microbialcontamination
1 | INTRODUCTION
Papermanufacturing requiresa largevolume ofwater,which, today,
is permanently recycled at the various stages during the production
process.Assuch,bacterialgrowthand biofilmformationinthe paper
machines are inevitable. These recycled waters are a main cause of
slime production related to the presence of bacteria which leads to
smell,discoloration,andirregularitiesinthepaperformationandweb
breaks(Blanco, Negro,Gaspar, &Tijero, 1996;Kolari,2007).Tomit-
igate these effects the microbial population is continuously treated
with biocides (Blanco, Negro, Monte, Fuente, & Tijero, 2004). But
when bacterial colonization is out ofcontrol, the consequences are
variablepaperquality,increasingdowntime,andhighermaintenance
costs(Kolari,Nuutinen,Rainey,&Salkinoja-Salonen,2003).
Various bacterial species may be responsible for biofilm formation
in paper machines. Deinococcus geothermalisisaprimarycolonizerlead-
ingtothick, synergistic biofilms withdifferentbacilli species (Kolari,
Nuutinen,&Salkinoja-Salonen,2001).Furthermore,Tepidimonasspp.,
belonging to the Betaproteobacteria,were identified directly in the
paperprocessalreadyatthe earlystage ofbiofilmformation(Tiirola,
Lahtinen,Vuento,&Oker-Blom,2009).Several bacterial classesand
genera are known to populate the waters and raw products in paper
machines.Vaisanenetal.(1998)analyzed390cultivableaerobicbac-
teria from process steps and raw materials and demonstrated a vast
bacterialdiversity.Athoroughphylogeneticanalysisof404cloned16S
rRNAgene amplicons was performed by Granhalletal. (2010), who
analyzedtwodifferentpapermillsthatshowedsimilaroverallprofiles
but still unique individual populations. Bacteroidetes (including the
2 of 6 
|
   ZUMSTEG ET al.
genus Chryseobacterium)predominated,butseveralotherPhylawere
identified such as members of the Firmicutes (including Clostridium
sp.),Alpha—andGammaproteobacteria,butnotBetaproteobacteria.
Most of the published research focuses on cultivable bacteria from
smoothlyrunningpapermachines.However,in thisstudyweuse,to
ourknowledgeforthefirsttime,Illuminanext-generationsequencing
to analyze the total bacterial community,including the uncultivable
bacteria,to comparethecommunities presentin the processwaters
of four paper machines at the same mill. The exemplified paper mill in
this report experienced recurring problems in one of the four paper
machines. We identified and compared the bacterial population found
directly in the irregularities on the paper sheets consistently produced
by this machine. Such a thorough process analysis allows us to identify
process steps harboring the problematic microbialpopulations, and
thus,inprinciple,enablingamoreefficient strategytobefollowedin
the future for their control.
2 | MATERIALS AND METHODS
2.1 | Sampling and enumeration of cultivable
bacteria
Allsamples were providedfrom a northernGerman paper manufac-
turer(undisclosed)andarelisted in Table S1. Defective paper sam-
pleswere derivedfrom papermachine1 (PM1).Additionally, waters
(press water, white water, and clear filtrate) were sampled from all
fourpapermachines(PM1,PM2,PM3,andPM4)locatedatthesame
site. Figure 1 represents a simplified scheme of the process and water
circulation, and illustrates the three types of water (press water,
whitewater,andclearfiltrate)sampled.The totalviable count(TVC)
of water samples was determined by plating 0.1 ml of a 10- fold dilu-
tionin phosphatebufferedsaline (PBS)(pH7.4, Sigma-Aldrich)onto
TrypticSoy Broth Agar(TSA) (Sigma-Aldrich).Plateswere incubated
for48h at 30°C priortoenumeration of colony-forming units(cfu).
Counts with 1–9cfu/plate and 10–99cfu/plate were reported as
>102 cfu.ml−1 and >103 cfu.ml−1, respectively. Higher counts were
reported as >104 cfu.ml−1 when colonies remained separated or
>105 cfu.ml−1 when colonies fused to bacterial lawns. No bacterial
viable count was done for paper samples.
2.2 | Propidium monoazide treatment and
DNA extraction
For better accessibility of bacteria in slurries, bacteria were sepa-
rated from turbid insoluble compounds, such as minerals and pig-
ments, using density gradient centrifugation. For this, 1-ml water
samples were overlaid onto 0.3 ml of 1.6- mol.lHistodenz (Sigma-
Aldrich) in 2-ml microcentrifuge tubes and centrifuged at 10 000
rcf(relativecentrifugalforce;1rcf=9.81m.s−2)for6minwithslow
deceleration. The upper phase, including the interphase was pel-
letedinanewtubeat 10,000 rcf for 3min. For propidium mono-
azide(PMA)treatment(Nocker,Cheung, &Camper, 2006),thepel-
letwasresuspendedin0.5-mlsterilePBSandPMAaddedtoafinal
concentration of 0.05 mmol.l,placedoniceandexposedtoa500W
halogenlight source for 4mintocross-link the PMAwiththe free
DNA.Thisensures thatDNAfrom deadcellsisnotamplifiedinthe
following PCR reaction. The PMA-treated samples were then pel-
leted again. From these final pellets, DNA was isolated using the
DNeasyBlood&TissueKit(QIAGEN,Hilden,Germany)accordingto
the manufacturer’s instructions.
Toidentifythecausativebacterialcommunityforthedefectpaper,
wealso analyzedthe bacterialpopulation presentat thedefect sites
on the paper sheets. For these paper samples, DNA was isolated
using the PowerSoil®DNA IsolationKit(MOBIOLaboratories,Inc.,
Carlsbad,USA)alsoaccordingtothemanufacturer’sinstructions.
2.3 | Bacterial DNA quantification
DNAwasquantifiedbyreal-timePCRtargetingthe16SrRNAgeneas
describedpreviously(Cliffordetal.,2012).Briefly,ina25-μl final reac-
tionvolumetheprimerpairrtPCR_f(ACTCCTACGGGAGGCAGCAGT)
andrtPCR_r(TATTACCGCGGCTGCTGGC)wereused(Cliffordetal.,
2012) at 500nmol.l, 10% (v/v) of template DNA, and FastStart
SYBR Green Master Mix (Roche cat. No. 4673484001). Using the
ThermocyclerRotorGene(Qiagen) andthesequential thermalprofile
(1)10minat95°C followed by (2) 45 cycles of 20sat95°C,56°C,
and 72°C, the concentration of bacterial DNA was quantified rela-
tivetoaDNAstandardcurveconsistingofaknownconcentrationof
Escherichia coliK1genomes(approx.300016srRNAcopiesperμl).
