ArticlePDF Available

Characterization of BAFF and APRIL subfamily receptors in rainbow trout (Oncorhynchus mykiss). Potential role of the BAFF / APRIL axis in the pathogenesis of proliferative kidney disease

Authors:

Abstract and Figures

Proliferative kidney disease (PKD) is a parasitic infection of salmonid fish characterized by hyper-secretion of immunoglobulins in response to the presence of the myxozoan parasite, Tetracapsuloides bryosalmonae. In this context, we hypothesized that the BAFF/APRIL axis, known to play a major role in B cell differentiation and survival in mammals, could be affected by the parasite and consequently be involved in the apparent shift in normal B cell activity. To regulate B cell activity, BAFF and APRIL bind to transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) and B cell maturation antigen (BCMA), whereas BAFF also binds to BAFF receptor (BAFF-R). In teleost fish, although some BAFF and APRIL sequences have been reported, their receptors have not been identified. Thus, as a first step in the current work, we have identified homologues to mammalian TACI, BCMA and BAFF-R in rainbow trout (Oncorhynchus mykiss), that constitute the first report of BAFF and APRIL receptor sequences in fish. Subsequently we studied the transcriptional modulation of BAFF, APRIL, and the fish-specific related cytokine, BALM and their putative receptors in fish naturally exposed to T. bryosalmonae. Finally, to gain further insights on the functional role that these cytokines play during the course of PKD, we have studied their effect on the survival of kidney IgM⁺ B cells and on immunoglobulin transcription. Our results support the premise that the BAFF / APRIL axis could play an important role during PKD, which may open the possibility of new therapeutic treatments against the disease.
Content may be subject to copyright.
RESEARCH ARTICLE
Characterization of BAFF and APRIL subfamily
receptors in rainbow trout (Oncorhynchus
mykiss). Potential role of the BAFF / APRIL axis
in the pathogenesis of proliferative kidney
disease
Aitor G. Granja
1
, Jason W. Holland
2
, Jaime Pignatelli
1
, Christopher J. Secombes
2
,
Carolina Tafalla
1
*
1Centro de Investigacio
´n en Sanidad Animal (CISA-INIA). Valdeolmos (Madrid), Spain, 2Scottish Fish
Immunology Research Centre, University of Aberdeen, Aberdeen, United Kingdom
*tafalla@inia.es
Abstract
Proliferative kidney disease (PKD) is a parasitic infection of salmonid fish characterized by
hyper-secretion of immunoglobulins in response to the presence of the myxozoan parasite,
Tetracapsuloides bryosalmonae. In this context, we hypothesized that the BAFF/APRIL
axis, known to play a major role in B cell differentiation and survival in mammals, could be
affected by the parasite and consequently be involved in the apparent shift in normal B cell
activity. To regulate B cell activity, BAFF and APRIL bind to transmembrane activator and
calcium modulator and cyclophilin ligand interactor (TACI) and B cell maturation antigen
(BCMA), whereas BAFF also binds to BAFF receptor (BAFF-R). In teleost fish, although
some BAFF and APRIL sequences have been reported, their receptors have not been iden-
tified. Thus, as a first step in the current work, we have identified homologues to mammalian
TACI, BCMA and BAFF-R in rainbow trout (Oncorhynchus mykiss), that constitute the first
report of BAFF and APRIL receptor sequences in fish. Subsequently we studied the tran-
scriptional modulation of BAFF, APRIL, and the fish-specific related cytokine, BALM and
their putative receptors in fish naturally exposed to T.bryosalmonae. Finally, to gain further
insights on the functional role that these cytokines play during the course of PKD, we have
studied their effect on the survival of kidney IgM
+
B cells and on immunoglobulin transcrip-
tion. Our results support the premise that the BAFF / APRIL axis could play an important
role during PKD, which may open the possibility of new therapeutic treatments against the
disease.
Introduction
The tumor necrosis factor (TNF) superfamilies of ligands and receptors (TNFRs) play a key
role in development, tissue homeostasis and the initiation of innate and adaptive immune
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 1 / 24
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Granja AG, Holland JW, Pignatelli J,
Secombes CJ, Tafalla C (2017) Characterization of
BAFF and APRIL subfamily receptors in rainbow
trout (Oncorhynchus mykiss). Potential role of the
BAFF / APRIL axis in the pathogenesis of
proliferative kidney disease. PLoS ONE 12(3):
e0174249. https://doi.org/10.1371/journal.
pone.0174249
Editor: Yolande Richard, Institut Cochin, FRANCE
Received: October 25, 2016
Accepted: March 6, 2017
Published: March 21, 2017
Copyright: ©2017 Granja et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: This work was supported by the
European Research Council (ERC Starting Grant
2011 280469) and by the European Commission
under the 7th Framework Programme for Research
and Technological Development (FP7) of the
European Union (Grant Agreement 311993
TARGETFISH) and under the Horizon H2020
responses [1]. With respect to the latter, most TNF superfamily members play essential roles
in different aspects of B cell biology, from their development in hematopoietic tissues, to their
maturation in peripheral tissues and their differentiation into memory or plasma cells [2].
Interestingly, cooperative signaling via TNF ligands and receptors was first seen within the
CD40-CD40 ligand (CD40L) interaction, that promotes the proliferation of antigen-activated
B cells through the expression of CD40L by CD4
+
T helper (Th) cells [3]. B cells do not only
receive co-stimulating signals from Th cells but can also receive them from phagocytes such as
macrophages, dendritic cells (DCs) and granulocytes that secrete cytokines in response to pro-
inflammatory stimuli or after recognition of invariant pathogenic patterns. BAFF (B cell acti-
vating factor) and APRIL (a proliferation inducing ligand), are two of the main cytokines pro-
duced by innate immune cells to co-stimulate B cells [4]. As with many of the TNF family
ligands, BAFF and APRIL are produced as transmembrane proteins that are proteolytically
cleaved at a furin protease site and released in a soluble form [5]. Both cytokines regulate B cell
survival, proliferation and differentiation, especially during innate immune responses [6].
Ligand–receptor interactions within the BAFF–APRIL subfamily of TNF ligands are both
redundant and specific. BAFF binds to the BAFF receptor (BAFF-R, also known as TNFR13C),
to transmembrane activator and CAML interactor (TACI, also known as TNFR13B) and, with
lower affinity, to B-cell maturation antigen (BCMA, also known as TNFR17), whereas APRIL
binds to TACI and BCMA (reviewed in [7]). APRIL also interacts with the polysaccharide side
chains of heparan sulfate proteoglycans (HSPGs), structurally unrelated to TNF receptors [8].
