ArticlePDF Available

Possible Molecular Targets of Cinnamon in the Insulin Signaling Pathway

Authors:

Abstract and Figures

Cinnamon (CN) is known for its anti-diabetic activities in traditional medicine. CN extracts are reported to have beneficial effects on normal and impaired glucose tolerance, insulin resistance and type-2 diabetes. The aim of this study is to observe the effect of CN extract on certain diabetogenes involved in insulin signaling. Streptozotocin (STZ) induced type-2 diabetic rats were given CN extract for one month and its effect was observed on blood glucose levels, body weights and gene expression levels of protein tyrosine phosphatase-1B (PTP-1B), insulin receptor (INSR), insulin receptor substrate-1 (IRS-1), phosphoinositide 3-kinase (PI3K), protein kinase B (PKB), protein kinase C-theta (PKCθ) and phosphoinositide-dependent protein kinase-1 (PDK1) in skeletal muscle and adipose tissue. Statistically significant difference was found in the glucose levels and body weights of test and diabetic control groups. In muscle, statistically significant difference was observed in gene expression levels of PTP-1B, IRS-1, PKB, PDK1, PI3K and PKCθ between test and diabetic control groups and PTP-1B, IRS-1, PKB, PDK1 and PKCθ between normal and diabetic control groups. In adipose tissue, statistically significant difference was found in gene expression levels of PTP-1B, PKCθ, IRS-1 between test and diabetic control groups and PTP-1B, PDK1, PI3K, PKCθ and IRS-1 between normal and diabetic control groups. These results suggest that cinnamon normalizes blood glucose level and body weight and affect certain molecular targets in the insulin signaling pathway and therefore, possess strong anti-diabetogenic and hypoglycemic action in STZ-induced type-2 diabetic rat model. The consistent and / or variable pattern of these genes in skeletal muscle and adipose tissue indicates that cinnamon acts differently by affecting some but not all of these genes and that their expressions are tissue specific.
Content may be subject to copyright.
J Biochem Tech (2014) 5(2): 708-717
I
SSN:
097
4-2
3
2
8
Abstract
Cinnamon (CN) is known for its anti-diabetic activities in traditional
medicine. CN extracts are reported to have beneficial effects on
normal and impaired glucose tolerance, insulin resistance and type-2
diabetes. The aim of this study is to observe the effect of CN extract
on certain diabetogenes involved in insulin signaling. Streptozotocin
(STZ) induced type-2 diabetic rats were given CN extract for one
month and its effect was observed on blood glucose levels, body
weights and gene expression levels of protein tyrosine phosphatase-
1B (PTP-1B), insulin receptor (INSR), insulin receptor substrate-1
(IRS-1), phosphoinositide 3-kinase (PI3K), protein kinase B (PKB),
protein kinase C-theta (PKCθ) and phosphoinositide-dependent
protein kinase-1 (PDK1) in skeletal muscle and adipose tissue.
Statistically significant difference was found in the glucose levels
and body weights of test and diabetic control groups. In muscle,
statistically significant difference was observed in gene expression
levels of PTP-1B, IRS-1, PKB, PDK1, PI3K and PKCθ between test
and diabetic control groups and PTP-1B, IRS-1, PKB, PDK1 and
PKCθ between normal and diabetic control groups. In adipose
tissue, statistically significant difference was found in gene
expression levels of PTP-1B, PKCθ, IRS-1 between test and
diabetic control groups and PTP-1B, PDK1, PI3K, PKCθ and IRS-1
between normal and diabetic control groups. These results suggest
that cinnamon normalizes blood glucose level and body weight and
affect certain molecular targets in the insulin signaling
pathway and therefore, possess strong anti-diabetogenic and
hypoglycemic action in STZ-induced type-2 diabetic rat
model. The consistent and / or variable pattern of these
genes in skeletal muscle and adipose tissue indicates that
cinnamon acts differently by affecting some but not all of these
genes and that their expressions are tissue specific.
Keywords: Type-2 diabetes; cinnamon; streptozotocin; insulin
resistance; skeletal muscle; adipose tissue.
Introduction
Insulin is the principal hormone that regulates uptake of
glucose from the blood into most cells, including skeletal
muscle cells and adipocytes. Insulin resistance which refers to
suppressed or delayed responses to insulin, is the major
pathway that leads to type-2 diabetes (Lin and Sun 2010).
There is a considerable reduction in the insulin induced
glucose disposal in skeletal muscle which is the most
prominent tissue for the utilization of glucose in insulin
dependent manner (Defronzo and Tripathy 2009). This triggers
disturbances in glucose homeostasis throughout the body
ultimately leading to impaired insulin sensitivity and disease
development (Oberg et al. 2011). A number of protein
molecules are involved in the insulin signal transduction
cascade which includes protein kinases and phosphatases.
Insulin receptor (INSR) is hetero-tetrameric in nature (Frodea
and Medeirosb 2008; Kim et al. 2012). Its kinase activity is
reduced in type-2 diabetes (Frojdo et al. 2008). Insulin receptor
substrate-1 (IRS-1) which is significantly expressed in
adipocytes, is the first intermediate in the insulin signal
transduction pathway. Several downstream proteins docks IRS-
1 and initiate certain metabolic pathways (Waqar et al. 2009).
In adipose tissue, IRS-1 acts as a critical factor for the
translocation of GLUT-4 by phosphoinositide 3-kinase (PI3K)
which induces downstream phosphorylation and
dephosphorylation events (Chawla et al. 2011). It is suggested
that the insulin-induced PI3K activity become lowered in type-
2 diabetic patients that may lead to abnormal GLUT-4
translocation and insulin resistance (Choi and Kim 2010).
Phosphoinositide-dependent protein kinase-1 (PDK1)
Possible Molecular Targets of Cinnamon in the Insulin Signaling
Pathway
Sana Eijaz, Asmat Salim*, Mohammed Anwar Waqar
Received: 25 June 2013 / Received in revised form: 04 August 2013, Accepted: 20 August 2013, Published online: 30 April 2014
© Sevas Educational Society 2008-2014
Sana Eijaz
Dr. Panjwani Center for Molecular Medicine and Drug Research,
International Center for Chemical and Biological Sciences (ICCBS),
University of Karachi, Karachi-75270, Pakistan.
Asmat Salim*
Dr. Panjwani Center for Molecular Medicine and Drug Research,
ICCBS, University of Karachi, Karachi-75270, Pakistan.
Tel.: 00919450358872
*Email: asmat.slim@iccs.edu
Muhammad Anwar Waqar
Dr. Panjwani Center for Molecular Medicine and Drug Research,
ICCBS, University of Karachi, Karachi-75270, Pakistan.
J Biochem Tech (2014) 5(2): 708-717
709
stimulates the phosphorylation and activation of protein kinase B
(PKB) at the plasma membrane (Bayascas et al. 2008). Studies
suggest that in the adipose tissue of type-2 diabetic subjects, the
insulin-induced activation of PKB become moderate (Bayascas
2008; Waugh et al. 2009). Protein kinase C-theta (PKCθ) is
significantly associated with insulin resistance in muscle and
adipose tissue and thus responsible for type-2 diabetes (Wang et al.
2009). PKCθ is a serine-threonine kinase and induces the abnormal
phosphorylation of IRS-1 that weakens its potential to activate
PI3K. High plasma concentration of free fatty acids leads to the
higher diacyl glycerol (DAG) levels which trigger the plasma
activation of PKCθ lowering the tyrosine phosphorylation of IRS-1
(Nowotny et al. 2013). Protein tyrosine phosphatase-1B (PTP-1B) is
a protein tyrosine phosphatase which catalyzes the de-
phosphorylation of INSR and IRS-1, followed by the modification
of insulin action (Pessin and Saltiel 2000; Tsuruzoe et al. 2001). The
down regulation of PTP-1B improves insulin sensitivity and glucose
tolerance as well as decreases the chances of obesity triggered by
high fat diet (Lantz et al. 2010). PTP-1B knockout mice showed
enhancement in insulin sensitivity. PTP-1B is therefore, one of the
strong candidates to target insulin resistance (Lian et al. 2007; Tsou
and Bence 2012).
