ArticlePDF Available

A new family, Pervetustaceae with a new genus, Pervetustus , and P. simplex sp. nov. (Paraglomerales), and a new genus, Innospora with I. majewskii comb. nov. (Paraglomeraceae) in the Glomeromycotina

Authors:

Abstract and Figures

A new arbuscular mycorrhizal, Paraglomus-like, fungal species (Glomeromycotina) was found and propagated in single-species cultures established from spores coming from Oman, Greece, Tunisia, and New Caledonia. The hyaline spores of the fungus are small, 17-67 μm diam. when globose. Their spore wall consists of an evanescent, 1.0-2.3 μm thick, short-lived outer layer and a laminate, smooth, 3.8-7.3 μm thick inner layer, of which none shows amyloid or dextrinoid reaction in Melzer’s reagent. Mycorrhizal structures (arbuscules and hyphae without vesicles) of the fungus stained slightly in Trypan blue, thus like those of the formerly described Paraglomus spp., in which the histochemical feature has been recognized. However, in the phylogenies gained from analyses of nrDNA sequences, the fungus formed a distinct lineage in a basal position relative to and highly diverged from that with P. majewskii and that with the other Paraglomus spp. of known molecular phylogeny. Comparisons of similarity of sequences and the spore wall structure of the new fungus with those of P. majewskii and the other Paraglomus spp. and the positions of clades of the three taxa relative to those of the other taxa of the Glomeromycotina suggested transferring P. majewskii to a new genus in the Paraglomeraceae and describing the new fungus as a new species of a new genus in a new family of the order Paraglomerales. © 2017 J. Cramer in Gebr. Borntraeger Verlagsbuchhandlung, Stuttgart, Germany.
Content may be subject to copyright.
397
© 2017 J. Cramer in Gebr. Borntraeger Verlagsbuchhandlung, Stuttgart, www.borntraeger-cramer.de
Germany. DOI: 10.1127/nova_hedwigia/2017/0419 0029-5035/2017/0419 $ 3.50
Nova Hedwigia Vol. 105 (2017) Issue 3–4, 397–410
published online April 24, 2017; published in print November 2017 Article
C
A new family, Pervetustaceae with a new genus,
Pervetustus, and P. simplex sp. nov. (Paraglomerales),
and a new genus, Innospora with I. majewskii comb. nov.
(Paraglomeraceae) in the Glomeromycotina
Janusz Błaszkowski1*, Anna Kozłowska1, Thomas Crossay2, Sarah
Symanczik3 and Mohamed N. Al-Yahya’ei4
1 Department of Ecology, Protection and Shaping of Environment, West Pomeranian
 UniversityofTechnologyinSzczecin,Słowackiego17,PL-71434Szczecin,Poland
2LaboratoireduVivantetdelEnvironnement(LIVE)UniversityofNewCaledoniaBP
 R4,AveJamesCook,Noumea98851,Nouvelle-Calédonie
3DepartmentofSoilSciences,ResearchInstituteofOrganicAgriculture,
 Ackerstrasse113,CH-5070Frick,Switzerland
4DepartmentofAridlandAgriculture,CollegeofFoodandAgriculture,UnitedArab
 EmiratesUniversity(UAEU),POBox15551,AlAin,UAE
With11gures
Abstract: A new arbuscular mycorrhizal, Paraglomus-like, fungal species (Glomeromycotina) was
found and propagated in single-species cultures established from spores coming from Oman, Greece,
Tunisia, and New Caledonia. The hyaline spores of the fungus are small, 17–67 µm diam. when
globose. Their spore wall consists of an evanescent, 1.0–2.3 µm thick, short-lived outer layer and a
laminate, smooth, 3.8–7.3 µm thick inner layer, of which none shows amyloid or dextrinoid reaction
in Melzer’s reagent. Mycorrhizal structures (arbuscules and hyphae without vesicles) of the fungus
stained slightly in Trypan blue, thus like those of the formerly described Paraglomus spp., in which
the histochemical feature has been recognized. However, in the phylogenies gained from analyses
of nrDNA sequences, the fungus formed a distinct lineage in a basal position relative to and highly
diverged from that with P. majewskii and that with the other Paraglomus spp. of known molecular
phylogeny. Comparisons of similarity of sequences and the spore wall structure of the new fungus
with those of P. majewskii and the other Paraglomus spp. and the positions of clades of the three taxa
relative to those of the other taxa of the Glomeromycotina suggested transferring P. majewskii to a
new genus in the Paraglomeraceae and describing the new fungus as a new species of a new genus
in a new family of the order Paraglomerales.
Key words: arbuscular mycorrhizal fungi, molecular phylogeny, mycorrhiza, new taxa.
*Corresponding author: janusz.blaszkowski@zut.edu.pl
eschweizerbart_xxx
398
Introduction
Based on rRNA gene sequence data, Redecker et al. (2000) and Sawaki et al. (1998)
recognized the ancient origin of five species of arbuscular mycorrhizal fungi (AMF)
that have been classified in the phylum Zygomycota. Three of them, Acaulospora
gerdemannii N.C.Schenck & T.H.Nicolson, A. trappei R.N.Ames & Linderman and
Glomus gerdemannii S.L.Rose, B.A.Daniels & Trappe, were dimorphic organisms
(Morton & Redecker 2001, Spain 2003, Spain et al. 2006). Spores of one of the
morphs arose laterally from the neck of a sporiferous saccule like in Acaulospora
laevis Gerd. & Trappe, the type species of the genus Acaulospora Gerd. & Trappe
(Gerdemann & Trappe 1974), but differed in subcellular structure and the phenotypic
and histochemical characters of components of their spore walls. In addition, the spores
usually developed from a short branch of the sporiferous saccule neck rather than
directly from it as sessile acaulosporoid spores of Acaulospora spp. The second morph
produced spores blastically at the tip of a sporogenous hypha (called glomoid spores)
like G. microcarpum Tul. & C. Tul., which at that time was considered the type species
of the genus (Gerdemann & Trappe 1974); now it is G. macrocarpum Tul. & C.Tul.
(Schüßler & Walker 2010). Glomus brasilianum Spain & J. Miranda and G. occultum
C. Walker formed only glomoid spores (Błaszkowski 2012, Morton and Redecker
2001). In addition, the fungi were distinguished by the following (i) their mycorrhizal
structures usually lacked vesicles and the other structures (arbuscules, intraradical and
extraradical hyphae) stained much lighter than those of other AMF or did not stain at all
in mycological stains and (ii) G. leptotichum Schenck & Smith (the synanamorph of A.
gerdemannii) and G. occultum contained a unique fatty acid, C16:1 ω7 cis (Redecker
et al. 2000, Spain et al. 2006). However, all of the morphological, histochemical and
biochemical characters did not contain enough information to determine the position
of the species among other AMF in a phylogenetic tree. Therefore, Morton & Redecker
(2001), based on sequences of the 18S ribosomal RNA gene, transferred G. brasilianum
and G. occultum to a newly erected genus, Paraglomus J.B.Morton & D.Redecker, in a
new family, Paraglomeraceae J.B.Morton & D.Redecker. The other three species were
accommodated in the genus Archaeospora J.B.Morton & D.Redecker of the family
Archaeosporaceae J.B.Morton & D.Redecker.
Currently AMF are grouped in the subphylum Glomeromycotina (C.Walker
& A.Schüßler) Spatafora & Stajichthe of the phylum Mucoromycota Doweld
(Spatafora et al. 2016) and the species mentioned above are in three families:
Ambisporaceae C.Walker, Vestberg & A.Schüßler, Archaeosporaceae representing
the order Archaeosporales C.Walker & A.Schüßler, and Paraglomeraceae belonging
to Paraglomerales Walker & A.Schüßler (Bills & Morton 2015, Oehl et al. 2011a, b,
Redecker et al. 2013, Schüßler & Walker 2010), of which the last family is the focus
of this study.
Apart from the two Paraglomus spp. mentioned above, currently the genus Paraglomus
still comprises four other species with known molecular phylogenies, i.e. P. bolivianum
(Sieverd. & Oehl) Oehl & G.A.Silva, P. laccatum (Błaszk.) Renker, Błaszk. & Buscot,
P. majewskii Błaszk. & Kovács, and P. pernambucanum Oehl et al. (Błaszkowski 2012,
Mello et al. 2013). In addition, Oehl et al. (2011a) proposed two new combinations
eschweizerbart_xxx
399
in the Paraglomus, i.e. P. albidum (C.Walker & L.H.Rhodes) Oehl et al. (formerly
G. albidum C.Walker & L.H.Rhodes) and P. lacteum (S.L.Rose & Trappe) Oehl et
al. (formerly G. lacteum S.L.Rose & Trappe) only based on morphological similarity
of their spores to those of most Paraglomus spp. mentioned above. However, given
that Paraglomus spp. represent the most ancient lineage in the Glomeromycotina,
the number of named species of the genus compared to that of the other clades of the
subphylum is low and probably concerns a small part of species existing in the world,
as Krüger et al. (2012) suggested.