In fish, many different TNF superfamily members have been identified in diverse fish spe-
cies. Regarding the BAFF and APRIL subfamily of ligands and receptors, BAFF sequences
have been reported recently in different teleosts including zebrafish (Danio rerio) [9], mefugu
(Takifugu obscurus) [10], Japanese sea perch (Lateolabrax japonicus) [11], grass carp (Cteno-
pharyngodon idella) [12], yellow grouper (Epinephelus awoara) [13], miiuy croaker (Miichthys
miiuy) [14], tongue sole (Cynoglossus semilaevis) [15], Nile tilapia (Oreochromis niloticus) [16],
rock bream (Oplegnathus fasciatus) [17], rainbow trout (Oncorhynchus mykiss) [18], rohu
(Labeo rohita) [19] and cartilaginous fish such as white-spotted catshark (Chiloscyllium plagio-
sum) [20], spiny dogfish (Squalus acanthias) [21] and small-spotted catshark (Scyliorhinus
canicula) [22]. APRIL sequences, on the other hand, have only been identified in channel cat-
fish (Ictalurus punctatus), Atlantic salmon (Salmo salar) and rainbow trout [18,22]. Interest-
ingly, in species such as rainbow trout, a cytokine designated as a BAFF and APRIL-like
molecule (BALM) has also been reported [18]. Given the absence of BALM sequences in tetra-
pods and its recent discovery in lampreys, BALM has been postulated as an ancestral homolog
of BAFF and APRIL [23]. As for the receptors of BAFF and APRIL, no BAFF-R, BCMA or
TACI sequences have been reported in fish to date. Thus, the role played by these cytokines
and their receptors during the fish immune response is currently unknown.
Proliferative Kidney Disease (PKD), caused by the myxozoan parasite Tetracapsuloides
bryosalmonae, is a slow progressive disease of major economic importance to salmonid aquacul-
ture [24]. Parasite spores, released from infected freshwater bryozoans, gain entry into the fish
host vascular system via the gills [25] and migrate to different organs, with the posterior kidney
being the main focus of parasite development and proliferation [24]. In teleosts, the head kidney
is the main hematopoietic tissue where B cells develop and most proliferating B cell precursors
are found. The posterior kidney, on the other hand, houses significant populations of partially
activated B cells and plasmablasts [26]. Extrasporogonic proliferation and development of T.
bryosalmonae in the kidney interstitial tissue provokes chronic immunopathology characterized
by a lymphocytic hyperplasia, formation of granulomatous lesions, renal atrophy, and hyper-
secretion of immunoglobulins [24,27]. Furthermore, recent transcriptional analysis of the kid-
ney in naturally infected fish with different degrees of PKD also pointed to dysregulation of B
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 2 / 24
research and innovation programme (Grant
H2020-634429 ParaFishControl). This work was
also partially funded by project AGL2014-54456-
JIN from the Spanish Ministry of Economy and
Competitiveness (MINECO). JWH was supported
by the Swiss National Science Foundation (grant
reference CRSII3_147649-1). The funders had no
role in study design, data collection and analysis,
decision to publish, or preparation of the
manuscript.
Competing interests: The authors have declared
that no competing interests exist.
cell activity in response to the parasite [28]. In this context, trout BAFF / APRIL ligands and
receptors could be implicated in the pathogenesis of this disease. Thus, in this study we have
sequenced and characterized rainbow trout BAFF-R, BCMA and TACI and, along with their
potential ligands, studied their transcriptional modulation in the kidneys of fish naturally
infected by the parasite. Additionally, we have studied the effect of recombinant BAFF, APRIL
and BALM on survival of IgM
+
B cells and immunoglobulin transcription in the kidney. Our
results reveal a potential role of the BAFF / APRIL axis during the course of PKD pathogenesis
that may open the door to potential anti-parasitic treatments, which are discussed.
Materials and methods
Identification of BAFF receptor sequences
Murine and human BAFF-R protein sequences were used as tBLASTn queries against rainbow
trout (Oncorhynchus mykiss) expressed sequence tag (EST) databases within the National Center
for Biotechnology Information database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). A rainbow
trout EST encoding a BAFF-R-like sequence was identified (accession number CA381223.1).
The sequence lacked a stop codon, therefore 3’ RACE (Rapid Amplification of cDNA Ends)
(Invitrogen) was used to obtain the full length sequence from a mixed tissue cDNA sample with
specific primers (Table 1). Sequences corresponding to Atlantic salmon (Salmo salar) BCMA
and TACI homologues were retrieved from GenBank (accession numbers XM_014178965 and
XM_014178939.1 respectively). Primers designed from the salmon sequences (Table 1) were
used to generate complete and incomplete rainbow trout BCMA and TACI transcripts from a
mixed tissue cDNA sample respectively. 3’RACE was again performed to obtain the full coding
sequence and 3´UTR of rainbow trout TACI (Table 1).
Protein analysis was performed using the ExPASy Molecular Biology server (http://us.
expasy.org). Similarity searches were performed by BLASTP analysis (http://blast.ncbi.nlm.
nih.gov/Blast.cgi) and phylogenetic analyses performed using MegAlign Software (DNAstar
Inc., Madison, USA) and the ClustalW algorithm. Bootstrapped phylogenetic trees (x 1000
replicates) were built using the neighbor-joining method. The TMHMM program Server
(v. 2.0) (http://www.cbs.dtu.dk/services/TMHMM/) was used to predict protein structure.
Fish maintenance
Female rainbow trout of approximately 90–100 g were obtained from Centro de Acuicultura
El Molino (Madrid, Spain) and maintained at the animal facilities of the Centro de Investiga-
cio
´n en Sanidad Animal (CISA-INIA, Spain) in a re-circulating water system at 16˚C under a
12:12 h light dark photoperiod. Fish were fed twice a day with a commercial diet (Skretting,
Spain). Prior to any experimental procedure, fish were acclimatized to laboratory conditions
for at least 2 weeks. The experiments described comply with the Guidelines of the European
Union Council (2010/63/EU) for the use of laboratory animals and were approved by the Eth-
ics committee from the Instituto Nacional de Investigacio
´n y Tecnologı
´a Agraria y Alimentaria
(INIA; Code CEEA 2011/044; Permit Number: PROEX 309/14). Fish were anaesthetized with
benzocaine (Sigma) prior to being killed, following the recommendations from Zhal et al. [29].
All efforts were made to minimize suffering.
Tissue collection
Blood was extracted from the caudal vein of freshly killed rainbow trout, using a heparinized
needle/syringe. Transcardial perfusion using teleost Ringer solution pH 7.4 containing 0.1%
procaine was undertaken to remove all blood from fish tissues. Spleen, head kidney, intestine,
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 3 / 24
gills, brain, liver and muscle samples were then collected and placed in Trizol [30,31]. Single
cell suspensions from spleen, head kidney and gills were prepared by pushing the tissues
through 100 μm nylon cell strainers (BD Biosciences). Intestine cell suspensions were also pre-
pared. Samples corresponding to the hindgut were opened lengthwise, washed in PBS and cut
into small pieces. Prior to cell extraction, pieces of gut tissue were agitated for 30 min at 4˚C in
L-15 medium containing 100 I.U./ml penicillin, 100 ug/ml streptomycin (P/S) and 5% fetal
calf serum (FCS), followed by agitation for 30 min in PBS containing 1 mM EDTA and 1 mM
DTT. Tissue digestion was performed using 0.15 mg/ml collagenase type IV from Clostridium
histolyticum (Sigma) in L-15 for 1.5 h at 20˚C. All cell suspensions were placed onto 30 / 51%
Percoll (GE Healthcare) density gradients and centrifuged at 500 x gfor 30 min at 4˚C. Cells at
the interface were collected and washed twice in L-15 medium containing 5% FCS.