Anti-diabetic herbs have been used since long but its specific
mechanism of action is not completely understood. Cinnamomum
cassia, commonly known as cinnamon has long been known to have
anti-diabetic activity (Qin et al. 2003). It enhances the expression of
proteins involved in glucose transport, insulin signaling, and
regulates dislipidemia (Cao et al. 2010). In this study, we observed
the effect of cinnamon extract containing diet on the blood glucose
levels and body weights of type-2 diabetic rats and analyzed the
expression of certain diabetogenes that play important role in insulin
signaling. The data presented here is yet another attempt in
elucidating the role of cinnamon herb in the insulin signaling
pathway.
Materials and Methods
Experimental animals
Wistar male rats, weighing 180-200 g were housed in the Animal
House Facility of the International Center for Chemical and
Biological Sciences (ICCBS), University of Karachi, Karachi,
Pakistan. Temperature was maintained at 21 ± 1°C and humidity
around 57% at 12:12 hour standard light and dark cycle.
International guidelines were followed for the care and use of
laboratory animals. Animal study was endorsed by the ‘Institutional
Animal Care and Use Committee’ of ICCBS. Animals were grouped
into Test, Diabetic Control and Normal. The number of animals was
6 in each group (n = 6).
To prepare High Fat Diet (HFD), butter was mixed with normal diet
ingredients in the ratio of 4:6 respectively. HFD was given to two
groups (Table 1) for six months. Rats had free access to HFD and
water. One group was fed normal diet throughout the experiment
and was considered as the normal group. These rats were non-
diabetic as compared to the rats in the test and diabetic control
groups. During the administration of HFD, weights of all the rats
were recorded twice a month to observe the effect of HFD on body
mass. Before the analysis of insulin resistance, animals were fasted
overnight. Weights of all the rats in each group were recorded. In
order to determine the effect of HFD, oral glucose tolerance test
(OGTT) of both the test and diabetic control groups were carried
out. Fasting glucose levels were first recorded. OGTT was
performed by oral administration of glucose (1 gm/ml/kg). Blood
samples were collected by venipuncture from the tail at 30, 60
and 120 minutes after the oral glucose administration and
readings were recorded with glucometer (Roche).
Intravenous administration of streptozotocin
Streptozotocin (STZ) was prepared in 0.1 M citrate buffer (pH
4.3) and administered intravenously as (35mg/kg/ml) to the test
and diabetic control groups while rats were still in fasting
condition. Normal group was administered citrate buffer only.
Table 1: Experimental groups used in this study
Experimental
Groups
High Fat
Diet
(HFD)
Streptozotocin
(STZ)
Cinnamon
(CN) Extract
Diabetic
Control
+ + -
Test + + +
Normal - - -
(+ given, - not given)
Determination of type-2 diabetes
Onset of type-2 diabetes was monitored by OGTT as
described in case of insulin resistance.
Administration of cinnamon diet
Cinnamomum cassia, commonly known as cinnamon (CN)
was purchased in the dry form from a local distributor. It
was washed and dried under sunlight. Ethanolic extracts of
cinnamon was prepared by soaking in 80% ethanol for 72
hours. The extracts were filtered and mixed with normal diet
ingredient. The extract was administered as 1g/kg/day and
continued for one month. During the treatment, weights of
all rats were recorded twice a month to see its effect on body
mass. The diabetic control group was not given the
cinnamon extract.
Effect of cinnamon extract on blood glucose level and body
weight
The effect of cinnamon extract on blood glucose level was
analyzed by performing OGTT. Body weights of all the
treated rats were also recorded.
Effect of cinnamon on PTP-1B, IRS-1, INSR, PI3K, PKB,
PKCθ and PDK1 genes
After the completion of the experimental period, rats of all
three groups were sacrificed and skeletal muscle and
adipose tissues were dissected out. After isolation, muscle
and adipose tissues were preserved immediately in RNA
stabilization reagent (Qiagen, Germany) and stored at -20°C
until later use. RNA isolation was done with SV Total RNA
Isolation System (Promega, USA) and quantified at 260nm.
0.5µg total RNA was subjected to cDNA synthesis by
RevertAidTM First Strand cDNA Synthesis Kit (Fermentas,
USA). RT-PCR was done using GoTaq Green Master Mix
(Promega, USA). cDNA samples corresponding to PTP-1B,
IRS-1, INSR, PI3K, PKB, PKCθ and PDK1 genes were
subjected to denaturation for 5 min at 94°C, followed by 30
cycles of amplification (denaturation at 94°C, annealing at
50-61°C and extension at 72°C for 1 min each) and a final
extension at 72°C for 10 min. GAPDH was used as internal
standard. The primers were designed using the primer
710
J Biochem Tech (2014) 5(2): 708-717
design program, primer 3 online software
(http://frodo.wi.mit.edu/). The primer sequences and their product
sizes are: (i) PTP-1B gene 5’ CCACACCATCTCCCAGAAGT
3’ (forward); 5’ CGGAACAG GTACCGAGATGT 3’ (reverse);
product size: 174 base pairs; (ii) INSR gene 5’
GGATGGTCAGTGTGTGGAGA 3’ (forward); 5’
TCGTGAGGTTGTGCTTGTTC 3’ (reverse), product size: 563
base pairs; (iii) IRS-1 gene 5’ CACCCAGTTTTTCGACAC
3’(forward); 5’ GAGTTGAGCTT CACAAAG 3’ (reverse);
product size: 600 base pairs; (iv) PI3K gene 5’
AGCCACAGGTGAAAATACGG’ 3 (forward); 5’
TTTTCTTTCCGCAACAGCTT’ 3 (reverse); product size: 199
base pairs; (v) PKB gene 5’ ACCTCATGCTGGACAAGGAC
3’(forward); 5’ TGAGCTCGAACAGCTTCTCA 3’(reverse);
product size: 246 base pairs; (vi) PKC-θ gene: 5’
CCGAGAAGGACCAATTGAAA 3’(forward); 5’ AAACTTCC
TTTCCCCAGCAT 3’(reverse); product size: 240 base pairs; (vii)
PDK1 gene: 5’ CTCACAGAAGGGCCACATTT 3’ (forward); 5’
AGCATCTGGACTGCTCTGGT 3’ (reverse); product size: 228
base pairs; (viii) GAPDH: 5’ GGAAAGCTGTGGCGTGATGG
3’ (forward); 5’ GTAGGCCATGAGGTCCACCA 3’ (reverse);
product size: 414 base pairs. Each PCR product was
electrophoretically resolved on 3% agarose gel. Bands were
visualized under UV light in the FluorChem Imaging System
(Alpha Innotech, USA). The relative expression ratio of each
gene was calibrated with GAPDH and comparison was done
between test, diabetic control and normal groups.
Statistical analysis
Statistical analysis was performed by using the Sigma plot 11.2.0.
Student's t-test was used to compare the test, diabetic control and
normal groups. The differences were considered significant at a
value of p < 0.05. Data are presented as mean ± SEM.
Results
Effect of high fat diet on blood glucose level
High Fat Diet (HFD) was given to rats for six months. After the
completion of the six month period, OGTT of all rats were
performed. Readings were recorded at fasting (0 min) and at 30,
60 and 120 min after the administration of oral glucose. There
was a significant increase in the blood glucose levels of overnight
fasted rats and during all time periods after glucose
administration when normal group was compared with diabetic
control and test groups (Fig. 1; Table 2). Overall differences
between the blood glucose levels among diabetic control and
normal groups (p= 0.045*) and test and normal group (p=
0.004**) were recorded and found to be significant (Fig. 1; Table
2).