Except for P. bolivianum and P. pernambucanum found to have 2-walled spores (Mello
et al. 2013), the other Paraglomus spp. were originally described as forming spores with
one spore wall, as all species of the Glomeromycotina with glomoid spores. However,
Mello et al. (2013) suggested that only P. majewskii produces one-walled spores and
this corresponds with its clearly diverged and basal molecular phylogenetic position
relative to the other Paraglomus spp. of recognized natural phylogeny (Błaszkowski et
al. 2012). In addition, the currently named Paraglomus spp. are either uncharacterized
or heterogeneous in respect of histochemical features and pigmentation of their spores.
Spores of six Paraglomus spp. lack amyloid or dextrinoid reaction in Melzer’s reagent,
young P. albidum spores turn pink to orange in this reagent, and this property has not
been recognized at all in P. lacteum (Błaszkowski 2012, Mello et al. 2013, Rose &
Trappe 1980, Walker & Rhodes 1981). Except for P. bolivianum producing yellow
brown to brown spores (Mello et al. 2013), spores of the other Paraglomus spp. are
hyaline to light-coloured at most (Błaszkowski 2012, Mello et al. 2013, Morton &
Redecker 2001).
We found and grew in single-species cultures a Paraglomus-like fungus with small,
hyaline spores with a simple, 2-layered spore wall, whose mycorrhizal structures stain
slightly in Trypan blue, thus like those of, for example, P. occultum, the type species
of the genus Paraglomus (Morton & Redecker 2001). However, phylogenetic analyses
of nrDNA sequences of this Paraglomus-like fungus placed it in its own clade located
basally relative to but highly diverged from the clade of P. majewskii and that of the
other Paraglomus spp. of known molecular phylogeny. Comparisons of similarity of
sequences and the spore wall structure of the new fungus with those of P. majewskii
and the other Paraglomus spp. and the positions of clades of the three taxa relative to
those containing the other taxa of the Glomeromycotina strengthened our confidence
that P. majewskii represents a separate genus in the Paraglomeraceae, and the new
fungus forming the basal lineage is an undescribed species of a new family in the
order Paraglomerales. Therefore, below we transferred P. majewskii to a new genus
in the Paraglomeraceae and erected a new family with a new genus and a new species
in the Paraglomerales.
Materials and methods
Origin Of the study material, establishment and grOwth Of trap and single-species cultures,
extract iOn O f spOr es, and staining Of mycOrrhizal structures: The study material used in
morphological and molecular analyses of the new species described below came from Oman, Greece,
and Tunisia (North Africa). The presence of the fungus in New Caledonia was confirmed on the
eschweizerbart_xxx
400
basis of sequences and microscopic pictures provided by T. Crossay. Spores were first extracted
from trap cultures that were established from field-collected rhizosphere soils and roots of sampled
plants mixed with autoclaved coarse grained sand and then grown in conditions described previously
(Błaszkowski et al. 2012, Al-Yahya’ei et al. 2011). The sampled plants were Salvadora persica Wall.
and Tetraena qatarensis Beier & Thulin. growing at AlKamel, the area located between Al-Sharqiya
Sands and Oman Mountains in southern Arabia in the Sultanate of Oman (Al-Yahya’ei et al. 2011),
and Ammophila arenaria (L.) Link colonizing sand dunes of the Mediterranean Sea located near
Thessalonica, Greece, and Tunis, Tunisia.
Single-species cultures of the fungus coming from Oman were initiated by positioning a single spore
close to a leek (Allium porrum L.) seed and growing in conditions described by Symanczik et al.
(2014), and those with the Greek and Tunisian isolates by inoculating roots of Plantago lanceolata
L. with 10–20 spores per pot and growing according to Błaszkowski et al. (2012). Spores for
morphological and molecular analyses and roots for studies of mycorrhizal structures were collected
from four- to five-month-old cultures. Spores were extracted from trap and single-species cultures by
wet sieving and sucrose density gradient centrifugation (Daniels & Skipper 1982) and by the method
described by Błaszkowski et al. (2015). Roots were stained as described in Błaszkowski (2012).
micrOscOpy and nOmenclature: Morphological features of spores and the phenotypic and
histochemical characters of spore wall layers were determined after examination of at least 100
spores mounted in water, lactic acid, polyvinyl alcohol/lactic acid/glycerol (PVLG, Omar et al.
1979) and a mixture of PVLG and Melzer’s reagent (1:1, v/v). The preparation of spores for studies,
determination of colour, and photographing of spores and mycorrhizal structures were as those
described previously (Błaszkowski 2012, Błaszkowski et al. 2012). Types of spore wall layers are
those defined by Błaszkowski (2012), Stürmer & Morton (1997), and Walker (1983). Colour names
are from Kornerup & Wanscher (1983). Nomenclature of fungi and the authors of fungal names are
from the Index Fungorum website http://www.indexfungorum.org/AuthorsOfFungalNames.htm.
Voucher specimens were mounted in PVLG and a mixture of PVLG and Melzer’s reagent (1:1, v/v)
on slides and deposited at the common mycological herbarium of the ETH and University of Zurich,
Switzerland (Z+ZT, holotype), the Department of Ecology, Protection and Shaping of Environment
(DEPSE), West Pomeranian University of Technology in Szczecin, Poland and in the herbarium at
Oregon State University (OSC) in Corvallis, Oregon, USA (isotypes).
mOlecular phylOgeny, dna extractiOn, pOlymerase chain reactiOn, clOning, and dna sequencing:
Molecular analyses of spores from Oman were performed at Zurich Basel Plant Science Center,
Institute of Botany, University of Basel, Switzerland. The Greek and Tunisian isolates were studied
at J. Błaszkowski’s lab. Crude DNA was extracted from eight single spores. The treatment of the
spores prior to polymerase chain reactions (PCRs), the conditions and primers used in the PCRs to
obtain sequences of the small subunit (SSU) rRNA gene, the internal transcribed spacer 1 (ITS1),
the 5.8S rRNA gene, ITS2 rDNA (hereinafter named ITS), and the large subunit (LSU) rRNA gene
(together named SSU–ITS–LSU nrDNA), as well as cloning and sequencing were as those described
in Błaszkowski et al. (2013) and Symanczik et al. (2014). The sequences were deposited in GenBank
(KY630227–KY630251).
sequence alignment and phylOgenetic analyses: Aligning SSUITS–LSU nrDNA sequences of
AMF belonging to distant clades may be impossible or may led to erroneous conclusions due to the
highly variable ITS1 and ITS2 regions (Krüger et al. 2012, pers. observ.). Therefore, to know the
position of the AMF discussed here among other taxa of the Glomeromycotina, we performed pilot
phylogenetic analyses separately with SSU-only and LSU-only sequences of the fungus and species
representing all named genera of AMF with glomoid spores. The analyses placed the fungus basally
relative to the other AMF and indicated that it is most closely related to Paraglomus spp. (data not
shown). Consequently, we assembled a set with sequences covering the SSU–ITS–LSU region
or part thereof. Apart from 17 sequences of our fungus, the set contained 60 other sequences that
characterized seven species originally described in the genus Paraglomus and one to three species
each of the families Ambisporaceae, Archaeosporaceae and Geosiphonaceae. The outgroup was
represented by sequences of species of the families Endogonaceae Paol. and Mortierellaceae A.Fisch.
The pilot and final sequence sets were aligned with MAFFT v. 7 using the auto option (http://mafft.
cbrc.jp/alignment/server/). In the SSU–ITS–LSU set, indels were coded by means of the simple indel
eschweizerbart_xxx
401
coding algorithm (Simmons et al. 2001) as implemented in GapCoder (Young & Healy 2003) and this
binary character set was added to the nucleotide alignment, as described and justified in Błaszkowski
et al. (2014). Bayesian (BI) analysis was conducted with MrBayes 3.1.2 (Huelsenbeck & Ronquist
2001) using SSU–ITS–LSU sequences plus indel analysis divided into four partitions. GTR+G and
two-parameter Markov (Mk2 Lewis) models were applied for the nucleotide partitions and indel
matrices, respectively. The GTR+G nucleotide substitution model was selected in jModelTest (Posada
2008) considering the Akaike criterion. Four Markov chains were run for 5 000 000 generations,
sampling every 100 steps, with a burn-in at 7500 sampled trees. Maximum likelihood (ML) analysis
was carried out with the raxmlGUI (Silvestro & Michalak 2012) implementation of RAxML
(Stamatakis 2014) with the GTRGAMMA algorithm. Rapid bootstrap analysis with 1000 replicates
was used to test the support for the branches. The generated phylogenetic trees were visualized and
edited in MEGA6 (Tamura et al. 2013).
