ArticlePDF Available

Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen Shoot Virus Comprises Multiple, Divergent Molecular Variants

Authors:

Abstract and Figures

swollen shoot virus (CSSV) [Badnavirus, Caulimoviridae] causes swollen shoot disease of cacao (Theobroma cacao) L. in West Africa. Beginning in ~2002, tests once effective for detection of CSSV failed to detect virus in ~50-70% of symptomatic cacao plants in Ghana and Cote d’Ivoire, suggesting the possible emergence of an uncharacterized CSSV variant(s). Asymptomatic and symptomatic cacao and non-cacao plant samples from Cote d’Ivoire were subjected to polymerase chain reaction (PCR) amplification using eight different sequence-specific and/ or degenerate primer pairs with an expected size amplicon of 375-1100 base pairs. The frequency of PCR-amplification was variable, depending on sample-primer combination. Virus was not detectable in all symptomatic samples, despite characteristic CSSV-like symptoms, and several asymptomatic samples were CSSV-positive. Phylogenetic analysis using Maximum Likelihood of DNA sequences determined from the amplicons resulting from each primer pair resolved two to three groups, two that were closely related to previously reported CSSV isolates, and a third previously undescribed group. Based on the badnavirus species threshold at ≥ 80% pairwise nucleotide (nt) identity for the taxonomicallyinformative RT-RNase H region of the genome, analysis of a partial fragment corresponding to this locus resolved four CSSV groups, at 66-99% nt identity, among the PCR-amplifiable field isolates. Also, sequence analysis of as many as seven additional regions of the CSSV genome revealed extensive within-genome variability. These findings provide robust evidence for extensive genomic variation among multiple, divergent CSSV variants associated with swollen shoot disease symptoms in cacao in West Africa. Keywords: Badnavirus; Caulimoviridae; dsDNA virus; Emergent plant virus; Mealybug-transmitted virus; Pararetrovirus
Content may be subject to copyright.
Sci Forschen
Open HUB for Sc i e n t if i c R e s e a r c h
Journal of Emerging Diseases and Virology
Open Access
Copyright: © 2017 Chingandu N et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Volume: 3.1
Research Article
Unexpected Genome Variability at Multiple Loci
Suggests Cacao Swollen Shoot Virus Comprises
Multiple, Divergent Molecular Variants
Nomatter Chingandu1, Kofe Kouakou2, Romain Aka2, Osman A Gutierrez3 and
Judith K Brown1*
1School of Plant Sciences, University of Arizona, Tucson, AZ 85721, USA
2Centre National de Recherche Agronomique (CNRA), Programme Cacao, Divo, Côte d’Ivoire
3USDA-ARS Subtropical Horticultural Research Station, Miami FL 33158, USA
Received date: 08 Dec 2016; Accepted date: 09
Mar 2017; Published date: 15 Mar 2017.
Citation: Chingandu N, Kouakou K, Aka R,
Gutierrez OA, Brown JK (2017) P Unexpected
Genome Variability at Multiple Loci Suggests
Cacao Swollen Shoot Virus Comprises Multiple,
Divergent Molecular Variants. J Emerg Virol Dis
3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Copyright: © 2017 Chingandu N et al. This is an
open-access article distributed under the terms
of the Creative Commons Attribution License,
which permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
*Corresponding author: Judith K. Brown, School of Plant Sciences, 1140 E. South Campus
Drive, University of Arizona, Tucson, AZ 85721 USA, E-mail: jbrown@ag.arizona.edu
Introduction
eobroma cacao (L.), or cacao (Malvaceae), is cultivated for the bean
used to manufacture chocolate, confectionaries, and non-food products.
Over 70% of the global supply of beans is produced in West Africa making
it an essential crop for economic and food security [1]. e yield and
quality of beans are reduced by feeding damage caused by insect pests,
and by pathogens, including fungi [2] and plant viruses [3,4]. e Cacao
swollen shoot virus (CSSV) [5] is the most economically-important among
plant viruses known to infect the cacao tree. e virus was rst reported
in 1936 in cacao in Ghana [6]. It is endemic throughout West Africa,
including in Cote d’Ivoire [7,8], Nigeria [9,10], Sierra Leone [11], and
Togo [12,13], infecting many uncultivated species in the Bombacaceae,
Malvaceae, Sterculiaceae, and Tiliaceae [14-16]. Further, outbreaks of
CSSV in cacao have been correlated to the proximity of farms to native
forest trees, and disease prevalence and rate of subsequent spread are
inuenced by elevation, precipitation, and temperature [17].
CSSV is classied in the genus Badnavirus (family, Caulimoviridae)
[18,19]. e double-stranded, circular DNA genome of CSSV of
approximately 7.0-7.3 kilo base pairs (kbp) in size, is encapsidated in a
non-enveloped 128 × 28 nm bacilliform particle [20]. e badnavirus
genome contains one discontinuity in the viral plus strand [21,22], the
location of the priming site for reverse transcription of the DNA minus
strand [19,23]. e CSSV genome encodes from four to six open reading
frames (ORFs), which are named ORFs 1-4, and X and Y [8,21,24].
Although the function of many of the viral genes remain uncharacterized,
ORF2 is known to encode a nucleic-acid binding protein [25], whereas,
ORF3 encodes a polyprotein that is processed into movement (MP), coat
protein (CP), and reverse transcriptase (RT), and an aspartate protease
(AP) and ribonuclease H (RNase H) [24] that function in polypeptide
cleavage and RNA hydrolysis, respectively.
Symptoms caused by CSSV infection of cacao trees range from mild
to severe and vary seasonally, being most evident and severe on new
ush growth that develops following each rainy season. Foliar symptoms
develop predominantly on newly developing and young leaves, manifest
as red and green vein-banding, or yellow- or white-green mosaics. New
vegetative growth developing from the base of the tree or the trunk,
referred to as shoots, develop swellings caused by viral-induced phloem
proliferation [26]. Within 3-5 years aer symptom development, infected
trees undergo dieback, decline, and then death. Compared to uninfected
trees, CSSV-infected trees produced fewer pods and beans, and both size
and quality of beans are reduced [27].
e CSSV is transmitted in a semi-persistent manner by 14 mealybug
species [28,29], but is not pollen or seed transmitted [30], despite evidence
that it can be detected transiently in seed [31]. e long and short distance
spread of CSSV is exacerbated by human-mediated exchange of virus-
infected cacao cuttings.
Disease management has relied on replacement of infected trees with
virus-free planting material, either grown from seed, or more recently, as
seedlings [32-34]. Also, cross-protection using mild strain such as N1 or
SS365B, showed initial promise for reducing the eects of CSSV severe
strain 1A [35,36], however, a recent study found that spread of the severe
CSSV strains had increased over time, resulting in deterioration of the
Abstract
Cacao swollen shoot virus (CSSV) [Badnavirus, Caulimoviridae] causes swollen shoot disease of cacao (Theobroma cacao) L. in West Africa.
Beginning in ~2002, tests once effective for detection of CSSV failed to detect virus in ~50-70% of symptomatic cacao plants in Ghana and
Cote d’Ivoire, suggesting the possible emergence of an uncharacterized CSSV variant(s). Asymptomatic and symptomatic cacao and non-cacao
plant samples from Cote d’Ivoire were subjected to polymerase chain reaction (PCR) amplication using eight different sequence-specic and/
or degenerate primer pairs with an expected size amplicon of 375-1100 base pairs. The frequency of PCR-amplication was variable, depending
on sample-primer combination. Virus was not detectable in all symptomatic samples, despite characteristic CSSV-like symptoms, and several
asymptomatic samples were CSSV-positive. Phylogenetic analysis using Maximum Likelihood of DNA sequences determined from the amplicons
resulting from each primer pair resolved two to three groups, two that were closely related to previously reported CSSV isolates, and a third
previously undescribed group. Based on the badnavirus species threshold at ≥ 80% pairwise nucleotide (nt) identity for the taxonomically-
informative RT-RNase H region of the genome, analysis of a partial fragment corresponding to this locus resolved four CSSV groups, at 66-99% nt
identity, among the PCR-ampliable eld isolates. Also, sequence analysis of as many as seven additional regions of the CSSV genome revealed
extensive within-genome variability. These ndings provide robust evidence for extensive genomic variation among multiple, divergent CSSV
variants associated with swollen shoot disease symptoms in cacao in West Africa.
Keywords: Badnavirus; Caulimoviridae; dsDNA virus; Emergent plant virus; Mealybug-transmitted virus; Pararetrovirus
ISSN 2473-1846
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
2
benecial eects of mild-isolate induced cross-protection, and leading to
decreased life spans of trees [37]. Chemical control of mealybug vectors
has shown minimal promise for reducing rates of virus spread [38,39].
However, the expansion of cacao farms to previously uncultivated locales,
while at the same time abandoning diseased farms that can serve as a CSSV
inoculum source has resulted in virus spread into new plantings by the
mealybug vectors [1]. Long-term disease management has been attempted
by breeding programs established during the 1940’s and ongoing to the
present, to develop CSSV resistance. ese eorts have exploited cacao
germplasm introduced into West Africa from the Amazon Basin of South
America, however, resistance even when eective for periods of time, has
not proven durable [40-43]. Despite management eorts, virus infection
has continued to be manifest as characteristic CSSV symptoms, or
recently, by a rapid decline and death phenotype rst observed in western
Ghana during ~2000-2002, and then in eastern and western Cote dIvoire
[44] and Togo [45] during 2003-onward. Whether the similar symptom
phenotypes observed at dierent sites where outbreaks have occurred are
associated with the same CSSV variant(s) has not been determined.
Previously, an enzyme-linked immune sorbent assay (ELISA) was
widely used for CSSV detection in West Africa [10,46,47]. Recently, ELISA
tests have failed to detect CSSV in approximately 25-30% of samples
analyzed from symptomatic trees. To the present, there is no serological
or molecular diagnostic test available for comprehensive CSSV detection.
Seven complete CSSV genome sequences have been deposited in the
NCBI GenBank database. ey range from 7006-7297 bp in size and
collectively, share 71-98% nucleotide (nt) identity (authors, unpublished
data). Based on alignment of the seven genome sequences, PCR primers
have been designed that amplify a fragment of CSSV ORF1 [48] or ORF3
[49]. However, neither primer set was found capable of detecting CSSV
in all symptomatic leaf samples tested from Ghana [30,50], Cote d’Ivoire,
or Togo [13,49]. An alternative practice used for CSSV detection in
exotic germplasm has been applied in quarantine units, and uses graing
of scions from suspect plants onto the CSSV-susceptible ‘Amelonado’
rootstock, followed by periodic inspection of indicator plants for three-
years, post-graing for evidence of CSSV symptoms [51], overall, a time-
consuming, expensive, and impractical approach.
e increasing spread of CSSV, including both isolates associated with
the classical CSSV symptom phenotypes, and the recently discovered
‘severe decline’ phenotypes has made the development of eective
diagnostic tests essential, to enable the epidemiological studies that rely on
understanding the identity and distribution of CSSV variants throughout
the region. Indeed, sequencing of PCR amplicons representing a variable
region found in ORF3 that encodes the viral movement protein, has
resolved six and nine CSSV groups in Cote d’Ivoire and Ghana, respectively
[49,50]. Although this apparently, highly divergent coding region is
not considered taxonomically informative at the species level, results
underscore the greater-than expected molecular variability observed
among CSSV isolates, and suggests the possibility that a number of as yet
undescribed species and/or strains may be associated with distinct CSSV-
like symptoms occurring in cacao plantings throughout West Africa.
e objective of this study was to design degenerate or non-degenerate
primer sets for CSSV detection that were feasibly based on sequence
alignments of the seven available CSSV genome sequences. Molecular
testing focused on cacao samples collected from trees in CSSV-like
outbreak areas that exhibited a range of symptom phenotypes occurring in
cacao plantations throughout eastern, central, and western Cote d’Ivoire.
