ArticlePDF Available

Valproic Acid Induces Decreased Expression of H19 Promoting Cell Apoptosis in A549 Cells

Authors:

Abstract and Figures

It has been suggested that the imprinted gene, H19, plays a crucial role in the development of cancer. In the present study, we attempted to treat the abnormal expression and methylation status of H19 in A549 cells using valproic acid (VPA), ascorbic acid (Vc), and 5-aza-Cytidine (5-Aza). The results suggested that VPA administration could alter the expression pattern of H19, while the hypomethylation status of H19 DMR was unchanged. Furthermore, overexpression of HDAC1 and DNMT1 was associated with decreased expression of H19 in VPA-treated cells. Western blot results showed that the expression of p53 protein was increased following treatment with VPA. In addition, we also investigated cellular apoptosis and the cell cycle of treated cells. Flow cytometry data indicated that VPA could increase the occurrence of cell apoptosis in A549 cells. Taken together, our results suggest that H19 expression was suppressed by VPA through HDAC1 and DNMT1 and decreased H19 expression correlated with cell apoptosis in A549 cells.
Content may be subject to copyright.
ORIGINAL RESEARCH ARTICLES
Valproic Acid Induces Decreased Expression of H19
Promoting Cell Apoptosis in A549 Cells
Yang Hao,
1,
*Guodong Wang,
1,
*Chao Lin,
2,
*Dong Li,
3
Zhonghao Ji,
1
Fei Gao,
1
Zhanjun Li,
1
Dianfeng Liu,
1
and Dongxu Wang
1
It has been suggested that the imprinted gene, H19, plays a crucial role in the development of cancer. In the
present study, we attempted to treat the abnormal expression and methylation status of H19 in A549 cells using
valproic acid (VPA), ascorbic acid (Vc), and 5-aza-Cytidine (5-Aza). The results suggested that VPA ad-
ministration could alter the expression pattern of H19, while the hypomethylation status of H19 DMR was
unchanged. Furthermore, overexpression of HDAC1 and DNMT1 was associated with decreased expression of
H19 in VPA-treated cells. Western blot results showed that the expression of p53 protein was increased
following treatment with VPA. In addition, we also investigated cellular apoptosis and the cell cycle of treated
cells. Flow cytometry data indicated that VPA could increase the occurrence of cell apoptosis in A549 cells.
Taken together, our results suggest that H19 expression was suppressed by VPA through HDAC1 and DNMT1
and decreased H19 expression correlated with cell apoptosis in A549 cells.
Keywords: H19, DNA methylation, VPA, DNMT1, HDAC1, cancer
Introduction
The imprinted gene H19, as an oncogene, was previ-
ously found to have abnormal expression in different
cancers, including thyroid cancer (Liu et al., 2016b), bladder
cancer (Hua et al., 2016), nasopharyngeal carcinoma (Li
et al., 2016b), colorectal cancer, and gastric cancer (Li et al.,
2016a). Previous studies have suggested that H19 plays a
crucial role in the development of cancer (Looijenga et al.,
1997). Furthermore, overexpression of H19 has been de-
tected in breast cancer cells and lung cancer cells (Lottin
et al., 2002; Chen et al., 2013). Recent evidence suggests
that silencing H19 could inhibit OV90 and SKOV3 OC cell
proliferation (Zhu et al., 2015). Thus, H19 is an important
factor in tumor biology and as a predictor of malignancy.
In our previous study, we showed that the expression of
H19 is regulated by DNA methylation in porcine embryo
development (Wang et al., 2015). Compared to porcine
differentially methylated regions (DMRs), human H19 also
has a DMR that contains a CTCF binding site. Recent
studies have indicated that inappropriate DNA methylation
status may induce abnormal H19 expression (Su et al., 2011;
Rotondo et al., 2013). DNA methylation, as well as histone
deacetylases (HDACs), can regulate H19 expression (Zup-
kovitz et al., 2006).
In this study, valproic acid (VPA, a histone deacetylase
inhibitor) was used in treated human lung cancer cells
(A549) to evaluate H19 expression patterns. Previous stud-
ies suggested that VPA could regulate the expression of
many genes by histone modification (Wood et al., 2005;
Rakitin et al., 2015). However, little is known about how
VPA regulates H19 expression. To determine if epigenetic
changes affect the regulation of H19 expression, DNA
methyltransferases (DNMTs) and HDACs were investigated
using quantitative real-time polymerase chain reaction
(qRT-PCR). In addition, numerous studies have suggested
that ascorbic acid (Vc) and 5-aza-Cytidine (5-Aza, DNMT
inhibitors) may also regulate gene expression (Zhao et al.,
2012; Van Pham et al., 2016). In this study, we aimed to
compare the expression and methylation pattern of H19 after
VPA, Vc, and 5-Aza treatment.
Materials and Methods
Cell culture and treatment
The human lung adenocarcinoma epithelial cell line A549
and human embryonic kidney (HEK) 293FT cells were
cultured in DMEM (Dulbecco’s modified Eagle’s medium
high glucose) supplemented with 10% FBS (fetal bovine
serum) at 37Cin5%CO
2
. Cells (2 ·10
5
cells/mL) were
1
Laboratory Animal Center, College of Animal Science, Jilin University, Changchun, China.
2
Department of Emergency, First Hospital, Jilin University, Changchun, China.
3
Department of Immunology, College of Basic Medical Science, Jilin University, Changchun, China.
*These three authors contributed equally to this work.
DNA AND CELL BIOLOGY
Volume 36, Number 6, 2017
ªMary Ann Liebert, Inc.
Pp. 428–435
DOI: 10.1089/dna.2016.3542
428
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
incubated for 24h, after which VPA (1000nM), Vc (1000nM),
or 5-Aza (100 nM) was added for 24, 48, and 72 h.
Gene expression analysis
Total RNA was isolated from A549 cells using the
TRNzol reagent (TIANGEN, Beijing, China), according to
the manufacturer’s instructions. RNA samples were first
treated with DNase I (Fermentas) and reverse transcribed to
cDNA using the BioRT cDNA First Strand Synthesis Kit
(Bioer Technology, Hangzhou, China). qRT-PCR was per-
formed to determine gene expression. The primer sequences
used in this study are listed in Table 1. Quantitative PCR
was performed using the BIO-RAD iQ5 Multicolor Real-
Time PCR Detection System with the BioEasy SYBR Green
I Real Time PCR Kit (Bioer Technology). PCR conditions
were 95C for 3 min, followed by 40 cycles of denaturation
at 95C for 10 s, annealing at 60C for 15 s, and extension
at 72C for 30 s. The 2
-DDCT
method was used to deter-
mine relative gene expression, which was normalized to the
amount of GAPDH mRNA. All experiments were repeated
thrice for each gene. All data are expressed as the mean
S.E.M. Reverse transcription–polymerase chain reaction
(RT-PCR) was carried out to determine H19 expression. The
primer sequences included: H19 5¢-AAAGACACCATCGG
AACAGC-3¢and 5¢-AGAGTCGTGGAGGCTTTGAA-3¢;
GAPDH 5¢-CCACTCCTCCACCTTTGAC-3¢and 5¢-ACCC
TGTTGCTGTAGCCA-3¢. PCR conditions were 95C for
3 min, followed by 35 cycles of denaturation at 95C for 30 s,
annealing at 60C for 30 s, and extension at 72C for 30 s. The
PCR product was subjected to agarose gel electrophoresis.