Taxonomy
phylOgeny: The phylogenies of the fungi studied here were determined based on a set
of SSU–ITS–LSU nrDNA sequences. The set was 2377 characters in length, had 2167
(91.17%) informative sites and comprised 77 sequences, of which 28 characterized
six Paraglomus spp. (including the fungus originally described as P. majewskii), and
17 sequences represented our new AMF. Bayesian and ML phylogenetic analyses of
the sequence set proved that P. majewskii represents a new basal genus in the family
Paraglomeraceae and our undescribed species belongs to a new genus in a new basal
family of the order Paraglomerales (Fig. 1). The clade with P. majewskii sequences
and the node connecting it with the clade with sequences of the other Paraglomus spp.
obtained full BI (1.0) and ML (100%) support values. The clade with the new taxon
was also fully supported, and the BI and ML support values of the node connecting it
with the clade representing the family Paraglomeraceae were 1.0 and 99%, respectively.
The eight P. majewskii and the four P. laccatum sequences used in the analyses showed
83.6% similarity. The similarity between P. majewskii sequences and those of our new
species was 77.8%. The intraspecific variability of sequences of P. majewskii and the
new species were 0.9% and 1.3%, respectively. No environmental sequences were
found matching closer than 85% with the sequences of the new species. The taxa are
erected and defined below.
Erection of a new genus in the Paraglomeraceae
Innospora Błaszk., Kovács, Chwat & Kozłowska, gen. nov.
MycoBank MB 820124.
Spores single, glomoid, hyaline with one spore wall and a subtending hypha with
an open pore. Mycorrhiza with arbuscules and vesicles staining variable in Try-
pan blue. nrDNA sequences highly divergent from those of Paraglomus spp., from
which and other genera of the Glomeromycotina and other fungi differing in the
SSU nrDNA sequences GATAGAGGCCTACCATGGTAGTAACGGGTAACGGG
GAATTAGGGTGATTCCGGAGAGGG,GTCTTGTTATTGGAATGAGTAC
GATTTAAATCTCCTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAG
eschweizerbart_xxx
402
Fig. 1. A 50% majority rule consensus phylogram inferred from a Bayesian analysis of SSU–ITS–
LSU nrDNA sequences of Innospora majewskii comb. nov. and Pervetustus simplex gen. and sp.
nov., five known Paraglomus spp. and six species of the families Ambisporaceae, Archaeosporaceae
and Geosiphonaceae of the Glomeromycotina with seven species of the families Endogonaceae and
Mortierellaceae as outgroup. The two new taxa are in boldface and their names are followed by
GenBank accession numbers. The Bayesian posterior probabilities 0.50 and ML bootstrap values
50% are shown near the branches, respectively. Bar indicates 0.1 expected change per site per branch.
eschweizerbart_xxx
403
CAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGT
TAAAAAGCTCGTAGTTGAACTTCAGGCCTGTCCAGATGGTCCGCCT
TAA,GCTCGAATACATTAGCATGGAATAATGGAATAGGACGATGGTTCTAT
TTTGTTGGTTCTAGGACCGTTGTAATGATTAATAGGGATAGT and GGGGGC
ATTAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAAC
TACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGT
TAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTAT
GCCGACTAGGAATCGGGCGATGTTGACAAAATGACTCGCTCGGCACCT
CATGGGAAACCAAAGTGTTTGGGT, the ITS2LSU nrDNA signature sequence
TTTATATTCCTTTATTATGAGACCTCAAATCAGACAAGAATACCC
GCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAA
CAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGACAGCT
CAAATTTTAAATCGGTTTGCACAATGCAGCCCGAGTTGTAGTTT
GAAGAAGTCTGTCGCAG and the LSU nrDNA sequences TTGTGAAATTTTTC
GCATGGCAGGTCAGCATCAGTTTC and GCTCCCCGTGCTCAACAGCATGC
TGAGTGGGTGTGGGGACGCTTTGAACACCAGGTTGCGGAAGCCAGC.
etymOlOgy: Latin, Innospora, inno = float, spora = spore, referring to spores of this
fungus floating in water.
type species: Innospora majewskii (Błaszk. & Kovács) Błaszk., Kovács, Chwat & Kozłowska, comb.
nov. MycoBank No. MB 820125.
basiOnym: Paraglomus majewskii Błaszk. & Kovács. Mycologia 104: 149, 2012.
nOtes: Other data on the morphology, phylogeny, and distribution of the species are
in Błaszkowski (2012) and Błaszkowski et al. (2012).
Innospora majewskii does not contain any particular morphological trait conclusively
distinguishing the species from those of other genera of the Glomeromycotina with
glomoid spores. The formation of one-walled spores clearly separates I. majewskii
from Paraglomus spp. having two-walled spores, as Mello et al. (2013) concluded.
However, one-walled glomoid spores are also produced in all members of the orders
Archaeosporales and Glomerales and many species of the order Diversisporales
(Redecker et al. 2013, Bills & Morton 2015), as well as a fungus representing a new
family described below. Thus, only a large phylogenetic distance, unique molecular
properties included in the signature sequences mentioned above, and the position
of the clade with the sequences relative to other clades in the Glomeromycotina
unambiguously indicate that the species should represent a new genus (Fig. 1).
Erection of a new family and a new genus in the Paraglomerales
Pervetustaceae Błaszk., Chwat, Kozłowska, Symanczik & Al-Yahya’ei, fam. nov.
MycoBank MB 820126.
Spores single, glomoid, hyaline. Mycorrhiza with arbuscules staining variably in Trypan
blue. nrDNA sequences highly divergent from those of Innospora and Paraglomus spp.,
from which and other genera of the Glomeromycotina and other fungi differing in the SSU
eschweizerbart_xxx
404
nrDNA signature sequences CTTGGTGTCCGCGGGAACCAGGACCTTTACCTT
GAAAAAATTAGAGTGCTCAAAGCGGGCTCGTACGCTTGAATACATTAG
CATGGAATAATGAAATAGGACGACGGTTCTATTTTGTTGGTTTCCGGG and
GCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGATC
GAAGACGATCAGATACCGTCGTAGTCTCAACCATAAACTATGC
CGACTGGGAATCGGGCGATGTTA, the ITS2LSU nrDNA sequence ATTTCCT
GGCCTCAGATCAAGCAAGACCACCCGCTGAACTTAAGCATATCAATA
AGC and the LSU nrDNA sequences GTCCACGGCCGGCGCACCGGATGCG
TACGATACGACCTC,AGTTCGTTCGCCGTGCACTATTCCGCATGGCAGGC
CAGCGTCGGTTTCGGACGTCGTAAAACGGCCGGGGAAAGGTGGCCCCC
GCGGGGGTGTTTACAGACCCTGGTCAATGCGGCGTGCGGAACCGAG
GAATGCGGCGGCGACCCTTCTGGGCTTGGACCTTTCCTTTGTGTGGC
GGC,TGCGTTCCGAGCTTGCTCGGGCGTGGGTGACCGTTCGCTCAA and C
ACCGCCAAGGACGCTGGCGTAATGGCTTCAAACGACCCGTCTTGAAA
CACGGACCAAGGAGTC.
etymOlOgy: Latin, from pervetusta = very old, referring to the molecular phylogeny
of the type species of the family, suggesting its very old origin.
type genus: Pervetustus Błaszk., Chwat, Kozłowska, Symanczik & Al-Yahya’ei.
Pervetustus Błaszk., Chwat, Kozłowska, Symanczik & Al-Yahya’ei, gen. nov.
MycoBank MB 820127.
Diagnostic characters as for Pervetustaceae.
type species: Pervetustus simplex Błaszk., Chwat, Kozłowska, Crossay, Symanczik & Al-Yahya’ei,
sp. nov.
etymOlOgy: Latin, Pervetustus, as for Pervetustaceae.
nOtes: The formation of single, colourless, very small spores with one spore wall
(Figs 27) by the new fungus characterized below suggested that it is most closely
related to I. majewskii. However, the unique nrDNA sequences of the fungus, which
differ from those of I. majewskii by an average of 22.2%, and the basal position of the
clade with the sequences relative to the clades with sequences of the other species of
the Glomeromycotina (Fig. 1) proved that the fungus is a new species of a previously
unrecognized new genus and a new family.