Effect of streptozotocin on blood glucose level
After the completion of the six month period, STZ was
administered intravenously. The normal group was administered
citrate buffer only. After one month, OGTT was performed.
Readings were recorded at fasting (0 min) and at 30, 60 and 120
min after the administration of oral glucose. There was a
significant increase in the blood glucose levels of overnight fasted
rats and during all time periods after glucose administration when
normal group was compared with diabetic control and test groups
(Fig. 2; Table 3). Overall differences between the blood glucose
levels among diabetic control and normal groups
(p= 0.045*) and test and normal group (p= 0.004**) were
recorded and found to be significant (Fig. 2; Table 3). There
was a marked overall difference between the blood glucose
Figure 1: Effect of High Fat Diet (HFD) on blood glucose levels of
diabetic control, test and normal groups
levels of diabetic control and normal group (p = <0.001***)
and between the test and normal group (p = <0.001***)
(Fig. 2; Table 3).
Table 2: Blood glucose levels after administration of high fat diet
(HFD)
Experimenta
l Groups
Time
0 min 30 min 60 min 120 min
Diabetic
Control#
102 ±
1.31***
152 ±
9.71**
163 ±
15.78*
170
±15.44***
Test## 130 ±
8.38***
172 ±
7.89***
160 ±
8.1***
166 ±
17.17**
Normal 88 ± 2.16 119 ± 3.36 113 ±
3.48
99 ± 1.58
Comparison at individual time periods: Normal group was compared
with diabetic control and test groups (*p = 0.01; **p = 0.009 and
***p = <0.001), Overall comparison: Blood glucose levels of test and
diabetic control were compared with that of normal group ( #p = 0.
045 and ##p = 0.004)
Figure 2: Effect of Streptozotocin (STZ) on blood glucose levels of
diabetic control, test and normal groups
Effect of cinnamon extract on blood glucose level
After the development of type-2 diabetes, test group was given
cinnamon (CN) extract containing diet while the diabetic
control and normal group was given normal diet. After one
month, OGTT was performed. Readings were recorded at
fasting (0 min) and at 30, 60 and 120 min after the
administration of oral glucose. There was a significant
difference in the blood glucose levels of overnight fasted rats
J Biochem Tech (2014) 5(2): 708-717
711
and during all time periods after glucose administration when test
Table 3: Blood glucose levels after STZ treatment
Experimental
Groups
Time
0 min 30 min 60 min 120 min
Diabetic
Control###
401 ±
11.38**
*
458 ±
18.97***
585 ±
6.2***
572 ± 12.1***
Test### 554 ±
15.88**
*
584 ±
8.76***
584 ±
11.94***
577 ± 9.47***
Normal 89 ± 2.1
8
122 ± 3.6
4
108 ± 3.17 91 ± 2.27
Comparison at individual time periods: Normal group was compared
with diabetic control and test group (***p = <0.001), Overall
comparison: Blood glucose levels of test and diabetic control were
compared with that of normal group (### p = <0.001)
group was compared with diabetic control group (Fig 3; Table 4).
However, statistical difference was also observed at all time
periods between test and normal groups except after 120 min of
glucose administration (Fig 3; Table 4). Overall statistically
significant difference was observed in blood glucose levels of the
test and diabetic control groups (p= <0.001) (Fig 3; Table 4).
Figure 3: Effect of Cinnamon (CN) extract on blood glucose levels of
diabetic control, test and normal groups
Effect of high fat diet, streptozotocin and cinnamon on body
weight
During the six months period of HFD administration, body
weights of rats belonging to all groups were recorded every
month till 6 months. After the administration of HFD, all rats
gained weight gradually. In the test group, weight gain was
gradual with HFD administration. As the STZ was administered
to rats of both diabetic control and test groups, there was a
marked decrease in the body weight. After the development of
type-2 diabetes, test group was given cinnamon extract for one
month. At the end of the treatment, weights of all rats belonging
to this group were recorded before and after treatment.
Effect of cinnamon on body weight
Gradual weight gain was observed in the normal group.
Decrease in the body weight was observed in the diabetic
control and test groups after the administration of STZ. Weight
gain was normalized in the test group after treatment with
cinnamon while no change was observed in the diabetic control
group (Fig 4; Table 5). Statistically significant change was
observed in the body weights within the test group before and
after CN treatment (p= <0.001). There was also a statistically
significant difference in the body weights of the test and
diabetic control groups (p= 0.002**) (Table 5).
Figure 4: Effect of High Fat Diet (HFD), streptozotocin (STZ) and
cinnamon extract (CN) on body weights of diabetic control, test and
normal groups: The weights were recorded every month, before the
start of any treatment or HFD administration (month 0), during HFD
administration (months 1-6), STZ treatment (month 7) and cinnamon
treatment (month 8).
Effect of cinnamon on PTP-1B, IRS-1, INSR, PI3K, PKB,
PKCθ and PDK1 genes in skeletal muscle
The expression levels of PTP-1B, IRS-1, INSR, PI3K, PKB,
PKCθ, and PDK1 genes were analyzed in the skeletal muscle
of diabetic control, test and normal groups (Table 6).
Statistically significant difference was observed in the gene
expression levels of PTP-1B, IRS-1, PKB, PDK1, PI3K and
PKCθ between diabetic control and test groups and PTP-1B,
IRS-1, PKB, PDK and PKCθ between diabetic control and
normal groups (Fig. 5). In case of normal and test groups
statistically significant difference was only observed in
expression level of PDK1 (p= 0.004***) (Table 7).
Effect of cinnamon on PTP-1B, IRS-1, INSR, PI3K, PKB,
PKCθ and PDK1 genes in adipose tissue
The expression levels of PTP-1B, IRS-1, INSR, PI3K, PKB,
PKCθ, and PDK1 genes were analyzed in the adipose tissue of
diabetic control, test and normal groups (Table 8). Statistically
significant difference was found in the gene expression levels
of PTP-1B, PKCθ and IRS-1 between diabetic control and test
groups and PTP-1B, PDK1, PI3K, PKCθ and IRS-1 between
diabetic control and normal groups (Fig. 6). In case of normal
and test groups statistically significant difference was observed
in the expression level of PTP-1B, PDK1, PI3K, PKCθ and
INSR (Table 9).
Table 4: Blood glucose levels after cinnamon administration
Experimental
Groups
Time
0 min 30 min 60 min 120 min
Diabetic
Control###
507 ±
13.23***
584 ±
8.84***
585 ±
8.8***
589 ±
10.9***
Test### 132 ±
18.79
312 ±
9.00
236 ±
23.35
140 ± 37.05
Normal 89 ±
2.18*
122 ±
4.64***
105 ±
3.02***
92 ± 2.37
Comparison at individual time periods: Test group was compared with
diabetic control and normal groups (*p = 0.01 and ***p = <0.001)
Overall comparison: Blood glucose levels of test group were compared
with that of and diabetic group (### p = <0.001)
712
J Biochem Tech (2014) 5(2): 708-717
(a)
(b)
Table 5: Body weights recorded during the course of study
Groups
Months
0
HFD
1
HFD
2
HFD
3
HFD
4
HFD
5
HFD
6
HFD
7
STZ
8
CN
Diabetic control 188±3.17 193±3.37 210±7.08 211±3.24 253±17.7 285±14.2 319±7.88 224±11.9 200±11.9
Test# 185±1.85 194±2.02 221±4.13 240±8.02 249±7.27 261±10.1 274±15.48 201±2.74 374±8.44
Normal 189±4.02 215±9.64 227±7.42 329±7.16 343±16.9 370±11.5 376±8.34 384±10.1 392±8.48
HFD was given to all rats; STZ to diabetic control and test groups while CN only to the test group, # p = <0.001*** and = 0.002** respectively when
values were compared within test group and with the diabetic control group after cinnamon treatment.