2.4 | 16S rRNA amplicon sequencing and
data analysis
For library generation the V3 and V4 region of 16S rRNA region
wasamplified by PCR with30cycles from the extractedDNA.PCR
protocol, primer, and library generation were performed exactly as
describedby(Illumina(2013)usingMiSeqReagentKitv3600-cycles
(Illumina, San Diego CA., Cat. No. S102-3003). Data were acquired
using the MiSeqDx System MiSeq and metagenomic analysis of
the raw data was performed using the in-system software MiSeq
Reporter.Fortaxonomicclassification,theGreengenesDatabasefiles
wereused(Mc Donaldetal.,2012).InGreengenesanOTUrefers to
the terminal level at which the sequence is classified.
3 | RESULTS AND DISCUSSION
The exemplified paper mill experienced recurring problems in one of
the four paper machines (PM1). The final paper showed defects in
terms of irregular spots and holes of approximately 1 cm diameter
due to slime deposits in the web during continuous line production.
Consequently,themachinehadtobestoppedandcleanedmorefre-
quentlythantheotherpapermachines(PM2,PM3,andPM4)leading
to costly down time and maintenance. Biofilms have been described
as a reason for such slimes and consequently the resulting paper
defects(Lahtinen,Kosonen,Tiirola,Vuento,&Oker-Blom,2006).
    
|
 3 of 6
ZUMSTEG ET al.
To identify the causative bacterial community we analyzed the
bacterial population present at the paper defect site.The DNA was
isolated from the paper samples and the amount of bacterial DNA
quantifiedby 16S rDNAPCR (Table1).Allpaper samples containeda
highamount ofbacterialDNAequivalentto approximately105 to 106
Escherichia coli genomes per cm2.UsingthepurifiedDNA,thebacterial
population was further characterized and quantified by Illumina 16S
rRNA metagenomics analysis (Illumina, 2013). Interestingly, all nine
samplesanalyzedshowedtheexactsamegenusdistributionwithtwo
extraordinarily predominant genera; Tepidimonas and Chryseobacterium
(Figure2).Thesetwogenerarepresentedatleast90%(average95%)of
allclassifiedgenerainallpapersamplesanalyzed,wherebyTepidimonas
contributes byfar the majority with at least 60% (average68%). Out
of the more than 80 Chryseobacteriumspeciesthatexist (Parte,2014),
only one Chryseobacterium soli was found here. For Tepidimonas four
differentspeciesoutoffiveknowntodatewerefound(Albuquerque,
Tiago,Veríssimo,&DaCosta,2006).Tepidimonas has been associated
previously with biofilms in different paper mills (Tiirola etal., 2009).
Particularlyatearlystagesofbiofilmformation,thisgenusrepresented
more than 40% of the population as quantified by length- heterogeneity
PCR analysis of 16S rRNA (Tiirola etal., 2009). The other genus,
Chryseobacterium,andrelatedgenerafromtheBacteroideteshavebeen
identifiedbyT-RLFPinbiofilmsofpapermills(Granhalletal.,2010)and
they have been described to form slimes (Oppong, King, & Bowen,
2003). Ourdata point toward Tepidimonas spp. and Chryseobacterium
sp. as causative agents for the defects in the paper sheets. It was very
FIGURE1 Simplifiedschemeofwatercirculationinatypicalpapermachinedisplayingthethreesamplingpoints:clearfiltrate,whitewater,
and press water. Red arrows indicate sites of biocide addition. Remark: waters from the clear filtrate water tanks of all paper machines are used
for pulping
Wire sectionPress/drying section
Head
box
Pressure
screen
Mixing
pump
Mixing
chest
Disc
filter
Water
tank
Water
tank
Stock preparation
Clear
filtrate
White water
Pulp Coating
rejects
PM
rejects
Additives
(e.g.
starch)
Retains
Water
tank
Press water
Processing and tanks
TABLE1 Quantificationofbacterialcontentsinpapersamplesby
16Sreal-timePCRrelativetoastandardconsistingofgenomicDNA
equivalents of E. coliK1
Paper sample no.
Genome equivalents
cm−2
1 2·106
2 5·105
3 5·105
4 1·106
5 4·105
6 7·105
7 6·105
8 5·105
91·105FIGURE2 Bacterialpopulation,identifiedby16SrRNA
metagenomicsanalysis,atsitesofdamageinthefinalpaperofPM1
4 of 6 
|
   ZUMSTEG ET al.
surprising, though, that the bacterial diversity in the samples was
extremelylow,reducedtomainlythesetwogenera.
Astheproblemwithdefectirregularitiesonthepaperwasmainly
on PM1 (as informed bythe paper mill), we assessed the bacterial
communities in the water circulations of all paper machines to com-
pare them and identify differences. The clear filtrates are well filtered
and used to prepare the rawmaterial (e.g. pulp fiber) and, as such,
may enter the circulation of all four paper machines. The two recycled
watersfromthewiresection(whitewater)andfromthepresssection
(presswater)areturbidwatersthatare,forthemajority,recycledcon-
tinuously for wet end fiber stock preparations.
The samples taken from the recycled waters from the paper
machinesshowedamoderatebacterialcontamination,asdetermined
byculturingmethods andquantitativePCR oftotalDNA(Table2).In
additiontothetotalDNAextractionfromthewaters,wetreatedthe
samplesprior toDNAextractionwith PMAtoassess thefractionof
DNAarisingfromlivebacteria(Table2).ThePMAtreatmentremoved
thefreeDNAfromdeadcellsandreducedtheDNAvaluesmeasured
inallsamplescomparedtothetotalDNAfraction.
ThetotalandPMA-treated(live)DNAsamplesweresubsequently
used to identify and quantify the genera present in the bacterial
community (Figure3). There were only minor differences apparent
betweenthe genus diversitydetermined usingtotalDNAandPMA-
treatedDNA.Theproportionsofthegeneravariedbetweenthetwo
DNApreparationmethods,butthemaingenerashowupinbothsam-
ples,asshowninFigure3.Thenumberofabundantgenera(i.e.atleast
0.5% of all classified genera) correlates between the live and total
DNAsamplewith linearcorrelationcoefficientofR2 = 0.82. Table S2
displays the number of the abundant genera identified in the different
samples as well as the calculated Shannon’s diversity (Shannon &
Weaver,1946),evenness,andstatisticaldataoftheanalysis.
Eventhoughallsamplingswerefromthesame mill,the bacterial
diversities were, nonetheless, unique for each paper machine and
sample type. This confirms previous observations showing the unique
bacterial population in different papermachines and mills (Granhall
etal.,2010).Nevertheless,severalsimilaritiesbetweenthemachines
and samples became apparent.