According to Oehl et al. (2011a), likely all Paraglomus spp. germinate through the
spore wall instead of through the subtending hypha as in species of most other genera
with glomoid spores. Unfortunately, the mode of spore germination in I. majewskii
and Pe. simplex has not been recognized to date.
Pervetustus simplex Błaszk., Chwat, Kozłowska, Crossay, Symanczik & Al-Yahya’ei,
sp. nov. Figs 211
MycoBank MB 820128.
cOllectiOns examined: hOlOtype: ZT Myc 57795 (Z+ZT), isotypes: 3258–3274, 3276–3280
(DEPSE), and OSC 156399, OSC 156400 (OSC).
eschweizerbart_xxx
405
Figs 2–7. Pervetustus simplex. 2. Intact spores. 3, 4. Spore wall layers (swl) 1 and 2 and subtending
hyphal wall layer (shwl) 2; shwl1 is completely sloughed. 5. Spore wall layers (swl) 1 and 2. 6.
Spore wall layers (swl) 1 and 2 and subtending hyphal wall layers (shwl) 1 and 2. 7. Spore wall
layers (swl) 1 and 2 and subtending hyphal wall layer (shwl) 2; shwl1 is completely sloughed; note
the septum (s) in the lumen of the subtending hypha. Figs 3, 4, 6, 7. Spores in PVLG. Figs 2, 5.
Spores in PVLG+Melzer’s reagent. Figs 2–7. Differential interference microscopy. Bars: Fig. 2 =
20 µm, Figs 3–7 = 10 µm.
eschweizerbart_xxx
406
etymOlOgy: Latin, simplex, referring to the morphological simplicity of the fungus.
spOrOcarps unknown. Spores formed singly in soil (Figs 27) and blastically at the
tip of sporogenous hyphae developed from mycorrhizal extraradical hyphae. spOres
hyaline; globose to subglobose; (17)51(67) µm diam.; very rarely ovoid; 5258 ×
5863 µm; with one subtending hypha (Figs 27). spOre wall consists of two hyaline
layers (Figs 37). Layer 1, forming the spore surface, evanescent, (1.0)1.5(–2.3) µm
thick, short-lived, usually highly deteriorated or completely sloughed in most spores
(Figs 37). Layer 2 laminate, smooth, (3.8)5.1(7.3) µm thick, consisting of very thin,
<0.5 µm thick, laminae, tightly adherent to each other (Figs 37). Layers 1 and 2 do
not show amyloid or dextrinoid reaction in Melzer’s reagent (Figs 2, 5). subtending
hypha hyaline; straight or recurved, cylindrical to slightly funnel-shaped, sometimes
slightly constricted at the spore base; (3.0)4.2(5.8) µm wide at the spore base (Figs
3, 4, 6, 7). wall Of subtending hypha hyaline; (1.0)1.3(1.8) µm thick at the spore
base; continuous with spore wall layers 1 and 2; layer 1 usually highly deteriorated
and present only near the spore base or completely sloughed in most spores (Figs 3,
4, 6, 7). pOre (0.8)1.8(2.8) µm diam, open (Figs 3, 4, 6) or occluded by a straight or
curved septum connecting the inner surfaces of subtending hyphal wall layer 2 (Fig.
7). germinatiOn unknown.
mycOrrhizal assOciatiOns: In the field, Pe. simplex was likely associated with roots of
S. persica and T. qatarensis (growing in undisturbed natural field at Al-Kamel in Al-
Sharqyia region of Oman), Am. arenaria (colonizing sand dunes of the Mediterranean
Sea near Thessalonica, Greece and Tunis, Tunisia) and Alphitonia neocaledonica
(Schltr.) Guillaumin (an endemic plant of New Caledonia that grew in soil of a nickel
mine). However, the presence of the fungus inside roots of the plant species was not
examined using molecular methods.
In single-species cultures with A. porrum and P. lanceolata as host plants, Pe. simplex
formed mycorrhiza with arbuscules and intraradical and extraradical hyphae (Figs
811). No vesicles were found. Arbuscules were generally widely dispersed along
the root fragments examined (Figs 8, 9). Intraradical hyphae grew along the root axis,
were (2.0)3.8(8.8) µm wide, straight or slightly recurved, and occasionally formed
Y-shaped branches and coils (Fig. 9). The coils were ellipsoidal; 22.828.8 × 36.8
62.5 µm; when seen in a plan view. Extraradical hyphae were (1.8)3.1(4.5) µm wide
and occurred infrequently or abundantly, depending on the root fragment examined
(Figs 10, 11). In 0.1% Trypan blue, arbuscules stained pale violet (17A3) to greyish
violet (17B3), intraradical hyphae violet white (17A2) to light violet (17A5), coils
pale violet (17A3) to light violet (17A5), and extraradical hyphae pastel violet (17A4)
to greyish violet (17C6, Figs 811).
phylOgenetic pOsitiOn: As that of Pervetustaceae fam. nov. (see above and Fig. 1).
distributiOn and habitat: As mentioned in "Mycorrhizal associations", Pe. simplex
has so far been found only in an undisturbed natural field located in Oman, in two
maritime sand dune sites belonging to Greece and Tunisia, and in soil of a nickel mine
of New Caledonia. The Oman field is situated in a sandy plain area (22°14'11"N,
59°10'30"E) characterized by its hyperaridity based on the aridity index defined by
eschweizerbart_xxx
407
the United Nations Environmental Program (UNEP 2006). Annual rainfall does not
exceed 100 mm and summer temperatures exceed 48 °C (Symanczik et al. 2014). The
Greek (40°33'59"E, 22°57'26"E) and Tunisian (36°48'19"N, 10°12'04"E) sites were
located ca. 50 m and 20 m, respectively, from the bank of the Mediterranean Sea. The
New Caledonian nickel mine is situated in the great south ultramafic massif of the
archipelago, near Plum (22°16'35"S, 166°36'55"E). The annual rainfall on the study
site ranges from 900 to 2000 mm with variations between and within years (Enright
et al. 2001). Sampling in Oman and Tunisia took place in August 2006, in Greece in
September 2008, and in New Caledonia in September 2014. Chemical and physical
properties of the habitat soil from Oman are presented in Al-Yahya’ei et al. (2011). The
soil from New Caledonia is a colluvial lateritic soil with the following characteristics:
coarse sand, 39.4%; fine sand, 22.1%; silt-clay, 37.2%; pH H20, 5.9; pH KCl, 5.6; total
C, 42.1 g kg−1; total N, 2.2 g kg−1; total P, 147 mg kg−1; available P (Mehlich), 3 mg
kg−1; and total Ni, 4.78 g kg−1.
Figs 8–11. Mycorrhizal structures of Pervetustus simplex in roots of Plantago lanceolata stained in
0.1% Trypan blue. 8. Arbuscules (a) and arbuscular trunk (t) developed from parent hypha (ph). 9.
Arbuscules (a), Y-shaped branch (Yb), straight hypha (sh), and coil (c). 10. Extraradical hyphae (eh)
on the root surface. 11. Extraradical hyphae (eh) and spore (sp). Figs 8–11. In PVLG. Figs 8–11.
Differential interference microscopy. Bars: Figs 8–10 = 10 µm, Fig. 11 = 20 µm.
eschweizerbart_xxx
408
BLAST queries did not show any sequence from environmental samples with at least
97% similarity to those of Pe. simplex. The fungus has not also been found in ca.
3000 field-collected soil samples and ca. 2900 trap cultures that represented different
cultivated and uncultivated sites located in Africa, Asia, Brazil, Europe, and USA
(Błaszkowski, pers. observ.). Thus, Pe. simplex is likely to be rare in the world.
nOtes: Morphologically Pe. simplex is conspicuous because of its very small and
colourless spores that are produced singly in soil and have a simple spore wall structure
consisting of an evanescent, short-lived, thin outer layer and a much thicker, permanent,
smooth, laminate inner layer. None of these layers shows amyloid or dextrinoid reaction
in Melzer’s reagent (Figs 27).
Spores of Pe. simplex and I. majewskii are similar in colour (are hyaline), size, width of
their subtending hypha, thickness of its wall and in diameter of the subtending hyphal
pore at the spore base (Błaszkowski et al. 2012). However, in I. majewskii the spore
wall is 1.41.6-fold thicker and consists of three layers (vs. two layers in Pe. simplex,
Figs 37), and its subtending hyphal pore is open (vs. open or occluded by a septum,
Figs 3, 4, 6, 7). Finally, the subtending hypha of I. majewskii spores is more regular
in shape (cylindrical to flared vs. cylindrical to slightly funnel-shaped in Pe. simplex).
Most importantly, Pe. simplex is unique due to its molecular properties expressed
among others in the signature sequences given above.