Two previously published primer pairs designed for molecular detection
of CSSV [48,49], a pair designed for ‘universal’ badnavirus detection [52],
and ve primers designed herein around selected dierent genomic coding
and non-coding regions, or ‘loci, were evaluated for the ability to detect
CSSV by polymerase chain reaction (PCR) amplication. Annotation of
the amplicons indicated that some sequences were non-viral, and oen
of cacao host origin, indicating occurrences of viral-plant host sequence
homology and therefore lack of primer specicity. ose annotated as
CSSV-like and analyzed with their respective genomic loci with respect
to pairwise distances and phylogenetic relationships, revealed extensive
between-genome variability resulting in multiple molecular variants.
Materials and Methods
Plant samples and total DNA isolation
Samples of leaves and/or swollen shoots were collected from
91 symptomatic and asymptomatic cacao trees in the three major
cacao growing regions of central, eastern, and western Cote d’Ivoire,
experiencing recent and/or long-term CSSV outbreaks (Figure 1), and
from experimentally inoculated, young, symptomatic cacao plants
maintained at the Centre National de Recherche Agronomique (CNRA),
Côte d’Ivoire, in 2012. An additional 33 samples were collected from
suspect endemic CSSV hosts, representing 15 species, growing near cacao
plantations. e plant samples were preserved in glycerol, and stored at
4°C. Total DNA was isolated from 100 mg of leaf or shoot tissue using the
cetyl trimethylammonium bromide (CTAB) method [53]. e nal pellet
was dissolved in 100 µL of low TE buer (10 mM Tris-HCL (pH 7.5),
containing 0.1 mM EDTA (pH 8.0), and stored at -20°C.
Primer design
Five primer pairs were designed based on a multiple sequence
alignment of seven available full-length CSSV genome sequences:
Accession numbers AJ534983, AJ608931, AJ609019, AJ609020, AJ781003,
JN606110, and L14546. e sequences were aligned using MUSCLE
[54] implemented in CLC Sequence viewer 7.5 (http://www.clcbio.com/
products/clc-sequence-viewer). Four primer pairs were designed within
ORF3 and one pair on the non-coding intergenic region. e coordinates
and approximate size of PCR amplicons are provided in (Table 1 and
Figure 2). ree previously published primer sets included for comparison
Figure 1: The three major cacao-growing regions in Cote d’Ivoire from
which the plant samples analyzed in this study were collected. The
western, central and eastern regions are indicated on the map as blue,
green and red, respectively.
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
3
were those designed to target the movement protein (5’-end of ORF3)
[49] or a fragment of ORF1 [48], and the degenerate ‘general’ badnavirus
Badna FP/RPprimers [52] (table 1, gure 2), herein, referred to as ORF3A,
ORF1, and Badna, respectively. To assess DNA quality, eight samples were
selected for PCR amplication of a 2-kbpplant mitochondrial DNA intron
located within the nad4 gene, between the exons 1 and 2 [55].
Rolling circle amplicationand polymerase chain reaction
e circular DNA present in puried eld sample DNA was enriched
using rolling circle amplication (RCA) and phi29 DNA polymerase [56]
(Templiphi RCA kit, GE Healthcare Bio-Sciences, NJ, USA) according to
manufacturer’s instructions with modications as described [57,58].
e RCA product was used as template for PCR amplication.
Reactions contained 10.5 µL nuclease-free water, 12.5 µL RedTAQ mix
(Sigma-Aldrich, St. Louis, MO, USA), 0.2 µM of each primer, and 1 µL
RCA template in 25 µL. Cycling parameters were: initial denaturation
for 2 min at 94°C, followed by 35 cycles each of denaturation at 94°C for
30s, annealing at 50-56°C for 30s, extension at 72°C for 1 min/kbp, with
a nal extension at 72°C for 10 min. Parameters for Badna primers were
as previously described [52]. e expected amplicon sizes were veried
by agarose gel (0.8%) electrophoresis, in Tris-acetate EDTA buer, pH
8.0. e bands were visualized by GelRed staining (10 µL/mL) (Biotium,
Aurora, CO, USA).
Cloning and DNA sequencing of amplicons
Only PCR amplicons of the expected sizes were ligated into the pGEM
T-Easy plasmid vector (Promega, Madison, WI, USA), followed by
transformation into Escherichia coli DH5α bacterial cells, according to
manufacturer’s instructions using blue-white selection. Colony PCR was
carried out in1X PCR buer, 0.5 U Platinum Taq polymerase (Invitrogen),
0.2 mM dNTP mix (Sigma-Aldrich, St. Louis, MO, USA), 0.2 µM each
of M13 forward and reverse primers, and nuclease- free water, in a nal
volume of 50 µL. Amplicon size was veried by agarose gel electrophoresis
as described above. Two to three plasmids per sample, each bearing the
expected size insert, were subjected to bi-directional Sanger capillary
DNA sequencing at the University of Arizona Genetics Core sequencing
facility (Tucson, AZ).
DNA sequence analysis
e DNA sequences were assembled using SeqMan Pro Soware
Lasergene version 11 (DNASTAR, Madison, WI), and annotated using
BLAST2GO soware [59]. e CSSV sequences were aligned using
MUSCLE [54] implemented in CLC Sequence viewer, version 7.5. To
reduce the number of sequences used for the analyses, those sequences
sharing 100% identity, i.e. ‘haplotypes’, were removed using FaBox v1.41
soware [60]. Representative haplotype sequences for each CSSV genomic
locus were deposited in the NCBI GenBank database, and assigned the
Accession numbers KY473626 - KY473897.
e pairwise nt identity was calculated for each group of amplicons,
per primer pair or genomic locus, using Sequence Demarcation Tool
soware (SDTv1.2) [61]. e amplicon sequences representing the partial
RT-RNase H locus were grouped with a basis in ≥ 80% shared nt identity.
Primers forward (F),
reverse (R) Primer pairs 5’– 3’ orientation Primer coordinates Primer Ta°C Expected size (bp)
RT_F AACGACAACACTGAAAAGGA 5325 - 5344 56 421
RT_R GTGCCCAAAAATTCAATCTC 5727 - 5746 56
ORF3A_F GTYRTACCRRAYAYYATGATGAC 1848 - 1870 55 532
ORF3A_R GTTYCCRTTRSYRGAYTCYTCCCATAC 2355 - 2380 55
ORF1_F AACCTTGAGTACCTTGACCT 498 - 517 56 375
ORF1_R TCATTGACCAACCCACTGGTCAAG 849 - 872 56
P1_F RGCAGCWGAARWGGCWAAGR 1244 - 1263 56 774
P1-R TTDGGWGTRTTKGAYARYCK 1999 - 2018 56
P2_F ACDGGHTGGGRMRRYGATRA 2461 - 2480 56 804
P2_R TRTCYTTKATRTTGTKGCADGT 3244 - 3265 56
P3_F ATNMHRGTCCARCAGCAGCC 4089 - 4108 56 1042
P3_R TTDATGGGCTTRTCTTCWAT 5112 - 5131 56
P4_F TGGCAACDGAACATGCCATCTC 6585 - 6606 56 1123
P4_R TGGTTGTTGGTCACTTTACT 528 - 547 56
BadnaFP ATGCCITTYGGIAARAAYGCICC 5513 - 5536 50 577
BadnaRP CCAYTTRCAIACISCICCCCAICC 6066 - 6090 50
Table 1: Primer pairs used for PCR-amplication of eight Cacao swollen shoot virus genomic regions. The primer coordinates are based on the CSSV
reference sequence, Genbank Accession number NC_001574.1
Figure 2: The genome sequence map of Cacao swollen shoot virus
(CSSV) showing approximate primer coordinates, based on the Genbank
CSSV isolate Accession number NC_001574. The previously published
primers, Badna [52], ORF1 [48], and ORF3A [49] were designed to
target regions denoted in solid green. The locations of primers designed
herein are shown in solid orange. The red arrow indicates the position
of nucleotide coordinate one, based on the convention established for
badnaviral genome sequences.
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
4
Phylogenetic analysis was carried out using Maximum Likelihood
(ML), implemented in MEGA6 [62] with 1000 bootstrap iterations, and
the nt substitution model [62] predicted to have the lowest Bayesian
Information Criterion score.
Results
Frequency of CSSV detection
Analyses of the PCR amplicon sequences obtained using the combined
results for each primer set, indicated CSSV was detectable in 56 cacao
and 13 non-cacao plant samples (from a total of 69) of the 124 samples
tested. However, the ability of each primer set to produce an amplicon of
the expected size was highly variable, depending on the sample. Certain
primers did not produce a CSSV-amplicon from samples otherwise
conrmed to be CSSV-positive by PCR using other primer pairs, indicating
that the PCR-amplication was generally inconsistent among the primer
sets. e PCR-amplication of a CSSV-like sequence by one or more of the
eight primer pairs (Table 2) indicated that 69 of 124 samples were positive
for CSSV detection e.g. veried for each sequence by BLASTn analysis.
e number of amplicons obtained from the 124 eld samples using the
eight primer pairs ranged from 24 to 52, representing an amplication rate
ranging from 19 and 42%. Among the 69 samples that were conrmed
CSSV-positive by one or more primer set, virus was found to be detectable
in only35 to 75% samples.
Among the primers tested, P4, which targeted the CSSV non-
coding intergenic region yielding a 1,123 bp product, had the highest
amplification frequency, at 42% (52/124), whereas, the PCR primers
designed to amplify an expected size product of 421 of the CSSV
conserved RT region (located in ORF3), showed the second highest
frequency, at 37% (46/124).
e previously published ORF3A primers and the P3 primers (herein),
amplied CSSV at a similar frequency of 33%, or 41 of 124 samples. e
ORF3A primer target is a 532 fragment of the ORF3-movement protein
gene, located at the nt coordinates 1848 – 2380 (GenBank Accession
NC_001574.1), compared to P3 that was designed to amplify a dierent
ORF3 fragment corresponding to the pepsin-like aspartate protease
region. When the Badna primers were tested, only 28% (35/124) of eld
samples were CSSV positive. e Badna primers have been reported to be
‘universal’ or genus-specic, having been designed by taking into account
all badnaviral genome sequences available in public databases at the time.
e 577 bp Badna amplicon represents about half, or 46.9%, of the RT-
RNase H locus sequence. is 577 bp fragment can be amplied from
divergent variants using these primers because they and the region they
amplify represent the most conserved region within the RT-RNase H locus
that it sels ~1,230 bp in size. is 1,230 bp region of the CSSV and other
badnaviral genomes has been ratied by the International Committee
on Taxonomy of Viruses (ICTV) for species demarcation in the genus
Badnavirus [19]. Although the fragment amplied here represents only
about 47% of the RT-RNase H domains combined, it has been widely used
for provisional badnaviral species classication, nonetheless [50,63-66].