The most distinct bacterial population appears in the samples
fromPM2, with membersofthe Gammaproteobacteriapredominat-
ing in all waters where the genera Pseudomonas and Azorhizophilus
aredominating. PM1,PM3, and PM4mainly harbormembers ofthe
Bacteroidetes and Betaproteobacteria. Abundant genera besides
Chryseobacterum, Tepidimonas, and Acidovorax which are discussed
below were Clostridium,Pseudomonas, andSteroidobacter. The genus
Pseudomonas is vast and consists of many environmental bacteria
that can be basically found in everyhabitat (Peix, Ramírez-Bahena,
& Velázquez, 2009). Thegenus Clostridium was mainly found in the
white water of PM3. They are anaerobic and endospore forming and
were found in diverse environments (Rodloff, 2005). Of the genus
Steroidobacter foundin PM1, only one species could be found was
Steroidobacter denitrificans. It was isolated from wastewater of a
wastewatertreatmentplant(Fahrbachetal.,2008).
Interestingly, the two genera Chryseobaterium and Tepidimonas,
identified as causative factors forbad paper quality from PM1, could
also be identified in all other paper machines. Especially in the water
cycle of PM3 and PM4 the two genera represented the majority of all
theclassifiedgenera.InPM1, thesetwo generawerea minorityinthe
two immediate recycled turbidwaters (white water and presswater).
TABLE2 Quantificationofbacterialcountsinwatersamples
ATotal viable count [cfu.cm−3]
PM1 PM2 PM3 PM4
Clear filtrate >103>103>103>104
White water >104>105>104>104
Press water >104>104>105>104
BTotal DNA [genome equivalents cm−3]
PM1 PM2 PM3 PM4
Clear filtrate 2·1034·1036·1045·103
White water 3·1043·1041·1054·104
Press water 3·1031·1045·1035·103
CPMA- treated DNA (live) [genome equivalents cm−3]
PM1 PM2 PM3 PM4
Clear filtrate 1·1033·1036·1035·103
White water 1·1042·1041·1043·103
Press water 8·1021·1043·1032·103
(A)Totalviablecountascolony-formingunits(cfu)percm3.(B)TotalbacterialDNA.(C)DNAfromlivebacteria.Forlivefraction,thesampleswerePMA-
treatedpriorDNAisolationandquantificationtoremoveDNAfromdeadbacteria.BacterialDNAwasquantifiedby16Sreal-timePCRrelativetoastand-
ardconsistingofgenomicDNAequivalentsofE. coliK1.
    
|
 5 of 6
ZUMSTEG ET al.
Onthe otherhand, theclearfiltrate,which isheavilyreducedin parti-
cles,andrepresentswaterleaving the PM1tobereused forallpaper
machines, showed predominantlythe two troubling genera. Different
possibilities could account for the seemingly contradicting results.
First,PM1experiencedmorefrequentmaintenanceperiodsduetothe
defective paper sheets. These different frequencies could influence
the bacterial population. The nearly complete absence of Tepidimonas
spp.inthewhiteand presswaterwas,however,verysurprising,as the
defect problems remained after maintenance. Even more surprising is
that although Tepidimonas spp. were the most abundant genera in slime
depositsonthepapersheets of PM1, theywere found tobepresent
inall clearfiltrates usedfor theraw materialpreparation(e.g.,pulping)
and abundantly identified in all waters of the smoothly running paper
machines PM3 and PM4. One explanation could be that Tepidimonas,
together with Chryseobacterium, growas compact biofilms and slimes
in PM1 exclusively due to an unknown trigger. This would then lead to
defectpaperdue todepositoftheslime. Whentheseslimesdislocate,
theyremainin thepaperweb.As such,by farthe majorityofbacterial
cellspresentin the biofilm (i.e., Tepidimonassp.)would be filtered out
by the paper web and not enter the white and press water. Such a trig-
ger for film formation could be the identified species Acidovorax,mainly
identified in PM1 white water. This genus was shown to be an import-
antcolonizerofthe headbox adaptedtothe availablecarbon sources
(Kashama,Prince, Simao-Beaunoir,& Beaulieu,2009)and abundantin
activatedsludge communities (Willems &Gillis,2005). It is known for
itsaggregatingabilitiesduetogenerationofanextracellularDNAmatrix
forattachment(Heijstra,Pichler,Liang,Blaza, &Turner,2009).As such
Acidovoraxsp.contributetoyoungbiofilms(Liuetal.,2012).Itisverywell
possible that Chrysobacterium sp. and Tepidimonas spp. require the extra-
cellular matrix produced by Acidovoraxsp.to generatecompactslimes,
and,as such, causethepaper defects.The bacteriacellsof Acidovorax
sp.,however,arenotpartoftheslime.ThisisconsistentwithKolarietal.
(2001)whoshowedthatBacillus sp. uses Deinococcus geothermalis as an
auxiliaryfactortoformbiofilmsin papermachines. Interestingly,some
Bacillus species then emit heat- stable metabolites in order to inhibit the
growth of Deinococcus geothermalis. This could explain that we did not
find Acidovorax sp. in our samples as it was suppressed by the two later
colonizers.AnotherexplanationisthatAcidovoraxsp.,asaprimarycolo-
nizerispresentinPM1duetothemorefrequentmaintenancesandthat
the trigger for the biofilm formation is due to another factor.
Althoughthis study offersan overviewof thelikelycontributory
bacterial factors in slime formation, besides not investigating repli-
catesamples,avitalremainingfactoralsonotinvestigatedhereisthe
substrate and environment upon which the slime is formed. Surface
morphology,surface chemistry,and physicalconditionssuch as nor-
mally stagnant regions in water flows occasionally exposed to shear
flowand/orpresenceofvibrationencouragingdetachment,aswellas
oxygenationand moisture levels, exposure to biocide concentration
variations,etc.,allcontributetotheimpactofbiofilmandslimeinsen-
sitive processes such as papermaking.
FIGURE3 Bacterialpopulation,
identifiedby16SrRNAmetagenomics
analysis,inprocesswatersofthefour
differentpapermachines(PM1-PM4)
located at the same paper plant. For each
sample,thetotal bacterial population and
thePMA-treatedfraction,representingthe
livebacterialpopulation,werequantified
6 of 6 
|
   ZUMSTEG ET al.