Gene expression in fish tissues
DNase I-treated total RNA was prepared from tissue samples using a combination of Trizol (In-
vitrogen) and an RNAeasy Mini kit (Qiagen) as described previously [32]. Total RNA was eluted
from the columns in RNase-free water, quantified using a Nanodrop 1000 spectrophotometer
Table 1. Primers used for PCR cloning and real-time PCR analysis of gene expression
Gene Primer name Primer sequence (5´-3´) Application
TACI SS-TACI-F GCTCAGTGTCACTGCATGAGAGGC Cloning
SS-TACI-R ACACGTCTCTGTGGGGCTGG Cloning
TACI-3-RACE GTGTCTGGCTCTGCTGCTGTTGACC 3´RACE
TACI-3-RACE-nest GTGCTGCTGAGGAGGGCCAGTGCC 3´RACE
RT-TACI-F GCATCGAGTACTGTGCTTCTCTAGG Real time PCR
RT-TACI-F AAGTCAGGCTGTTGGGTCTTACATT Real time PCR
BCMA SS-BCMA-F ATGTCAGAAGGACAGTGTGGACTGG Cloning
SS-BCMA-R CTGTGTGGTTAAAGATCTGTACTGTCTTGG Cloning
RT-BCMA-F ATGTCAGAAGGACAGTGTGGACTGG Real time PCR
RT-BCMA-R CGGCTCTGGGGCTTTGCTCT Real time PCR
BAFF-R BAFFR-3-RACE- CCTCGGTGTGTGGCTCTCTTGGGG 3´RACE
BAFFR-3-RACE-nest GGGAGCATTGGATCCCACTTCCTGC 3´RACE
RT-BAFFR-F TGTCTGGATATCAATGGTCGTCATA Real time PCR
RT-BAFFR-R CTTTAGCTGGAGGGTTAAGTCTTGC Real time PCR
BAFF RT-BAFF-F ATGTTTGATGCTTATTCTGGCAGGT Real time PCR
RT-BAFF-R TGGGACTGTGTCTTGACTGTGTGTA Real time PCR
APRIL RT-APRIL-F CACAGACATACACAATGGAATGGAA Real time PCR
RT-APRIL-R TGTGATGACAGAGGAACAAGATGAA Real time PCR
BALM RT-BALM-F TGGAGGTACAGTAGTTCAGCAGTCG Real time PCR
RT-BALM-R ACTATCCAAGGAATCACCGTCACAT Real time PCR
IgMtotal RT-IgMtotal-F TGCGTGTTTGAGAACAAAGC Real time PCR
RT-IgMtotal-R GACGGCTCGATGATCGTAAT Real time PCR
IgMsec RT-IgMsec-F CCTTAACCAGCCGAAAGGG Real time PCR
RT-IgMsec-R TGAGGTTCTATCAATGGTTCTC Real time PCR
IgT RT-IgTtotal-F AACATCACCTGGCACATCAA Real time PCR
RT-IgTtotal-R TTCAGGTTGCCCTTTGATTC Real time PCR
IgD RT-IgDtotal-F AGCTACATGGGAGTCAGTCAACT Real time PCR
RT-IgDtotal-R CTTCGATCCTACCTCCAGTTCCT Real time PCR
EF-1αRT-EF1α-F GATCCAGAAGGAGGTCACCA Real time PCR
RT-EF1α-R TTACGTTCGACCTTCCATCC Real time PCR
https://doi.org/10.1371/journal.pone.0174249.t001
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 4 / 24
(Thermo Scientific) and stored at -80˚C. For each sample, 2 μg of total RNA was reverse tran-
scribed using Bioscript reverse transcriptase (Bioline Reagents Ltd) primed with oligo (dT)
12-18
(0.5 μg/ ml), following the manufacturer´s instructions. cDNA was diluted in nuclease-free water
and stored at -20˚C.
To evaluate the levels of transcription of the different genes, real-time PCR was performed
in a LightCycler 96 System instrument (Roche) using FastStart Essential DNA Green Master
reagents (Roche) and specific primers (shown in Table 1). The efficiency of the amplification
was determined for each primer pair using serial 10 fold dilutions of pooled cDNA, and only
primer pairs with efficiencies between 1.95 and 2 were used. Each sample was measured in
duplicate under the following conditions: 10 min at 95˚C, followed by 40 amplification cycles
(30 s at 95˚C and 1 min at 60˚C). The expression of individual genes was normalized to that of
trout EF-1αand expression levels calculated using the 2
-ΔCt
method, where ΔCt is determined
by subtracting the EF-1αvalue from the target Ct as described previously [33,34]. Negative
controls with no template were included in all experiments. A melting curve for each PCR was
determined by reading fluorescence every degree between 60˚C and 95˚C to ensure only a sin-
gle product had been amplified.
Gene expression at early life stages
To investigate if TACI, BCMA and BAFF-R are expressed at early life stages, eyed eggs at differ-
ent degree days (DD) post-fertilization (~306 DD, ~354 DD, ~402 DD), immediate post hatch
fry (hatch, ~450 DD), pre-first feeding fry (PFF, ~562 DD), fry at the stage of full disappearance
of the yolk sac (first feeding, FF, ~674 DD), and fry three weeks following first feeding (Fry, 786
DD) were sampled. The fish were maintained at 16˚C in recirculated freshwater. Total RNA
was extracted and cDNA prepared for real-time PCR analysis from eggs or whole fry using a
combination of Trizol (Invitrogen) and an RNAeasy Mini kit (Qiagen) as described above.
Gene expression in isolated IgM
+
cells
Leukocyte suspensions were incubated for 30 min on ice with an anti-trout IgM mAb (1.14)
[35] coupled to phycoerythrin (PE) in staining buffer (PBS containing 1% FCS and 0.5%
sodium azide) that prevents cell activation. Following two wash steps, cells were resuspended
in FACS buffer and IgM
+
B cells isolated based on their FSC/SSC profiles (excluding the gran-
ulocyte gate) and fluorescence emitted by anti-trout IgM (S1 Fig).
DNase I-treated total RNA was reverse transcribed directly from IgM
+
and IgM
-
sorted
populations using the Power Sybr Green Cells-to-Ct Kit (Invitrogen) following the manufac-
turer´s instructions. Real-time PCR was performed using SYBR Green PCR core Reagents
(Applied Biosystems) following the manufacturer´s instructions as described previously [31].