Table 7: Statistical difference among groups with respect to
expression of dibeteogenes in skeletal muscle
Genes
Groups
Diabetic Control
and Test
Diabetic
Control
and Normal
Normal and
Test
PTP-1B 0.03* 0.01** 0.06
IRS-1 <0.001*** 0.01** 0.14
INSR 0.45 0.64 0.38
PDK1 0.001*** 0.01** 0.004***
PKB 0.02* 0.03* 0.24
PI3K 0.01** 0.20 0.28
PKCθ <0.001*** <0.001*** 0.12
Table 6: Expression of dibeteogenes in skeletal muscle
Genes
Groups
Test Diabetic Control Normal
PTP-1B 0.337 ± 0.07 1.123 ± 0.22 0.169 ± 0.04
IRS-1 0.344 ± 0.006 0.226 ± 0.008 0.230 ± 0.02
INSR 0.137 ± 0.05 0.105 ± 0.01 0.087 ± 0.03
PDK1 1.454 ± 0.14 0.255 ± 0.06 0.592 ± 0.02
PKB 5.717 ± 1.603 0.165 ± 0.05 1.237 ± 0.04
PI3K 0.489 ± 0.05 0.210 ± 0.03 0.334 ± 0.06
PKCθ 0.311 ± 0.03 0.800 ± 0.02 0.194 ± 0.04
(c)
J Biochem Tech (2014) 5(2): 708-717
713
(d)
(e)
(f)
(g)
Figure 5: Effect of cinnamon (CN) extract on the expression levels of (a) PTP-1B, (b) IRS-1, (c) INSR, (d) PI3K (e) PKB (f) PKCθ and (g) PDK1 genes
in skeletal muscle: The density of each band was measured as “integrated density values (IDVs)”. Graphs are showing expression of genes relative to the
expression of GAPDH. Data are expressed as means ± SEM, indicating the significant levels of difference in the expression profile of these genes in the
diabetic control, test and normal groups.
Table 8: Expression of dibeteogenes in adipose tissue
Genes Groups
Test Diabetic Control Normal
PTP-1B 0.238 ± 0.007 0.742 ± 0.009 0.080 ± 0.01
IRS-1 0.403 ± 0.05** 0.153 ± 0.02 1.167 ± 0.01
INSR 0.055 ± 0.01 0.045 ± 0.01 0.109 ± 0.02
PDK1 0.676 ± 0.01 0.689 ± 0.005 0.485 ± 0.05
PKB 0.211 ± 0.09 0.197 ± 0.006 0.207 ± 0.03
PI3K 1.582 ± 0.21 0.261 ± 0.06 1.361 ± 0.31
PKC-θ 0.441 ± 0.04 0.727 ± 0.08 0.112 ± 0.006
Table 9: Statistical difference among groups with respect to
expression of dibeteogenes in adipose tissue
Genes Groups
Diabetic
Control and
Test
Diabetic Control Normal and Test
and Normal
PTP-1B <0.001*** 0.002*** <0.001***
IRS-1 0.01** <0.001*** 0.55
INSR 0.61 0.21 0.05*
PDK1 0.45 0.02* <0.001***
PKB 0.88 0.79 0.96
PI3K 0.59 0.02* 0.005**
PKCθ 0.04* 0.002*** 0.002***
714
J Biochem Tech (2014) 5(2): 708-717
(a)
(b)
(c)
(d)
(e)
J Biochem Tech (2014) 5(2): 708-717
715
(f)
(g)
Figure 6: Effect of cinnamon (CN) extract on the expression levels of (a)
PTP-1B, (b) IRS-1, (c) INSR, (d) PI3K (e) PKB (f) PKCθ and (g) PDK1
genes in adipose tissue. The density of each band was measured as
“integrated density values (IDVs)”. Graphs are showing expression of genes
relative to the expression of GAPDH. Data are expressed as means ± SEM,
indicating the significant levels of difference in the expression profile of
these genes in the diabetic control, test and normal groups.
Discussion
Type-2 diabetes mellitus is the major metabolic disorder throughout
the world. As conventional drugs are associated with a number of
side effects, there is a need to search for safe alternative drugs. In
this respect, natural products hold great promise and are expected to
have similar efficacy with no side effects (Anand et al. 2010). Some
patients who experienced insulin resistance do not respond well to
the conventional drugs but show good response to natural products
(Waqar et al. 2009). A number of anti-diabetic herbs have been used
for a long period of time. However, their exact mechanism of
action is not known. Earlier studies have suggested that
cinnamaldehyde, an active component of cinnamon acts by
enhancing release of insulin through direct insulin releasing
effect on β-cells (Bolkent et al. 2000; Sharma et al. 2006; Patel
et al. 2012). The present study was conducted to see the effect
of cinnamon extract on blood glucose level, body weight and
expression level of some diabetogenes in the STZ-induced
diabetic rats. Insulin resistance was developed by means of
High Fat Diet (HFD) which critically affects insulin signaling
pathway (Hancock et al. 2008). Adipose tissues and skeletal
muscles are drastically affected by HFD and show increased
insulin resistance (Gong et al. 2012; Higashida et al. 2013).
The high fat-fed animal models therefore aid in understanding
the patho-physiological mechanisms in association with insulin
resistance but their phenotype differ substantially in various
studies (Henriksen et al. 2008).
In our study, experimental animals showed impaired glucose
tolerance and marked increase in the body weight during the
course of HFD administration. OGTT confirmed that all rats
with HFD developed insulin resistance which is the pre-
diabetic state. We used streptozotocin (STZ) treatment to
develop type-2 diabetes in insulin resistant rats. After one
month of STZ administration, the OGTT results showed
marked increase in blood glucose level in the STZ-
administered groups. The blood glucose level remained
elevated even after two hours of oral glucose administration,
whilst the blood glucose level of normal group returned back
to normal value after two hours. The body weight of STZ-
administered groups also reduced significantly as compared to
the normal group. As the STZ-administered rats became
diabetic, there was reduced glucose uptake and the body
tissues fail to utilize glucose as energy source. To tackle with
this critical situation, diabetic rats start to use surplus body fat
as energy source which was accumulated around their tissues.
After a certain period of time, the fat stores began to deplete so
the obese diabetic rats lose their body weight.
After the confirmation of the onset of diabetes, we treated one
of the diabetic groups with cinnamon extract (test group) while
the other one was left untreated (diabetic control group). The
normal group did not receive cinnamon extract. After one
month, blood glucose level was monitored by OGTT and it
was found that the test group showed reduced blood glucose
levels after two hours. This shows that the cinnamon extract
has improved glucose uptake. On the other hand, blood
glucose level of the diabetic control group did not return to
normal levels even after two hours showing that the glucose
uptake process is still impaired. The results of both the groups
were statistically significant. We also analyzed the body
weights after the cinnamon extract administration. The results
showed statistically significant increase in the body weights of
the test group. This means that as the glucose uptake becomes
normal, body has started to use glucose instead of fats.