Western blot analysis
Proteins were extractedfrom cells with 2·SDS lysis buffer.
Protein concentrations were determined using the BCA Pro-
tein Assay Kit (TIANGEN). Proteins were separated on 10%
SDS-polyacrylamide gels and transferred to a PVDF mem-
brane. Membranes were blocked in 5% nonfat milk powder in
TBS-T (0.1% Tween-20 in PBS) and incubated with primary
antibodies overnight at 4C. The primary antibodies used
included rabbit anti-p53 (Abcam), anti-HDAC1 (Abcam),
anti-HDAC2 (Abcam), and mouse anti-b-Actin (Abcam).
After washing in PBS-T, membranes were incubated with
HRP-conjugated secondary antibodies (Invitrogen) for 1 h at
room temperature and were detected using ECL Super Signal
(Pierce).
Methylation pattern of H19 DMR
The procedure for bisulfite sequencing PCR (BSP) has been
previously described (Clark et al., 1994). Briefly, genomic
DNA from A549 and 293FT cells was isolated using the
TIANamp Genomic DNA Kit (TIANGEN) and treated using
the CpGenomeTurbo Bisulfite Modification Kit (Milli-
pore), according to the manufacturer’s instructions. Nested
PCR was performed using the Taq Plus PCR MasterMix
(TIANGEN) to amplify the H19 DMR. The primer sequences
are listed in Table 2. PCR products were purified and sub-
jected to BSP (10 positive clones) and Combined Bisulfite
Restriction Analysis (COBRA), which have been described
previously (Watanabe et al., 2010; Huntriss et al., 2013).
Cell apoptosis and cell cycle analysis
The procedure for cell apoptosis detection has been pre-
viously described (William-Faltaos et al., 2006). Briefly,
A549 cells were used for Annexin V-FITC/PI staining fol-
lowing treatment with VPA, Vc, or 5-Aza for 24, 48, and
72 h. Following incubation, the cells were washed with PBS
twice and collected at a concentration of 1 ·10
6
cells/mL.
For each treated cell sample, Annexin V-FITC and PI were
added, according to the manufacturer’s instructions. These
cells were incubated for 30 min and then analyzed with an
AccuriC6 flow cytometer (BD Biosciences, Franklin
Lakes, NJ).
To analyze the cell cycle, PI staining was performed. In
brief, A549 cells (1 ·10
6
cells/mL) were treated with VPA,
Vc, or 5-Aza for 24, 48, and 72 h. The cells were washed
with PBS and then fixed in 70% ethanol for 2 h at 4C.
These cells were incubated with PI and RNase A for 30 min,
and an Accuri C6 flow cytometer was used for analysis of
the cell cycle.
Statistical analysis
Quantitative RT-PCR, BSP, and flow cytometry (FCM)
data were analyzed by ttests using SPSS 16.0 software
(SPSS, Inc., Chicago, IL). A p-value of <0.05 was considered
Table 1. Primers for Quantitative Real-Time Polymerase Chain Reaction Analysis
Genes Annealing (C) Primer sequences (5¢/3¢) Size (bp) Reference/accession
H19 60 F: GGAGTTGTGGAGACGGCCTTGAGT 90
R: CCAGTCACCCGGCCCAGATGGAG
HDAC1 60 F: TAAATTCTTGCGCTCCATCC 102 NM_004964
R: AACAGGCCATCGAATACTGG
HDAC2 60 F: CAGTTGCTGGAGCTGTGAAG 139 NM_001527
R: AATTCAAGGATGGCAAGCAC
DNMT1 60 F: CCCAAGTAACTGGGATTAGAGC 71 NM_001130823.1
R: GGTTTGCCTGGTGCTTTTC
DNMT3a 60 F: CCTGAAGCCTCAAGAGCAGT 94 NM_175629.1
R: TGGTCTCCTTCTGTTCTTTGC
GAPDH 60 F: TGGTATCGTGGAAGGACTCA 69 J02642.1
R: GGGCCATCGACAGTCTTC
VPA INDUCED CELL APOPTOSIS BY REGULATED H19 429
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
statistically significant. The methylation status was analyzed
using the online software tool, BiQ Analyzer (http://biq-
analyzer.bioinf.mpi-inf.mpg.de/tools/MethylationDiagrams/
index.php).
Results
The expression pattern and methylation status
analysis of H19
To determine if VPA, Vc, or 5-Aza affected the expres-
sion of H19, qRT-PCR was carried out. As shown in
Figure 1, the expression of H19 was upregulated by Vc;
however, it was reduced by VPA treatment and did not
change after treatment with 5-Aza. RT-PCR was used as an
independent method to detect H19 expression, which con-
firmed the qRT-PCR results (Supplementary Fig. S1; Sup-
plementary Data are available online at www.liebertpub
.com/dna). These results indicated that H19 expression in
A549 cells was suppressed by VPA and stimulated by Vc.
To further investigate whether the expression of H19 was
associated with DMR methylation patterns, we analyzed
the H19 DMR in A549 and 293FT cells using BSP and
COBRA, following treatment with VPA, Vc, or 5-Aza. As
expected, the H19 DMR was found to be hemimethylated in
293FT cells. In contrast, this region was hypomethylated in
A549 cells. In addition, the BSP results suggested that the
hypomethylation status of the H19 DMR was unchanged
after treatment with VPA, Vc, or 5-Aza (Fig. 2A). The PCR
products were subjected to COBRA and sequence analyses,
which confirmed the BSP results (Fig. 2B, C). Statistical
analyses also revealed that there were no significant dif-
ferences between VPA, Vc, and 5-Aza treatments (Fig. 2D).
Analysis of HDAC and DNMT gene expression profiles
HDACs play a vital role in gene expression and are as-
sociated with histone modification. As an HDAC inhibitor,
VPA may inhibit HDAC1 and HDAC2 gene expression in
A549 cells (Fig. 3A, B). Furthermore, the western blot re-
sults showed that there was no expression of HDAC1/2 in
VPA treated cells (Supplementary Fig. S2).
DNMTs can contribute to DNA methylation. To under-
stand the role of VPA in the expression of DNA methyl-
transferases, expression levels of DNMT1 and DNMT3a
were determined by qRT-PCR. Expression of DNMT1 was
increased after VPA treatment, but was decreased after
treatment with 5-Aza (Fig. 4A). Compared with DNMT1,
DNMT3a expression was not significantly increased in
VPA-treated cells (Fig. 4B). These results suggest that H19
is regulated by VPA through HDAC1 and DNMT1.
Effects of VPA, Vc, and 5-Aza on cell cycle
and cell death
As shown, VPA could induce cell apoptosis, compared
with the Vc and control cells (Fig. 5A and Supplementary
Table S1). To determine the impact of downregulation of
H19 on apoptosis, we evaluated p53 expression by western
blot. The results indicated that p53 overexpression was
observed after treatment with VPA (Supplementary Fig. S2).