As a conclusion we can saythat as Tepidimonas spp. was found
inallpapermachines, thedevelopmentofproblematicslimesisobvi-
ously not only dependent on the mere presence of given bacteria in a
system.Auxiliaryfactorsgeneratingthe necessaryenvironment,pos-
siblyotherbacterialspecies,canbeasimportant.Athoroughprocess
analysis for the bacterial communities present helps to shed light on
criticalfactorscontrollingslimeformation.Inthepresentcase,target-
ing Chrysobacterium sp. and Tepidimonas spp. would bring little success
astheyarepresentinallpapermachines,andevenintheclearfiltrate.
However,theestablishedbacterialpopulationattheprocessstepsis
indicators for the given environmental conditions. Such differences
asseenbetweenthepaper machines (PM1-4) are recommendedas
the points of action to change the environmental conditions for the
good(e.g.aeration,stirringadaption).Thesuccessofmodificationsto
a favorable microbial community and environment can again be fol-
lowed by population analysis.
ACKNOWLEDGMENTS
We thank the unnamed paper mill for sharing samples and information.
CONFLICT OF INTEREST
No conflict of interest declared.
REFERENCES
Albuquerque, L., Tiago, I., Veríssimo, A., & Da Costa, M. S. (2006).
Tepidimonasthermarumsp.nov.,anewslightlythermophilicbetapro-
teobacteriumisolatedfrom the Elisenquelle inAachen and emended
description of the genus Tepidimonas. Systematic and Applied
Microbiology,29,450–456.
Blanco,M. A.,Negro, C., Gaspar,I., &Tijero,J.(1996). Slime problemsin
the paper and board industry. Applied Microbiology and Biotechnology,
46,203–208.
Blanco, A., Negro, C., Monte, C., Fuente, E., & Tijero, J. (2004). The
challenges of sustainable papermaking. Environmental Science and
Technology,38,414A–420A.
Clifford,R.J.,Milillo,M.,Prestwood,J.,Quintero,R.,Zurawski,D.V.,Kwak,
Y.I.,…McGann,P.(2012).Detectionofbacterial16SrRNAandiden-
tification of four clinically important bacteria by real- time PCR. PLoS
ONE,7,e48558.
Parte,A. C.(2014).LPSN—list ofprokaryoticnameswithstanding in no-
menclature. Nucleic Acids Research,42,D613–D616.doi:10.1093/nar/
gkt1111.
Fahrbach, M., Kuever, J., Remesch, M., Huber, B. E., Kämpfer, P., Dott,
W., & Hollender, J. (2008). Steroidobacter denitrificans gen. nov.,
sp. nov., a steroidal hormone-degrading gammaproteobacterium.
International Journal of Systematic and Evolutionary Microbiology, 58,
2215–2223.
Granhall, U.,Welsh, A., Throback,I. N., Hjort, K., Hansson, M., & Hallin,
S.(2010).Bacterial communitydiversityin papermillsprocessing re-
cycled paper. Journal of Industrial Microbiology and Biotechnology,37,
1061–1069.
Heijstra,B. D.,Pichler,F.B., Liang, Q.,Blaza, R.G., &Turner,S.J. (2009).
Extracellular DNA and Type IV pili mediate surface attachment by
Acidovoraxtemperans.Antonie van Leeuwenhoek,95,343–349.
Illumina. (2013). 16S Metagenomic Sequencing Library Preparation.
SanDiego,CA:Illumina.
Kashama, J., Prince, V., Simao-Beaunoir, A. M., & Beaulieu, C. (2009).
Carbonutilizationprofilesofbacteriacolonizingtheheadboxwaterof
two paper machines in a Canadian mill. Journal of Industrial Microbiology
and Biotechnology,36,391–399.
Kolari, M. (2007). Papermachine microbiology. In R. ALEN(ed.),In paper
making chemistry. Jyväskylä Finland: Finnisch Paper Engineers’
Association/PaperijaPuuOy.
Kolari, M., Nuutinen,J., Rainey, F.A., & Salkinoja-Salonen, M. S. (2003).
Colored moderately thermophilic bacteria in paper- machine biofilms.
Journal of Industrial Microbiology and Biotechnology,30,225–238.
Kolari, M., Nuutinen, J.,& Salkinoja-Salonen, M. S. (2001). Mechanisms
of biofilm formation in paper machine by Bacillus species: The role
of Deinococcus geothermalis. Journal of Industrial Microbiology and
Biotechnology,27,343–351.
Lahtinen,T.,Kosonen,M.,Tiirola,M.,Vuento,M.,&Oker-Blom,C.(2006).
Diversity of bacteria contaminating paper machines. Journal of Industrial
Microbiology and Biotechnology,33,734–740.
Liu,R.,Yu,Z.,Guo,H.,Liu,M.,Zhang,H.,&Yang,M.(2012).Pyrosequencing
analysis of eukaryotic and bacterial communities in faucet biofilms.
Science of the Total Environment,435–436,124–131.
McDonald, D.,Price, M. N.,Goodrich, J.,Nawrocki,E.P.,Desantis,T.Z.,
Probst,A., …Hugenholtz,P.(2012). AnimprovedGreengenestaxon-
omy with explicit ranks for ecological and evolutionary analyses of bac-
teria and archaea. ISME Journal,6,610–618.
Nocker,A.,Cheung,C.-Y.,&Camper,A. K.(2006). Comparisonofpropid-
iummonoazidewithethidium monoazidefordifferentiationoflivevs.
deadbacteriabyselectiveremovalofDNAfromdeadcells.Journal of
Microbiological Methods,67,310–320.
Oppong, D.,King, V. M., & Bowen,J. A. (2003). Isolation and character-
ization of filamentous bacteria from paper mill slimes. International
Biodeterioration & Biodegradation,52,53–62.
Peix, A., Ramírez-Bahena, M.-H., & Velázquez, E. (2009). Historical evo-
lution and current status of the taxonomy of genus Pseudomonas.
Infection, Genetics and Evolution,9,1132–1147.
Rodloff, A. C. (2005). Obligat anaerobe sporenbildende Stäbchen
(Clostridien).In H. Hahn, D. Falke,S. H. E. Kaufmann & U. Ullmann,
(eds.) Medizinische Mikrobiologie und Infektiologie. Berlin, Heidelberg:
Springer Berlin Heidelberg.
Shannon, C. E., & Weaver, W. J. (1946). The Mathematical Theory of
Communication.Urbana:UniversityofIllinoisPress.
Tiirola, M., Lahtinen, T., Vuento, M., & Oker-Blom, C. (2009). Earlysuc-
cession of bacterial biofilms in paper machines. Journal of Industrial
Microbiology and Biotechnology,36,929–937.
Vaisanen, O. M.,Weber, A., Bennasar,A., Rainey, F.A., Busse, H. J., &
Salkinoja-Salonen, M. S. (1998). Microbial communities of printing
paper machines. Journal of Applied Microbiology,84,1069–1084.