In the present study, the effect of cinnamon extract on the
expression of some diabetogenes in skeletal muscle and
adipose tissue was also analyzed. Most of the studied
diabetogenes in our study are the components of insulin
signaling pathway. These include protein tyrosine phosphatase-
1B (PTP-1B), insulin receptor (INSR), insulin receptor
substrate-1 (IRS-1), phosphoinositide 3-kinase (PI3K), protein
kinase B (PKB), protein kinase C-theta (PKCθ) and
phosphoinositide-dependent protein kinase-1 (PDK1) genes in
skeletal muscle and adipose tissue. In our study, we
hypothesized that cinnamon may improve insulin resistance by
716
J Biochem Tech (2014) 5(2): 708-717
ameliorating some of the impaired insulin signaling genes in skeletal
muscle and adipose tissue. Our results showed increased expression
of PTP-1B and PKCθ in the skeletal muscle and adipose tissue of
the diabetic control group as compared to normal group while
cinnamon extract significantly reduced the expression of these genes
in the test group. The reduced expression is significant in both
skeletal muscle and adipose tissues in case of PTP-1B and while
PKCθ expression was markedly reduced mainly in the skeletal
muscle. Decreased expression of PKB, PDK1 and IRS-1 genes was
observed in diabetic control and normal groups. This decrease is
significant in both skeletal muscle and adipose tissue for PDK1 and
IRS-1 genes while PKB showed significant decrease only in case of
skeletal muscle. Cinnamon markedly increased the expression of
PKB and PDK1 in skeletal muscle and that of IRS-1 in both skeletal
muscle and adipose tissue of the test group. Decreased expression
was also observed in case of PI3K in diabetic control as compared
to normal group both in skeletal muscle and adipose tissue while the
test group showed remarkable increase in the expression of PI3K in
the skeletal muscle in comparison with diabetic control after the
administration of cinnamon extract. We did not observe any
significant different both in the skeletal muscle and adipose tissue of
diabetic control and the normal group and there was no change
observed in the test group as well.
Conclusion
The present study demonstrates that cinnamon has strong anti-
diabetogenic and hypoglycemic action in HFD and STZ-induced
type-2 diabetic rat models. Cinnamon affected the expression of
PTP-1B, PKB, PDK1, PI3K, PKCθ, IRS-1 and INSR which
accounts for the onset of insulin resistance and type-2 diabetes. It
was interesting to note that the effect of cinnamon is consistent in
both skeletal muscle and adipose tissue in case of some genes while
for others it showed variable pattern. This shows that cinnamon acts
differently in these tissues by affecting some of these genes while at
the same time other genes are not affected. Taken together, the
results suggest that amelioration of hyperglycemia and insulin
resistance by cinnamon in type-2 diabetic rats is possibly due to the
effective normalization of the expression of insulin signaling genes.
Moreover, there is an inhibitory effect on these genes which
negatively influence the insulin signaling pathway. In our study, we
attempted to see the effect of cinnamon herb on genes of insulin
regulating pathway. These findings may help to understand the
possible molecular mechanism of action of cinnamon and to
elucidate its precise role as an anti-diabetic herb.
Acknowledgement
We would like to acknowledge Mr. Ghulam Abbas (PCMD) for his
help regarding development diabetic rat model.
References
Anand P, Murali KY, Tandon V, Murthy PS, Chandra R (2010)
Insulinotropic effect of cinnamaldehyde on transcriptional
regulation of pyruvate kinase, phosphoenolpyruvate
carboxykinase, and GLUT4 translocation in experimental
diabetic rats. Chemico-Biological Interactions 186: 72-81
Bayascas JR (2008) Dissecting the role of the 3- phosphoinositide-
dependentprotein kinase-1 (PDK1) signalling pathways. Cell
Cycle 7: 2978-2982
Bayascas JR, Wullschleger S, Sakamoto K, Garcia-Martinez JM,
Clacher C, Komander D, Van ADM, Boini KM,
Lang F, Lipina C, Logie L, Sutherland C, Chudek JA, Van
DJA, Voshol PJ, Lucocq JM, Alessi DR (2008) Mutation of the
PDK1 PH domain inhibits protein kinase B/Akt, leading to
small size and insulin resistance. Molecular and Cellular
Biology 28: 3258-3272
Bolkent S, Yamardag R, Tabakogluoguz A, Ozsoy-Sacon O
(2000) Effects of chard (B. vulgaris L. var. cicla) extract
on pancreatic B-cells in streptozotocin-diabetic rats: a
morphologic and biochemical study. Journal of
Ethnopharmacology 73: 251-259
Chawla S, Gupta D, Tiwari A (2011) Type-2 diabetes in the
wake of insulin resistance: Molecular etiology and
therapeutics. Journal of Pharmacy Research 4: 1118-1123
Choi K and Kim Young-Bum (2010) Molecular mechanism of
insulin resistance in obesity and type 2 diabetes. Korean J
Intern Med 25:119-129
Cao H, Polansky MM, Anderson RA (2010) Cinnamon extract
regulates plasma levels of adipose-derived factors and
expression of multiple genes related to carbohydrate
metabolism and lipogenesis in adipose tissue of fructose-
fed rats. Hormone and Metabolic Research 42: 187-193
Defronzo RA, Tripathy D (2009) Skeletal muscle insulin
resistance is the primary defect in type-2 diabetes.
Diabetes care 32: 157-163
Frodea TS, Medeirosb YS (2008) Animal models to test drugs
with potential antidiabetic activity. Journal of
Ethnopharmacology 115: 173-183
Frojdo S, Vidal H, Pirola L (2009) Alterations of insulin
signalling in type 2 diabetes: A review of the current
evidence from humans. Biochim Biophys Acta 1792: 83-
92
Gong Y, Li J, Li C, Mu Y, Xiao Y, Tian H, Pan C, Liu Y
(2012) The adipose tissue endocrine mechanism of the
prophylactic protective effect of pioglitazone in high-fat
diet-induced insulin resistance. Journal of International
Medical Research 40: 1304-1316
Hancock CR, Han Dong-Ho, Chen M, Terada S, Yasuda T,
Wright DC, Holloszy JO (2008) High-fat diets cause
insulin resistance despite an increase in muscle
mitochondria. PNAS 105: 7815-7820
Henriksen EJ, Teachey MK, Lindborg KA, Diehl CJ, Beneze
AN (2008) The high-fat-fed lean Zucker rat: a
spontaneous isocaloric model of fat-induced insulin
resistance associated with muscle GSK-3 overactivity. Am
J Physiol Regul Integr Comp Physiol 294: 1813-1821
Higashida K, Fujimoto E, Higuchi M, Terada S (2013) Effects
of e-day fasting on high-fat diet induced insulin resistance
in rat skeletal muscle. Life Science 93: 208-13
Kim D, Cho SY, Yeau S-H, Park SW, Sohn YB, Kwon M-J,
Kim J-Y, Ki C-S, Jin D-K (2012) Two novel insulin
receptor gene mutations in a patient with Rabson-
Mendenhall Syndrome: The first Korean case confirmed
by biochemical, and molecular evidence. J Korean Med
Sci 27: 565-568
Lantz KA, Hart SG, Planey SL, Roitman MF, Ruiz-White IA,
Wolfe HR, McLane MP (2010) Inhibition of PTP1B by
Trodusquemine (MSI-1436) Causes Fat-specific Weight
Loss in Diet-induced Obese Mice. Obesity 18: 1516-1523
Lian JH, Guo L, Hu WR, Wu GL, Ji W, Gong BQ (2007)
Establishment of a cell-based drug screening model for
identifying down-regulators of protein tyrosine
phosphatase 1B expression. Experimental and Clinical
Endocrinology & Diabetes 115: 24-28
Lin Y, Sun Z (2010) Current views on type 2 diabetes. Journal
of Endocrinology 204: 1-11