In addition, the effects of VPA, Vc, and 5-Aza on the cell
cycle profile were analyzed (Fig. 5B and Supplementary
Table S2). Statistical analyses confirmed our apoptosis re-
sults (Fig. 5C), which showed that there were increased
numbers of VPA-treated cells in G1 phase at 24 h, while no
change was observed at 48 h, and a decrease was observed at
72 h. In contrast, the proportion of VPA-treated cells in G2
was increased at 72 h and the number of cells in S phase
decreased at 24 h (Fig. 5D). These results indicate that the
cell cycle and cell apoptosis profile of A549 cells was al-
tered by VPA treatment.
Discussion
In the present study, VPA, Vc, and 5-Aza were used to
treat A549 cells. Although many reports have indicated that
Vc can stimulate the overexpression of some genes, there is
little evidence to suggest that Vc can modify H19 expression
(Yu et al., 2015; Van Pham et al., 2016). Our results dem-
onstrated that Vc can increase H19 expression. The DNMT
inhibitor 5-Aza did not alter H19 expression. There has been
Table 2. Primers for Bisulfite Sequencing PCR Analysis
Genes Annealing (C) Primer sequences (5¢/3¢) Size (bp) Reference/accession
H19 DMR
Outer 58 F: TTTTTGGTAGGTATAGAGTT
R: AAACCATAACACTAAAACCC
Inner 58 F: TGTATAGTATATGGGTATTTTTGGAGGTTT 240 AF087017
R: TCCCATAAATATCCTATTCCCAAATAACC
DMR, differentially methylated region.
FIG. 1. Relative expression levels of H19. The data are
represented as the mean S.E.M. (n=3). *( p<0.05) and
***( p<0.005) indicates statistically significant differences.
S.E.M., standard error of the mean.
430 HAO ET AL.
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
FIG. 2. The methylation pattern of H19 DMR. CpG methylation profiles (A) of H19 DMR in A549 and 293FT cells. The black and white circles indicate methylated and
unmethylated CpGs, respectively. The numbers indicate the proportion of methylated CpG sites relative to all counted CpG sites. Sequencing analysis (B) of H19 DMR with TAQ
I recognition sites. For COBRA analysis (C), the PCR products of H19 DMR were digested with the restriction enzyme TAQ I. Nondigested (-) and digested (+) PCR products
are indicated. Statistical analysis (D) of methylated CpG sites of H19 DMR. ***( p<0.005) indicate statistically significant differences. COBRA, Combined Bisulfite Restriction
Analysis; DMR, differentially methylated region.
431
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
no evidence to show that VPA can regulate H19 expression,
although several reports have suggested that VPA can affect
the expression of some genes (Sun et al., 2015; Liu et al.,
2016c). In our results, VPA suppressed H19 expression in
A549 cells. These data indicate that decreased expression of
H19 was associated with epigenetic modification.
Previous studies have shown that DMRs play a crucial
role in the regulation of imprinted gene expression, in-
cluding H19/IGF2 (Wang et al., 2015). To determine if
abnormal H19 expression was regulated by DNA methyla-
tion, we analyzed the methylation status of the H19 DMR
and, as seen in a previous study, confirmed that H19 was
hemimethylated in 293FT cells (Nye et al., 2015). In con-
trast, an aberrant methylation profile of H19 DMR was
detected in A549 cells. These results indicate that the hy-
pomethylation status of DMR contributed to the over-
expression of H19 in A549 cells. In our study, VPA, Vc, and
5-Aza did not change the methylation of H19 DMR.
To further determine whether H19 expression was regu-
lated by epigenetic modification, HDACs and DNMTs were
analyzed. Our results are consistent with previous reports
that VPA may inhibit HDAC1 and HDAC2 expression
(Castro et al., 2005). In addition, studies suggest that H19
acts as a HDAC1 target in humans (Zupkovitz et al., 2006),
goats (Meng et al., 2014), bovines (Ma et al., 2015), and
mice (Duren and Wang, 2016). Thus, we speculate that VPA
inhibits H19 expression through HDAC1. In this study, we
have addressed the question of whether DNMTs contribute
to H19 expression. DNMT1 and DNMT3a are both impor-
tant in the maintenance of methylation and de novo meth-
ylation. In a recent study, reduced DNMT1 and decreased
H19 were detected in cloned goat fibroblasts (Wan et al.,
2016). Furthermore, reduced levels of DNMT1 and DNMT3a
and hypermethylated H19 DMR were detected in human
spermatogenic cell stages ( Marques et al., 2011). In our study,
VPA stimulated an increase in DNMT1 expression in A549
cells. Thus, our results suggested that an abnormal expression
pattern and methylation status of H19 is associated with
overexpression of DNMT1.
It has been demonstrated that VPA can induce apoptosis
in A549 cells (Gavrilov et al., 2014). However, little is
known about how VPA induces apoptosis. In a previous
study, VPA increased p53 protein expression ( Jambalganiin
et al., 2014). Moreover, upregulation of H19 expression
contributed to tumorigenesis by regulating p53 activation,
and H19-derived miR-675 was able to regulate p53 activa-
tion (Yang et al., 2012; Liu et al., 2016a). Thus, our results
indicate that abnormal expression of H19 is associated with
p53 protein and activated p53 induced apoptosis in A549
cells.
A previous study has suggested that VPA plays a key role
in the regulation of the cell cycle (Kramer et al., 2008). VPA
FIG. 4. Relative expression levels of DNMTs. The expression of DNMT1 (A) and DNMT3a (B) was analyzed by qPCR
in A549 cells. The data are represented as the mean S.E.M. (n=3). *( p<0.05) and **( p<0.01) indicates statistically
significant differences. DNMTs, DNA methyltransferases.
FIG. 3. Relative expression levels of HDACs. The expression of HDAC1 (A) and HDAC2 (B) was analyzed by qPCR in
A549 cells. The data are represented as the mean S.E.M. (n=3). **( p<0.01) indicate statistically significant differences.
432 HAO ET AL.
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
FIG. 5. Analysis of cell death and cell cycle. Effects of VPA, Vc, and 5-Aza on cell death (A) and cell cycle (B). Statistical analysis of percentage of apoptotic cells (C) and cell
cycle (D).*(p<0.05), **(p<0.01), ***(p<0.005), and ****(p<0.001) indicates statistically significant differences. Vc, ascorbic acid; VPA, valproic acid.
433
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
slowed cell cycle progression with A549 cells accumulating
in G1 phase after 24 h (Tonelli et al., 2006). These results
were confirmed in this study, as a decrease in cells in the G1
phase at 48 and 72 h was also observed, suggesting that VPA
induced cell death in the G1 phase. By contrast, the number
of cells in the G2 and S phases was different. This indicates
that the fraction of cells in the G1 phase was reduced, and
the accumulation of cells in the S and G2 phases, which
correlated with increased apoptosis, shows that VPA in-
duced cell death in the G1 phase.
In conclusion, the results of the present study demonstrate
that the expression of H19 is regulated by VPA in A549
cells. In addition, abnormal methylation of H19 DMR was
observed and this led to the overexpression of H19. Our
results showed that H19 was regulated by HDAC1 and
DNMT1 following VPA treatment in A549 cells. Further-
more, we found that decreased expression of H19 induced
cell death after VPA treatment in A549 cells. Our data
suggest an important role for H19 expression in cancer de-
velopment and point toward H19 as a novel biomarker in
cancer therapy.