Willems,A.,&Gillis, M.(2005).Genus II.Acidovorax.InG.M. Garrity,D.
J.Brenner,N.R.Krieg,J.T.Staley&D.H.Bergey,(eds.)Bergey’s man-
ual of systematic bacteriology/Vol. 2 The proteobacteria/Don J. Brenner,
Noel R. Krieg, James T. Staley, editors, volume two. 2nd ed ed. New York:
Springer.
SUPPORTING INFORMATION
Additional Supporting Informationmay be found online in the sup-
porting information tab for this article.
How to cite this article:ZumstegA,UrwylerSK,GlaubitzJ.
Characterizingbacterialcommunitiesinpaperproduction—
troublemakers revealed. MicrobiologyOpen. 2017;00:e487.
https://doi.org/10.1002/mbo3.487
... We asked whether biofilm α ( Figure 1) was associated with an increase in the abundance of biofilm formers, while biofilms β1 and β2 ( Figure 1) were associated with a reduction in the number of biofilm formers. The bacterial genera with higher abundance in response to anti-tick immunity include the strong biofilm formers Mycobacterium [36], Tepidimonas [37], Rothia [38] and Leuconostoc [39], whereas A. phagocytophilum infection and antimicrobial peptide reduced the presence of the biofilm formers Gracilibacteria [40] and Enterococcus [3], respectively. ...
... We asked whether biofilm α (Figure 1) was associated with an increase in the abundance of biofilm formers, while biofilms β1 and β2 ( Figure 1) were associated with a reduction in the number of biofilm formers. The bacterial genera with higher abundance in response to anti-tick immunity include the strong biofilm formers Mycobacterium [36], Tepidimonas [37], Rothia [38] and Leuconostoc [39], whereas A. phagocytophilum infection and antimicrobial peptide reduced the presence of the biofilm formers Gracilibacteria [40] and Enterococcus [3], respectively. ...
Article
Full-text available
Ixodes scapularis ticks harbor microbial communities including pathogenic and non-pathogenic microbes. Pathogen infection increases the expression of several tick gut proteins, which disturb the tick gut microbiota and impact bacterial biofilm formation. Anaplasma phagocytophilum induces ticks to express I. scapularis antifreeze glycoprotein (IAFGP), a protein with antimicrobial activity, while Borrelia burgdorferi induces the expression of PIXR. Here, we tested the resistance of I. scapularis microbiome to A. phagocytophilum infection, antimicrobial peptide IAFGP, and anti-tick immunity specific to PIXR. We demonstrate that A. phagocytophilum infection and IAFGP affect the taxonomic composition and taxa co-occurrence networks, but had limited impact on the functional traits of tick microbiome. In contrast, anti-tick immunity disturbed the taxonomic composition and the functional profile of tick microbiome, by increasing both the taxonomic and pathways diversity. Mechanistically, we show that anti-tick immunity increases the representation and importance of the polysaccharide biosynthesis pathways involved in biofilm formation, while these pathways are under-represented in the microbiome of ticks infected by A. phagocytophilum or exposed to IAFGP. These analyses revealed that tick microbiota is highly sensitive to anti-tick immunity, while it is less sensitive to pathogen infection and antimicrobial peptides. Results suggest that biofilm formation may be a defensive response of tick microbiome to anti-tick immunity.
... We asked whether biofilm α ( Figure 1) was associated with an increase in the abundance of biofilm formers, while biofilms β1 and β2 ( Figure 1) were associated with a reduction in the number of biofilm formers. The bacterial genera with higher abundance in response to anti-tick immunity include the strong biofilm formers Mycobacterium [36], Tepidimonas [37], Rothia [38] and Leuconostoc [39], whereas A. phagocytophilum infection and antimicrobial peptide reduced the presence of the biofilm formers Gracilibacteria [40] and Enterococcus [3], respectively. ...
... We asked whether biofilm α (Figure 1) was associated with an increase in the abundance of biofilm formers, while biofilms β1 and β2 ( Figure 1) were associated with a reduction in the number of biofilm formers. The bacterial genera with higher abundance in response to anti-tick immunity include the strong biofilm formers Mycobacterium [36], Tepidimonas [37], Rothia [38] and Leuconostoc [39], whereas A. phagocytophilum infection and antimicrobial peptide reduced the presence of the biofilm formers Gracilibacteria [40] and Enterococcus [3], respectively. ...
Preprint
Background: Ixodes scapularis ticks harbor microbial communities including pathogenic and non-pathogenic microbes. Pathogen infection increases the expression of several tick gut proteins which disturb the tick gut microbiota and impact bacterial biofilm formation. Anaplasma phagocytophilum induces ticks to express I. scapularis IAFGP, a protein with antimicrobial activity while Borrelia burgdorferi induces the expression of PIXR. Here, we tested the resistance of I. scapularis microbiome to A. phagocytophilum infection, antimicrobial peptide IAFGP, and anti-tick immunity specific to PIXR. Results: We demonstrate that A. phagocytophilum infection and IAFGP affect the taxonomic composition and taxa co-occurrence networks but had no effect on the functional traits of tick microbiome. In contrast, anti-tick immunity disturbed the taxonomic composition and the functional profile of tick microbiome, by increasing both taxonomic and pathways diversity. Mechanistically, we show that anti-tick immunity increases the representation and importance of polysaccharide biosynthesis pathways involved in biofilm formation while these pathways are under-represented in the microbiome of ticks infected by A. phagocytophilum or exposed to IAFGP. Conclusions: These analyses revealed that tick microbiota is highly sensitive to anti-tick immunity, while it is less sensitive to pathogen infection and antimicrobial peptides. Results suggest that biofilm formation is a defensive response of tick microbiome to anti-tick immunity.
... Most antibiotics are derived from Actinomycetes, a soil bacterial group (Genilloud, 2017). They are also used to produce industrial enzymes involved in improving detergent quality, cleaning toxic waste, in the processing of paper and pulp, and in the fashion industry (Zumsteg et al., 2017;De Menezes et al., 2021;Intasian et al., 2021;Mazotto et al., 2021). Furthermore, microorganisms and their enzymes/metabolites are also exploited globally for remediation of several xenobiotic compounds and emerging pollutants under different environmental conditions, being used in wastewater treatment to decompose organic matter in sewage as to well as to generate biofuels such as biogas or bioethanol and for oil extraction (Singh et al., 2016;Amadu et al., 2020;Amin et al., 2020;Arias et al., 2021;Zhang et al., 2021;Ahmad et al., 2022). ...