In lieu of having the complete RT-RNase H sequence for isolates studied
herein, the use of this region for pair wise nucleotide identity analysis to
provisionally classify the isolates to species followed these latter examples.
Amplication of CSSV using the P2, P1, and ORF1 primers yielded
approximately one-fourth or less of the eld isolates tested, at 27%
(34/124), 23% (29/124), and 19% (24/124), respectively. e P1 and P2
primers targeted the ORF3 5’-end, yielding amplicons of 774 bp and 804
bp in size, respectively. Also, the P1 primers amplify the region located
between nt coordinates 1244 - 2018, which overlaps with the target
region of the previously published ORF3A primers [49]. e P2 primers
amplied a fragment anked by nt coordinates 2,461 - 3,265, in a region
that harbors no predicted functional protein domains in NCBI Conserved
Domain Database searches [67]. e ORF1 primers directed amplication
of a 375 bp region of ORF1 that contains a badnavirus-specic domain of
unknown function, DUF1319 [67] present in all seven available genomes.
To determine whether the inability of the PCR primers to amplify CSSV
from otherwise CSSV-symptomatic samples could be due to DNA quality,
eight samples were selected for testing by PCR-amplication with nad4
primers [55], based on poor CSSV amplication. Four of the eight samples
did not yield a product regardless of CSSV primer pair, and four had been
amplied by only one or any two CSSV primer pairs. Results using the
nad4 primers indicated that all eight samples yielded the expected 2 kbp
amplicon (data not shown), conrming that the DNA could be used for
successful PCR amplication of plant genes, and therefore should also
have produced CSSV amplicons given sucient virus titer.
BLASTn search
e GenBank database BLASTn search for the 69 amplicon sequences
obtained revealed robust match(es) with one or more CSSV sequences,
at an e-value of 0 and ≥ 87% similarity scores. e only exceptions were
sequences from ve samples amplied with Badna, ORF3A, and P3
primers, which had similarity scores of 69-76%, e-values of 8e-61 to 1e-
102, and only 30-70% coverage.
One or more primer pairs successfully amplied CSSV-like or other
badnaviral sequences froms even non-cacao plant species. e plant host
species and successful primer(s) were for: Carica papaya (Badna,P4,RT),
Ceiba pentandra (all except P1), Commelina erecta (Badna), Dioscorea
cayenensis (P4), Spigelia anthelmia (P4), Tapinanthus bangwensis (P4), and
Xanthosoma maafa (ORF3A,P4). Among these endemic plant species, C.
pentandra has been previously reported as a host of CSSV in mealybug
transmission studies [15].
All eight PCR primers, except ORF1, produced at least some amplicons
that when sequenced, were annotated as cacao genomic DNA. e
BLASTn results indicated that most of the cacao sequences shared their
highest similarity score(s) with T. cacao sequences. Examples of cacao
sequence hits included the DNA/RNA polymerase super family, gag-pro-
like proteins, receptor kinases, retrotransposons, reverse transcriptase,
transport proteins, or T. cacao uncharacterized proteins. Perhaps
surprisingly, among the primers tested, the Badna primers amplied the
greatest number of cacao sequences, at 48%. Also, the Badna primers
amplied a 577 bp fragment that was annotated as Dioscorea bacilliform
virus (DBV) or Banana streak Uganda E virus (BSUEV). e latter
amplicons were associated with four cacao samples that also yielded CSSV
amplicons with six of the eight primers, suggesting that they co-infected
RT ORF3A ORF1 P1 P2 P3 P4 Badna
I46/69
(67%)
41/69
(59%)
24/69
(35%)
29/69
42%
34/69
49%
41/69
59%
52/69
75%
35/69
51%
II 46/124
(37%)
41/124
(33%)
24/124
(19%)
29/124
(23%)
34/124
(27%)
41/124
(33%)
52/124
(42%)
35/124
(28%)
III 2/46 2/41 1/24 0/29 1/34 1/41 6/52 3/35
Table 2: Frequency of polymerase chain reaction amplication of a
fragment of the Cacao swollen shoot virus (CSSV) genome using the eight
primer pairs. Rows/Panels I and II show the number and percent of samples
amplied by each primer pair, in relation to the 69 samples conrmed
positive for CSSV, and to the 124 total samples tested, respectively. Panel/
Row III indicates the number of non-cacao plant samples positive for CSSV,
in relation to samples positive for CSSV using each primer pair
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
5
cacao with CSSV. Also, BLASTn searches identied DBV-like badnavirus
sequences in X. maafa (n = 2) and D. cayenensis (n = 1), and a BSUEV-
like sequence in T. bangwensis (n = 1), with similarity search scores at
73–82% for DBV and 73% for BSUEV, with 48-74% coverage and e-values
of 1e-53 to 6e-51.
Pairwise nucleotide comparisons
Analysis of the RT-RNase H partial fragment delimited by the Badna
primers using ≥ 80% nt identity species threshold indicated a shared nt
identity, at 68-99%, among all isolates for which the fragment could be
amplied. However, in the absence of a complete ~1230 bp RT-RNase
H sequence, the analysis was not considered taxonomically informative,
albeit, eventually it will become possible to determine if the result is
taxonomically consistent with the complete locus predictions.
Pairwise distance analysis of CSSV sequences amplied with the eight
primer pairs indicated 66 – 99% shared nt identities. e P1, P4, and
ORF1 primers yielded 63, 98 and 53 CSSV-like amplicons from the eld
isolates, respectively (Table 3). e loci delimited by P1, P4, and ORF1
primers were found to be equally divergent from each other by pairwise
distance analysis, at 74 – 99% shared nt identity, however, the amplicons
are not necessarily from closely related isolates, given the dierent
amplication frequencies for primers P1, P4, and ORF1, at 23, 42 and
19%, respectively (Table 2).
e Badna and ORF3A primers produced 87 and 85 viral amplicons,
respectively, which shared similar nt identity, at 68–99%. Pairwise
nucleotide analysis for the Badna amplicons resolved four CSSV groups,
at ≥ 80% species cuto. Although the Badna primers amplify the partial
region of the RT-RNase H used for taxonomy of badna viruses, the
analysis delimiting four (SDT) groups represents four CSSV variants that
are will most likely be characterized as dierent species. However, it will be
necessary to consider the entire ‘informative sequence’ for each to test this
hypothesis. Among these, Group I contained GenBank CSSV Accessions
AJ609019, AJ608931, AJ609020, L14546, and AJ534983, whereas, Groups
II and III harbored Accessions AJ781003 and JN606110, respectively, and
Group IV contained previously unreported CSSV-like variants that were
highly divergent from Groups I, II, and III isolates, at 73-77%,70-75%, and
71-75 %, respectively.
Based on pairwise identities, the P2- and RT-amplicons shared 71–99%
and 73-99% nt identity, represented by 68 and 77 sequences, respectively.
e greatest divergence occurred among the 82 P3-amplicon sequences,
at 66-99% nt shared identity.
Phylogenetic analysis
Maximum likelihood analysis (>70% bootstrap; 1000 iterations) of the
eight groups of amplicons resolved at least two clades per group, which
also contained one or more CSSV GenBank reference sequences, and
each clade was statistically supported (Figure 3). e CSSV-like sequences
determined from the seven non-cacao samples grouped with sequences
from cacao samples that clustered with available CSSV GenBank
sequences representing cacao isolates from Togo, Ghana or Cote dIvoire.
Phylogenetic trees reconstructed from sequences amplied by ORF1,
RT, P1, and P4 primers were similar by resolving two groups, referred to as
Clades I and II (Figure 3a, b, e, h). In contrast, the phylogeny reconstructed
for Badna, ORF3A, P2, and P3 amplicons each resolved a previously
unknown CSSV-like clade, referred to as Clade III (Figure 3 c, d, f, g).
e relationship among the isolates represented in each phylogenetic
tree did not appear to be based solely on extant geographic origin. In all
instances, Clade I contained isolates collected from central eastern and
western Cote d’Ivoire, three GenBank reference sequences from Ghana
(Accessions AJ608931, AJ609019, and AJ609020), and isolates from
Togo(Accessions, AJ534983, AJ781003 and L14546). An exception to this
pattern was observed by the ORF1 tree, where the three Togo reference
genomes grouped in Clade II (Figure 3a). In contrast, for most trees, Clade
II consisted primarily of isolates from eastern Cote d’Ivoire, GenBank
Accession JN606110 from Cote d’Ivoire, and occasionally, the GenBank
reference from Togo, Accession AJ781003, or R290 from western Cote
d’Ivoire (Figure 3b, c). Overall, <33% of all amplicon sequences grouped
in Clade II with the Cote d’Ivoire GenBank reference, even though all
samples were collected in Cote d’Ivoire.
e nineteen amplicons obtained using the Badna, ORF3A, P2, and P3
primers, grouped in Clade III, sharing <80% nt identity with previously
published CSSV sequences. ese viral sequences were obtained from ve
of the 69 CSSV-positive samples, four of which were cacao while the h
was X. maafa (Figure 3 c, d, f, g). Neither the Badna amplicons (Clade
III; Figure 3c), P2 (Figure 3f) nor the P3 primer pair-derived sequences
(Figure 3g) grouped with apartial or complete genome sequence in
GenBank. However, four ORF3A-amplicons clustered in Clade III with
previously reported partial ORF3-amplicons from Cote d’Ivoire cacao
samples [49]. Conversely, Clade I and II amplicons were most closely
related to the ORF3A MP region, referred to as GroupA, B, and D, where
as Clade III amplicons were closely related to groups E and F, per Kouakou
et al. [49]; (Figure 3d). By comparison, none of the isolates identied
herein clustered with Group A or C reference sequences, except for the
R290MP1 isolate sequence that is positioned between these two groups in
the phylogenetic tree.
In addition, by phylogenetic analysis, several amplicons from cacao
and non-cacao hosts were basal to the three well-supported clades,
indicating they diverged substantially from all other eld isolates,
thereby representing previously unreported CSSV-like types. Lastly, some
amplicons were observed to ‘shi’ among clades I, II, and III, depending
on the primers used for PCR amplication, and involved both cacao- and
non-cacao samples. For example, R290 grouped in Clade I based on the
RT, ORF3A, P2, P3, and P4-derived amplicons, in Clade II with respect to
the RT-RNase H locus, and for the ORF1 amplicon, was basal to Clades I
and II. Similarly, the Togo AccessionAJ781003 loci shied between Clades
I and II for ORF1, RT, RT-RNase H, ORF3A, and P1 amplicons, or were
basal to the latter two clades, with respect to P2, P3 and P4 amplicons.