Gene expression in response to PKD infection
Two groups of fish from the same egg source (50–100 g each) were sampled for this study: a
parasite-naïve uninfected group and a parasite-naïve group exposed to parasite-infected water,
as described previously [28]. Briefly, the sampling of both groups was undertaken when naïve
parasite-exposed fish exhibited kidney pathology ranging from early to advanced clinical
stages (kidney swelling grades 1 to 3), as determined using the kidney swelling index system
devised by Clifton-Hadley and colleagues [36]. All control fish had a kidney swelling grade of 0
whereas the presence of T.bryosalmonae in parasite-exposed fish was confirmed by histologi-
cal examination of posterior kidney smears. In all fish sampled, approximately 100 mg of kid-
ney tissue was removed immediately below the dorsal fin, the area of the kidney associated
with the onset of clinical disease. Tissue samples were placed into 1 ml of RNA-later (Sigma,
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 5 / 24
ST. Louis, USA), kept at 4˚C for 24 h and stored at -80˚C prior to RNA extraction and PCR
analysis. Total RNA was extracted using TRI-reagent (Sigma) according to the manufacturer’s
instructions. Purified RNA was quantified using a Nanodrop spectrophotometer (NanoDrop
Technologies, Wilmington, USA) and reverse transcribed into cDNA as described above. To
evaluate the levels of transcription of the different genes, real-time PCR was performed using
Fast-Start Essential DNA Green Master reagents following the protocol described above.
Production of recombinant BAFF, APRIL and BALM
To study the effects of rainbow trout BAFF, APRIL and BALM on kidney IgM
+
B cell survival
and immunoglobulin transcription, we produced the three cytokines in E.coli. To carry this
out, the nucleotide sequence corresponding to the extracellular domain of the rainbow trout
BAFF sequence (GenBank Accession number DQ218467.1), APRIL (GenBank Accession num-
ber EF451543.1) or BALM (GenBank Accession number DQ218469.1) sequences together with
an N-terminal 6 x histidine tag were synthesized and subcloned into the E3 expression vector
(Abyntek). The recombinant plasmids were transformed into BL21 cells and kanamycin-resis-
tant single positive colonies for each clone were then incubated at 37˚C in Luria-Bertani (LB)
media. When the OD
600
reached 0.6, 0.1 mM of isopropyl β-D-thiogalactoside (IPTG, Sigma
Aldrich) was added to induce protein production. After 16 h, cells were harvested, lysed by soni-
cation and dissolved using urea. Thereafter, BAFF, APRIL or BALM were obtained through the
use of Nickel columns (Sigma Aldrich). The protein-containing fractions were pooled, refolded,
filtered through 0.22 μm and resuspended in storage buffer (50 mM Tris-HCl, 150 mM NaCl,
10% glycerol, 0.5 M L-arginine and 2 mM DTT, pH 8.5). Protein concentrations were deter-
mined in a BCA protein assay (Thermo Fisher Scientific) and the recombinant rainbow trout
cytokines (0.3 mg/ml) aliquoted and stored at -80
˚
C until used. An irrelevant protein with a
similar molecular weight to that of these recombinant proteins, also bearing an N-terminal His
tag was produced in the same conditions (C-His) and was used as a functional control.
Effect of BAFF, APRIL and BALM on survival and proliferation of kidney
IgM
+
B cells
Kidney leukocytes were incubated in the presence of recombinant rainbow trout BAFF, APRIL
or BALM at a final concentration of 3 μg/ml, in the presence of LPS (50 μg/ml) or with media
alone (control). After 72 h of incubation, cells were reacted with PE-labeled anti-IgM (1.14)
antibody and live IgM
+
B cells were quantified by flow cytometry. In those cases in which
increased IgM
+
B cell survival was observed, we analyzed cell proliferation to establish whether
the cells were actively proliferating in response to the cytokine or only an increased survival was
occurring. For this, kidney leukocytes were incubated in the presence of BALM (3 μg/ml), LPS
(50 μg/ml) or left unstimulated (control) at 20˚C. After 96 h of incubation, 10 μM EdU was
added to the cultures for 2 h, and cells were reacted with APC-labeled anti-IgM antibody (1.14),
and then treated for subsequent cell proliferation analysis following the manufacturer´s instruc-
tions (Click-iT1Plus EdU Alexa Fluor 488 Flow Cytometry Assay kit, Thermo Fisher Scien-
tific). All samples were analyzed on a FACSCalibur flow cytometer (BD Biosciences) equipped
with CellQuest Pro software. Analysis was performed with FlowJo 10 (TreeStar)
Effect of BAFF, APRIL and BALM on immunoglobulin transcription in
kidney
Kidney leukocytes were incubated at 20˚C in the presence of recombinant rainbow trout
BAFF, APRIL or BALM, or the C-His control protein, at a final concentration of 3 μg/ml.
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 6 / 24
After 24 h, total RNA was extracted using TRI-reagent (Sigma) according to the manufactur-
er’s instructions. Purified RNA was quantified using a Nanodrop spectrophotometer (Nano-
Drop Technologies, Wilmington, USA) and reverse transcribed into cDNA as described
above. The levels of transcription of IgM and IgT were evaluated by real-time PCR using Fast-
Start Essential DNA Green Master reagents following the protocol described above.
Statistics
Data handling, statistical analyses and graphic representation were performed using Office
Excel 2010 (Microsoft Corporation) and GraphPad Prism v. 6.0 (GraphPad Software Inc.). Sta-
tistical differences between populations were analyzed using a two tailed unpaired Student’s t
test. Correlations between T.bryosalmonae (PKD) kidney swelling grade and immune gene
expression were assessed by calculating the Pearson product–moment correlation coefficient
(r) and considered significant at P0.05 (using the two tailed Student’s ttest). Correlation
between parameters was represented by a linear regression.
Results
Sequence analysis of the rainbow trout BAFF receptor sequences
BAFF-R, BCMA and TACI are all type III transmembrane receptors with a single transmem-
brane domain, the N terminus on the extracellular side and no signal sequence [37]. After con-
ducting 3´RACE, we obtained a rainbow trout sequence that corresponds to a complete ORF
of 561 bp encoding a protein of 186 aa with closest homology to mammalian BAFF-R (Fig 1).
The phylogenetic tree clustered all fish and mammalian BAFF-R sequences but included two
fish sequences from Haplochromis burtoni and Neolamprologus brichardi that had been anno-
tated as TNFR17C in GenBank. However, their encoded proteins share the general structure
of mammalian BAFF-R and not that of other TNF receptors (Fig 2). TNF receptors are typi-
cally organized into multiple cysteine-rich domains (CRDs), each composed of six cysteine
residues and three disulfide bonds [38]. These CRDs are involved in interaction with the li-
gand. In mammals, BAFF-R contains only four cysteine residues in its ligand-binding domain
and being the smallest CRD in the TNF receptor family, it has sometimes been referred to as a
partial CRD [39]. The cysteine residues within the CRD establish disulfide bridges. Although
most CRDs have three disulfide bridges, BAFF-R has been predicted to only establish one
disulfide bridge between what have been designated as cysteines 1 and 2, whereas the remain-
ing two cysteines found in the CRD are free. Interestingly, rainbow trout BAFF-R has two con-
served cysteines (1 and 2), and therefore could maintain the 1–2 disulfide bridge conserved in
all TNF receptors (Fig 2). Some additional residues that condition the binding of BAFF-R to
either BAFF or APRIL in mammals are also conserved among fish and mammalian BAFF-R
sequences (Fig 2). These include an aspartic acid in position 13 (D26 in human) and a leucine
in position 15 (L28 in human), that allow the binding of BAFF-R to both BAFF and APRIL. In
contrast, the C24 and the L38 that favor binding to BAFF but are detrimental for APRIL bind-
ing in mammals are not conserved in fish [40]. Finally, the COOH-terminal region of BAFF-R
was found to be highly conserved between all species, as this is the signaling domain [40].