Article
Full-text available
Microorganisms are an important component of the ecosystem and have an enormous impact on human lives. Moreover, microorganisms are considered to have desirable effects on other co-existing species in a variety of habitats, such as agriculture and industries. In this way, they also have enormous environmental applications. Hence, collections of microorganisms with specific traits are a crucial step in developing new technologies to harness the microbial potential. Microbial culture collections (MCCs) are a repository for the preservation of a large variety of microbial species distributed throughout the world. In this context, culture collections (CCs) and microbial biological resource centres (mBRCs) are vital for the safeguarding and circulation of biological resources, as well as for the progress of the life sciences. Ex situ conservation of microorganisms tagged with specific traits in the collections is the crucial step in developing new technologies to harness their potential. Type strains are mainly used in taxonomic study, whereas reference strains are used for agricultural, biotechnological, pharmaceutical research and commercial work. Despite the tremendous potential in microbiological research, little effort has been made in the true sense to harness the potential of conserved microorganisms. This review highlights (1) the importance of available global microbial collections for man and (2) the use of these resources in different research and applications in agriculture, biotechnology, and industry. In addition, an extensive literature survey was carried out on preserved microorganisms from different collection centres using the Web of Science (WoS) and SCOPUS. This review also emphasizes knowledge gaps and future perspectives. Finally, this study provides a critical analysis of the current and future roles of microorganisms available in culture collections for different sustainable agricultural and industrial applications. This work highlights target-specific potential microbial strains that have multiple important metabolic and genetic traits for future research and use.
... Such migration can be overcome by the use of functional barriers between recycled packaging paper and food (Johansson, et al., 2001). Flemming, Meier and Schild (2013) and Zumsteg, Urwyler and Glaubitz (2017) showed the presence of microbial contamination in paper production, which may lead to economic losses, deterioration of raw materials and lowering product quality. ...
Article
Full-text available
In order to increase the sustainability of paper or board production, it is desirable to use recycled fibers as much as possible. Microorganisms are in a smaller or higher amount present on the surface of paper or paperboard, so they are also present in the paper pulp or on the cellulose fibers. The purity of the mentioned fibers is important for obtaining a quality raw material that is health conforming. The aim of this study is to determine the microbiological quality of recycled fibers obtained by recycling of paper and paperboard intended for the manufacture of packaging products. Samples were in an average microbiological environment without food exposure. Quality of recycled fibers was studied through the total number of bacteria and determined for different recycled samples. The total number of microorganisms was estimated by both the disintegration and smear method. Results showed that only the disin- tegration method was suitable for the evaluation since the smear method did not produce any results. Moreover, the disintegration method was suitable only for the determination of bacteria alone, since no growth of molds or yeast occurred. In addition, the influence of paper composition, paperboard coatings and recycling methods on bacterial growth is demonstrated. The number of bacteria obtained on recycled fibers is affected by the presence of nanopar- ticles in coatings (Zn, Si and Al), as well as by the presence of different components in the base paper.
... Pulp and paper industries use large amounts of water, providing good conditions for microbial proliferation, and consequent biofouling development [40,41]. Related-biofouling concerns comprise undesired odour alterations (production of volatile substances), discolouration, loss of paper quality, possibility of explosions by formation of methane and hydrogen via anaerobic metabolism, and aerosol spread of pathogens [40]. ...
Article
Biofouling is the unwanted accumulation of deposits on surfaces, composed by organic and inorganic particles and (micro)organisms. Its occurrence in industrial equipment is responsible for several drawbacks related to operation and maintenance costs, reduction of process safety and product quality, and putative outbreaks of pathogens. The understanding on the role of operating conditions in biofouling development highlights the hydrodynamic conditions as key parameter. In general, (bio)fouling occurs in a higher extension when laminar flow conditions are used. However, the characteristics and resilience of biofouling are highly dependent on the hydrodynamic conditions under which it is developed, with turbulent conditions being associated to recalcitrant biodeposits. In industrial settings like heat exchangers, fluid distribution networks and stirred tanks, hydrodynamics play a dual function, affecting the process effectiveness while favouring biofouling formation. This review summarizes the hydrodynamics played in conventional industrial settings and provides an overview on the relevance of hydrodynamic conditions in biofouling development as well as in the effectiveness of industrial processes.
... Bacteria growing as a biofilm are more tolerant of the presence of toxic compounds [1,2] and predation by protists [3,4], and exhibit increased persistence during infection due to antimicrobial tolerance [5,6] and the ability to evade the host immune response [7,8]. As a result, biofilm formation is linked not only to chronic bacterial infection in humans [9] [10], and plants and animals of economic importance [11][12][13], but also to the contamination of industrial facilities involved in processing food [14,15], and pulp and paper [16]. ...
Article
Full-text available
Our understanding of the biofilm matrix components utilized by Gram-positive bacteria, and the signalling pathways that regulate their production are largely unknown. In a companion study, we developed a computational pipeline for the unbiased identification of homologous bacterial operons and applied this algorithm to the analysis of synthase-dependent exopolysaccharide biosynthetic systems. Here, we explore the finding that many species of Gram-positive bacteria have operons with similarity to the Pseudomonas aeruginosa pel locus. Our characterization of the pelDEADAFG operon from Bacillus cereus ATCC 10987, presented herein, demonstrates that this locus is required for biofilm formation and produces a polysaccharide structurally similar to Pel. We show that the degenerate GGDEF domain of the B. cereus PelD ortholog binds cyclic-3’,5’-dimeric guanosine monophosphate (c-di-GMP), and that this binding is required for biofilm formation. Finally, we identify a diguanylate cyclase, CdgF, and a c-di-GMP phosphodiesterase, CdgE, that reciprocally regulate the production of Pel. The discovery of this novel c-di-GMP regulatory circuit significantly contributes to our limited understanding of c-di-GMP signalling in Gram-positive organisms. Furthermore, conservation of the core pelDEADAFG locus amongst many species of bacilli, clostridia, streptococci, and actinobacteria suggests that Pel may be a common biofilm matrix component in many Gram-positive bacteria.