Acknowledgements
We thank Dr. Roland Kirschner for managing the review process of the paper. This study was supported
in part by the Polish National Centre of Science, grants no. 2012/05/B/NZ8/00498 and 2012/07/N/
NZ8/02363, Oman’s Ministry of Agriculture and Fisheries, the Universities of Basel and of UAE
which are gratefully acknowledged.
References
AL-YAHYA’EI, M.N, F. OEHL F, M. VALLINO, E. LUMINI, D. REDECKER et al. 2011: Unique
arbuscular mycorrhizal fungal communities uncovered in date palm plantations and surrounding
desert habitats of southern Arabia. – Mycorrhiza 21: 195–209, doi:10.1007/s00572-010-0323-5.
BILLS, R.B. & J.B MORTON 2015: A combination of morphology and 28S rRNA gene sequences
provide grouping and ranking criteria to merge eight into three Ambispora species (Ambisporaceae,
Glomeromycota). Mycorrhiza 25: 485–498, doi: 10.1007/s00572-015-0626-7.
BŁASZKOWSKI, J. 2012: Glomeromycota. – W. Szafer Institute of Botany, Polish Academy of
Sciences, Kraków.
BŁASZKOWSKI, J., G. CHWAT, A. GÓRALSKA, P., RYSZKA & M. ORFANOUDAKIS 2014:
Septoglomus jasnowskae and Septoglomus turnauae, two new species of arbuscular mycorrhizal
fungi (Glomeromycota). – Mycol. Prog. 13: 999–1009, doi: 10.1007/s11557-014-0985-z).
BŁASZKOWSKI, J., G. CHWAT, G.M. KOVÁCS, B.K. GÁSPÁR, P. RYSZKA et al. 2013:
Septoglomus fuscum and S. furcatum, two new species of arbuscular mycorrhizal fungi
(Glomeromycota). – Mycologia 105: 670–680, doi: 10.3852/12–127.
eschweizerbart_xxx
409
BŁASZKOWSKI, J., G. CHWAT, S. SYMANCZIK & A. GÓRALSKA 2015: Dominikia duoreactiva
and D. difficilevidera, two new species in the Glomeromycota. – Botany 93: 389–396, doi:10.1139/
cjb-2015-0016.
BŁASZKOWSKI, J., G.M. KOVÁCS, B.K. GÁSPÁR, T.K. BALÁZS, F. BUSCOT et al. 2012: The
arbuscular mycorrhizal Paraglomus majewskii sp. nov. represents a new distinct basal lineage in
Paraglomeraceae (Glomeromycota). – Mycologia 104: 148–156, doi: 10.3852/10–430.
DANIELS, B.A. & H.D. SKIPPER 1982: Methods for the recovery and quantitative estimation of
propagules from soil. – In: SCHENCK, N.C. (ed.): Methods and principles of mycorrhizal research.
St Paul, Minnesota: Am. Phytopathol. Soc. p. 29–35.
ENRIGHT, N.J., L. RIGG & T. JAFFRÉ 2001: Environmental controls on species composition
along a (maquis) shrubland to forest gradient on ultramafics at Mont Do, New Caledonia. – S. Afr.
J. Sci. 97: 573–58.
GERDEMANN, J.W. & J.M. TRAPPE 1974: The Endogonaceae in the Pacific Northwest. – Myc.
Memoir 5: 1–76.
HUELSENBECK, J.P. & F. RONQUIST 2001. MRBAYES: Bayesian inference of phylogenetic
trees. – Bioinformatics 17: 754–755, doi: 10.1093/bioinformatics/17.8.754
KORNERUP, A. & J.H. WANSCHER 1983: Methuen handbook of colour. – 3rd ed., Methuen,
London.
KRÜGER, M., C. KRÜGER, C. WALKER, H. STOCKINGER & A. SCHÜSSLER 2012: Phylo-
genetic reference data for systematics and phylotaxonomy of arbuscular mycorrhizal fungi from
phylum to species level. – New Phytol. 193: 970–984, doi:10.1111/j.1469–8137.2011.03962.x
MELLO DE, C.M.A., G.A. DA SILVA, D.M.A. DE ASSIS, J.S. DE PONTES, A.C.A. FERREIRA
et al. 2013: Paraglomus pernambucanum sp. nov. and Paraglomus bolivianum comb. nov., and
biogeographic distribution of Paraglomus and Pacispora. – J. Appl. Bot. Food Qual. 86: 113–125,
doi: 10.5073/JABFQ.2013.086.016
MORTON, J.B. & D. REDECKER 2001: Two families of Glomales, Archaeosporaceae and
Paraglomaceae, with two new genera Archaeospora and Paraglomus, based on concordant molecular
and morphological characters. – Mycologia 93: 181–195, doi: 10.2307/3761615
OEHL, F., G.A. DA SILVA, B.T. GOTO & E. SIEVERDING 2011a: Glomeromycota: three new
genera and glomoid species reorganized. – Mycotaxon 116: 75–120, doi: 10.5248/116.75
OEHL, F., G.A. DA SILVA, B.T. GOTO, L.C. MAIA & E. SIEVERDING 2011b: Glomeromycota:
two new classes and a new order. – Mycotaxon 116: 365–379, doi: 10.5248/116.365
OMAR, M.B., L. BOLLAN & W.A. HEATHER 1979: A permanent mounting medium for fungi. –
Bull. Brit. Mycol. Soc. 13: 31–32, doi: 10.1016/S0007-1528(79)80038-3
POSADA, D. 2008: jModelTest: phylogenetic model averaging. – Mol. Biol. Evol. 25: 1253–1256,
doi: 10.1093/molbev/msn083
REDECKER, D., J.B. MORTON & T.D. BRUNS 2000: Ancestral lineages of arbuscular mycorrhizal
fungi (Glomales). – Mol. Phylogenet. Evol. 14: 297–301, doi: 10.1006/mpev.1999.0713
REDECKER, D., A. SCHÜSSLER, H. STOCKINGER, S.L. STÜRMER, J.B. MORTON et al. 2013:
An evidence-based consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota).
– Mycorrhiza 23: 515–531, doi: 10.1007/s00572-013-0486-y
ROSE, S.L. & J.M. TRAPPE 1980: Three new endomycorrhizal Glomus spp. associated with
actinorrhizal shrubs. – Mycotaxon 10: 413–420.
SAWAKI, H., K. SUGAWARA & M. SAITO 1998: Phylogenetic position of an arbuscular mycorrhizal
fungus, Acaulospora gerdemannii, and its synanamorph Glomus leptotichum, based upon 18 rRNA
gene sequence. – Mycoscience 39: 477–480, doi: 10.1007/BF02460910
eschweizerbart_xxx
410
SCHÜSSLER, A. & C. WALKER 2010: The Glomeromycota: a species list with new families and
new genera. – Royal Botanic Garden Edinburgh, Gloucester.
SILVESTRO, D. & I. MICHALAK 2012: raxmlGUI: a graphical front-end for RAxML. – Org.
Divers. Evol. 12: 335–337, doi: 10.1007/s13127-011-0056-0
SIMMONS, M.P., H. OCHOTERENA & T.G. CARR 2001: Incorporation, relative homoplasy, and
effect of gap characters in sequence-based phylogenetic analyses. – Syst. Biol. 50: 454–462, doi:
10.1080/106351501300318049
SPAIN, J.L. 2003: Emendation of Archaeospora and its type species, Archaeospora trappei. –
Mycotaxon 87: 109–112.
SPAIN, J.L., E. SIEVERDING & F. OEHL 2006: Appendicispora: a new genus in the arbuscular
mycorrhiza-forming Glomeromycetes, with a discussion of the genus Archaeospora. – Mycotaxon
97: 163–182.
SPATAFORA, J.W., Y. CHANG, G.L. BENNY, K. LAZARUS, M.E. SMITH et al. 2016: A phylum-
level phylogenetic classification of zygomycete fungi based on genome-scale data. – Mycologia 108:
1028–1046, doi: 10.3852/16-042
STAMATAKIS, A. 2014: RAxML Version 8: a tool for phylogenetic analysis and post-analysis of
large phylogenies. – Bioinformatics 30: 1312–1313, doi: 10.1093/bioinformatics/btu033
STÜRMER, S.L. & J.B. MORTON 1997: Developmental patterns defining morphological characters
in spores of four species in Glomus. – Mycologia 89: 72–81, doi: 10.2307/3761174
SYMANCZIK, S., J. BŁASZKOWSKI, G. CHWAT, T. BOLLER, A. WIEMKEN et al. 2014:
Three new species of arbuscular mycorrhizal fungi discovered at one location in a desert of Oman:
Diversispora omaniana, Septoglomus nakheelum and Rhizophagus arabicus. – Mycologia 106:
243–259, doi: 10.3852/106.2.243
TAMURA, K., G. STECHER, D. PETERSON, A. FILIPSKI & S. KUMAR 2013: MEGA6: Molecular
Evolutionary Genetics Analysis Version 6.0. – Mol. Biol. Evol. 30: 2725–2729, doi:10.1093/molbev/
mst197
UNEP 2006: Global deserts outlook. – United Nations environmental program; 148 p.