Although the TRAF-binding signature (P/S/A/T-X-Q/E-E) is not conserved in BAFF-R, this
highly-conserved COOH-terminal region is known to bind TRAF3 with high selectivity in
mammals [41].
The BCMA sequence identified in rainbow trout includes a complete ORF of 507 bp encod-
ing a protein of 168 aa. Rainbow trout BCMA and other fish BCMA sequences found in the
databases clearly clustered with mammalian BCMA sequences (Fig 1). As in mammals, fish
BCMA sequences contain one complete CRD composed of six cysteine residues and three
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 7 / 24
disulfide bonds (Fig 3). The sequence also possesses additional conserved residues known to
favor BAFF and APRIL binding in mammals. These include a tyrosine in position 11 (Y13 in
human), an aspartic acid in position 13 (D15 in human) and a leucine in position 15 (L17 in
human). The rainbow trout BCMA sequence also has a conserved arginine in position 25 (R27
in human) which favors APRIL binding and somehow limits the interaction with BAFF [40].
This residue, together with a histidine in position 19 (not present in the fish sequences),
accounts for the weak affinity of BAFF for BCMA in mammals. As seen in BAFF-R, the
COOH-terminal region of BCMA was also highly conserved between all species, including a
TRAF-binding consensus site (P/S/A/T-X-Q/E-E) [40].
Rainbow trout TACI includes an ORF of 783 bp encoding a protein of 260 aa. The phy-
logenetic analysis performed clearly grouped rainbow trout TACI with other vertebrate
sequences found in GenBank (Fig 1). TACI is characterized by the presence of two CRDs, each
composed of six cysteine residues, and this structure has also been conserved in fish (Fig 4). In
humans, the first ligand-binding domain has much weaker affinity for BAFF and APRIL than
Fig 1. Phylogenetic analysis of rainbow trout BAFF-R, BCMA and TACI. The rooted phylogenetic tree shows the relationship
between available sequences and those representing rainbow trout TNFR17 or BCMA, TNFR13B or TACI and TNFR13C or BAFF-R
(in bold) with other fish species and with human and other available mammalian sequences. The tree was constructed based on a
Clustal V multiple alignment of the complete sequences for each TNFR and was bootstrapped 1000 times as indicated. Accession
numbers of the sequences used for the phylogenetic analysis are as follows: Homo sapiens TNFR13C [NP_443177], TNFR13B
[NP_036584] and TNFR17 [NP_001183]; Mus musculus TNFR13C [NP_082351], TNFR13B [NP_067324] and TNFR17
[NP_035738]; Oryctolagus cuniculus TNFR13C [XP_008273381], TNFR13B [XP_008250513] and TNFR17 [XP_008255958];
Salmo salar TNFR13C [XP_014059270], TNFR13B [XP_014034414] and TNFR17 [XP_014034440]; Sinocyclocheilus rhinocerous
TNFR13C [XP_016414908] and TNFR17 [XP_016397935]; Sinocyclocheilus anshuiensis TNFR13C [XP_016321777]; Poecilia
latipinna TNFR13C [XP_014910891]; Haplochromis burtoni TNFR13C [XP_005947083]; Neolamprologus brichardi TNFR13C
[XP_006798027]; Esox lucius TNFR13B [XP_010863669]; Danio rerio TNFR13B [XP_009304656] and TNFR17 [XP_009304977];
Cyprinus carpio TNFR17 [KTF73008].
https://doi.org/10.1371/journal.pone.0174249.g001
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 8 / 24
the second one [42]. Consequently, the conserved residues that are known to favor BAFF and
APRIL binding are located in CRD2. Many of these residues, such as an aspartic acid in posi-
tion 52 (D80 in humans), a leucine in position 54 (L82 in humans) and a proline in position 69
(P97 in humans) are conserved in all fish TACI sequences. There is a high degree of homology
in the COOH terminal region of all vertebrate TACI sequences, although the consensus
TRAF-binding domain found in mammalian TACI sequences is not found in fish TACI
sequences.
Constitutive tissue distribution of BAFF-R, BCMA and TACI
We analyzed the levels of constitutive BAFF-R, BCMA and TACI expression in tissues
obtained from naïve perfused fish, to avoid contamination of tissues with circulating blood.
This is particularly important since we have shown PBLs to constitutively express all three
receptors (Fig 5). BAFF-R and BCMA were constitutively transcribed in all tissues analyzed,
although higher mRNA levels were observed for both receptors in spleen, PBLs and kidney
(Fig 5A and 5B). TACI, on the other hand, was not constitutively transcribed in hindgut and
brain (Fig 5C). TACI was expressed in PBLs, spleen and kidney, with low mRNA levels
observed in skin, gills, liver and muscle (Fig 5C). In general, BAFF-R mRNA levels were higher
than those of the other two receptors, suggesting a more predominant role of BAFF-R in B cell
regulation in physiological conditions (Fig 5).
Fig 2. Clustal W alignment of BAFF-R (TNFR13C) from trout (KX894509), salmon (XP_014059270), P.latipinna (XP_014910891), human
(NP_443177) and mouse (NP_082351). The location of the cysteine rich domains (CRD), transmembrane domain (TM) and TRAF binding domain
(TRAF domain) are shown above the alignment. Cysteine residues conserved in all species forming disulfide bonds in CRD regions are shown in red and
the predicted disulfide bond is indicated with brackets. Residues implicated in receptor binding to BAFF and APRIL are shown in green and those that are
known to limit APRIL binding in mammals are indicated in blue.
https://doi.org/10.1371/journal.pone.0174249.g002
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 9 / 24
Transcription of BAFF-R, BCMA and TACI during trout development
BAFF-R was detected in all the early developmental stages with a significant increase in
BAFF-R mRNA levels from hatching (Fig 6A). BCMA and TACI transcription was also
detected in all developmental stages, although no significant stage-specific differences in
mRNA levels were observed during development (Fig 6B and 6C). Again these results point to
a predominant physiological role of BAFF-R.