Article
The pesticide atrazine poses a potential threat to the health of frogs living in farmland areas. The exposure concentration in traditional pesticide experiments is usually constant, while pesticide pollution in actual water may fluctuate due to periodic or seasonal application. We examined the effects of different concentrations of atrazine (50, 100 and 500 μg/L) over a 14-day exposure and a 7-day recovery on intestinal histology, bacterial composition and intestinal metabolites of male Pelophylax nigromaculatus. HE staining revealed that after a 14-day atrazine exposure, the 100 μg/L and 500 μg/L groups showed obvious cysts and significantly decreased intestinal crypt depth and villus height. After a 7-day recovery, the damaged intestine in the 100 μg/L group was partially recovered, while in the 500 μg/L exposure group there was no improvement. 16S rRNA gene analysis of intestinal bacteria showed that 500 μg/L atrazine exposure significantly caused a persistent decrease in bacterial α diversity. Compared to the control and other atrazine exposure groups, the 500 μg/L group showed significant changes in the relative abundance of predominant bacteria. In addition, most dominant bacteria in the 500 μg/L recovery group showed significant differences with the 50 μg/L and 100 μg/L recovery groups. Nontargeted metabolomics profiling based on UPLC/MS analysis showed that atrazine exposure and recovery induced changes in the intestinal metabolic profile. The changes in metabolites were mainly related to purine/pyrimidine metabolism, glycine, serine and threonine metabolism, and arginine and proline metabolism. In general, these pathways were closely related to energy metabolism and amino acid metabolism. These results suggest that the short-term exposure to 500 μg/L atrazine causes persistent harm to intestinal health. This study is an important step toward a better understanding of the toxic effects of atrazine exposure and recovery in frog intestines.
Article
The bacterial diversity in terms of structure and community profile, with special reference to water quality in the wastewater treatment plant of Indian paper industries, is poorly understood. In the present work, characterization of bacterial diversity using 16S (V3-V4 region) rRNA gene amplicon sequencing data with reference to physicochemical parameters in the wastewater treatment plant of two paper industries has been carried out. Amplicon data analysis revealed the presence of bacterial taxa belonging to the phylum such as Bacteroidetes, Proteobacteria, Patescibacteria, Firmicutes, Actinobacteria, etc. Further, taxonomic classification upto genus level and functional analysis data indicated that genera such as Cloacibacterium, Aerococcus, Chryseobacterium, Microbacterium, Acinetobacter, Sphingobium, etc., were involved in the predicted metabolic pathways like carbohydrate metabolism, fatty acid and aromatic compounds biosynthesis as well as degradation. Canonical correspondence analysis confirmed a significant correlation between the microbial pollutions loads and physicochemical parameters. Further, the chemical oxygen demand, biochemical oxygen demand and total suspended solids exceeded the acceptable limits prescribed by Central Pollution Control Board New Delhi, Government of India, for discharge of wastewater. This study finds the correlation between the bacterial community residing in the polluted water of wastewater treatment plant and their environmental preferences. The presence of these bacterial diversity in the wastewater treatment plant of paper industries may affect the maintenance as well as paper quality. In future, it will provide a benchmark for the better understanding and management of wastewater treatment plant in paper industries across the globe.
Article
This study evaluated the fouling development of membrane distillation (MD) when treating different feed waters were taken from three local water bodies: Xuanwu Lake, Nan Lake and Qinhuai River. Trends of flux decline could be divided into three phases including a similar rapid decline in first phase, a slow decline in phase II, while significant difference was observed in the last phase. It could be seen that inorganic matters in feed waters had some influences on the attachment of salt crystals to membrane, mainly in the form of CaCO3. Furthermore, the biovolume exhibited little difference but the amount of extracellular polymeric substances (EPS) was distinct in the three systems. 16S rRNA revealed that although the microbial communities in feed waters had different structures, they on-membrane microbes shared the same dominant communities in the early stage due to the same growth environment including Tepidimonas, Meiothermus, OLB14_norank, Env.OPS 17_norank and Schlegelella with a relatively stable proportion of 63.5%-68.0%. However, at the later operational phase, the bacteria composition was changed with community succession, and Armatimonadetes_norank, Hydrogenophilaceae_uncultured and Methyloversatilis respectively thrived on the three scaling membrane surfaces which was correlated with the concentration of feed water, resulting the influence of inorganic substances on microbial growth was enhanced. A result obviously suggested that bacteria had great influence on the degree of flux decline due to their structure and property, especially at the later operational phase. It would be helpful to explore the structure and potential function of dominant communities on membranes and provide basic theory for the treatment of microbial pollution.
Article
Full-text available
The contribution of the biofilm extracellular polymeric substance (EPS) matrix to reduced antimicrobial susceptibility in biofilms is widely recognised. As such, the direct targeting of the EPS matrix is a promising biofilm control strategy that allows for the disruption of the matrix, thereby allowing a subsequent increase in susceptibility to antimicrobial agents. To this end, surface-functionalized nanoparticles (NPs) have received considerable attention. However, the fundamental understanding of the interactions occurring between engineered NPs and the biofilm EPS matrix has not yet been fully elucidated. An insight into the underlying mechanisms involved when a NP interacts with the EPS matrix will aid in the design of more efficient NPs for biofilm control. Here we demonstrate the use of highly specific fluorescent probes in confocal laser scanning microscopy (CLSM) to illustrate the distribution of EPS macromolecules within the biofilm. Thereafter, a three-dimensional (3D) colocalization analysis was used to assess the affinity of differently functionalized silica NPs (SiNPs) and EPS macromolecules from Pseudomonas fluorescens biofilms. Results show that both the charge and surface functional groups of SiNPs dramatically affected the extent to which SiNPs interacted and localized with EPS macromolecules, including proteins, polysaccharides and DNA. Hypotheses are also presented about the possible physicochemical interactions which may be dominant in EPS matrix-NP interactions. This research not only develops an innovative CLSM-based methodology for elucidating biofilm-nanoparticle interactions but also provides a platform on which to build more efficient NP systems for biofilm control.
Article
Full-text available
The List of Prokaryotic Names with Standing in Nomenclature (LPSN; http://www.bacterio.net) is a database that lists the names of prokaryotes (Bacteria and Archaea) that have been validly published in the International Journal of Systematic and Evolutionary Microbiology directly or by inclusion in a Validation List, under the Rules of International Code of Nomenclature of Bacteria. Currently there are 15 974 taxa listed. In addition, LPSN has an up-to-date classification of prokaryotes and information on prokaryotic nomenclature and culture collections.
Article
Full-text available
Within the paradigm of clinical infectious disease research, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa represent the four most clinically relevant, and hence most extensively studied bacteria. Current culture-based methods for identifying these organisms are slow and cumbersome, and there is increasing need for more rapid and accurate molecular detection methods. Using bioinformatic tools, 962,279 bacterial 16S rRNA gene sequences were aligned, and regions of homology were selected to generate a set of real-time PCR primers that target 93.6% of all bacterial 16S rRNA sequences published to date. A set of four species-specific real-time PCR primer pairs were also designed, capable of detecting less than 100 genome copies of A. baumannii, E. coli, K. pneumoniae, and P. aeruginosa. All primers were tested for specificity in vitro against 50 species of Gram-positive and -negative bacteria. Additionally, the species-specific primers were tested against a panel of 200 clinical isolates of each species, randomly selected from a large repository of clinical isolates from diverse areas and sources. A comparison of culture and real-time PCR demonstrated 100% concordance. The primers were incorporated into a rapid assay capable of positive identification from plate or broth cultures in less than 90 minutes. Furthermore, our data demonstrate that current targets, such as the uidA gene in E.coli, are not suitable as species-specific genes due to sequence variation. The assay described herein is rapid, cost-effective and accurate, and can be easily incorporated into any research laboratory capable of real-time PCR.