Acknowledgment
This work was financially supported by the National
Natural Science Foundation of China (Grant No. 31601003).
Disclosure Statement
No competing financial interests exist.
References
Castro, L.M., Gallant, M., and Niles, L.P. (2005). Novel targets
for valproic acid: up-regulation of melatonin receptors and
neurotrophic factors in C6 glioma cells. J Neurochem 95,
1227–1236.
Chen, B., Yu, M., Chang, Q., Lu, Y., Thakur, C., Ma, D., et al.
(2013). Mdig de-represses H19 large intergenic non-coding
RNA (lincRNA) by down-regulating H3K9me3 and hetero-
chromatin. Oncotarget 4, 1427–1437.
Clark, S.J., Harrison, J., Paul, C.L., and Frommer, M. (1994).
High sensitivity mapping of methylated cytosines. Nucleic
Acids Res 22, 2990–2997.
Duren, Z., and Wang, Y. (2016). A systematic method to
identify modulation of transcriptional regulation via chro-
matin activity reveals regulatory network during mESC dif-
ferentiation. Sci Rep 6, 22656.
Gavrilov, V., Lavrenkov, K., Ariad, S., and Shany, S. (2014).
Sodium valproate, a histone deacetylase inhibitor, enhances
the efficacy of vinorelbine-cisplatin-based chemoradiation in
non-small cell lung cancer cells. Anticancer Res 34, 6565–
6572.
Hua, Q., Lv, X., Gu, X., Chen, Y., Chu, H., Du, M., et al.
(2016). Genetic variants in lncRNA H19 are associated with
the risk of bladder cancer in a Chinese population. Muta-
genesis 31, 531–538.
Huntriss, J.D., Hemmings, K.E., Hinkins, M., Rutherford, A.J.,
Sturmey, R.G., Elder, K., et al. (2013). Variable imprinting of
the MEST gene in human preimplantation embryos. Eur J
Hum Genet 21, 40–47.
Jambalganiin, U., Tsolmongyn, B., Koide, N., Odkhuu, E.,
Naiki, Y., Komatsu, T., et al. (2014). A novel mechanism for
inhibition of lipopolysaccharide-induced proinflammatory
cytokine production by valproic acid. Int Immunopharmacol
20, 181–187.
Kramer, O.H., Knauer, S.K., Zimmermann, D., Stauber, R.H.,
and Heinzel, T. (2008). Histone deacetylase inhibitors and
hydroxyurea modulate the cell cycle and cooperatively induce
apoptosis. Oncogene 27, 732–740.
Li, C.Y., Liang, G.Y., Yao, W.Z., Sui, J., Shen, X., Zhang,
Y.Q., et al. (2016a). Integrated analysis of long non-coding
RNA competing interactions reveals the potential role in pro-
gression of human gastric cancer. Int J Oncol 48, 1965–1976.
Li, X., Lin, Y., Yang, X., Wu, X., and He, X. (2016b). Long
noncoding RNA H19 regulates EZH2 expression by inter-
acting with miR-630 and promotes cell invasion in naso-
pharyngeal carcinoma. Biochem Biophys Res Commun 473,
913–919.
Liu, C., Chen, Z., Fang, J., Xu, A., Zhang, W., and Wang, Z.
(2016a). H19-derived miR-675 contributes to bladder cancer
cell proliferation by regulating p53 activation. Tumour Biol
37, 263–270.
Liu, L., Yang, J., Zhu, X., Li, D., Lv, Z., and Zhang, X. (2016b).
Long noncoding RNA H19 competitively binds miR-17-5p
to regulate YES1 expression in thyroid cancer. FEBS J 283,
2326–2339.
Liu, N., Wang, C., Wang, L., Gao, L., Cheng, H., Tang, G.,
et al. (2016c). Valproic acid enhances the antileukemic effect
of cytarabine by triggering cell apoptosis. Int J Mol Med 37,
1686–1696.
Looijenga, L.H., Verkerk, A.J., De Groot, N., Hochberg, A.A.,
and Oosterhuis, J.W. (1997). H19 in normal development and
neoplasia. Mol Reprod Dev 46, 419–439.
Lottin, S., Adriaenssens, E., Dupressoir, T., Berteaux, N.,
Montpellier, C., Coll, J., et al. (2002). Overexpression of an
ectopic H19 gene enhances the tumorigenic properties of
breast cancer cells. Carcinogenesis 23, 1885–1895.
Ma, P.J., Zhang, H., Li, R., Wang, Y.S., Zhang, Y., and Hua, S.
(2015). P53-mediated repression of the reprogramming in
cloned bovine embryos through direct interaction with
HDAC1 and indirect interaction with DNMT3A. Reprod
Domest Anim 50, 400–409.
Marques, C.J., Joao Pinho, M., Carvalho, F., Bieche, I., Barros,
A., and Sousa, M. (2011). DNA methylation imprinting marks
and DNA methyltransferase expression in human spermato-
genic cell stages. Epigenetics 6, 1354–1361.
Meng, L., Jia, R.X., Sun, Y.Y., Wang, Z.Y., Wan, Y.J., Zhang,
Y.L., et al. (2014). Growth regulation, imprinting, and epi-
genetic transcription-related gene expression differs in lung
of deceased transgenic cloned and normal goats. Ther-
iogenology 81, 459–466.
Nye, M.D., Hoyo, C., and Murphy, S.K. (2015). In vitro lead
exposure changes DNA methylation and expression of IGF2
and PEG1/MEST. Toxicol In Vitro 29, 544–550.
Rakitin, A., Koks, S., Reimann, E., Prans, E., and Haldre, S.
(2015). Changes in the peripheral blood gene expression
profile induced by 3 months of valproate treatment in patients
with newly diagnosed epilepsy. Front Neurol 6, 188.
Rotondo, J.C., Selvatici, R., Di Domenico, M., Marci, R.,
Vesce, F., Tognon, M., et al. (2013). Methylation loss at H19
imprinted gene correlates with methylenetetrahydrofolate
reductase gene promoter hypermethylation in semen samples
from infertile males. Epigenetics 8, 990–997.
Su, J.M., Yang, B., Wang, Y.S., Li, Y.Y., Xiong, X.R., Wang,
L.J., et al. (2011). Expression and methylation status of im-
printed genes in placentas of deceased and live cloned
transgenic calves. Theriogenology 75, 1346–1359.
434 HAO ET AL.
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
Sun, G., Mackey, L.V., Coy, D.H., Yu, C.Y., and Sun, L.
(2015). The histone deacetylase inhibitor vaproic acid induces
cell growth arrest in hepatocellular carcinoma cells via sup-
pressing notch signaling. J Cancer 6, 996–1004.
Tonelli, R., Sartini, R., Fronza, R., Freccero, F., Franzoni, M.,
Dongiovanni, D., et al. (2006). G1 cell-cycle arrest and ap-
optosis by histone deacetylase inhibition in MLL-AF9 acute
myeloid leukemia cells is p21 dependent and MLL-AF9 in-
dependent. Leukemia 20, 1307–1310.