Collectively, such amplicon-shiing is strongly suggestive of mixed
infections and/or possibly, of interspecic recombination.
Discussion
In this study, eight primers pairs evaluated for PCR-amplication
of CSSV from DNA puried from cacao and non-cacao eld-collected
samples from Cote d’Ivoire, were shown to dier greatly with respect to
amplication frequency. Amplication using the newly designed primer
pairs, RT, P1, P2, P3, and P4, ranged from 23 - 42% (Table 2). By comparison
Primer / region Amplicon
sequences
Pairwise nucleotide
identity
ORF3A 85 68-99%
RT 77 73-99%
P1 63 74-99%
P2 68 71-99%
P3 82 66-99%
P4 98 74-99%
ORF1 53 74-99%
Badna 87 68-99%
Table 3: Pairwise nucleotide identities of amplicon sequences determined
from a fragment of the Cacao swollen shoot virus (CSSV) genome amplied
using the eight primer pairs
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
6
Figure 3: Phylogenetic trees (ML)(1000 bootstrap iterations, >70% bootstrap) of Cacao swollen shoot virus (CSSV) sequences amplied using the eight
primers, ORF1 (a), RT (b), Badna (c), ORF3A (d), P1 (e), P2 (f), P3 (g), and P4 (h). The CSSV sequences available in the NCBI- GenBank database
are indicated by Accession number, in bold. Field isolates collected from the central, eastern and western regions are labeled using green, red and blue
letters, respectively. Statistically supported clades are designated I, II or III. Sequences indicated by an asterisk (*) were determined from endemic, wild
plant species. The partial genome fragment of Citrus yellow mosaic virus (Genbank Accession number AF347695) corresponding to the ORF3 priming
region, was included as the outgroup (d). The use of the designations, Group A – F (d) was adopted from Kouakou et al. [49] and were used to compare to
the current grouping system. The letter codes CI (Cote d’Ivoire), GH (Ghana), or TG (Togo) indicate the country from which cacao samples were collected
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
7
with three previously reported primers, ORF3A, ORF1, and Badna
[13,49,52] amplication of CSSV-like sequences was successful 19 – 33%
of the time, making the newly designed primers somewhat more eective
but not much more reliable. Results indicate that CSSV detection was
dependent upon the viral region targeted by the particular primer pairs.
Nevertheless, no one primer set amplied CSSV from all symptomatic
samples despite amplication by at least one primer pair that conrmed
positive infection. Although P4 primers had the highest amplication
frequency, at 42%, they were unable to detect all of the isolates amplied
by other primer sets that had overall lower frequencies, compared to
P4. Although six of the eight primer pairs were degenerate and so, were
expected to detect CSSV at a higher frequency than non-degenerate
primers, they failed to meet this expectation. is was considered
most likely due to the paucity of available information regarding true
genomic variability among extant CSSV eld isolates that precludes the
consideration of global variability in primer design. Also, the intended use
of the Badna primers was for genus-wide badnavirus amplication [52],
however, when they were designed, only one CSSV genome sequence was
available for consideration. is shortcoming in the Badna primer design,
given the now apparently extensive divergence among CSSV isolates,
appears to explain the basis for the lower than expected detection of CSSV
e.g. in only 35 of 124 (28%) samples tested. Likewise, each primer pair
gave ‘false negative’ results, based on the observation that 69 samples
were conrmed positive for CSSV by at least one primer pair. Given the
apparently greater than expected variability among CSSV-like isolate, the
design and use of multiple instead of a single putative universal primer
pair will probably be essential to develop a reliable molecular diagnostic
test for CSSV.
Despite the characteristic CSSV-like symptoms, 55 of 124 eld samples
were negative for CSSV detection, regardless of primer pair. Primer design
has been based on regions of high intra-isolate genomic conservation, and
therefore was considered to represent informative regions for species-
wide molecular detection. e lack of success to amplify virus from all
symptomatic plants, despite a logical approach, indicates greater than
expected genomic variability among CSSV-like eld isolates, and may
suggest that previously known genotypes have undergone dierentiation,
and/or that new genome types have emerged. Another explanation
for the negative detection may be sample quality, low CSSV titer, or
that symptoms observed in cacao, or the suspected wild hosts, are not
caused by CSSV. Among the eight samples assessed for DNA quality by
PCR amplication of the cacao nad 4 gene, results showed that all eight
samples produced an amplicon of the expected size, indicating that the
lack of amplication was not likely due to poor DNA quality. e results
here in corroborate other failures to amplify CSSV by PCR amplication
from multiple independently-collected eld isolates [13,49] and further
support the hypothesis that CSSV is more divergent than expected, an
observation that has been reported for other badnaviruses, which exhibit
inherent, intra-specic variability [68-70].
e overall genome sequence coverage made possible using the eight
primer pairs accounted for 5 to 75% of an average-sized CSSV-like genome.
Among the sequences, the variability was high, at 66 –99% pairwise nt
identities. e locus with the greatest variability was that corresponding
to the P3 amplicons, at 66-99% nt divergence, followed by ORF3A and
Badna amplicon sequences, at 68-99% nt divergence, respectively. e P3
and ORF3A regions encode viral AP and MP, respectively, whereas, the
Badna region encodes the partial RT and RNase H protein, collectively,
the proteins involved in virus replication and in planta movement.
Interestingly, the AP, MP, and RT-RNase H regions are about equally
divergent, however, to what extent they have evolved compared to other
genome regions among the isolates studied, is not yet known. Also,
whether the AP and MP partial genome loci are similarly taxonomically
informative as the RT-RNase H marker has not been evaluated.
e other ve loci, RT, P1, P2, P4 and ORF1, which showed nucleotide
variability at 71 – 99%, are less divergent than the AP, MP and RT-RNase
H, and are therefore expected to readily detect the more conserved
regions of the genome. Although the ORF3A, P3 and Badna loci are
valuable at showing the extent of divergence of the CSSV genome, PCR
amplication results showed that their amplication frequencies are not
as high as that of the less divergent RT and P4 loci, for example (Table 2),
which is expected. is suggests that the AP, MP and RT-RNase H may be
going through more rapid evolutionary changes compared to all the other
regions of the CSSV genome. at regions of virus genomes do not evolve
at the same rate is consistent with a number of other plant viral groups.
Pairwise distance analysis of the 577 bp fragment of the taxonomically
informative RT-RNase H region, which is delimited by the Badna primers,
revealed the presence of four CSSV variants, based on the less than 80%
nt identity threshold. Clearly, DNA sequencing of the entire RT-RNase
H locus will be required to conrm species status, and corroborate the
suggestion based on results herein that CSSV constitutes a complex of
multiple, divergent entities.
e proposed extensive variability further explains the inability of
most of the primer pairs evaluated here to amplify CSSV from all of the
symptomatic plants analyzed in this study. Further, the apparently wide
occurrence of single nucleotide polymorphisms in the viral genomes is
expected to greatly limit or even preclude the design of “universal” primers
for the group, albeit, variant-specic primer design may be tractable. Also,
additional design attempts based on existing sequence data are expected
to fail to amplify all isolates because the information regarding genomic
variability is greatly limited. is extensive divergence suggests that
variant-specic primers would oer the most likely-to-succeed strategy,
however, far more CSSV genomic data are needed to test this hypothesis.
Phylogenetic analyses resolved a tree with two or three major clades
containing sequences obtained as amplicons using the eight primer
pairs. e sequences amplied by the ORF1, RT, P1, and P4 primers
were grouped into two major Clades, I and II (Figure 3a, b, e, and h).
In contrast, the trees based on the sequences amplied by the ORF3A,
P2, P3, and Badna primers showed an additional third clade, III, which
grouped separately, basal to the Clades I and II (Figure 3 c,d, f,g). e
ORF3A and P3 regions appear to be more divergent than the other six
regions because they resolve the tree sub-structure better as an indicator
of genomic variability. ey both resolved six or more CSSV subgroups
of isolates in samples from Cote d’Ivoire and Ghana [49,50] (Figure 3d,
3g). Among them, ORF3A sequence subclades are the best resolved, most
likely because there are more previously published partial sequences
available for this region [49] included in the analysis, while no partial
fragments corresponding to the P3 region are available, except for the
full-length genomes. For the same reason, the badnavirus-taxonomically
informative RT-RNase region [19] shows less genomic variability, given
that only a few sequences were considered in the phylogenetic analysis,
compared to MP and P3 regions. Such high variability was also observed
with the nucleotide pairwise analyses, and may be attributed to a high
rate of mutation or evolution. Although some loci had more sequences
than the P3 and the ORF3A considered for the phylogenetic analyses,
for example, the RT and P4 regions, they showed less genomic variability
because they resolved less subgroups. In summary, the results suggest that
some CSSV loci are better at resolving genetic variability, while some are
better at detecting more CSSV isolates.
Phylogenetic analyses based on the ML method showed no evidence of
phylogeographical distribution for the sequences analyzed here. At least
two-thirds of the sequences in this study from Cote d’Ivoire represented
across the eight phylogenetic trees were most closely related to the Ghana
GenBank reference sequences in Clade I (Figure 3). Clades II and III
contained GenBank reference sequences from Togo and/or Cote d’Ivoire,
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
8
or none. is distribution suggests that the CSSV isolates studied here may
not be endemic to Cote d’Ivoire, and that representatives of each group
of isolates may be present in all cacao-growing countries in West Africa.
Also, within, Cote d’Ivoire, there was no evidence for close relationships
between CSSV isolates based on sampling location or plant host species, in
that eastern, western, or central region isolates from cacao and non-cacao
hosts were equally distributed among the clades. Because of the exchange
of germplasm among cacao growers in the cacao-growing regions in West
Africa, and also movement of planting material in search of new locations
that are not aected by the swollen shoot disease, it is expected that several
isolates or variants of CSSV be present in the region.
e Badna, ORF3A, and P3 amplicons that grouped within Clade III
also shared the least nt identity with other isolates by pairwise distance
analysis. And for the Clade III taxa, no close relative (≥ 80% identity)
was identied among the CSSV sequences in GenBank, indicating they
represented highly divergent isolates.
CSSV sequences were not detected only in the cacao host, they were
also amplied by all primers but P1 and ORF1, from seven wild host
species; C. papaya, C. pentandra, C. erecta, D. cayenensis, S. anthelmia, T.
bangwensis, and X. maafa. Of the seven, C. pentandra has been previously
described as an alternative host [15]. e CSSV sequences from the seven
wild host plants and the cacao samples from Cote d’Ivoire grouped in the
same subclade with Togo, Cote d’Ivoire, and Ghana isolates (Figure 3b,
c, d, g, and h), indicating a close evolutionary relationship. is supports
ndings from previous studies that wild hosts serve at least in part as the
source of CSSV, and it is well known that CSSV was present in West Africa
in wild hosts prior to the introduction of cacao in the 1800’s [14,15].
Results suggest that use of cover crops in cacao plantations that have not
been evaluated with respect to CSSV susceptibility may harbor CSSV and
lead to unintentional cultivation of an alternative host from which the
virus can spread into the cacao trees they are intended to protect. Also,
establishing new elds near native forests may periodically lead to host
shiing by CSSV or other as yet uncharacterized endemic badnavirus
species into newly planted cacao trees.