WALKER, C. 1983: Taxonomic concepts in the Endogonaceae: spore wall characteristics in species
descriptions. – Mycotaxon 18: 443–455.
WALKER C. & L.H. RHODES 1981: Glomus albidus: a new species in the Endogonaceae. –
Mycotaxon 12: 509–514.
YOUNG, N.D. & J. HEALY 2003: GapCoder automates the use of indel characters in phylogenetic
analysis. – BMC Bioinformatics 4: 6, doi: 10.1186/1471-2105-4-6
Manuscript submitted November 10, 2016: accepted March 31, 2017.
eschweizerbart_xxx
... Single-spore assays were checked for sporulation, and positive cultures were used as inocula for further propagation by culturing with a consortium of Allium porrum L., Hieracium pilosella L., and Plantago lanceolata L. as AMF host plants. The resulting mycorrhizal inocula were identified using morphological and molecular identification methods, as described previously (Symanczik et al. 2014a, b;Blaszkovski et al. 2017;Symanczik et al. 2018). ...
... However, four species were previously unknown. They were given names unique to the geographical region of the Southern Arabian Peninsula: Desertispora omaniana, Rhizophagus arabicus, Septoglomus nakheelum and Pervetustus simplex (Symanczik et al. 2014a;Blaszkovski et al. 2017). The phylogenetic and morphological characterization of all eight species is represented in Fig. 1 zones in India (TERI) and for AMF in China (Gai et al. 2006). ...
Article
Full-text available
The vegetation in the Arabian Peninsula experiences drought, heat, soil salinity, and low fertility, mainly due to low phosphorus (P) availability. The beneficial mycorrhizal symbiosis between plants and arbuscular mycorrhizal fungi (AMF) is a key factor supporting plant growth under such environmental conditions. Therefore, AMF strains isolated from these soils might be useful as biotechnological tools for agriculture and revegetation practices in the region. Here we present a pioneering program to isolate, identify, and apply AMF isolated from rhizosphere soils of agricultural and natural habitats, namely date palm plantations and five native desert plants, respectively in the Southern Arabian Peninsula. We established taxonomically unique AMF species as single-spore cultures as part of an expanding collection of AMF strains adapted to arid ecosystems. Preliminary experiments were conducted to evaluate the abilities of these AMF strains to promote seedling growth of a main crop Phoenix dactylifera L. and a common plant Prosopis cineraria L. (Druce) in the Arabian Peninsula. The results showed that inoculation with certain AMF species enhanced the growth of both plants, highlighting the potential of these fungi as part of sustainable land use practices in this region.
... In this sense, Table 1 shows the current taxonomic classification of these symbionts, considering the new families and genera that have so far been reported by internationally renowned researchers such as Oehl and Sieverding (2004), Walker and Schüßler (2004), Spain et al. (2006), Palenzuela et al. (2008), Goto et al. (2012), Oehl et al. (2008Oehl et al. ( , 2011b; Sieverding et al. (2015), Błaszkowski et al. (2017Błaszkowski et al. ( , 2018, and Symanczik et al. (2018), among others. ...
... Thus, once the spore has matured, the saccule collapses and leaves this scar on its way, located in the structural layer "2" of the Acaulospora, Ambispora, Archaeospora, Entrophospora and Sacculospora genera (Oehl et al., , 2011bKaonongbua et al., 2010) (Fig. 1a). • Clamping hypha: It occurs with different number of layers, shapes and occlusions at the base of the glomerospora in the genera Ambispora, Claroideoglomus, Diversispora, Desertispora, Dominikia, Innospora, Kamienskia, Funneliformis, Glomus, Pacispora, Paraglomus, Pervetustus, Rhizoglomus, Redeckera, Sclerocystis, Septoglomus, and Simiglomus ( Fig. 1) (Oehl & Sieverding, 2004;Schüßler & Walker, 2010;Oehl et al., 2011b;Błaszkowski et al., 2015Błaszkowski et al., , 2017Symanczik et al., 2018). • Septum: Structure that separates the glomerospore from the subjection hypha with a septum; the septum can be located at the base or the middle part of the hypha (Fig. 1d) and, according to its position, makes it belong to one of the genera mentioned above (Oehl et al., 2011d;Souza, 2015b). ...
Chapter
Full-text available
Arbuscular mycorrhiza (AM) is the mutualistic symbiosis established between fungi of the Phylum Glomeromycota and most vascular plants (Smith & Read, 2008; Parniske, 2008) including species of great value in agricultural systems (Giovannini et al., 2020; Gao et al., 2020), whose ability to increase the absorption of water and low-mobility nutrients is usually transcendent in its growth and development (Cardoso et al., 2017; Ma et al., 2019). In addition, AM confers other benefits on plants such as resistance to attack by pests and diseases (Jung et al., 2012; Cameron et al., 2013), tolerance under saline stress (Frosi et al., 2017; Chang et al., 2018; Wang et al., 2019), drought stress (Silva et al., 2015; Chitarra et al., 2016; Fernández-Lizarazo & Moreno-Fonseca, 2016; Wu & Zou, 2017), and presence of heavy metals (Miransari, 2017; Kumar & Singh, 2019; Kumar & Saxena, 2019). These do not underestimate the improvement of physical-chemical properties of the soil like texture, structure (Thirkell et al., 2017; Atakan et al., 2018), and the release of nutrients (Ortaş et al., 2017). On the other hand, the trend of the current scientific classification of arbuscular mycorrhizal fungi (AMF) is based on the combined application of conventional identification methods by discrete characters of the subcellular structure of spores such as size, color, and supporting hypha (Morton & Bentivenga, 1994), as well as by the phylogenetic-molecular analyzes of the partial region of the β-tubulin gene and primers that flank the SSU rRNA-ITS-LSU region (Oehl et al., 2011a) known as a polyphasic taxonomy (Tindall et al., 2010). In this context, Schüßler (2006) had proposed the existence of ten AMF genera with around 193 described species, but recently Oehl et al. (2011a) reported 29 genera with 230 species arranged in 14 families. Despite the fact that information on AMF diversity in natural and managed ecosystems is scarce, there are evidences that this could be higher than estimated (Opik et al., 2008). Thus, and in this manner, Börstler et al. (2006) considered that in the world there could be 1250 species of mycorrhizal fungi. Although the controversy about how their composition changes in natural ecosystems that were transformed into agroecosystems still prevents a standardized criterion among specialists (Belay et al., 2015) especially if the mycorrhizal spore population is forged in response to alterations in the plant community due to the obligate nature of the mycobionts (Paliocha, 2017; Sharma et al., 2018). As far as agricultural systems are concerned, many the practices are carried out that in one way or another tend to negatively affect the abundance, diversity, and functioning of AMF (Schalamuk et al., 2006, 2013; Gómez et al., 2007; Lovera & Cuenca, 2007; Alguacil et al., 2008). Therefore, it is essential that the focus of research related to the use and application of mycorrhizal inoculum is specified to the development of mycotechnologies aimed at the formation of sustainable agroecosystems where assess the colonizing capacity of native mycobionts and promote the permanence and proliferation of members of the mycorrhizal fungal 186 L. Lara-Capistrán et al. community with desirable agronomic traits (Rillig et al., 2016; Mukherjee et al., 2018). Therefore, if the richness and composition of AMF species present in the soil varies according to the abiotic factors and predominant host plants in a given area (Cuenca, 2015), then understanding the effect of agronomic practices could contribute to the identification of management strategies that optimize the benefits of AM in the production of various crops.
... In this sense, Table 1 shows the current taxonomic classification of these symbionts, considering the new families and genera that have so far been reported by internationally renowned researchers such as Oehl and Sieverding (2004), Walker and Schüßler (2004), Spain et al. (2006), Palenzuela et al. (2008), Goto et al. (2012), Oehl et al. (2008Oehl et al. ( , 2011b; Sieverding et al. (2015), Błaszkowski et al. (2017Błaszkowski et al. ( , 2018, and Symanczik et al. (2018), among others. ...