Van Pham, P., Tran, N.Y., Phan, N.L., Vu, N.B., and Phan, N.K.
(2016). Vitamin C stimulates human gingival stem cell pro-
liferation and expression of pluripotent markers. In Vitro Cell
Dev Biol Anim 52, 218–227.
Wan, Y., Deng, M., Zhang, G., Ren, C., Zhang, H., Zhang, Y.,
et al. (2016). Abnormal expression of DNA methyltransferases
and genomic imprinting in cloned goat fibroblasts. Cell Biol Int
40, 74–82.
Wang, D., Yuan, L., Sui, T., Song, Y., Lv, Q., Wang, A., et al.
(2015). Faithful expression of imprinted genes in donor cells
of SCNT cloned pigs. FEBS Lett 589, 2066–2072.
Watanabe, K., Emoto, N., Sunohara, M., Kawakami, M., Kage,
H., Nagase, T., et al. (2010). Treatment of PCR products with
exonuclease I and heat-labile alkaline phosphatase improves
the visibility of combined bisulfite restriction analysis. Bio-
chem Biophys Res Commun 399, 422–424.
William-Faltaos, S., Rouillard, D., Lechat, P., and Bastian, G.
(2006). Cell cycle arrest and apoptosis induced by oxaliplatin
(L-OHP) on four human cancer cell lines. Anticancer Res 26,
2093–2099.
Wood, J.R., Nelson-Degrave, V.L., Jansen, E., McAllister, J.M.,
Mosselman, S., and Strauss, J.F., 3rd. (2005). Valproate-
induced alterations in human theca cell gene expression: clues
to the association between valproate use and metabolic side
effects. Physiol Genomics 20, 233–243.
Yang, F., Bi, J., Xue, X., Zheng, L., Zhi, K., Hua, J., et al.
(2012). Up-regulated long non-coding RNA H19 contrib-
utes to proliferation of gastric cancer cells. FEBS J 279,
3159–3165.
Yu, Y., Gao, Q., Zhao, H.C., Li, R., Gao, J.M., Ding, T., et al.
(2015). Ascorbic acid improves pluripotency of human par-
thenogenetic embryonic stem cells through modifying im-
printed gene expression in the Dlk1-Dio3 region. Stem Cell
Res Ther 6, 69.
Zhao, X.M., Ren, J.J., Du, W.H., Hao, H.S., Wang, D., Liu, Y.,
et al. (2012). Effect of 5-aza-2¢-deoxycytidine on methylation
of the putative imprinted control region of H19 during the
in vitro development of vitrified bovine two-cell embryos.
Fertil Steril 98, 222–227.
Zhu, Z., Song, L., He, J., Sun, Y., Liu, X., and Zou, X. (2015).
Ectopic expressed long non-coding RNA H19 contributes to
malignant cell behavior of ovarian cancer. Int J Clin Exp
Pathol 8, 10082–10091.
Zupkovitz, G., Tischler, J., Posch, M., Sadzak, I., Ramsauer, K.,
Egger, G., et al. (2006). Negative and positive regulation of
gene expression by mouse histone deacetylase 1. Mol Cell
Biol 26, 7913–7928.
Address correspondence to:
Dianfeng Liu, PhD
Laboratory Animal Center
College of Animal Science
Jilin University
5333#, Xi’an Road
Changchun 130062
China
E-mail: ccldf@163.com
Dongxu Wang, PhD
Laboratory Animal Center
College of Animal Science
Jilin University
5333#, Xi’an Road
Changchun 130062
China
E-mail: wang_dong_xu@jlu.edu.cn
Received for publication October 8, 2016; received in re-
vised form February 18, 2017; accepted February 19, 2017.
VPA INDUCED CELL APOPTOSIS BY REGULATED H19 435
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
This article has been cited by:
1. Artur Zajkowicz, Małgorzata Krześniak, Agnieszka Gdowicz-Kłosok, Barbara Łasut, Marek Rusin. 2018. PIM2 survival kinase
is upregulated in a p53-dependent manner in cells treated with camptothecin or co-treated with actinomycin D and nutlin-3a.
Archives of Biochemistry and Biophysics 655, 26-36. [Crossref]
Downloaded by 139.81.111.28 from www.liebertpub.com at 10/15/18. For personal use only.
... By suppressing the activity Frontiers in Chemistry frontiersin.org 15 of HDAC1 and modifying the methylation state of H19 by induction of the enzyme DNA methyltransferase 1 (DNMT1) expression, Hao et al. (2017) found that VPA may induce death in A549 BC cells and reduce the production of the H19 oncogene. ...
... By suppressing the activity Frontiers in Chemistry frontiersin.org 15 of HDAC1 and modifying the methylation state of H19 by induction of the enzyme DNA methyltransferase 1 (DNMT1) expression, Hao et al. (2017) found that VPA may induce death in A549 BC cells and reduce the production of the H19 oncogene. ...
Article
Full-text available
Histone deacetylases (HDACs) are enzymes that play a role in chromatin remodeling and epigenetics. They belong to a specific category of enzymes that eliminate the acetyl part of the histones’ -N-acetyl lysine, causing the histones to be wrapped compactly around DNA. Numerous biological processes rely on HDACs, including cell proliferation and differentiation, angiogenesis, metastasis, gene regulation, and transcription. Epigenetic changes, specifically increased expression and activity of HDACs, are commonly detected in cancer. As a result, HDACi could be used to develop anticancer drugs. Although preclinical outcomes with HDACs as monotherapy have been promising clinical trials have had mixed results and limited success. In both preclinical and clinical trials, however, combination therapy with different anticancer medicines has proved to have synergistic effects. Furthermore, these combinations improved efficacy, decreased tumor resistance to therapy, and decreased toxicity. In the present review, the detailed modes of action, classification of HDACs, and their correlation with different cancers like prostate, breast, and ovarian cancer were discussed. Further, the different cell signaling pathways and the structure-activity relationship and pharmaco-toxicological properties of the HDACi, and their synergistic effects with other anticancer drugs observed in recent preclinical and clinical studies used in combination therapy were discussed for prostate, breast, and ovarian cancer treatment.
... Since its discovery in 1991 by Bartolomei, the crucial role of LncRNA H19 in tumorigenesis has been proven by numerous studies (Bartolomei et al., 1991;H. Li et al., 2014;Hao et al., 2017). A study showed increased expression of H19 in GC tissues as well as cell lines, followed by elevated cell proliferation and attenuated cell apoptosis (Yan et al., 2017). ...