BAFF-R, BCMA and TACI transcription in sorted IgM
+
B cells
In mammals, BAFF and APRIL receptors are preferentially expressed in B cells, thus we next
examined the transcription of BAFF-R, BCMA and TACI in sorted IgM
+
B cells from different
rainbow trout tissues. Spleen, blood and kidney IgM
+
B cells did not constitutively express
TACI transcripts but did express BCMA and BAFF-R (Fig 7). Conversely, IgM
+
cells from the
hindgut had high TACI and BAFF-R transcript levels but low BCMA levels (Fig 7). IgM
+
B
cells from the gills expressed all three receptors at similar levels (Fig 7). These results strongly
Fig 3. Clustal W alignment of BCMA (TNFR17) from trout (KX894511), salmon (XP_014034440), zebrafish (XP_009304977),
human (NP_001183) and mouse (NP_035738). The location of the cysteine rich domains (CRD), transmembrane domain (TM) and
TRAF binding domain (TRAF domain) are shown above the alignment. Residues predicted as essential for TRAF binding are boxed
(TRAF binding sequence), cysteine residues forming disulfide bonds in CRD regions are shown in red and the predicted disulfide bonds
are indicated with brackets. Residues implicated in BAFF and/or APRIL binding are shown in green.
https://doi.org/10.1371/journal.pone.0174249.g003
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 10 / 24
suggest that in trout IgM
+
B cells from different sources use these receptors differently to regu-
late their activation and differentiation processes.
Fig 4. Clustal W alignment of TACI (TNFR13B) from trout (KX894510), salmon (XP_014034414), Esox lucius (XP_010863669),
human (NP_036584) and mouse (NP_067324). The location of the cysteine rich domains (CRD), transmembrane domain (TM) and TRAF
binding domain (TRAF domain) are shown above the alignment. Residues predicted as essential for TRAF binding are boxed (TRAF binding
sequence), cysteine residues conserved in all species forming disulfide bonds on each CRD region are shown in red and the predicted
disulfide bonds are indicated with brackets. Residues implicated in BAFF and/or APRIL binding are shown in green.
https://doi.org/10.1371/journal.pone.0174249.g004
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 11 / 24
Fig 5. Constitutive levels of transcription of BAFF-R, BCMA and TACI in different tissues. The amount
of BAFF-R (A), BCMA (B) and TACI (C) mRNA in PBLs and tissues (spleen, head kidney (HK), skin, hindgut,
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 12 / 24
Effect of PKD on the transcriptional regulation of BAFF, APRIL, BALM
and their receptors
In situ lymphocyte proliferation [43] and hyper-immunoglobulinaemia [24] are two of the
most significant traits of clinical PKD in trout. For this reason, we hypothesized that cytokines
that are implicated in the control of B cell responses, such as BAFF and APRIL, might be impli-
cated in the pathogenesis of this disease. Thus, we studied the transcription of BAFF, APRIL
and BALM as well as the receptors BAFF-R, BCMA and TACI in posterior kidney samples
from fish that had been naturally infected with T.bryosalmonae. Rainbow trout were found to
exhibit clinical pathology ranging from grade 1 at low levels to grade 3 in cases of severe/
advanced clinical disease. BAFF was significantly upregulated only in grade 3 fish relative to
uninfected controls, whereas APRIL and BALM were significantly upregulated in fish graded
from 1–2 to 3 and from 2 to 3 respectively (Fig 8). Despite these differences, mRNA levels of
all three cytokines strongly correlated with disease progression (rvalues from 0.854 to 0.939)
revealing a key role of these three cytokines in PKD pathogenesis in the kidney. Regarding
receptor expression, BAFF-R and TACI were both significantly upregulated in infected fish
(from grade 1) in comparison to control fish, with a strong correlation apparent between
BAFF-R and TACI mRNA levels and disease progression (rvalues 0.988 and 0.906, respec-
tively) (Fig 8D and 8F). In contrast, BCMA transcription was not influenced by parasite
infection (Fig 8E), suggesting that this receptor, mostly involved in plasma cell survival [44], is
not mediating the effects of BAFF, APRIL and BALM through the course of PKD infection.
Despite this, our results suggest that the BAFF, APRIL and BALM signaling axis plays a key
role in PKD pathogenesis.
To further understand the situation in the kidney in response to PKD, we analyzed the cor-
relation among ligand and receptor mRNA levels in all kidney samples, as well as the ligands
and receptors in relation to fish Igs. Interestingly, BAFF-R mRNA levels correlated signifi-
cantly with mRNA levels of BAFF, BALM and APRIL (Table 2A). Intriguingly, BCMA mRNA
levels only correlated significantly with BAFF (Table 2A), despite the fact that BAFF in mam-
mals has lower affinity than APRIL for BCMA [40]. TACI mRNA levels, in contrast, only
correlated significantly with BALM (Table 2A). When correlations among cytokine mRNA
levels and levels of transcription of the different Igs were performed, a significant correlation
between total IgM mRNA levels and those of the three cytokines was observed, particularly in
the case of BALM (Table 2B). BAFF and BALM also correlated significantly with transcripts
encoding the secretory forms of IgM and IgT, whereas no correlation was observed with
any of the cytokines and IgD (Table 2B). Concerning the receptors, BAFF-R mRNA levels
correlated significantly with total IgM, secretory IgM and IgT transcripts, but not with IgD
(Table 2C). Despite the fact that BCMA was not significantly induced during PKD progres-
sion, there was a significant correlation between IgM levels (both total and secreted) and
BCMA transcription (Table 2C). Conversely, no correlation was observed between Ig and
TACI expression even though TACI expression was upregulated in parasite exposed fish
(Table 2C).
Effect of BAFF, APRIL and BALM on the survival of kidney IgM
+
B cells
To gain further insights into the potential impact of BAFF, APRIL and BALM transcriptional
upregulation on leukocytes during PKD, we tested the effect of all three cytokines on the
gills, brain, liver and muscle) from 3 naïve perfused fish was estimated by real time PCR in duplicate samples.
Data are shown as the gene expression relative to the expression of endogenous control EF-1α(mean + SD).
https://doi.org/10.1371/journal.pone.0174249.g005
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 13 / 24
Fig 6. Levels of transcription of BAFF-R, BCMA and TACI in early rainbow trout stages. Transcriptional
levels of BAFF-R (A), BCMA (B) and TACI (C) during trout early development at different stages. Data are
shown as the gene expression relative to the expression of an endogenous control (EF-1α) (mean + SD,
n = 5). DD: degree days; HAT: hatching; PFF: pre-first feeding; FF: first feeding; Fry: 3 weeks post-first
feeding. *** Levels of expression significantly different to those observed in samples taken at 640 DD
(p <0.005).
https://doi.org/10.1371/journal.pone.0174249.g006
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 14 / 24
survival of IgM
+
B cells in the kidney. We included LPS in these experiments as a positive con-
trol, since LPS has been shown to induce proliferation and increase survival of trout IgM
+
B
cells [45]. Surprisingly, only BALM was capable of significantly promoting the survival of
IgM
+
B cells in the kidney after 3 days of incubation, at similar levels to those induced by LPS
(Fig 9A). Thus, we further explored, in cell proliferation assays, the mechanism by which
BALM increased IgM
+
B cell survival, by comparing the effects of this cytokine with those of
LPS. Our results demonstrated that BALM was capable of significantly inducing IgM
+
B cell
proliferation (S2 Fig), at levels similar to those triggered by LPS (S2 Fig). Therefore, these pro-
liferative effects likely account for the increase of the total numbers of IgM
+
B cells observed in
BALM-treated cultures.