Conclusion
e ve primer pairs designed here in for CSSV detection, collectively,
amplied badnavirus amplicons from 19-42% of the cacao and non-
cacao eld samples collected in Cote d’Ivoire. Based on the collective
sequence coverage (AP, MP, RT-RNase H, RT, P1, P2, P4 and ORF1) of the
CSSV-like amplicons, enabled by amplication of eight primers in total
(including positive control primers), unexpectedly extensive variability
was uncovered, at 66 – 99% nt identity. Given the current ICTV species
cut-o at ≥80%, for the RT-RNase region, and the amplication herein of a
577 bp fragment of that locus (~47%), it is not possible to determine if this
extent of genomic variability (representing 5 -75% of the total genome) is
a valid indicator of species divergence, however, results provide important
new clues that support this possibility, and one that implicates CSSV as
complex of at least four or more variants. is provisional scenariois
consistent with the observed similarly high divergence among badnavirus
Banana streak virus genomes [68], and regarding certain emergent
begomoviral species groups in the family Geminiviridae [71]. Given
these results, it is unlikely that a single PCR primer pair can be designed
for detection of all extant CSSV-like or other badnaviral variants. is
underscores the urgency to develop new molecular or other diagnostic
tools that enable reliable detection and identication of cacao-infecting
badnaviruses responsible for unprecedented losses in cacao plantations
throughout West Africa. Comprehensive molecular diagnostic tests would
be invaluable for conrming the virus-free status of cacao clones destined
for new production areas and for tree replacement programs in extant
cacao-growing locales, as well as to provide support ongoing breeding
eorts to identify CSSV-resistant germplasm. In addition, the application
of next-generation genomic pathology approaches to epidemiological
studies will be invaluable for reconciling the extensive genomic variability
occurring among suspect new and emerging badnaviral species of cacao,
with viral evolutionary patterns in the context of the current pandemic
spread, and with respect to comprehensive cacao genetics/genomics
data sets, to achieve long-term disease management solutions to enable
sustainable cacao production in West Africa.
Declaration of Conict of Interest
e authors declare no conict of interest.
Funding
Funding for this project was provided by USDA-ARS through a Specic
Cooperative Agreement, Project # 6038-21000-023-07, Development
and Optimization of Molecular Diagnostics Method for Qualitative
and Quantitative Detection of Cacao Swollen Shoot Virus, and from
MARS, Inc.; Trust Agreement #58-6631-6-123: Genetic Improvement of
eobroma cacao, and by the USDA-Foreign Agricultural Services, World
Cocoa Foundation, Borlaug Fellowship Program that was awarded to the
second and third authors.
References
1. Clough Y, Faust H, Tscharntke T (2009) Cacao boom and bust:
sustainability of agroforests and opportunities for biodiversity
conservation. Conserv Lett 2: 197-205.
2. Guest D (2007) Black pod: Diverse pathogens with a global impact on
cocoa yield. Phytopathology 97:1650-1653.
3. Ploetz RC (2006) Cacao diseases : Important threats to chocolate
production worldwide. Phytopathology 97: 1634-1639.
4. Ollennu A (2001) Synthesis : case history of cocoa viruses. In: Hughes
J d’A., Odu BO (eds) Plant Virol. Sub-Saharan Africa. International
Institute of Tropical Agriculture, Ibadan, Nigeria 33-49
5. Thresh JM (1958) The spread of virus disease in cacao. West African
Cocoa Res Inst Tech Bull 5: 36.
6. Steven WF (1936) Swollen shoot and die-back—a new disease of
cocoa. Gold Coast Farmer V:144.
7. Mangenot G, Alibert H, Basset A (1946) Sur les caracteres du swollen
shoot en Cote d’Ivoire. Rev Int Bot Appl Paris 283: 13.
8. Muller E, Sackey S (2005) Molecular variability analysis of ve new
complete cacao swollen shoot virus genomic sequences. Arch Virol
150: 53-66.
9. Thresh JM, Tinsley TW (1959) The viruses of cocoa. West African
Cocoa Res Inst Tech Bull 7: 32.
10. Dongo LN, Orisajo SB (2007) Status of cocoa swollen shoot virus
disease in Nigeria. African J Biotechnol 6: 2054-2061.
11. Attafuah A, Blencowe JW, Brunt AA (1963) Swollen shoot disease of
cocoa in the Sierra Leone. Trop Agric Trinidad 40: 229-232.
12. Partiot M, Amea YK, Djiekpor EK, Bakar KA (1978) Le swollen shoot
du cacaoyer au Togo. Investaire preliminaire et premiere estimation
des pertes causees par la maladie. Cafe-cacao Thea 22: 217-228.
13. Oro F, Mississo E, Okassa M, Guilhaumon C, Fenouillet C, et al.
(2012) Geographical differentiation of the molecular diversity of cacao
swollen shoot virus in Togo. Arch Virol 157: 509-514.
14. Todd JM (1951) An indigenous source of swollen shoot disease of
cacao. Nature 167: 952-953.
15. Posnette AF, Robertson NF, Todd JM (1950) Virus diseases of cacao
in West Africa. V. Alternative host plants. Ann Appl Biol 37: 229-240.
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
9
16. Tinsley TW (1971) The ecology of cacao viruses. I. The role of wild
hosts in the incidence of swollen shoot virus in West Africa. J Appl
Ecol 8: 491-495.
17. Lartey LL (2013) Mapping cocoa swollen shoot virus disease
distribution in western region, Ghana. 78.
18. Lockhart BEL (1990) Evidence for a double-stranded circular DNA
genome in a second group of plant viruses. Phytopathology 80: 127-131.
19. King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ (2012) Badnavirus.
In: Virus taxonomy. Ninth report of the international committee on
taxonomy of viruses. Elsevier Academic Press, London.
20. Brunt AA, Kenten Rh, Nixon HL (1964) Some properties of Cacao
swollen shoot virus. J Gen Microbiol 36: 303-309.
21. Lot H, Djiekpor E, Jacquemond M (1991) Characterization of the
genome of cacao wollen shoot virus. J Gen Virol 72: 1735-1739.
22. Uhde C, Vetten HJ, Maiss E, Adomako D, Paul HL (1993) Studies on
particle components of Cacao swollen shoot virus. J Phytopathol
139: 207-216.
23. Geering ADW (2014) Caulimoviridae (Plant pararetroviruses). eLS.
24. Hagen LS, Jacquemond M, Lepingle A, Lot H, Tepfer M (1993)
Nucleotide sequence and genomic organization of Cacao swollen
shoot virus. Virology 196: 619-628.
25. Jacquot E, Hagen LS, Jacquemond M, Yot P (1996) The open reading
frame 2 product of Cacao swollen shoot badnavirus is a nucleic acid-
binding protein. Virology 225: 191-195.
26. Jacquot E, Hagen LS, Michler P, Rohfritsch O, Stussi-Garaud C, et al.
(1999) In situ localization of Cacao swollen shoot virus in agroinfected
Theobroma cacao. Arch Virol 144: 259-271.
27. Posnette AF (1947) Virus diseases of cacao in West Africa. I. Cacao
viruses 1A, 1B, 1C and 1D. Ann Appl Biol 34: 388-402.
28. Box HE (1945) Insect transmission of the “Swollen-Shoot” virus in
West African cacao. Nature 155: 68-609.
29. Posnette AF (1950) Virus dieases of cacao in West Africa. VII. Virus
transmission by different vector species. Ann Appl Biol 37: 378-384.
30. Ameyaw GA, Wetten A, Dzahini-Obiatey H, Domfeh O, Allainguillaume
J (2013) Investigation on Cacao swollen shoot virus (CSSV) pollen
transmission through cross-pollination. Plant Pathol 62: 421-427.
31. Quainoo AK, Wetten AC, Allainguillaume J (2008) Transmission of
cocoa swollen shoot virus by seeds. J Virol Methods 150: 45-49.
32. Dzahini-Obiatey H, Ameyaw GA, Ollennu LA (2006) Control of cocoa
swollen shoot disease by eradicating infected trees in Ghana: A
survey of treated and replanted areas. Crop Prot 25: 647-652.
33. Jeger MJ, Thresh JM (1993) Modeling reinfection of replanted cocoa
by swollen shoot virus in pandemically diseased areas. J Appl Ecol
30: 187-196.
34. Ameyaw GA, Ollennu LA (2006) Control of cocoa swollen shoot
disease by eradicating infected trees in Ghana : A survey of treated
and replanted areas. 25: 647-652.
35. Hughes J d’A, Ollennu LAA (1994) Mild strain protection of cocoa in
Ghana against cocoa swollen shoot virus — a review. Plant Pathol
43: 442-457.
36. Ollennu LAA, Owusu GK (1989) Isolation and study of mild strains of
cocoa swollen shoot virus for possible cross protection. In: Proc. 4th
Int. Plant Virus Epidemiol. Work. Montpellier, France 119-122.
37. Ameyaw GA, Domfeh O, Dzahini-Obiatey HK, Ollennu LAA, Owusu
GK (2016) Appraisal of Cocoa swollen shoot virus ( CSSV ) mild
isolates for cross protection of cocoa against severe strains in Ghana.
Plant Dis 100: 810-815.
38. Hanna AD, Heatherington W (1957) Arrest of the swollen-shoot virus
disease of cacao in the gold coast by controlling the mealybug vectors
with the systemic insecticide, dimefox. Ann Appl Biol 45: 473-480.
39. Bigger M (1972) Recent work on the mealybug vectors of Cocoa
swollen shoot disease in Ghana. Trop Pest Manag 18: 61-70.
40. Posnette AF, Todd JM (1951) Virus diseases of cacao in West Africa
VIII. The search for virus-resistant cacao. Ann Appl Biol 38: 785-800.
41. Legg JT, Lockwood G (1981) Genetic aspects of resistance to cocoa
swollen shoot virus in Ghana. I. Field trials. Ann Appl Biol 97: 75-89.
42. Ofori A, Padi FK, Ameyaw GA, Dadzie AM, Lowor S (2015) Genetic
variation among cocoa (Theobroma cacao L.) families for resistance
to cocoa swollen shoot virus disease in relation to total phenolic
content. Plant Breed 134: 477-484.
43. Padi FK, Domfeh O, Takrama J, Opoku S (2013) An evaluation of
gains in breeding for resistance to the cocoa swollen shoot virus
disease in Ghana. Crop Prot 51: 24-31.
44. Kebe BI, Kouakou K, N’Guessan NF, Assiri AA, Adiko A, et al (2006)
Le swollen shoot en Côte d’Ivoire: situation ac- tuelle et perspectives.
In: Proc. 15th Int. Cocoa Res. Conf. San José, Costa Rica. 907-922
45. Cilas C, Muller E, Mississo E (2005) Occurrence of Cacao swollen
shoot virus in Litimé, the Main Cocoa-Producing Area of Togo. Plant
Dis 89: 913.
46. Kenten RH, Legg JT (1971) Serological relationships of some
viruses from cocoa (Theobroma cacao L.) in Ghana. Ann Appl Biol
67: 195-200.