Article
Background Gastric cancer (GC) has been recognized as one of the most prevalent cancers of the gastrointestinal system. Cumulative studies have shown evidence on the effect of infectious agents such as H. pylori against lncRNA on host gene expression regulation. Both lncRNAs H19 and UCA1 are known as oncogenes, responsible for GC development, tumorigenesis, invasion and metastasis. Methods and results A total of 101 tumors and their corresponding marginal non-tumor tissues were sampled from GC patients. Total RNA was then isolated to measure H19 and UCA1 expression using quantitative reverse transcriptase (qRT)-PCR. Statistical analyses including Mann-Whitney U test, ROC plot and correlation were performed on their expression using R v4.5. The results demonstrated the overexpression of both lncRNAs H19 and UCA1 in GC tissues as compared to marginal non-tumor tissue samples (P < 0.0001 and P = 0.0003, respectively). The association with clinicopathological features was only observed between H19 with lymph node metastasis and H. pylori infection. Despite an obvious negative link between H19 and UCA1, these results did not demonstrate any sharp linear correlation. Conclusion With the respective area under the curve of 0.727 and 0.625 for H19 and UCA1, the results of the current research suggested moderate diagnostic biomarker value for these lncRNAs in GC. This study can contribute to future studies on the association of H. pylori infection and its effect on the joint expression of lncRNAs, specifically H19 and UCA1 regarding GC susceptibility.
... In a previous result, let-7a-3p could induce cell apoptosis through the competitively regulated lncRNA H19 (Yang et al., 2018b). Moreover, reduced expression of H19 could increase p53 protein expression in lung cancer cells (Hao et al., 2017). Indeed, p53 protein was a key factor in the cell apoptosis pathway (Paek et al., 2016). ...
Article
Full-text available
Although the therapeutic strategy showed significant improvement, the therapeutic effect was poor on metastases in tongue squamous cell carcinoma (TSCC) which is the most malignant tumor found in the head and neck. Chrysin, similar to the flavonoids, plays an antitumor role by regulating the expression of ncRNAs in many kinds of cancers. Compared to flavonoids, gold nanoparticles (AuNPs) provide a novel insight into inhibiting cancer cell growth via photothermal therapy (PPT) which is irradiated by near-infrared radiation (NIR). However, most flavonoids and AuNPs lack specificity of tumor in vivo. The extracellular vesicles (EVs) which were abundant with ncRNAs are isolated from the cellular supernatant fluid and have the ability to carry drugs or nanoparticles to improve specificity. In the present study, we aimed to synthesize a new nanomaterial based on EVs containing chrysin and analyzed cell apoptosis in TSCC cells. Our results demonstrated that EVs-chrysin were isolated from SCC9 cells that were treated with chrysin. To improve the therapeutic effect, AuNPs were carried by EVs-chrysin (Au-EVs). Compared to BGC823 and HCC-LM3 cells, the uptake of Au-EVs was specific in SCC9 cells. Moreover, Au-EVs combined with NIR enhanced cell apoptosis in TSCC cells. To confirm the role of miRNAs in cell apoptosis, the differentially expressed miRNAs between EVs-Con and EVs-chrysin were screened by RNA-seq. The results revealed that the let-7a-3p family, which acts as the tumor suppressor, was upregulated in EVs-chrysin compared to EVs-Con. Thus, let-7a-3p was screened in the apoptosis pathway that was associated with the p53 protein. Furthermore, compared to the Con group, Au-EVs combined with the NIR group effectively inhibited tumor growth in vivo via increasing the expression of let-7a-3p. Together, as a new nanomaterial, Au-EVs induced cell apoptosis and inhibited tumor growth by regulating let-7a-3p expression in TSCC.
... To investigate the role of EVs that contained lncRNAs in cancers, appropriate EVs were collected. The EVs were mostly obtained from the cells that were enriched in expressed lncRNA, such as the A549 cell line which exhibited increased H19 expression (Hao et al., 2017). In addition, the EVs were cultured in an environment that encouraged the increased expression of lncRNAs (Born et al., 2020). ...
Article
Full-text available
Extracellular vesicles (EVs) exert their biological functions by delivering proteins, metabolites, and nucleic acids to recipient cells. EVs play important roles in cancer development. The anti-tumor effect of EVs is by their cargos carrying proteins, metabolites, and nucleic acids to affect cell-to-cell communication. The characteristics of cell-to-cell communication can potentially be applied for the therapy of cancers, such as gastric cancer. In addition, EVs can be used as an effective cargos to deliver ncRNAs, peptides, and drugs, to target tumor tissues. In addition, EVs have the ability to regulate cell apoptosis, autophagy, proliferation, and migration of cancer cells. The ncRNA and peptides that were engaged with EVs were associated with cell signaling pathways in cancer development. This review focuses on the composition, cargo, function, mechanism, and application of EVs in cancers.
... LncRNA H19 was discovered in 1991 by Bartolomei and shown to lack a common open reading frame in the RNA or an encoded protein [16,17]. H19 has emerged as a vital regulatory molecule in tumorigenesis [18]. Our previous work showed that H19 was increased in GC cell lines and tissues, and H19 overexpression promoted gastric cell proliferation and inhibited cell apoptosis, whereas H19 knockdown yielded the opposite results [19]. ...
Article
Full-text available
Background: The aim of this study was to investigate the role of long non-coding RNA (lncRNA) H19 in gastric cancer (GC) with Helicobacter pylori (H. pylori). Methods: H19 expression in peripheral blood from H. pylori+/- GC patients and healthy donors (control) as well as in GC tissues and cells were detected by qRT-PCR. Cell proliferation was evaluated by CCK-8 assay. Cell migration and invasion were evaluated by Transwell assay. The levels of pro-inflammatory cytokines were determined by ELISA. The protein levels of IκBα, p-IκBα and p65 were determined by western blotting. Results: H19 expression was upregulated in H. pylori-infected GC tissues and cells. Furthermore, H. pylori promoted GC cell viability, migration, invasion and inflammatory response. Moreover, H19 overexpression promoted the proliferation, migration and invasion of H. pylori-infected GC cells via enhancing NF-κB-induced inflammation. Conclusions: LncRNA H19 promotes H. pylori-induced GC cell growth via enhancing NF-κB-induced inflammation.
Article
Intestinal absorption of vitamin C in humans is mediated via the sodium-dependent vitamin C transporters (hSVCT1 and hSVCT2). hSVCT1 and hSVCT2 are localized at the apical and basolateral membranes, respectively, of polarized intestinal epithelia. Studies have identified low plasma levels of vitamin C and decreased expression of hSVCT1 in patients with several inflammatory conditions including inflammatory bowel disease (IBD). Investigating the underlying mechanisms responsible for regulating hSVCT1 expression are critical for understanding vitamin C homeostasis, particularly in conditions where suboptimal vitamin C levels detrimentally affect human health. Previous research has shown that hSVCT1 expression is regulated at the transcriptional level, however, little is known about epigenetic regulatory pathways that modulate hSVCT1 expression in the intestine. In this study, we found that hSVCT1 expression and function were significantly decreased in intestinal epithelial cells by the histone deacetylase inhibitors (HDACi), valproic acid (VPA) and sodium butyrate (NaB). Further, expression of transcription factor HNF1α, which is critical for SLC23A1 promoter activity, was significantly down regulated in VPA-treated cells. Chromatin immunoprecipitation (ChIP) assays showed significantly increased enrichment of tetra-acetylated histone H3 and H4 within the SLC23A1 promoter following VPA treatment. In addition, knockdown of HDAC isoforms 2 and 3 significantly decreased hSVCT1 functional expression. Following VPA administration to mice, functional expression of SVCT1 in the jejunum was significantly decreased. Collectively, these in vitro and in vivo studies demonstrate epigenetic regulation of SVCT1 expression in intestinal epithelia partly mediated through HDAC isoforms 2 and 3.