Effect of BAFF, APRIL and BALM on the immunoglobulin transcription in
kidney
To further investigate the effect that induction of BAFF, APRIL and BALM may have on kid-
ney leukocytes during the course of PKD, we also tested the impact of the three cytokines on
the levels of IgM and IgT transcription. In this case, the incubation of kidney cells with the
three cytokines significantly increased the levels of transcription of IgM (Fig 9B). These results
are in agreement with the positive correlation found between IgM mRNA levels and mRNA
levels of BAFF, APRIL and BALM (Table 2). In the case of IgT, however, only BAFF was capa-
ble of significantly increasing its transcription levels (Fig 9C).
Discussion
In the current study, we have identified rainbow trout homologues of the three BAFF and
APRIL receptors found in mammals. Although during our database search we identified some
additional fish sequences for these receptors, our work constitutes the first in-depth analysis of
these receptors in fish. BAFF-R, BCMA and TACI are all type III transmembrane receptors
characterized by the N terminus of the protein being on the extracellular side, a single trans-
membrane domain, absence of a signal peptide, and a COOH terminal region responsible for
intracellular signaling [37]. Within the extracellular region, the CRDs are the areas in which
Fig 7. Transcription levels of BAFF-R, BCMA and TACI in B cells. Constitutive levels of transcription of
BAFF-R (A), BCMA (B) and TACI (C) in FACS isolated IgM
+
B cells from different trout tissues were evaluated
by real time PCR in duplicate. Results are shown as the gene expression relative to the expression of an
endogenous control (EF-1α) (mean + SD, n = 5).
https://doi.org/10.1371/journal.pone.0174249.g007
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 15 / 24
Fig 8. Regulation of BAFF and APRIL subfamily ligands and receptors during PKD infection. Posterior kidney tissue samples were obtained
from rainbow trout naturally infected with PKD. Samples were classified according to their kidney swelling grade, as detailed in the Methods.
All control fish had a kidney swelling grade of 0 (Control) and samples were named Grade 1 (G1), Grade 1–2 (G1-2), Grade 2 (G2) and Grade 3 (G3).
Transcriptional levels of BAFF (A), APRIL (B) and BALM (C) ligands, as well as the BAFF-R (A), BCMA (B) and TACI (C) receptors were evaluated by
real time PCR. Results are shown as the gene expression relative to the expression of an endogenous control(EF-1α) (mean ±SD) (Control, n = 10;
G1, n = 4, G1-2, n = 7; G2, n = 11, G3, n = 9). Statistical differences between control and infected groups were analyzed with a 2-tailed Student´s ttest
where *P<0.05, ** P<0.01 and *** P<0.005. A linear regression is also included (dotted line) to show the correlation between the expression of
specific genes and the course of the infection. The Pearson product-moment correlation coefficients (r) are also given relative to kidney swelling grade
(indicated in the plots).
https://doi.org/10.1371/journal.pone.0174249.g008
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 16 / 24
ligand binding takes place. Although TNF receptors often have multiple CRDs, BCMA only
has one, TACI has two and BAFF-R has only a partial one with four cysteine residues instead
of six [37]. Although this general structure was maintained for all three receptors in fish, some
important differences were observed in specific residues within the CRD between mammals
and fish. In mammals, it has been demonstrated that several conserved residues within the
main signaling CRD (CRD1 for BAFF-R and BCMA, and CRD2 in the case of TACI) influence
the affinity that each ligand has for each receptor [40]. As a consequence, BAFF binds BAFF-R
and TACI with affinities in the nanomolar range, although displaying three orders of magni-
tude weaker affinity for BCMA, whilst APRIL binds TACI and BCMA with high affinity,
but not BAFF-R [40]. However, the two residues known to inhibit the binding of APRIL to
BAFF-R in mammals (C24 and L38) are not conserved in fish. Whether this implies that
APRIL has the ability to bind to BAFF-R in fish warrants further investigation. This hypothesis
is supported by the fact that there is a significant correlation between APRIL and BAFF-R
mRNA levels in the kidney of PKD-infected fish. It is, nevertheless, plausible that such positive
correlation in gene expression is attributed to both APRIL and BAFF-R correlating with the
progression of clinical disease, although TACI is also upregulated during the clinical stages of
PKD without correlating to changes in APRIL transcription. In the case of BCMA, amino acid
residues H19 and the R27 are known to limit the capacity of BAFF to bind BCMA. In fish,
only one of these residues is conserved (R27) with the histidine in position 19 being substituted
by a glutamic acid. As before, whether the lack of one of these residues in fish implies a higher
affinity of BAFF for BCMA relative to mammals requires further investigation. Nevertheless,
during the course of clinical PKD, BCMA transcription correlated significantly with BAFF but
not with APRIL or BALM mRNA levels. Importantly, despite the high degree of sequence
identity between mammalian and fish TACI sequences in the COOH terminal region, the
absence of a TRAF binding consensus site in fish homologues could be indicative of key differ-
ences in down-stream intracellular signaling involving TACI in fish relative to mammals.
Table 2. Correlation of the expression of Ig and BAFF and APRIL subfamily ligands and receptors during the course of PKD infection.
A
BAFF-R BCMA TACI
BAFF 0.603** 0.426** 0.280
APRIL 0.602** 0.212 0.178
BALM 0.641** 0.297 0.356*
B
IgM total IgM sec IgT IgD
BAFF 0.407** 0.396** 0.436** 0.128
APRIL 0.396** 0.328 0.302 0.020
BALM 0.708** 0.644** 0.471** 0.242
C
IgM total IgM sec IgT IgD
BAFF-R 0.593** 0.584** 0.423** 0.261
BCMA 0.512** 0.508** 0.213 0.261
TACI 0.209 0.312 0.123 -0.048
Transcriptional levels of the TNF ligands BAFF, APRIL and BALM, the TNF receptors BAFF-R, BCMA and TACI, and total IgM, secreted IgM (IgM sec),
total IgD and total IgT were evaluated at each stage of clinical PKD (grade 1 to 3) by real-time PCR and normalized to the expression of trout EF-1α.
Correlations between TNF ligands and TNF receptors (A), TNF ligands and immunoglobulins (B) and TNF receptors and immunoglobulins (C) were studied,
and the Pearson product-moment correlation coefficient (r) was calculated for each pair. Statistical differences were analyzed by a 2-tailed Student´s ttest,
and significant differences are shown with numbers in bold, where *P<0.05 and ** P<0.01.
https://doi.org/10.1371/journal.pone.0174249.t002
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 17 / 24
After sequence verification of rainbow trout BAFF-R, BCMA and TACI, all three receptors
were shown to be constitutively expressed in systemic immune tissues (spleen, blood and kid-
ney). In mice, although the expression of BAFF-R protein is low on immature B cells, it
increases during B cell maturation and is eventually expressed by all mature B cells [46]. In
humans, BAFF-R is widely expressed by all B cells except for bone marrow plasma cells [46].
Rainbow trout BAFF-R was more highly expressed compared to BCMA and TACI, with
Fig 9. Effect of BAFF, APRIL and BALM on head kidney IgM
+
B cell survival and immunoglobulin transcription.