Nowotny B, Zahiragic L, Krog D, Nowotny PJ, Herder C,
Carstensen M, Yoshimura T, Szendroedi J, Phielix E,
Schadewaldt P, Schloot NC, Shulman G, Roden M (2013)
J Biochem Tech (2014) 5(2): 708-717
717
Mechanisms underlying the onset of oral lipid-induced skeletal
muscle insulin resistance in humans. Diabetes 62: 2240-2248
Oberg AI, Yassin K, Csikasz RI, Dehvari N, Shabalina
IG, Hutchinson DS, Wilcke M, Ostenson CG, Bengtsson T
(2011) Shikonin increases glucose uptake in skeletal muscle
cells and improves plasma glucose levels in diabetic Goto-
Kakizaki rats. PLoS one 6: 1-10
Patel DK, Prasad SK, Kumar R, Hemalatha S (2012) An overview
on antidiabetic medicinal plants having insulin mimetic
property. Asian Pac J Trop Biomed 2: 320-330
Pessin JE, Saltiel AR (2000) Signaling pathways in insulin action:
molecular targets of insulin resistance. Journal of Clinical
Investigation 106: 165-169
Qin B, Nagasaki M, Ren M, Bajotto G, Oshida Y, Sato Y (2003)
Cinnamon extract (traditional herb) potentiates in vivo insulin
regulated glucose utilization via enhancing insulin signaling in
rats. Diabetes Research and Clinical Practice 62: 139-148
Sharma SB, Nasir A, Prabhu KM, Murthy PS (2006)
Antihyperglycemic effect of the fruitpulp of Eugenia jambolana
in experimental diabetes mellitus. Journal of
Ethnopharmacology 104: 367-373
Tsou RC and Bence KK (2012) The Genetics of PTPN1 and
Obesity: Insights from Mouse Models of Tissue-Specific
PTP1B Deficiency. Journal of Obesity 2012: 1-8
Tsuruzoe K, Emkey R, Kriauciunas KM, Ueki K, Kahn CR (2001)
Insulin receptor substrate 3 (IRS-3) and IRS-4 impair IRS-1-
and IRS-2-mediated signaling. Molecular and Cellular Biology
21: 26-38
Wang C, Liu M, Riojas RA, Xin X, Gao Z, Zeng R, Wu J, Dong
LQ, Liu F (2009) Mechanisms of Signal Transduction: Protein
Kinase C theta (PKC theta) dependent Phosphorylation of
PDK1 at Ser504 and Ser532 Contributes to Palmitate-induced
Insulin Resistance. J Biol Chem 284: 2038-2044
Waqar MA, Aijaz S, Shaukat S, Saleem A (2009) Malfunctioning of
genes contributing towards diabetes mellitus type-2. Journal of
Chemical Society of Pakistan 31: 339-356
Waqar MA, Aijaz S, Shaukat S, Waqar A (2009) Herbs can
effectively talk with diabetogenes. Journal of Chemical Society
of Pakistan 31: 677-687
Waugh C, Sinclair L, Finlay D, Bayascas JR, Cantrell D (2009)
Phosphoinositide (3,4,5)-Triphosphate Binding to
Phosphoinositide-Dependent Kinase 1 Regulates a Protein
Kinase B/Akt Signaling Threshold That Dictates T-Cell
Migration, Not Proliferation. Molecular and Cellular Biology
29: 5952-5962
... It showed decreased expression of phosphoinositide 3-kinase (PI3K), protein kinase B (PKB), phosphoinositide-dependent protein kinase-1 (PDK1), and (insulin receptor substrate-1) IRS-1 genes in diabetic control and normal groups while Cinnamon markedly increased the expression PKB, PI3K and PDK1 in skeletal muscle and that of IRS-1 in both skeletal muscle and adipose tissue of the test group after the administration of the cinnamon extract. It was stated that amelioration of hyperglycemia and insulin resistance by cinnamon in type-2 diabetic rats is most probably due to the effective normalization of the expression of insulin signaling genes [77]. ...
Article
Full-text available
Cinnamon has been used for centuries as a flavor ingredient and for medicinal purposes. It is known to reduce the risk of cancers, hyperlipidemia, and hyperglycemia due to the presence of a variety of functional active compounds. Major active components available in Cinnamon are cinnamaldehyde, cinnamyl acetate, cinnamyl alcohol, eugenol, tannin, methyl-hydroxy chalcone polymer (MHCP), cinnamic acid, camphor, etc. Among the commonly cultivated cinnamon species; Cinnamon verum or Cinnamomum zeylanicum, known as Ceylon cinnamon, has been identified as superior in beneficial active compound composition compared to its counterpart C. cassia. Various parts of the cinnamon plant such as bark, roots, and leaves contain different compositions of active compounds. Hence, their extractions are in medicinal use. Cinnamon oils and oleoresins are frequently used in the food industry due to their flavor and health benefits. Cinnamon is proven to reduce low-density lipoprotein and serum triglyceride contents effectively. High antioxidant properties are assumed to reduce the risk of cancers of various types. The antimicrobial properties of cinnamon extracts are often considered in Asian endemic medicinal treatments and are clinically proven. Among all, the remarkable ability of cinnamon in increasing insulin sensitivity and thereby, reducing the risk of type 2 diabetes has is a highlight.
... Previous research has also shown that a ginsenosides extract from Panax ginseng, containing a triterpenoid saponin compound, increases the expression of the insulin receptor, IRS-1, PI3Kp85, phosphorylated Akt and GLUT-4 in the skeletal muscle of diabetic rats [26]. Cinnamon (Cinnamomum cassia) extract, which contains tannins, also caused increases in IRS-1, PKB, PI3K and protein kinase C (PKC) gene expression in the skeletal muscle of diabetic Wistar rats [27]. Finally, a study of the effects of guava (Folium Psidii Guajavae Psidiumguajava L.) leaf extract in diabetic rats demonstated increases in expression of IRS-1, Akt, and PI3K p85, which was suggested to be mediated through the tannins, flavonoids, pentacyclic triterpenoids, and/or other chemical compounds it contains [6]. ...
Article
Full-text available
BACKGROUND Defects in post-receptor insulin signalling are the major cause of insulin resistance in type 2 diabetes mellitus (T2DM). AIM This study aimed to investigate the correlations between insulin receptor substrate (IRS)-1 with phosphoinositide 3-kinase (PI3K) and p38 mitogen-activated protein kinase (MAPK) levels after puguntano (Curanga fel-terrae [Merr.]) leaf extract treatment in a rat model of T2DM. METHODS A combination of high-fat diet-feeding (HFD) and multiple low dose intraperitoneal injections of streptozotocin was used to induced T2DM in 48 Wistar rats, which were then randomly divided into control and treatment groups (n = 24 per group). Puguntano leaf extract was administered to the treatment group once daily (200 mg/kg.bw) for 10 days. IRS-1, PI3K and p38 MAPK levels were measured in skeletal muscle using sandwich ELISAs in control group after becoming T2DM and in the treatment group after 10 days of puguntano treatment. Data were analysed using the Wilcoxon test and Spearman’s correlation. RESULTS IRS-1, PI3K and p38 MAPK levels were significantly higher in the treatment group than in the control group. There were also significant positive correlations between IRS-1 with PI3K and p38 MAPK levels (r = 0.375, p = 0.035; r = 0.552, p = 0.003; respectively) after the treatment. CONCLUSION This study demonstrated significant positive correlations between IRS-1 with PI3K and p38 MAPK levels after puguntano leaf extract treatment of T2DM rats.
... Cinnamomum verum was chosen based on potential antiinflammatory properties and since it and other species of the Cinnamomum genra are being used by ethno-doctors and herbalists to cure inflammatory diseases in Pakistan (Qidwai et al. 2003;Parasuraman et al. 2014Akram et al. 2014Eijaz et al. 2014;Zaidi et al. 2015). ...