Article
Lung cancer is one of the most common types of cancer worldwide and the development of new treatment strategies is needed. Valproate exhibits anti-cancer properties and has been studied as a candidate for cancer therapy. Novel treatments with synthesized coordination complexes with valproate bioisosteres are promising, as they are often more effective and selective than organic molecules. We evaluated the anti-tumoral effects of two ternary complexes containing Zn⁺², valproate, and 2,2’-bipyridine (complex 1) or nicotinamide (complex 2) in a lung cancer cell line. Both complexes 1 and 2 exerted a 50% reduction in the viability of human epithelial lung cells (A549), indicating that coordination with Zn⁺² improves the cytotoxic effects of valproate. Complex 1 increased the frequency of apoptotic cells 6-fold compared to vehicle, but it was less selective to tumor cells than complex 2. Complex 2 reduced the frequency of cells in S phase at rates similar to valproate (from 10.2% in the control to 0% in both complex 2 and valproate). Our data highlighted the potential anti-tumoral activity of valproate-Zn⁺² complexes and their viability as proptotypes for new drugs.
Article
Full-text available
Methylation of the adenosine base at the nitrogen-6 position (m6A) is the most common post-transcriptional epigenetic modification of RNA, and it plays a very important role in regulating gene expression. To investigate the role of m6A methylation in the expression of non-coding RNA and miRNA, we used a system of adenine base editors (ABEs). Here, we mutated regions up- and downstream of miRNA 675 m6A modification sites in the H19 locus using HEK293T, L02, MHCC97L, MHCC97H, A549, and SGC-7901 cells. Our results showed that a T - A base transversion had occurred in all cell lines. Moreover, mutation of the regions upstream of the miRNA 675 m6A modification site led to reduced expression of H19 and the induction of cell apoptosis in HEK293T cells. To further confirm our results, L02 and MHCC97L cells were detected using an ABEs system. The results indicated increased cell apoptosis and reduced expression of miR675 as well as H19. To confirm the relationship between H19 and miR675 expression, overexpression and knock down studies were performed. The results showed that reduced HI9 expression induced cell apoptosis through miR675. Taken together, these results indicate that m6A modification can regulate the expression of H19 and miR675 which induce cell apoptosis.
Article
Full-text available
Ten-eleven translocation (TET) proteins are abnormally expressed in various cancers. Osteosarcoma cells were treated with hydroxyurea to investigate the expression pattern of TET proteins in these cells. The expression of TET1 was increased in U2OS cells after treatment with hydroxyurea. In addition, hydroxyurea increased cell apoptosis and altered the cell cycle. TET proteins catalyze the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC); therefore, 5mC and 5hmC levels were evaluated. Increased 5hmC levels were observed after the hydroxyurea treatment. Experiments examining cell apoptosis and the cell cycle after knockdown and overexpression of TET1 were conducted to further investigate whether TET1 expression affected cell growth. The overexpression of TET1 increased cell apoptosis and inhibited cell growth. Taken together, TET1 expression regulated proliferation and apoptosis in U2OS cells, changes that were associated with 5hmC levels.
Article
Full-text available
Chromatin regulators (CRs) are crucial for connecting the chromatin level and transcriptome level by modulating chromatin structures, establishing, and maintaining epigenetic modifications. We present a systematic method to identify MOdulation of transcriptional regulation via CHromatin Activity (MOCHA) from gene expression data and demonstrate its advantage in associating CRs to their chromatin localization and understand CRs’ function. We first re-construct the CRs modulation network by integrating the correlation and conditional correlation concepts. Then we quantify the chromatin activity as hidden variable in network by integrating the upstream and downstream information. We applied MOCHA to systematically explore the interplay of CRs, TFs, and target genes in mouse embryonic stem cells (ESC). As a result, MOCHA identified 420 chromatin regulators with modulation preference, including Pou5f1 and Eed. We found that BAF complex, NuRD complex, and polycomb-group proteins, regulate the delicate balance between pluripotency and differentiation by modulating key TFs including Klf4, Tcf3, and Max; NuRD complex members Mbd3 and Hdac1 may modulate Klf4 to achieve its dual functional roles in pluripotent and differentiation stages;Imprinted gene H19 and Igf2 are modulated by DNA methylation, histone acetylation, and insulator CTCF. Finally, we analyzed CR’s combinational modulation pattern by constructing a CR-CR interaction network.
Article
The p53 protein is an inducer of apoptosis, acting as a transcriptional regulator of apoptotic genes. In a previous study, we found that actinomycin D and nutlin-3a (A + N) synergistically activate p53. To better understand the molecular consequences of this synergism, we incubated arrays of antibodies against apoptotic proteins with extracts of A549 cells in which p53 had been activated. We found that strong activation of p53, marked by serine 46 and 392 phosphorylation, was associated with inactivating phosphorylation of proapoptotic BAD protein on serine 136. Investigation of the source of this phosphorylation revealed that activation of p53 was associated with accumulation of PIM2, a survival kinase. The accumulation of PIM2 following treatment with A + N was suppressed in p53-knockdown cells. Others discovered that PIM2 was activated by cooperatively acting p53 molecules. Our results are consistent with this finding. Moreover, we found that in A549 cells, the treatment with A + N stimulated in p53-dependent fashion the expression of other high cooperativity p53 target genes, DRAXIN and H19. Activation of antiapoptotic H19 can mechanistically explain relatively low rate of apoptosis of A549 cells exposed to A + N. We conclude that PIM2, DRAXIN and H19 are efficiently stimulated by strongly activated p53 molecules, probably acting cooperatively.
Article
The long non-coding RNA H19 is overexpressed in many cancers and acts as an oncogene. Here, we investigated the role of H19 in thyroid carcinogenesis and its relation to microRNA miR-17-5p and its target gene YES1. H19 expression was higher in tumor samples and in thyroid cancer cell lines than non-tumor tissues and normal thyroid cells. H19 knockdown and ectopic expression in the TPC-1 and NIM thyroid cancer cell lines showed that overexpression of H19 promoted proliferation, migration, and invasion, whereas H19 knockdown reduced cell viability and invasion and induced growth arrest in vitro and in vivo. H19 was identified as a target of miR-17-5p, by Dual-Luciferase Reporter assays and RNA binding protein immunoprecipitation assays. H19 antagonized the function of miR-17-5p on the upregulation of its target YES1 and inhibited miR-17-5p induced cell cycle progression. Our results suggest that H19 functions as competitive endogenous RNA (ceRNA) by acting as a sink for miR-17-5p, revealing a potential ceRNA regulatory network involving H19 and miR-17-5p with a role in the modulation of YES1 expression. This mechanism may stimulate to a more understanding of thyroid cancer pathogenesis and provide new sights for the treatment of this disease. This article is protected by copyright. All rights reserved.