Article
Full-text available
Reference phylogenies are crucial for providing a taxonomic framework for interpretation of marker gene and metagenomic surveys, which continue to reveal novel species at a remarkable rate. Greengenes is a dedicated full-length 16S rRNA gene database that provides users with a curated taxonomy based on de novo tree inference. We developed a 'taxonomy to tree' approach for transferring group names from an existing taxonomy to a tree topology, and used it to apply the Greengenes, National Center for Biotechnology Information (NCBI) and cyanoDB (Cyanobacteria only) taxonomies to a de novo tree comprising 408,315 sequences. We also incorporated explicit rank information provided by the NCBI taxonomy to group names (by prefixing rank designations) for better user orientation and classification consistency. The resulting merged taxonomy improved the classification of 75% of the sequences by one or more ranks relative to the original NCBI taxonomy with the most pronounced improvements occurring in under-classified environmental sequences. We also assessed candidate phyla (divisions) currently defined by NCBI and present recommendations for consolidation of 34 redundantly named groups. All intermediate results from the pipeline, which includes tree inference, jackknifing and transfer of a donor taxonomy to a recipient tree (tax2tree) are available for download. The improved Greengenes taxonomy should provide important infrastructure for a wide range of megasequencing projects studying ecosystems on scales ranging from our own bodies (the Human Microbiome Project) to the entire planet (the Earth Microbiome Project). The implementation of the software can be obtained from http://sourceforge.net/projects/tax2tree/.
Chapter
Obligat anaerobe, grampositive Stäbchen, die Endosporen bilden, wurden bisher in der Gattung Clostridium zusammengefasst (◘ Tab. 39.1). Aufgrund neuerer molekularbiologischer Untersuchungen sind weitere Gattungen etabliert worden (z. B. Propionispora, Anaerosporobacter, Propionivibrio; ◘ Tab. 39.2), die jedoch in der Infektionsmedizin bisher nicht verankert sind. Clostridien sind in der Natur ubiquitär verbreitet und häufig im Intestinaltrakt des Menschen zu finden. Durch Clostridien (gr. »closter«: Spindel) hervorgerufene Erkrankungen waren bereits im Altertum bekannt. Sie verursachen eine Reihe schwerer Krankheitsbilder, z. B. Botulismus, Tetanus und Gasbrand (Clostridienmyositis), können aber auch an eiterbildenden Infektionen beteiligt sein oder intestinale Infektionen hervorrufen, z. B. die antibiotikaassoziierte Diarrhö, die pseudomembranöse Kolitis und das toxische Megakolon (◘ Tab. 39.3).
Article
In order to understand the microbial communities in drinking water biofilms, both eukaryotic and bacterial communities in three faucet biofilms were characterized by 454 pyrosequencing and quantitative PCR approaches. Microbial assemblages of the biofilms were dominated by bacteria, with Sphingomonadales, Rhizobiales, and Burkholderiales comprising the major bacterial populations. Although about 2years of biofilm development occurred, the microbial community at site WSW still demonstrates the characteristics of a young biofilm community, e.g. low biomass, abundant aggregating bacteria (Blastomonas spp. and Acidovorax spp.) etc. Hartmannella of amoebae was the dominant eukaryotic predator in the biofilms, and correlated closely with biofilm bacterial biomass. Nonetheless, there was no obvious association of pathogens with amoebae in the faucet biofilms. In contrast, residual chlorine seems to be a dominant factor impacting the abundance of Legionella and Mycobacterium, two primary potential opportunistic pathogens detected in all faucet biofilms.
Chapter
Obligat anaerobe grampositive Stäbchen, die Endosporen bilden, sind in der Gattung Clostridium zusammengefaßt. Sie sind in der Natur ubiquitär verbreitet und auch häufig im Intestinaltrakt des Menschen zu finden.
Article
 The latest trends in the paper industry have been towards manufacturing by a neutral or alkaline process, greater consumption of secondary fibres and the closing-up of the process water systems. Under these conditions of papermaking, the problems of deposits, corrosion and odours due to the microbiological activity increase considerably and therefore, runnability and production problems occur. To help our understanding of the current situation in the paper industry, this paper presents a review of the microorganism sources, the consequences of the microbiological activity upon the actual systems of manufacturing paper and board, and the current state of the different alternatives for its prevention and control, as well as the future trends to address environmental considerations.
Article
The composition of filamentous bacteria in paper machine systems has received little scientific scrutiny, even though these organisms have been associated with many problems that affect machine efficiency and paper quality. The objective of the study was to isolate and characterize filamentous bacteria in paper mill slimes using conventional microbiological techniques, fatty acid methyl ester (FAME) analysis, and 16S rRNA gene sequencing. Filamentous or long, thread-like bacteria from different genera were observed. Pink or red-pigmented filamentous bacteria identified as Flectobacillus sp. were commonly isolated from pink slime deposits, but they were also obtained from deposits that did not appear pink or red. Two organisms had certain characteristics that were different from similar organisms previously described. One was a Gram-negative, filamentous bacterium with golden yellow colonies. This organism was esculin positive, and hydrolyzed starch but did not produce hydrogen sulfide. A BLAST search of GenBank database produced an identity of 92% with Cytophaga sp. or Flavobacterium columnare. A Gram-positive bacterium that produced very long or filamentous structures was also observed. On tryptic soy agar, this organism produced yellow colonies, but on plate count agar, the colonies were white. The plate count agar-grown cells were atypical with many of them having bulbs either in the middle or at the ends of the cell. In indole nitrite broth, the organism produced a very extensive filamentous structure. The FAME and 16S rRNA gene analyses of this organism showed that the organism was a Bacillus sp., but no spores were produced in any of the media studied, including a sporulating medium. Various spore-formers, identified as Bacillus psychrophilus and Paenibacillus sp., also had long continuous chains of cells. Two species of Chryseobacterium produced long filaments. Actinomycetes with branched mycelia and identified as Norcardiopsis alba and Streptomyces albidoflavus were isolated from wet lap pulp samples. These actinomycetes produced a very strong earthy odor both in culture and in field samples. Information, such as growth requirements and presence or absence of endospores, gained about these organisms will help in their control.