... Thus, once the spore has matured, the saccule collapses and leaves this scar on its way, located in the structural layer "2" of the Acaulospora, Ambispora, Archaeospora, Entrophospora and Sacculospora genera (Oehl et al., , 2011bKaonongbua et al., 2010) (Fig. 1a). • Clamping hypha: It occurs with different number of layers, shapes and occlusions at the base of the glomerospora in the genera Ambispora, Claroideoglomus, Diversispora, Desertispora, Dominikia, Innospora, Kamienskia, Funneliformis, Glomus, Pacispora, Paraglomus, Pervetustus, Rhizoglomus, Redeckera, Sclerocystis, Septoglomus, and Simiglomus ( Fig. 1) (Oehl & Sieverding, 2004;Schüßler & Walker, 2010;Oehl et al., 2011b;Błaszkowski et al., 2015Błaszkowski et al., , 2017Symanczik et al., 2018). • Septum: Structure that separates the glomerospore from the subjection hypha with a septum; the septum can be located at the base or the middle part of the hypha (Fig. 1d) and, according to its position, makes it belong to one of the genera mentioned above (Oehl et al., 2011d;Souza, 2015b). ...
Chapter
Currently in ecosystems, plants have evolved together with arbuscular mycorrhizal fungi (AMF) for millions of years. The arbuscular mycorrhiza is a mutualistic symbiosis in which the plants provide carbohydrates to the fungi and these in turn the mineral nutrients available to the plant such as phosphorus and nitrogen. Considered as the most important fungi group in terrestrial ecosystems due to their symbiotic behavior, establishing symbiosis with most vascular plants. The following paper literature review is presented where some important aspects of the systematic taxonomy of AMF are mentioned, as currently reported by some groups of taxonomists of these fungi and some morphological characteristics such as a group of walls, shapes, color, etc., of this group of fungi., as well as its diversity and ecology of this symbiosis in natural ecosystems and agroecosystems.
... These works gather important information on ecological plant-fungi interactions and distribution of AMF in Mexican ecosystems. In recent years, molecular and morphological studies have led to a major advance in the taxonomy of the phylum Glomeromycota, and phylogenetic analysis of nuclear rDNA genes have transferred many species to new families or genera and synonymized some species (Oehl et al. 2008, Oehl et al. 2011d, Błaszkowski et al. 2015, Błaszkowski et al. 2017, Corazon-Guivin et al. 2019a. We aimed to compile a current checklist of AMF in Mexico, organized to include its distribution by vegetation type and climate zones. ...
Article
Full-text available
The biogeographical species list based on data compilation represent a powerful tool to understand fungal diversity distribution. After five decades of extensive studies on arbuscular mycorrhizal (Glomeromycota) diversity we compiled a checklist with 160 species recorded in Mexico based in 95 publications. The richness found represents 49 % of species, distributed in 34 genera, 13 families and five orders in Glomeromycota. The genera Acaulospora and Glomus were dominant, with 27 and 26 species, respectively. The most represented spore development type was ectocarpic species (72 %) followed by glomerocarpic (28 %). The vegetation type with the highest species richness was agroecosystems (135 spp.), followed by xerophytic shrublands (74 species). Low number of species were recorded in aquatic and underwater vegetation (38 spp.) and coastal sand dunes (28 spp.). The Jac-card similarity index varied from 0.32 to 0.66, indicating a low to medium level of overlapping in AMF species between vegetation types in Mexico. More effort should be carried out on ecological and morphological studies of a larger geographical scale mostly in priority areas or less-studied vegetation types to better understand species distribution and to increase the number of AMF species that may still be discovered in Mexico. The inventory allows the definition of strategies for future studies in Mexico, a very biodiverse country, aiming to expand knowledge of AMF distribution as well as allowing the description of new taxa.
... RPB1 sequences of Ar. schenckii, Innospora majewskii, and Paraglomus laccatum were obtained by amplification with primers designed by Stockinger et al. (2014) following the recommended conditions. We used the same DNA, from which 18S-ITS-28S sequences had been obtained (Błaszkowski et al. 2017). The first PCR was performed with primers RPB1-Ac and RPB1-DR2160r, while the second PCR with RPB1-Ac and RPB1-DR1210r + RPB1-DR1210r_Aca_div. ...
Article
Full-text available
Phylogenetic analyses of sequences of the nuc rDNA small subunit (18S), internal transcribed spacer (ITS1-5.8S-ITS2 = ITS), and large subunit (28S) region (= 18S-ITS-28S), as well as sequences of this region concatenated with sequences of the largest subunit of RNA polymerase II (rpb1) gene proved that the species originally described as Acaulospora polonica (phylum Glomeromycota) represents a new combination in a new genus and a new family of the ancient order Archaeosporales, here introduced into the Glomeromycota under the names Polonospora polonica, Polonospora and Polonosporaceae, respectively. The phylogenetic analyses and BLAST queries also indicated that the Polonosporaceae still contains several morphologically undescribed taxa at the ranks of genus and species, which have a worldwide distribution.
... The classification used for Glomeromycota was based on Oehl et al. (2011), including recent updates (e.g. Błaszkowski et al. 2017, Corazon-Guivin et al. 2019) and for the taxonomic organization of classes, order, families and genera we followed Baltruschat et al. (2019) and Wijayawardene et al. (2020). ...
Article
Full-text available
Brazil is a megadiverse country, with around 20 % of all known biodiversity in the world. This diversity is distributed in six major biomes that present different floristic characteristics. These environments suffer constant threats, and the knowledge about their communities is essential for conservation. Among the soil organisms, the arbuscular mycorrhizal fungi (AMF – Glomeromycota) play a fundamental role in maintaining plant communities and are distributed in manifold environments, symbiotically associated to most terrestrial plants. The present synthesis brings the Brazilian records of 192 AMF species, belonging to 38 genera and 15 families, which represents circa 60 % of all diversity known in Glomeromycota. Most of the records of AMF species are in the Atlantic rainforest (153 species), Cerrado savanna (140), Caatinga dry forest (120) and the Amazon rainforest (97 species). Pantanal and Pampa so far have 19 and five AMF species, respectively. In general, Brazilian biomes harbor high AMF species richness, constituting an important repository of Glomeromycota taxa. The conservation of these areas is necessary to ensure the permanence of the native plant communities and associated fungi. Likewise, the importance of AMF diversity studies has to be emphasized, considering that these microorganisms are essential elements for the conservation of terrestrial environments and the survival of many threatened plant species.
Article
Full-text available
Arbuscular mycorrhizal fungi (AMF) have been frequently reported as effective tools for alleviating environmental stresses and promoting plant growth and yield. In this study, we aimed to isolate, culture, and identify molecular and morphological AMF species associated with date palms and spontaneous plants present at eight sites in the arid agroecosystem of the Dr a-Tafilalet oasis of Morocco. We tested the capacity of AMF to colonize micropropagated date palm seedlings at their first acclimatization stage. Soil and root samples were collected to propagate indigenous AMF strains using trap culture techniques under greenhouse conditions and, at the same time, their root colonization potential was evaluated. We used freshly propagated spores to establish a collection of single spore-derived cultures. Morphological, microscopic, and molecular approaches were adopted to quantify AMF communities in the roots and rhizosphere and identify the recovered AMF species present at the eight sites. In an inoculation experiment, a micropropagated date palm was inoculated with a consortium of four cultured AMF strains, alone or in combination with synthetic fertilizer or compost. Our results showed that after two cycles of trap culturing, the frequency and intensity of AMF colonizing host plant roots significantly increased, exceeding 91% and 50%, respectively. Using three trap plant species and favorable growing conditions helped increase root colonization rates and AMF proliferation. AMF propagation resulted in the cultivation of 13 AMF strains. Molecular and morphological analyses revealed six different AMF species within our cultures: Pervetustus simplex, Claroideoglomus etunicatum, Albahypha drummondii, Septoglomus xanthium, Funneliformis mosseae, and Rhizoglomus irregulare. Results of the inoculation experiment revealed that root colonization was higher in treatments augmented with synthetic fertilizers than those supplemented with compost with 84.4% as against 46.7% and 26.1% as against 12.3%, respectively, for colonization frequency and intensity. In contrast, shoot length and stem diameter of date palms were significantly higher in treatments augmented with compost and AMF than that with synthetic fertilizers. Synthetic fertilizers might have been partially immobilized directly after application, limiting availability and resulting in lower growth performance of date palms. These findings indicated that date palm groves are a niche for efficient indigenous AMF strains that can colonize and enhance date palm growth at the early stages.