Article
The long non-coding RNA (lncRNA) H19 as an imprinted gene transcribed from only the maternal allele has the vital role in carcinogenesis. Aberrant H19 expression is involved in bladder cancer development. In this study, we explored the association between single nucleotide polymorphisms (SNPs) in H19 and bladder cancer risk. Four tagging SNPs (tagSNPs) were selected from the 1000 Genomes Project database. In total, 1049 bladder cancer cases and 1399 controls were recruited in this case–control study. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were calculated by using unconditional univariate and multivariate logistic regression models to evaluate associations between the H19 tagSNPs genotypes and risk of bladder cancer. We found a statistically significant increased risk of bladder cancer in the carriers of the rs217727 AA genotype compared with carriers of GG/GA genotype (OR = 1.31, 95% CI = 1.03–1.67). The subsequently stratified analyses also revealed that the H19 rs217727 AA genotype remarkably elevated the risk of bladder cancer in subgroups of young subjects (OR = 1.80, 95% CI = 1.16–2.81), males (OR = 1.44, 95% CI = 1.10–1.89) and smokers (OR = 1.55, 95% CI = 1.06–2.27), as well as high tumour grade (OR = 1.89, 95% CI = 1.23–2.91) and invasive disease (OR = 1.62, 95% CI = 1.01–2.60). This finding indicates that the rs217727 polymorphism is significantly associated with the risk of bladder cancer.
Article
Acute myeloid leukemia (AML) is an aggressive clonal malignancy of hematopoietic progenitor cells with a poor clinical outcome. The resistance of leukemia cells to contemporary chemotherapy is one of the most formidable obstacles to treating AML. Combining valproic acid (VPA) with other anti-leukemic agents has previously been noted as a useful and necessary strategy which can be used to specifically induce anticancer gene expression. In the present study, we demonstrated the synergistic antileukemic activities between VPA and cytarabine (Ara‑C) in a retrovirus-mediated murine model with MLL-AF9 leukemia, three leukemia cell lines (THP-1, K562 and HL-60) and seven primary human AML samples. Using RT-qPCR, we noted that the combination of VPA and Ara‑C significantly upregulated Bax expression and led to the arrest of leukemia cell proliferation, sub-G1 DNA accumulation and cell apoptosis, as demonstrated by flow cytometric analysis. Significantly, further experiments revealed that knockdown of Bax expression prevented VPA and Ara‑C‑induced cell apoptosis in THP-1 cells. The results of our present study demonstrated the synergistic antileukemic effect of combined VPA and Ara‑C treatment in AML, and thus we suggest that VPA be used an alternative treatment for AML.
Article
The long non-coding RNA (lncRNA) H19 has been recently shown to participate in the progression of cancer, including metastasis. However, the biological role of H19 and the underlying mechanisms mediating its functions in nasopharyngeal carcinoma (NPC) remain unclear. Herein, we found that H19 was overexpressed in NPC tissues and poorly differentiated cell lines. Knockdown of H19 significantly inhibited the invasive ability of NPC cells. Moreover, H19 affected the expression of enhancer of zeste homolog 2 (EZH2), which has also been observed to be up-regulated in NPC and to promote cell invasion. Rather than direct interaction, H19 regulated EZH2 expression by suppressing the activity of miR-630, which is a repressor of EZH2 and interacts with H19 in a sequence-specific manner. Furthermore, H19 inhibited E-cadherin expression and promoted cell invasion of NPC cells via the miR-630/EZH2 pathway. Our data suggest an important role for H19 in NPC metastasis and suggest the feasibility of therapy for NPC involving modulation of the novel regulatory network.
Article
Abnormal expression of long non-coding RNAs (lncRNAs) have been shown to play an important role in tumor biology. The Cancer Genome Atlas (TCGA) platform is a large sample sequencing database of lncRNAs, and further analysis of the associations between these data and patients' clinical related information can provide new approaches to find the functions of lncRNA. In the present study, 361 RNA sequencing profiles of gastric cancer (GC) patients were selected from TCGA. Then, we constructed the lncRNA-miRNA-mRNA competitive endogenous RNA (ceRNA) network of GC. There were 25 GC specific lncRNAs (fold change >2, p<0.05) identified, 19 of them were included in ceRNA network. Subsequently, we selected these 19 key lncRNAs and analyzed the correlations with clinical features and overall survival, 14 of them were discriminatively expressed with tumor size, tumor grade, TNM stage and lymphatic metastasis (p<0.05). In addition, eight lncRNAs (RPLP0P2, FOXD2-AS1, H19, TINCR, SLC26A4-AS1, SMIM10L2A, SMIM10L2B and SNORD116-4) were found to be significantly associated with overall survival (log-rank p<0.05). Finally, two key lncRNAs HOTAIR and UCA1 were selected for validation of their expression levels in 82 newly diagnosed GC patients by qRT-PCR. Results showed that the fold changes between TCGA and qRT-PCR were 100% in agreement. In addition, we also found that HOTAIR was significantly correlated with tumor size and lymphatic metastasis (p<0.05), and UCA1 was significantly correlated with tumor size, TNM stage and lymphatic metastasis (p<0.05). The clinical relevance of the two lncRNAs and the bioinformatics analysis results were almost the same. Overall, our study showed the GC specific lncRNAs expression patterns and a ceRNA network in GC. Clinical features related to GC specific lncRNAs also suggested these lncRNAs are worthwhile for further study as novel candidate biomarkers for the clinical diagnosis of GC and potential indicators for prognosis.
Article
Recent studies have highlighted the role of long non-coding RNAs (IncRNAs) in carcinogenesis and have suggested that genes of this class might be used as biomarkers in cancer. However, whether incRNAs are involved in ovarian cancer (OC) remains largely unknown. In the present study, we focused on IncRNAH19 and investigated the expression and functional role of H19 in OC. H19 expression was measured in 70 pairs of ovarian cancer tissue samplescompared with normal controls by real-time quantitative RT-PCR. The effects of H19 on ovarian cancer cells were studied by RNA interference approach. Apoptosis and cell cycle were analyzed by flow cytometry. Cells viability was evaluated using cell counting Kit-8. Our results demonstrated that that H19 silencing inhibited OV90 and SKOV3 OC cell proliferation in vitro. Further investigation into the mechanisms responsible for the growth inhibitory effects by H19 silencing revealed that its knockdown resulted in the induction of cell cycle arrest and apoptosis through certain cell cycle-related and apoptosis-related proteins. Together, our data suggest that LncRNAH19 plays an important role in OC cell proliferation and contributes to a better understanding of the importance of dysregulated IncRNAs in OC progression.
Article
Gingival stem cells (GSCs) are a novel source of mesenchymal stem cells (MSCs) that are easily accessed from the oral cavity. GSCs were considered valuable autograft MSCs with particular characteristics. However, the limitation in the number of available GSCs remains an obstacle. Therefore, this study aimed to stimulate GSC proliferation by ascorbic acid (AA) and determined the effects of AA on GSC pluripotent potential-related gene expression. GSCs were isolated from gum tissue by explant culture and continuously subcultured before analysis of stemness and effects of AA on pluripotent-related gene expression. GSCs cultured with various concentrations of AA showed increased proliferation in a dose-dependent manner. AA-treated GSCs showed significantly higher expression of SSEA-3, Sox-2, Oct-3/4, Nanog, and TRA-1-60 compared with control cells. More importantly, GSCs also maintained their stemness with MSC phenotypes and failed to cause tumors in nude athymic mice. Our results show that AA is a suitable factor to stimulate GSC proliferation.