47. Sagemann W, Paul HL, Adomako D, Owusu GK (1983) The use of
Enzyme-Linked Immunosorbent Assay (ELISA) for detection of Cacao
swollen shoot sirus (CSSV) in Theobroma cacao. J Phytopathol 106:
281-284.
48. Quainoo AK, Wetten AC, Allainguillaume J (2008) The effectiveness of
somatic embryogenesis in eliminating the cocoa swollen shoot virus
from infected cocoa trees. J Virol Methods 149: 91-96.
49. Kouakou K, Kébé BI, Kouassi N, Aké S, Cilas C, et al. (2012)
Geographical distribution of Cacao swollen shoot virus molecular
variability in Côte d ’ Ivoire. Plant Dis 96: 1445-1450.
50. Abrokwah F, Dzahini-Obiatey H, Galyuon I, Osae-Awuku F, Muller
E (2016) Geographical Distribution of Cacao swollen shoot virus
Molecular Variability in Ghana. Plant Dis 100: 2011-2017.
51. End M, Daymond A, Hadley P (2010) Technical Guidelines for the Safe
Movement of Cacao Germplasm. Global Cacao Genetic Resources
Network (CacaoNet), Montpellier, France.
52. Yang IC, Hafner GJ, Revill P a., Dale JL, Harding RM (2003)
Sequence diversity of South Pacic isolates of Taro bacilliform virus
and the development of a PCR-based diagnostic test. Arch Virol 148:
1957-1968.
53. Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue.
Focus (Madison) 12: 13-15.
54. Edgar RC (2004) MUSCLE: multiple sequence alignment with high
accuracy and high throughput. Nucleic Acids Res 32: 1792-1797.
55. Demesure B, Sodzi N, Petit RJ (1995) A set of universal primers for
amplication of polymorphic non-coding regions of mitochondrial and
chloroplast DNA in plants. Mol Ecol 4: 129-131.
56. Dean FB, Nelson JR, Giesler TL, Lasken RS (2001) Rapid amplication
of plasmid and phage DNA using Phi29 DNA polymerase and multiply
primed rolling circle amplication. Genome Res 11: 1095-1099.
57. Rector A, Tachezy R, Van Ranst M (2004) A sequence-independent
strategy for detection and cloning of circular DNA virus genomes by
using multiply primed rolling-circle amplication. J Virol 78: 4993-
4998.
Sci Forschen
Open HUB for Sc ie n t i f i c R e s e a r c h
Citation: Chingandu N, Kouakou K, Aka R, Gutierrez OA, Brown JK (2017) P Unexpected Genome Variability at Multiple Loci Suggests Cacao Swollen
Shoot Virus Comprises Multiple, Divergent Molecular Variants. J Emerg Virol Dis 3(1): doi http://dx.doi.org/10.16966/2473-1846.128
Open Access
10
58. Stevens H, Rector A, Van Ranst M (2010) Multiply primed rolling-circle
amplication method for the amplication of circular DNA viruses.
Cold Spring Harb Protoc 2010: pdb.prot5415.
59. Conesa A, Gotz S (2008) Blast2GO: A comprehensive suite for
functional analysis in plant genomics. Int J Plant Genomics.
60. Villesen P (2007) FaBox: An online toolbox for FASTA sequences. Mol
Ecol Resources 7: 965-968.
61. Muhire BM, Varsani A, Martin DP (2014) SDT: A virus classication
tool based on pairwise sequence alignment and identity calculation.
PLoS One 9: e108277.
62. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6:
molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:
2725-2729.
63. Kenyon L, Lebas BSM, Seal SE (2008) Yams (Dioscorea spp.)
from the South Pacic Islands contain many novel badnaviruses:
Implications for international movement of yam germplasm. Arch Virol
153: 877-889.
64. Muller E, Dupuy V, Blondin L, Bauffe F, Daugrois JH, et al. (2011) High
molecular variability of sugarcane bacilliform viruses in Guadeloupe
implying the existence of at least three new species. Virus Res 160:
414-419.
65. Su L, Gao S, Huang Y, Ji C, Wang D, et al. (2007) Complete genomic
sequence of Dracaena mottle virus, a distinct badnavirus. Virus
Genes 35: 423-429.
66. Wu X-B, Alabi OJ, Damaj MB, Sun S-R, Mirkov TE, et al. (2016)
Prevalence and RT/RNase H Genealogy of Sugarcane Bacilliform
Virus Isolates from China. J Phytopathol 164: 595-607.
67. Marchler-Bauer A, Derbyshire MK, Gonzales NR, Lu S, Chitsaz F, et
al. (2015) CDD: NCBI’s conserved domain database. Nucleic Acids
Res 43:D222–D226.
68. Harper G, Hart D, Moult S, Hull R, Geering A, et al. (2005) The diversity
of Banana streak virus isolates in Uganda. Arch Virol 150: 2407-2420.
69. Geering AD, McMichael LA, Dietzgen RG, Thomas JE (2000)
Genetic diversity among Banana streak virus isolates from Australia.
Phytopathology 90: 921-927.
70. Hoffmann K, Sackey ST, Sackey E, Maiss D, Adomako D, et al.
(1997) Immunocapture polymerase chain reaction for the detection
and characterization of Cacao swollen shoot sirus 1A isolates. J
Phytopathol 145: 205-212.
71. Brown JK, Zerbini FM, Navas-Castillo J, Moriones E, Ramos-Sobrinho
R, et al (2015) Revision of Begomovirus taxonomy based on pairwise
sequence comparisons. Arch Virol 160: 1593-1619.
... Symptoms consisted of discoloration of leaves, vein chlorosis, red vein-banding, stem and root swellings, and pod deformation, with tree decline and death 3-5 years after symptoms development [6,7]. With the expansion of cacao production into other West African countries, outbreaks caused by cacao swollen shoot disease (CSSD) were reported throughout the entire region [8][9][10][11][12][13][14][15][16][17][18]. Disease symptoms reminiscent of CSSD in West Africa were observed in cacao in Sri Lanka in 1956-1957 [19]; however, only recently, the badnavirus Cacao bacilliform Sri Lanka virus (CBSLV) was identified in cacao trees showing symptoms similar to those described in the 1950s [15]. ...
... Even so, additional information is needed with respect to genomic variability to enable the development of reliable molecular detection assays for breeding programs and epidemiologically-based management [10,11,14,15,21,30,39,[68][69][70]. Also, population-level analysis has been limited to a relatively few complete genomes and/or partial sequences [9,14,16,34,66]. In this study, 30 new CSSD-badnavirus genome sequences were determined from symptomatic cacao trees in Côte d'Ivoire and Ghana using Illumina and/or Sanger DNA sequencing. ...
... Also, some of the CSSTBV and CSSCDV sequences identified as recombinants and/or as sequence donors/parents were recovered from double-infected cacao plants, providing evidence that recombination is occurring among extant cacao-infecting badnaviruses. Although it is well-known that wild plant species have served as the initial, primary sources of CSSD-badnaviruses in West Africa [9,28,75], representative badnaviral genome sequences from them are needed to pursue evolutionary and epidemiological questions and the patterns of diversification among isolates extant in wild host species. It is also important to understand which (if any) of them may continue to serve as CSSD-badnavirus reservoirs throughout the region. ...
Full-text available
Article
The incidence of cacao swollen shoot disease (CSSD) in cacao (Theobroma cacao L.) has increased in West Africa since ~2000. To investigate the genomic and species diversity of the CSSD-badnaviruses infecting cacao in Côte d’Ivoire and Ghana, symptomatic leaves were subjected to high-throughput sequencing. Among the 30 newly determined genomes, three badnaviruses were identified, Cacao swollen shoot Togo B virus (CSSTBV), Cacao swollen shoot CD virus, and Cacao swollen shoot CE virus (CSSCEV). The phylogenetic trees reconstructed for the reverse transcriptase (RT) and ribonuclease H (RNase H) sequences were incongruent with the complete viral genomes, which had the most robust statistical support. Recombination seems to be involved in the CSSD-badnavirus diversification. The genomic diversity varied among different CSSD-badnaviruses, with CSSTBV showing the lowest nucleotide diversity (π = 0.06236), and CSSCEV exhibiting the greatest variability (π = 0.21911). Evidence of strong purifying selection was found in the coding regions of the CSSTBV isolates.
... Accurate, early diagnosis is fundamental to developing programs to manage CSSD. While serological and PCR amplification assays have been developed, they do not detect virus in all symptomatic samples (Chingandu et al. 2017b(Chingandu et al. , 2019Kouakou et al. 2012;Oro et al. 2014). In an extensive study involving 124 symptomatic trees in Cote d'Ivoire, only half of the samples were positive for CSSD-badnaviruses by PCR amplification and DNA sequencing of the cloned amplicons (Chingandu et al. 2017b). ...
... While serological and PCR amplification assays have been developed, they do not detect virus in all symptomatic samples (Chingandu et al. 2017b(Chingandu et al. , 2019Kouakou et al. 2012;Oro et al. 2014). In an extensive study involving 124 symptomatic trees in Cote d'Ivoire, only half of the samples were positive for CSSD-badnaviruses by PCR amplification and DNA sequencing of the cloned amplicons (Chingandu et al. 2017b). The ...
... Thus, genomic variability of the CSSD badnavirus complex was more extensive than anticipated. Clearly, new approaches are needed for CSSD diagnosis and to elucidate the genomic complexity and phylogeny of the CSSD badnaviruses (Chingandu et al. 2017b). ...
Full-text available
Article
Theobroma cacao, the source of chocolate, is affected by destructive diseases wherever it is grown. Some diseases are endemic; however, as cacao was disseminated from the Amazon rain forest to new cultivation sites it encountered new pathogens. Two well-established diseases cause the greatest losses: black pod rot, caused by several species of Phytophthora, and witches' broom of cacao, caused by Moniliophthora perniciosa. Phytophthora megakarya causes the severest damage in the main cacao producing countries in West Africa, while P. palmivora causes significant losses globally. M. perniciosa is related to a sister basidiomycete species, M. roreri which causes frosty pod rot. These Moniliophthora species only occur in South and Central America, where they have significantly limited production since the beginnings of cacao cultivation. The basidiomycete Ceratobasidium theobromae causing vascular-streak dieback occurs only in South-East Asia and remains poorly understood. Cacao swollen shoot disease caused by Cacao swollen shoot virus is rapidly spreading in West Africa. This review presents contemporary research on the biology, taxonomy and genomics of what are often new-encounter pathogens, as well as the management of the diseases they cause.
... The availability of complete genome sequences for a number of isolates has led to the recognition by the International Committee on the Taxonomy of Viruses (ICTV) of Cacao swollen shoot CD virus (CSSCDV) and Cacao swollen shoot Togo A virus (CSSTAV) as distinct species (Kouakou et al. 2012;Muller 2015;Muller and Sackey 2005). The CSSDassociated badnaviruses recognized thus far include three ICTVapproved and one proposed species (Cacao red vein virus [CRVV], CSSCDV, CSSTAV, and CSSV) occurring in Cote d'Ivoire, Ghana, or Togo (Chingandu et al. 2017b;Muller 2015). Most recently, CRVV, which has been associated with rapid-decline in Ghana and Cote d'Ivoire (Chingandu et al. 2017a), and Cacao red veinbanding virus (CRVBV) from Nigeria (Dongo et al. 2018) (this report) have been described as new, provisional species. ...