Article
Full-text available
Ethnopharmacological relevance: Cinnamomum verum (CV), also known as 'Dalchini', is the dry bark of the Cinnamomum verum (L.) plant, and has been used as a traditional Pakistani medicine to alleviate pain and inflammation in patients suffering from arthritic rheumatism. It contains alkaloids, triterpenes, Cinnamaldehyde and other volatile oils. The aim of the present study was to investigate the underlying biological effect of ethyl alcohol (EtOH) and methyl alcohol (MeOH) extracts from CV on collagen type-II induced arthritic (CIA) mice. Materials and methods: Gas chromatography mass spectrophotometry was used to perform fingerprinting identification of the EtOH and MeOH extracts. CIA mice model was established by subdermal injections of type-II bovine collagen (CII) on the 1st, 8th and 14th day of the experiment. Ethyl alcohol extract and methyl alcohol extract (1 mg/KgBW, 2 mg/KgBW and 4 mg/KgBW), was orally administered from the 15th day onwards for 2 weeks. Progression of oedema and joint inflammation was measured in the paws using a digital Vernier calliper every 3 days from day 1 till the end of the experiment. The oxidative scavenging ability of cinnamaldehyde was evaluated using a DPPH assay. Similarly, the nitrogen free radical (NOS) production of isolated lymphocytes was evaluated using Greiss's method. The spleen index was calculated and knee joint changes were observed by histopathological sectioning. Western blot analysis was performed on peripheral blood derived serum for CII, CAPN1, TNFα and NFATc3. Results: Extracts were shown to be enriched in trans-cinnamaldehyde and its analogues. Extracts showed good ameliorative effects (p < 0.05) after day 2 of treatment. A greater therapeutic role was observed for the 4 mg/kgBW dosage of the methanolic extract (p < 0.01). Swelling in the spleen was greatly reduced along with the generation of free radicals by lymphocytes, post treatment. There was also an inhibitory role by the extracts on NFATc3 (p < 0.05), TNF-Alpha (p < 0.05), CAII (p < 0.05) and mCalpain (p < 0.05) all proteins involved in RA. Conclusion: In this study, it has been demonstrated that administration of CV has a therapeutic potential on CIA. The data suggest that CV could have a potential role in the treatment of RA patients.
... Cinnamomum verum was chosen based on potential antiinflammatory properties and since it and other species of the Cinnamomum genra are being used by ethno-doctors and herbalists to cure inflammatory diseases in Pakistan (Qidwai et al. 2003;Parasuraman et al. 2014Akram et al. 2014Eijaz et al. 2014;Zaidi et al. 2015). ...
Article
Full-text available
Diabetes is on the rise, and has become a major public health issue. In view of limitations of available glucose lowering therapy, there is a need to explore and develop natural remedies with anti-diabetic properties. Spices such as cinnamon, cloves, bay leaves, and turmeric display insulin-enhancing activity in vitro. Cinnamon or Dalchini is popularly use as a spice for its fragrance and flavour in wide variety of traditional foods. Among various types of cinnamon, C. zeylanicum is well known as effective substitute for diabetes. Cinnamaldehyde is one of the major constituents (65-80%) of bark oil extracted from C. Zeylonicum which seems to reduce plasma blood glucose concentration more effectively when it is compared with metformin. It enhances the expression of proteins involved in glucose transport, insulin signalling, and regulates dyslipidaemia. This review describes the basic and clinical pharmacology of cinnamon.
Article
Full-text available
Diabetes mellitus type 2, being a sweet killer disease is yet to be conquered. A lot of efforts are under way to find out the molecular mechanism of disease progression which will eventually be helpful in discovering the more reliable treatment options. Many environmental and inherited genetic factors have been worked out which are responsible for the initiation of the disease and progress further like a chain reaction. In either case, certain genes or their products are involved directly or indirectly. Many of these genes are known today claimed to be involved in the occurrence and progression of diabetes mellitus type 2 but still the sequence of events and some key intermediates are to be discovered This article is meant to review the role of these diabetogenes in the occurrence of the disease. Moreover, it may helpful to find out some linked or missing genes which may assist in the forward progression towards the understanding of this sweet killer.
Article
Full-text available
Diabetes mellitus type-2 is a sweet killer disease, yet to be conquered. The frequency of this disease is constantly growing, emphasizing the need of new insights into the disorder's ground realities and navel strategies for the treatment of this disease. Many herbs are used to treat diabetes mellitus type-2 in all the areas of world predominantly in Asia and Africa. The main reason which promote investigators to hunt for new anti-diabetic herbs is the side effects coupled with the conventional and non-conventtonal drugs. Diabetes mellitus type-2 is a complicated and heterogeneous disease due to the mutations in many genes, called diabetogenes. This article is meant to describe the mechanism of action or anti-diabetic herbs in association with diabetogenes. There is a scant amount of scientific data revealing the molecular mechanisms of herbal drugs but lot of efforts are under the way to find out the molecular mechanism of these herbal drugs which will be helpful in discovering the reliable treatment for diabetes mellitus type-2.
Article
Full-text available
Diabetes mellitus is one of the common metabolic disorders acquiring around 2.8% of the world's population and is anticipated to cross 5.4% by the year 2025. Since long back herbal medicines have been the highly esteemed source of medicine therefore, they have become a growing part of modern, high-tech medicine. In view of the above aspects the present review provides profiles of plants (65 species) with hypoglycaemic properties, available through literature source from various database with proper categorization according to the parts used, mode of reduction in blood glucose (insulinomimetic or insulin secretagogues activity) and active phytoconstituents having insulin mimetics activity. From the review it was suggested that, plant showing hypoglycemic potential mainly belongs to the family Leguminoseae, Lamiaceae, Liliaceae, Cucurbitaceae, Asteraceae, Moraceae, Rosaceae and Araliaceae. The most active plants are Allium sativum, Gymnema sylvestre, Citrullus colocynthis, Trigonella foenum greacum, Momordica charantia and Ficus bengalensis. The review describes some new bioactive drugs and isolated compounds from plants such as roseoside, epigallocatechin gallate, beta-pyrazol-1-ylalanine, cinchonain Ib, leucocyandin 3-O-beta-d-galactosyl cellobioside, leucopelargonidin-3- O-alpha-L rhamnoside, glycyrrhetinic acid, dehydrotrametenolic acid, strictinin, isostrictinin, pedunculagin, epicatechin and christinin-A showing significant insulinomimetic and antidiabetic activity with more efficacy than conventional hypoglycaemic agents. Thus, from the review majorly, the antidiabetic activity of medicinal plants is attributed to the presence of polyphenols, flavonoids, terpenoids, coumarins and other constituents which show reduction in blood glucose levels. The review also discusses the management aspect of diabetes mellitus using these plants and their active principles.
Article
Full-text available
Several mechanisms, such as innate immune responses via toll-like receptor-4, accumulation of diacylglycerols (DAG)/ceramides and activation of protein kinase C (PKC), are considered to underlie skeletal muscle insulin resistance. Here, we examined initial events occurring during the onset of insulin resistance upon oral high-fat loading compared to lipid and low-dose endotoxin infusion.Sixteen lean insulin-sensitive volunteers received intravenous fat (iv fat), oral fat (po fat), intravenous endotoxin (LPS) and intravenous glycerol as control (con). After 6 hours, whole-body insulin sensitivity was reduced by iv fat, po fat and LPS to 60%, 67% and 48%, respectively (all P<0.01), which was due to decreased nonoxidative glucose utilization, while hepatic insulin sensitivity was unaffected. Muscle PKCθ activation increased by 50% after iv and po fat, membrane Di-C18:2 DAG species doubled after iv fat and correlated with PKCθ activation after po fat, whereas ceramides were unchanged. Only after LPS, circulating inflammatory markers (TNF-α, IL-6, IL-1ra), their mRNA expression in subcutaneous adipose tissue and circulating cortisol were elevated.Oral fat ingestion rapidly induces insulin resistance by reducing nonoxidative glucose disposal, which associates with PKCθ activation and a rise in distinct myocellular membrane DAG, while endotoxin-induced insulin resistance is exclusively associated with stimulation of inflammatory pathways.