Article
Full-text available
In this 8th contribution to the Fungal Systematics and Evolution series published by Sydowia, the authors formally describe 11 species: Cortinarius caryae, C. flavolilacinus, C. lilaceolamellatus, C. malodorus, C. olivaceolamellatus, C. quercophilus, C. violaceoflavescens, C. viridicarneus, Entoloma meridionale (Agaricales), Hortiboletus rupicapreus (Boletales), and Paraglomus peruvianum (Paraglomerales). The following new country records are reported: Bolbitius callistus (Agaricales) from Russia and Hymenoscyphus equiseti (Helotiales) from Sweden. Hymenoscyphus equiseti is proposed as a new combination for Lanzia equiseti, based on ITS and LSU sequence data in combination with morphological study.
Article
Full-text available
This review presents the development of researches on arbuscular mycorrhizae (AM) conducted in Cuba, a tropical Caribbean island rich in biodiversity. The key findings from this work are highlighted and presented as a stepping stone for future research. Cuban research has contributed to understand the diversity and functionality of AM in several tropical ecosystems, mainly evergreen forests, agroecosystems, sand dunes and pasturelands. Inventories were conducted in 10 out of 16 provinces reported 79 AM species, representing 25% of the known species worldwide. Cuban researchers have a great deal of expertise in Glomeromycota taxonomy and have described 11 new species, of which six were not reported elsewhere in the world. Furthermore, important studies conducted in Cuba have shed light on the mycotrophic plants, the role of AM in forest ecosystems, and their use in crop production. The contribution of AM to ecosystem processes is a priority line of research. Interdisciplinary and multidisciplinary researches are necessary to define the role of AM symbioses and improve biogeochemical models. Recently created Cuban Mycorrhizal Research Network will help to coordinate validation campaigns for various biofertilizers with training courses for Cuban farmers to disseminate the key results on AM. Despite the challenges for Cuban mycorrhizologists, molecular (genomic) techniques, stable isotopes and nuclear magnetic resonance should also be included as priority lines of research in the future. Keywords-Arbuscular mycorrhizal fungi-diversity-ecosystems-mycorrhizal research-symbiotic associations Studies in Fungi 6(1): 240-262 (2021) www.studiesinfungi.org ISSN 2465-4973
Article
Full-text available
Learning more about the biodiversity and composition of arbuscular mycorrhizal fungi (AMF) under alternative agricultural management scenarios may be important to the sustainable intensification of switchgrass grown as a bioenergy crop. Using PacBio single-molecule sequencing and taxonomic resolution to the level of amplicon sequence variant (ASV), we assessed the effects of nitrogen amendment on AMF associating with switchgrass and explored relationships between AMF and switchgrass yield across three sites of various productivity in Wisconsin. Nitrogen amendment had little effect on AMF diversity metrics or community composition. While AMF ASV diversity was not correlated with switchgrass yield, AMF family richness and switchgrass yield had a strong, positive relationship at one of our three sites. Each of our sites was dominated by unique ASVs of the species Paraglomus brasilianum, indicating regional segregation of AMF at the intraspecific level. Our molecular biodiversity survey identified putative core members of the switchgrass microbiome as well as novel clades of AMF, especially in the order Paraglomerales and the genus Nanoglomus. Furthermore, our phylogenies unite the unknown, cosmopolitan, soil-inhabiting clade GS24 with Pervetustaceae, an enigmatic family prevalent in stressful environments. Future studies should isolate and characterize the novel genetic diversity found in switchgrass agroecosystems and explore potential yield benefits of AMF richness.
Article
Full-text available
Zygomycete fungi were classified as a single phylum, Zygomycota, based on sexual reproduction by zygospores, frequent asexual reproduction by sporangia, absence of multicellular sporocarps, and production of coenocytic hyphae, all with some exceptions. Molecular phylogenies based on one or a few genes did not support the monophyly of the phylum, however, and the phylum was subsequently abandoned. Here we present phyloge-netic analyses of a genome-scale data set for 46 taxa, including 25 zygomycetes and 192 proteins, and we demonstrate that zygomycetes comprise two major clades that form a paraphyletic grade. A formal phylogenetic classification is proposed herein and includes two phyla, six subphyla, four classes and 16 orders. On the basis of these results, the phyla Mucoromycota and Zoopago-mycota are circumscribed. Zoopagomycota comprises Entomophtoromycotina, Kickxellomycotina and Zoopa-gomycotina; it constitutes the earliest diverging lineage of zygomycetes and contains species that are primarily parasites and pathogens of small animals (e.g. amoeba, insects, etc.) and other fungi, i.e. mycoparasites. Mucor-omycota comprises Glomeromycotina, Mortierellomy-cotina, and Mucoromycotina and is sister to Dikarya. It is the more derived clade of zygomycetes and mainly consists of mycorrhizal fungi, root endophytes, and decomposers of plant material. Evolution of trophic modes, morphology, and analysis of genome-scale data are discussed.
Article
Full-text available
Two new species of arbuscular mycorrhizal fungi (AMF) of the recently erected genus Dominikia (Glomeromycota) are described based on their morphology and phylogenetic analyses of SSU-ITS-LSU sequences. The distinctive morphological characters of the first species, Dominikia duoreactiva sp. nov., is the formation of loose clusters with yellow-coloured, 30-70 μm diameter spores having a three-layered spore wall, of which layers 1 and 3 stain in Melzer’s reagent. The second species, Dominikia difficilevidera sp. nov., is distinguished by its hyaline, 31-45 μm diameter spores, which arise mainly singly and have a three-layered spore wall, of which layer 1 is thicker than the structural laminate layer 2, and layer 3 is flexible to semi-flexible. Both species were originally associated with maritime dune plants; D. duoreactiva comes from the Giftun Island, Egypt, Africa, and D. difficilevidera from the Słowin´ ski National Park, Poland. Based on available data, we suggest D. duoreactiva occurs rarely in the world, and D. difficilevidera has a worldwide distribution, but it either occurs infrequently or has been overlooked or lost during spore extraction from soils of many sites because of its extremely small and hyaline spores. A method allowing the extraction of even the smallest spores of AMF, but observable under a dissecting microscope, is described.
Article
A recent reclassification based on molecular findings and morphological characters placed Acaulospora trappei in the Archaeosporaceae. The emendations presented here reflect findings from a study of water-mounted spores of the type species of Archaeospora, A. trappei. A distinctive interior wall configuration, novel germination structure and dimorphism are reported.
Article
The landscape-scale pattern of distribution of maquis, maquis with emergent conifers (Araucaria laubenfelsii), and rain forest, on ultramafic substrate at Mont Do, New Caledonia, is investigated in relation to soil and plant chemistry, light and moisture. The structure and composition of these vegetation types reflects the impacts of disturbance on the one hand, and of physiological stresses on the other. Disturbance by fire is important in determining the presence and abundance of maquis and rain forest at the landscape level and is discussed in detail by Perry et al. elsewhere in this issue.1 The impacts of light environments, water availability and soil chemistry on the succession of vegetation from maquis to forest are also important. The chemistry of iron-crust and eroded oxisol soils does not vary greatly between vegetation types, and does not appear to define the distribution of species at the local scale. Nevertheless, low concentrations of macronutrients (such as P) and slow rates of biomass accumulation associated with this ultramafic landscape may be important in slowing the rate of progression of the vegetation from maquis to forest. Chlorophyll fluorescence studies of seedlings, saplings and trees in maquis and forest provide strong evidence for severe reductions in photosynthetic efficiency in photosystem II on clear days for seedlings growing in maquis. The importance of increased water supply to plants establishing beneath emergent araucarians in maquis through cloud-combing is also illustrated.
Article
Two ancestral clades of arbuscular mycorrhizal fungal species were discovered from deeply divergent ribosomal DNA sequences. They are classified here as two new families Archaeosporaceae and Paraglomaceae. Each family is phylogenetically distant from each other and from other glomalean families, despite similarities in mycorrhizal morphology and fatty acid profiles. Shared mycorrhizal morphology is not surprising, since it is highly conserved and resolves other taxa in Glomales at both family and suborder levels. At the present time, each family consists of one genus. Archaeospora (Archaeosporaceae) includes three species forming atypical Acaulospora-like spores from sporiferous saccules. Two of these species are dimorphic, forming Glomus-like spores as well. Paraglomus (Paraglomaceae) consists of two species forming spores indistinguishable from those of Glomus species. Morphological characters once considered unique, such as the sporiferous saccule defining species of Acaulosporaceae, clearly are distributed in phylogenetically distant groups. The simple design of spores of some species in Glomus also masks considerable divergence at the molecular level. It is the combination of DNA sequences, fatty acid profiles, immunological reactions against specific monoclonal antibodies, and mycorrhizal morphology which provides the basis for recognizing Archaeospora and Paraglomus. These results reinforce the value of molecular data sets in providing a clearer understanding of phylogenetic relationships, which in turn can lead to a more robust taxonomy.