... The ORF3 is best characterized and encodes a large polyprotein that is cleaved by viralaspartate protease to derive movement protein (MP), coat protein (CP), aspartate protease (AP), reverse transcription (RT), and ribonuclease H (RNase H) (Geering 2014). The function has not been determined for the additional two to three predicted ORFs, encoded by several other CSSD badnaviruses (Chingandu et al. 2017b). ...
... Until recently, CSSD virus detection in cacao relied on an enzymelinked immunosorbent assay (ELISA) developed for a CSSV isolate from Ghana (Sagemann et al. 1983). Polymerase chain reaction (PCR) detection assays have been developed for CSSD badnaviruses; however, their success has been largely constrained by the limited number of CSSD genome sequences available to guide primer design (Chingandu et al. 2017b;Dongo and Orisajo 2007;Edward and Wetten 2016;Kouakou et al. 2012;Muller et al. 2001). In Nigeria, only 7% of the cacao samples tested using the "universal" Badna-F/R primers (Yang et al. 2003) were positive for virus, despite the presence of virus-like symptoms (Dongo et al. 2012). ...
Article
Cacao swollen shoot disease (CSSD) of Theobroma cacao was reported in Nigeria in 1944; however, no badnaviral genome sequences have been found associated with the symptomatic trees. In 2017, leaf samples (n = 18) were collected from cacao trees from Osun and Oyo, Nigeria showing foliar symptoms that included red vein-banding and shoot swelling, and variable secondary mosaic, mottling, and fern-like pattern symptoms. Abutting primers designed around previously determined 500-bp intergenic region sequences were used for polymerase chain reaction (PCR) amplification. Of the 18 samples, 9 yielded an approximately 7,000-bp, apparently genome-size product. The nine genomes were sequenced and found to encode four open reading frames, and to share 86 to 99% nucleotide identity. Pairwise analysis of the Nigerian genomes with 21 previously reported CSSD badnaviruses, at the complete genome and reverse-transcription ribonuclease H (1,230 bp) sequence levels, indicated 71 to 75 and 72 to 76% nucleotide identity, respectively. Phylogenetic analysis of the nine complete genomes indicated that the closest relatives of the divergent Nigerian isolates were previously described West African CSSD badnaviruses. Based on pairwise comparisons and phylogenetic analyses, the Nigerian CSSD isolates constitute a previously unrecognized Badnavirus sp., herein named Cacao red vein-banding virus (CRVBV). Primers designed based on the CRVBV genome sequences amplified a 1,068-bp fragment from 16 of 18 field samples tested by PCR, suggesting the possible existence of additional CRVBV variants.
... A complex of at least seven badnaviruses (genus Badnavirus, family Caulimoviridae) have been associated with swollen shoot disease, cacao swollen shoot Togo A virus (CSSTAV), cacao swollen shoot Togo B virus (CSSTBV), cacao swollen shoot CD virus (CSSCDV), cacao swollen shoot CE virus (CSSCEV), cacao swollen shoot Ghana M virus (CSSGMV), cacao swollen shoot Ghana N virus (CSSGNV), and Cacao swollen shoot Ghana Q virus (CSSGQV) (Muller and Sackey, 2005;Oro et al., 2012;Chingandu et al., 2017aChingandu et al., ,b, 2019Muller et al., 2018;Ramos-Sobrinho et al., 2020). However, Koch's postulates have only been demonstrated for CSSTBV (Hagen et al., 1994). ...
... Despite the implementation of a number of management practices to mitigate crop losses caused by CSSD, including eradication of virus-infected cacao trees and wild host plants adjacent to plantations, insecticide applications to control the mealybug vectors, and rouging of symptomatic trees (Lister and Thresh, 1957;Thresh, 1958Thresh, , 1959, virus outbreaks have steadily increased, with the possible emergence of new strains and species (Chingandu et al., 2017a). Disease resistance strategies such as cross protection using a CSSD "mild" strain from Nigeria (Crowdy and Posnette, 1947;Todd, 1951, 1955;Ollennu and Owusu, 2003), and planting of CSSDtolerant/resistant cacao materials, have also been implemented to control the disease (Posnette and Todd, 1951;Dale, 1957;Thresh, 1958;Attafuah and Glendinning, 1965;Thresh et al., 1988). ...
Full-text available
Article
Cacao swollen shoot disease (CSSD) is a damaging disease of Theobroma cacao L. associated with infection by a group of poorly characterized badnaviral species. To establish causality and characterize the symptomatology associated with infection by the badnavirus cacao swollen shoot Ghana M virus (CSSGMV), an infectious clone (1.3-mer) was constructed and used to inoculated cacao “Amelonado” seedlings by biolistic inoculation (BI; n = 18) and agroinoculation (AI; n = 15). Newly expanded leaves of BI (10/18) and AI (12/15) plants developed foliar mosaic and curling symptoms 30-days post inoculation (dpi), with chlorotic mottling and necrotic crinkling being evident by 90 dpi. By 120 dpi, three of 15 AI plants exhibited characteristic stem-swelling. Viral infection was verified by PCR-amplification and sequencing of a 1068 bp fragment of the CSSGMV ORF3 from newly expanding leaves 60 dpi. The PCR results indicated that 14 of 18 and 15 of 15 BI and AI plants, respectively, were systemically infected. The complete CSSGMV genome sequence was determined, by Illumina sequencing, from representative AI and BI plants and shared >99.5% pairwise nucleotide identity with CSSGMV-Nig9 (GenBank Accession No. MH785299 ). Based on the development of characteristic CSSD symptoms and recovery of partial and complete genome sequences of CSSGMV-Nig9 from systemically infected cacao plants, Koch's postulates have been fulfilled.
... In the past, strains of CSSV were classified into various groups based on symptom expression, effects on host plants and serological relationships (Crowdy and Posnette 1947;Thresh et al. 1988). In recent times, classification of the virus has been based on molecular diversity (Kouakou et al. 2012;Oro et al. 2012;Abrokwah et al. 2016;Muller et al. 2018;Chingandu et al. 2017Chingandu et al. , 2019Marelli et al. 2019), resulting in at least seven distinct virus species. ...
Article
The yield, canopy status and cocoa swollen shoot virus disease (CSSVD) symptom severity were assessed in cacao trees in a long-term field experiment originally established to study cacao swollen shoot virus strain 1A (CSSV-1A) epidemics in plots inoculated with the mild strain CSSV-N1. Yield of cacao was 73.7% and 32.1% lower in cacao plants inoculated with CSSV-1A and the non-inoculated respectively, when compared with cacao plants inoculated with CSSV-N1. CSSVD severity and canopy cover of cacao plants were significantly (P < 0.0001) affected by varying the number of inner rows inoculated with CSSV-N1 as well as individual CSSV strains. The treatments in which all the test cacao trees or first five inner rows received mild strain cross protection (T4 and T1) had the best canopy and lowest disease severity. Trees with CSSV-N1 protection had better canopy and lower CSSVD severity in comparison with the non-inoculated and CSSV-1A inoculated trees. DNA fingerprinting analysis indicated that genetic make-up of the planting material does not appear to contribute significantly to variation in disease severity or canopy status. Significant relationships were established between some soil parameters and CSSVD symptom severity (organic carbon, phosphorus, calcium, nitrogen, magnesium) as well as canopy status (phosphorus, potassium, magnesium).
... The reverse transcriptase (RT)-ribonuclease H (RNase H) sequence for badnaviruses is considered taxonomically informative for species demarcation in the genus Badnavirus (Geering and Hull 2012), however, among strains and species of CSSD-badnaviruses, in particular, the 5′ region of open reading frame (ORF) 3 is highly conserved, making it a useful target for molecular detection (Oro et al. 2012;Kouakou et al. 2012;Chingandu et al. 2017;Puig et al. 2020). Because badnaviral and plant retroelement (RE) RT sequences share high nucleotide (nt) sequence identity, primers designed to target the badnaviral RT-RNase H region (ORF3) may amplify both the RT-RNase H fragment of CSSD-badnaviruses and RE-sequences in the plant host genome. ...
Article
Badnaviruses are plant pararetroviruses that infect economically important crops worldwide, and several badnaviral species have been reported causing significant economic losses in cacao plantations in West Africa. Based on the available full-length genome sequences of cacao swollen shoot disease (CSSD)-associated badnaviruses (n = 66), four primer pairs (CSSD1-CSSD4) were designed to amplify a fragment of the 5′ region of open reading frame (ORF) 3, which comprises the movement protein, by polymerase chain reaction (PCR). Primers were evaluated for their ability to amplify a badnaviral fragment(s) from symptomatic and asymptomatic cacao leaf samples collected in Côte d’Ivoire during 2017–2019. The PCR products obtained by amplification with the CSSD1 primers showed high sequence variability and were phylogenetically related to one of three different badnaviral species, Cacao swollen shoot Togo B virus, Cacao swollen shoot CD virus, and Cacao swollen shoot CE virus, while the CSSD2 and CSSD4 amplicon sequences grouped exclusively with either cacao swollen shoot Togo B virus (CSSTBV) and Cacao swollen shoot Ghana M virus isolates, respectively. The majority of the isolates obtained here were most closely phylogenetically related to CSSTBV, with which they shared 81.0–98.0% nucleotide identity, making the CSSTBV-like isolates the predominant species associated with badnavirus-infected cacao trees tested in Côte d’Ivoire.
... El fragmento Badna 1a/badna 4 del locus RT/RNasaH, es suficiente para la asignación de aislados a las diferentes especies en la familia Caulimoviridae(Geering y Hull, 2012). No obstante, los bajos porcentajes de identidad nucleotídica encontrados y el tamaño de las secuencias analizadas, pudieran sugerir que los aislados de PBCOV de Cuba constituyen variantes nuevas de esta especie.En un estudio de diversidad de aislados de Cacao swollen shoot virus (CSSV) en Ghana y Costa de Marfil, África, se encontró una extensa variabilidad entre los genomas de los aislados caracterizados, que no pudo ser detectada solo con el análisis de la región RT/RNasaH(Chingandu et al., 2017). Esta investigación propuso que al menos para CSSV, es necesario la secuenciación del locus completo RT/RNasaH. ...