Article
Full-text available
World-wide recognition of type 2 diabetes as an epidemic is a reality, despite the immense research, yielding in an increasingly complex signaling pathway network and consequent targetspecific sanative agents. The pathogenesis studies point to dual defect of insulin resistance in our body & insulin secretion by pancreatic ß cells. Herein, we discuss the central glucose-insulin axis and the recently established signaling cascades from lipid metabolism in context of free fatty acids and the white adipose tissue, to delineate the molecular causes of insulin resistance. Current pharmaceutical scenario target PPARs (Peroxisome Proliferator Activated Receptors) for insulin sensitization using thiazolidinediones, but recently these drugs have been amidst controversy; PTP1B, a protein tyrosine phosphatase, offers hope in this case, its inhibition being restorative to the distorted insulin signal. These two strategies are discussed encompassing their molecular action, current molecules being pursued and their future as a drug target. Herbal therapeutics though popular in masses lack the basis in terms of molecular players influenced and this deficiency is illustrated, urging for research endeavors in this direction. Lifestyle modifications such as dietary restrictions and adoption of exercise are reported from a molecular perspective.
Article
Full-text available
To explore the adipose tissue endocrine mechanism of pioglitazone and its possible prophylactic role in insulin resistance. Male Wistar rats were randomized to receive a normal diet (N group), a high-fat insulin resistance-inducing diet (IR group), or a high-fat diet plus treatment with pioglitazone (P group). Glucose tolerance and insulin resistance were tested at weeks 10 and 11 after starting the diet and, at week 12, adipose, liver and skeletal muscle tissue samples were taken. HepG2 cells were cultured with palmitic acid (PA), pioglitazone and PA plus pioglitazone, and RNA interference was used to downregulate adiponectin receptor (AdipoR) 2 in these cells. The mRNA and protein levels of adipokines (resistin and adiponectin), AdipoR1 and 2 and uptake of [(3)H]-labelled glucose were measured in the HepG2 cells. Resistin and adiponectin in adipose tissue and AdipoR2 in liver tissue were significantly decreased in the IR group compared with the N group. Adiponectin and AdipoR2 were significantly increased and insulin resistance significantly decreased in the P group versus the IR group. In HepG2 cells, AdipoR2 levels and glucose uptake decreased significantly when PA was ≥ 200 μM, but were elevated by pioglitazone. Small interfering RNA-AdipoR2 confirmed glucose uptake in liver was regulated by AdipoR2. Pioglitazone prevented insulin resistance in rats fed a high-fat diet. Liver AdipoR2-mediated glucose uptake is important in the prophylactic effect of pioglitazone on insulin resistance.
Article
Full-text available
The protein tyrosine phosphatase PTP1B is a negative regulator of both insulin and leptin signaling and is involved in the control of glucose homeostasis and energy expenditure. Due to its prominent role in regulating metabolism, PTP1B is a promising therapeutic target for the treatment of human obesity and type 2 diabetes. The PTP1B protein is encoded by the PTPN1 gene on human chromosome 20q13, a region that shows linkage with insulin resistance, type 2 diabetes, and obesity in human populations. In this paper, we summarize the genetics of the PTPN1 locus and associations with metabolic disease. In addition, we discuss the tissue-specific functions of PTP1B as gleaned from genetic mouse models.
Article
Full-text available
Rabson-Mendenhall syndrome (RMS) is a rare syndrome manifested by extreme insulin resistance with hyperinsulinemia, acanthosis nigricans, tooth dysplasia and growth retardation. Our patient was first noted at the age of 8 months due to pigmentations on skin-folded areas. Initial laboratory tests showed normal fasting glucose (69 mg/dL). Fasting insulin level was severely elevated, up to 554.6 µIU/mL, and c-peptide level was increased, up to 13.81 ng/mL. However, hemoglobin A1c was within normal range (4.8%). He is now 11 yr old. His growth development followed the 5-10th percentile and oral hypoglycemic agents are being administered. The last laboratory results showed insulin 364.1 µIU/mL, C-peptide 4.30 ng/mL, and hemoglobin A1c 7.6%. The boy was a compound heterozygote for the c.90C > A and c.712G > A mutations of the insulin receptor gene, INSR, which are nonsense and missense mutations. In summary, we report the first Korean case of RMS, which was confirmed by two novel mutations of the INSR.
Article
Full-text available
There is considerable interest in identifying compounds that can improve glucose homeostasis. Skeletal muscle, due to its large mass, is the principal organ for glucose disposal in the body and we have investigated here if shikonin, a naphthoquinone derived from the Chinese plant Lithospermum erythrorhizon, increases glucose uptake in skeletal muscle cells. Shikonin increases glucose uptake in L6 skeletal muscle myotubes, but does not phosphorylate Akt, indicating that in skeletal muscle cells its effect is medaited via a pathway distinct from that used for insulin-stimulated uptake. Furthermore we find no evidence for the involvement of AMP-activated protein kinase in shikonin induced glucose uptake. Shikonin increases the intracellular levels of calcium in these cells and this increase is necessary for shikonin-mediated glucose uptake. Furthermore, we found that shikonin stimulated the translocation of GLUT4 from intracellular vesicles to the cell surface in L6 myoblasts. The beneficial effect of shikonin on glucose uptake was investigated in vivo by measuring plasma glucose levels and insulin sensitivity in spontaneously diabetic Goto-Kakizaki rats. Treatment with shikonin (10 mg/kg intraperitoneally) once daily for 4 days significantly decreased plasma glucose levels. In an insulin sensitivity test (s.c. injection of 0.5 U/kg insulin), plasma glucose levels were significantly lower in the shikonin-treated rats. In conclusion, shikonin increases glucose uptake in muscle cells via an insulin-independent pathway dependent on calcium. Shikonin increases glucose uptake in skeletal muscle cells via an insulin-independent pathway dependent on calcium. The beneficial effects of shikonin on glucose metabolism, both in vitro and in vivo, show that the compound possesses properties that make it of considerable interest for developing novel treatment of type 2 diabetes.
Article
Aims: The purpose of this study was to investigate the effects of alternate-day fasting (ADF) on insulin-stimulated glucose transport activity in skeletal muscle in rats fed a high-fat diet. Main methods: Male Wistar rats were placed on a high-fat diet (n=24) or standard chow diet (Chow, n=12) for 10weeks. Rats fed the high-fat diet were separated into two groups after 4weeks. One group was subjected to ADF for the subsequent 6weeks (HF-ADF, n=12), and the other group was maintained on an ad libitum diet (HF-AL, n=12). After the 10-week dietary intervention, measurements of insulin-stimulated glucose uptake and insulin tolerance test (ITT) were performed. Key findings: Whereas the total intra-abdominal fat mass in the HF-AL group was significantly higher than in the Chow and HF-ADF groups, there was no significant difference between the Chow and HF-ADF groups. However, insulin-stimulated glucose uptake in skeletal muscles was significantly lower in both high-fat fed groups than in the Chow group. Muscle GLUT-4 protein content in HF-AL is significantly lower (~30%) than in Chow, and further reduction (~42%) was observed in the HF-ADF group rats. The HF-ADF and HF-AL group rats had less reduction in glycemia than did the Chow group rats during ITT. Significance: ADF was unable to eliminate high-fat diet-induced muscle insulin resistance, despite a substantial decrease in total intra-abdominal fat mass. This might have resulted from a reduction in GLUT-4 protein in both HF-AL and HF-ADF rats compared to the Chow group.