Full-text available
Thesis
La marchitez de la piña (MWP) es una enfermedad asociada a un complejo de ampelovirus [Pineapple mealybug wilt-associated virus 1 al 5 (PMWaV-1 al -5)] (Closteroviridae) y badnavirus [Pineapple bacilliform CO virus (PBCOV) y Pineapple bacilliform ER virus (PBERV) (Caulimoviridae)]. En Cuba, se informó PMWaV-2 en Ciego de Ávila en el 2007, pero se desconoce la diseminación de la enfermedad y del complejo viral asociado. El objetivo de esta investigación fue caracterizar el complejo viral asociado a la MWP en Cuba. La prospección en 10 provincias y la Isla de la Juventud, de 2009 a 2012, mostró la distribución de MWP en el país con incidencia que varió entre 0,01 % y 100 %, lo que implica un riesgo potencial para el cultivo de la piña [Ananas comosus var. comosus (L.) Merril]. El diagnóstico mediante RT-PCR, PCR y Dot-Blot de 144 muestras colectadas en estas áreas evidenciaron una amplia diseminación de PMWaV-1, PMWaV-2, PMWaV-3, PBCOV y secuencias de endogenous Pineapple bacilliform CO virus (ePBCOV). La detección de PMWaV-1, PMWaV-3, PBCOV y ePBCOV constituyen nuevos informes de estos agentes en el Caribe. Se demostró que PMWaV-2 infecta Bromelia pinguin L. (piña ratón), primer informe de esta planta como su hospedante natural. El complejo viral de MWP en las áreas prospectadas está compuesto por infecciones simples y mixtas de PMWaV-1, PMWaV-2, PMWaV-3 y PBCOV, y PMWaV-2 es la especie viral asociada a la enfermedad.
... El fragmento Badna 1a/badna 4 del locus RT/RNasaH, es suficiente para la asignación de aislados a las diferentes especies en la familia Caulimoviridae(Geering y Hull, 2012). No obstante, los bajos porcentajes de identidad nucleotídica encontrados y el tamaño de las secuencias analizadas, pudieran sugerir que los aislados de PBCOV de Cuba constituyen variantes nuevas de esta especie.En un estudio de diversidad de aislados de Cacao swollen shoot virus (CSSV) en Ghana y Costa de Marfil, África, se encontró una extensa variabilidad entre los genomas de los aislados caracterizados, que no pudo ser detectada solo con el análisis de la región RT/RNasaH(Chingandu et al., 2017). Esta investigación propuso que al menos para CSSV, es necesario la secuenciación del locus completo RT/RNasaH. ...
... Even though this MP locus is not phylogenetically informative at the species level [20], the region is informative of extensive intraspecific variability. Similarly, in a recent study of 124 field isolates from Cote d'Ivoire, only half of the samples were positive for CSSD badnavirus infection by PCR amplification [31]. The primers were designed based on the seven CSSD-associated genome sequences from Cote d'Ivoire, Ghana and Togo available in Gen-Bank, to direct amplification of CP, MP, RNase H, RT, and non-coding region fragments. ...
Full-text available
Article
Background Cacao swollen shoot virus (CSSV), Cacao swollen shoot CD virus (CSSCDV), and Cacao swollen shoot Togo A virus (CSSTAV) cause cacao swollen shoot disease (CSSD) in West Africa. During 2000–2003, leaf and shoot-swelling symptoms and rapid tree death were observed in cacao in Cote d’Ivoire and Ghana. Molecular tests showed positive infection in only ~50–60% of symptomatic trees, suggesting the possible emergence of an unknown badnavirus. Methods The DNA virome was determined from symptomatic cacao samples using Illumina-Hi Seq, and sequence accuracy was verified by Sanger sequencing. The resultant 14, and seven previously known, full-length badnaviral genomic and RT-RNase H sequences were analyzed by pairwise distance analysis to resolve species relationships, and by Maximum likelihood (ML) to reconstruct phylogenetic relationships. The viral coding and non-coding sequences, genome organization, and predicted conserved protein domains (CPDs) were identified and characterized at the species level. Results The 21 CSSD-badnaviral genomes and RT-RNase H sequences shared 70–100% and 72–100% identity, respectively. The RT-RNase H analysis predicted four species, based on an ≥80% species cutoff. The ML genome sequence tree resolved three well-supported clades, with ≥70% bootstrap, whereas, the RT-RNase H phylogeny was poorly resolved, however, both trees grouped CSSD isolates within one large clade, including the newly discovered Cacao red vein virus (CRVV) proposed species. The genome arrangement of the four species consists of four, five, or six predicted open reading frames (ORFs), and the CPDs have similar architectures. By comparison, two New World cacao-infecting badnaviruses encode four ORFs, and harbor CPDs like the West African species. Conclusions Three previously recognized West African cacao-infecting badnaviral species were identified, and a fourth, previously unidentified species, CRVV, is described for the first time. The CRVV is a suspect causal agent of the rapid decline phenotype, however Koch’s Postulates have not been proven. To reconcile viral evolutionary with epidemiology considerations, more detailed information about CSSD-genomic variability is essential. Also, the functional basis for the multiple genome arrangements and subtly distinct CPD architectures among cacao-infecting badnaviruses is poorly understood. New knowledge about functional relationships may help explain the diverse symptomatologies observed in affected cacao trees. Electronic supplementary material The online version of this article (10.1186/s12985-017-0866-6) contains supplementary material, which is available to authorized users.
Article
The protective capability of two Cacao swollen shoot Togo B virus (CSSTBV) mild strains (N1 and SS365B) in three cacao progenies (T85/799 × Amelonado, T85/799 × T79/501, and Amelonado) exposed to the natural spread of the New Juabeng strain (CSSTBV-1A) was investigated at the Cocoa Research Institute of Ghana (CRIG) over a period of 16 years. The trial was conducted in a randomized complete block design with 11 replicates. Each plot consisted of 16 cocoa trees triangularly planted at 1.5 m, made up of six CSSTBV-1A source plants (infectors) and ten test trees. The occurrence of severe symptoms of CSSTBV-1A was significantly influenced by cacao progeny (P = 0.0052), protecting strain (P < 0.0001), and year (P < 0.0001). Significant interactions were found between protecting strain and progeny (P = 0.0133), year and protecting strain (P < 0.0001), and for the three-way interaction – progeny*strain*year (P = 0.0052). The occurrence of severe symptoms of CSSTBV-1A ranged from an average of 1.72 in trees of T85/799 × T79/501 to 1.91 in trees of T85/799 × Amelonado. For protecting strain, occurrence of severe symptoms of CSSTBV-1A ranged from an average of 1.55 in trees protected by CSSTBV-N1 mild strain to 2.18 in test cacao trees which had no mild strain protection (non-inoculated treatment). The findings of this work demonstrate that in the presence of both severe and protecting CSSTBV strains, the progeny T85/799 × T79/501 proved most tolerant in terms of expression of visible symptoms of the severe strain. CSSTBV-N1 is further affirmed by this study to be a better protecting strain than CSSTBV-SS365B. This work has also revealed that protection offered by the two mild strains appears to wane after 11 to 14 years, necessitating additional field inoculation of cacao plants with protecting strains as booster to ensure continuous protection.
Full-text available
Article
NCBI's CDD, the Conserved Domain Database, enters its 15(th) year as a public resource for the annotation of proteins with the location of conserved domain footprints. Going forward, we strive to improve the coverage and consistency of domain annotation provided by CDD. We maintain a live search system as well as an archive of pre-computed domain annotation for sequences tracked in NCBI's Entrez protein database, which can be retrieved for single sequences or in bulk. We also maintain import procedures so that CDD contains domain models and domain definitions provided by several collections available in the public domain, as well as those produced by an in-house curation effort. The curation effort aims at increasing coverage and providing finer-grained classifications of common protein domains, for which a wealth of functional and structural data has become available. CDD curation generates alignment models of representative sequence fragments, which are in agreement with domain boundaries as observed in protein 3D structure, and which model the structurally conserved cores of domain families as well as annotate conserved features. CDD can be accessed at http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml. Published by Oxford University Press on behalf of Nucleic Acids Research 2014. This work is written by US Government employees and is in the public domain in the US.
Article
Phenolic compounds have been suggested as one of the defence mechanisms to cocoa swollen shoot virus disease (CSSVD), but not well studied. Correlation and genetic variation of total phenolic content (TPC) and CSSVD resistance among 53 cocoa families were investigated. Three-month-old seedlings of 15 families obtained from an incomplete 6 × 3 NCII mating design, of 24 families from a 3 × 8 NCII mating design and of 14 other families were evaluated for CSSVD and TPC. Plants were inoculated with viruliferous mealybugs carrying the New Juaben CSSV strain (1A) in a gauze house facility. A single seedling randomization within blocks procedure was followed, using the gauze house units as blocks. There were six blocks with five seedlings of each family randomized within each block. Disease severity scores on leaf flushes at the first, second, third and seventh flushes after inoculation were recorded. The TPC before and 3 months after inoculation was also determined. Family effects were highly significant (P ≤ 0.01) for CSSVD severity scores and TPC. Narrow- and broad-sense heritability estimates were low for CSSVD severity but moderate to high for TPC evaluations. Correlations between severity scores and TPC were weak (r = −0.22 to 0.40) suggesting that the TPC may be of little value in selecting CSSVD resistance varieties in cocoa. Additive effect in terms of significant GCA was important for CSSVD severity scores whereas both additive and non-additive effects were important for TPC values when the 3 × 8 and 6 × 3 NCII mating designs were analysed. Only clones GU 239/H, GU 290/H and GU 225/V had favourable GCA effects for CSSVD symptom expression indicating their potential for developing progeny with high levels of resistance to CSSVD infection.
Chapter
Family Caulimoviridae comprises seven genera of plant viruses whose members replicate by reverse transcription and whose virions contain double-stranded deoxyribonucleic acid. In a recent survey of the international scientific community, Cauliflower mosaic virus (CaMV), the type species of the family, was ranked sixth in the world in a list of the most scientifically or economically important plant viruses. This notoriety is due purely to the major conceptual advances that have been made in plant virology using CaMV as a model pathogen. However, several relatively lesser known viruses in the family, such as Rice tungro bacilliform virus and Cacao swollen shoot virus, are very serious constraints to crop production in tropical regions of the world. In this article, information on the taxonomy, replication cycle, vector transmission, epidemiology and disease management of this important group of plant viruses is summarised.
Article
1. Reinfection of healthy replanted cocoa (Theobroma cacao) by swollen shoot disease, caused by a mealybug-transmitted virus, has been modelled. Much of the spread of disease in pandemically diseased areas such as the Eastern Region of Ghana does not follow a pattern of focus expansion; and disease gradient models are not directly applicable. 2. Equations are derived for cases in which reinfection occurs by `radial spread' of vectors, moving short distances from around the perimeter of the replanted area; and by `jump spread' of windborne vectors into the replanted area. The effect of a cordon sanitaire separating the replanting from the surrounding diseased area is analysed. 3. The impact of jump spread appears to be small by contrast to radial spread, but the absence of estimates of the frequency of its occurrence precludes definitive conclusion. A cordon sanitaire markedly delays reinfection and this, together with eradication of diseased plants, may provide effective control of the disease. 4. Some problems raised by the simplistic assumptions made in the model are discussed in relation to the epidemiology of swollen shoot disease.
Article
The distribution of the cacao swollen shoot virus is markedly discontinuous in West and Central Africa. The available data were re-examined to investigate the part played by wild hosts in the infection cycle in cacao. Natural infections in Cola chlamydantha were found to be of local importance but this species could not be incriminated as an original host. Moreover, the evidence for the widely held view that the swollen shoot virus is West African in origin was found to be equivocal and it is suggested that other geographical origins are possible.