(A) Head kidney leukocytes were incubated with BAFF (3 μg/ml), APRIL (3 μg/ml), BALM (3 μg/ml), LPS (50 μg/ml) or
left unstimulated (control) for 3 days at 20˚C. After this time, cells were reacted with an anti-IgM mAb and analyzed by
flow cytometry. The total number of IgM
+
B cells per 10
5
cells was measured and plotted for each individual fish under
control or stimulation conditions. Each animal is represented by a broken line and the mean for each experiment is
represented by a solid line (n = 9). (B, C) Head kidney leukocytes were incubated with BAFF(3 μg/ml), APRIL (3 μg/ml),
BALM (3 μg/ml) or left unstimulated (control) for 24 h at 20˚C. Thereafter RNA was extracted from total leukocytes and
the transcription levels of total IgM (B) and total IgT (C) relative to the endogenous control gene EF-1αcalculated for
each sample and shown as mean + SD (n = 12). Statistical differences were evaluated bya two-tailed Student´s ttest,
where *p<0.05, ** p<0.01 and *** p<0.005.
https://doi.org/10.1371/journal.pone.0174249.g009
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 18 / 24
constitutive expression detected in all tissues analyzed. Furthermore, IgM
+
B cells from spleen,
blood, kidney, hindgut and gills also exhibited high BAFF-R mRNA levels suggesting that this
receptor plays an important role in the normal physiology of B cells. BCMA expression, in
contrast, is mostly restricted to antibody-producing cells in mammals, as signaling through
BCMA is an essential step for plasma cell survival [44]. Rainbow trout BCMA was found to be
constitutively expressed in all tissues analyzed and all IgM
+
B cell populations. It should be
noted that although mammalian IgG-producing cells eventually lose the surface Ig expression
when they fully differentiate into plasma cells, this does not occur in the case of IgM and IgA
plasma cells [47]. Similarly, antibody secreting cells that are differentiating to IgM-secreting
plasma cells in rainbow trout have also been shown to retain a functional B cell receptor (BCR)
[45]. It is, thus, plausible that some trout IgM
+
B cell populations that constitutively express
BCMA could be plasmablasts/plasma cells. Consistent with mammalian TACI [48], the consti-
tutive nature of fish TACI transcription was much more restricted than that seen with BCMA
or BAFF-R, suggesting that TACI is a highly inducible receptor throughout vertebrate phyla.
Interestingly, despite its transcription in tissue samples, TACI was not constitutively tran-
scribed by IgM
+
B cells in spleen, blood or kidney. Thus, the constitutive TACI mRNA levels
found in these immune tissues could be attributed to TACI expression in other subsets known
to express TACI in specific conditions including monocytes and DCs [49,50]. In contrast,
regardless of the low TACI transcription observed in hindgut and gills, IgM
+
B cells from these
tissues were found to constitutively express TACI, that could be indicative of an important
role for TACI in mucosal B cells. Mammalian TACI has been shown to play a crucial role in
the differentiation or survival of plasmablasts, particularly those derived from innate B cells
[51]. It is also known to be capable of conveying negative signals to B cells through TLR signal-
ing [52]. Thus, in fish, TACI could be contributing towards the maintenance of peripheral tol-
erance in mucosal sites, a premise that should be addressed in future research.
Given that BAFF-R, BCMA and TACI are expressed in fish B cells and the pathogenesis of
PKD being attributed to an apparent lymphoid-driven hyperplastic response and hyperim-
munoglobulinaemia [24], we studied the transcription of these receptors and their putative
ligands during the course of clinical PKD. BAFF, APRIL, BALM, BAFF-R and TACI were all
significantly upregulated in parasite-exposed fish, with transcription levels strongly correlating
with PKD progression. Interestingly, BCMA was not transcriptionally influenced by PKD, sug-
gesting a polyclonal or T cell-independent activation of B cells that occurs without the differen-
tiation of activated B cells to plasma cells. Although a complete characterization of the effects
of BAFF, APRIL and BALM on fish B cells has not been undertaken to date, some evidence in
fish species, such as rohu, imply that increased IgM levels may be attributed to a BAFF-like
activity [19], while in some other fish species expansion of B cell populations following BAFF
treatment has been reported [11,16]. It, therefore, seems plausible that BAFF, APRIL and
BALM secretion, as well as upregulation of BAFF-R and TACI, are at least partially responsible
for the high IgM and IgT levels found in PKD-infected fish [28]. In support of this premise, we
have demonstrated that transcription of BAFF, APRIL, BALM, BAFF-R and TACI signifi-
cantly correlated with total IgM mRNA levels, whereas BAFF, BALM, BAFF-R and TACI
transcription correlated with the secreted IgM and IgT mRNA levels. To further confirm a
potential role of the BAFF / APRIL axis on PKD pathogenesis, we have studied the effect of the
three cytokines on kidney cells. All three cytokines had positive effects on IgM transcription,
with BALM also significantly increasing the total number of IgM
+
B cells through proliferative
effects and BAFF being able to augment the transcription of IgT. These results strongly suggest
that the synthesis of these cytokines during the course of PKD accounts, at least partially, for
the increased immunoglobulin secretion observed in response to the parasite. Our experi-
ments showing the lymphoproliferative effects of BALM and its capacity to upregulate IgM
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 19 / 24
transcription provide the first evidences of a functional role for BALM, an ancient precursor
of mammalian BAFF and APRIL.
Treatments with chemicals such as malachite green and fumigillin are effective against
PKD, but are not licensable due to their toxicity effects in humans [53,54]. The data presented
here provides a fascinating insight into potential immune therapies that could be developed in
the future to control PKD pathogenesis in the absence of an effective vaccine. Increased serum
levels of BAFF and/or APRIL are often found in patients with autoimmune diseases, including
systemic lupus erythematosus (SLE) or rheumatoid arthritis [55]. The appreciation that BAFF
overexpression induced in murine models causes SLE and that BAFF inhibition delays SLE
onset has encouraged the development of therapeutic agents for inhibiting BAFF, APRIL, or
their receptors, as treatments for SLE and other autoimmune disorders [56]. These blocking
strategies include a monoclonal antibody against soluble BAFF, antibodies recognizing both
soluble and membrane BAFF, and a TACI-Ig fusion protein. Such strategies to curtail human
autoimmune disorders have been the subject of recent clinical trials [57]. In this context, a sim-
ilar approach for sequestering BAFF, APRIL, BALM or blocking their receptors could be
employed for the control of PKD in fish given the fact that fish infected with T.bryosalmonae
exhibit a chronic immune disorder that in some ways resembles an autoimmune disease.
In summary, we have identified for the first time in fish the three BAFF and APRIL recep-
tors known in mammals, namely TACI, BCMA and BAFF-R. Additionally, we report the regu-
lation of BAFF-R and TACI and their potential ligands, BAFF, APRIL and BALM during the
course of PKD in rainbow trout, as well as the correlation between the transcription of these
genes and Igs. These results, together with those obtained from functional studies that point
to a role for these cytokines in B cell function strongly suggest that activation of the BAFF /
APRIL axis contributes to the hyper-immunoglobulinaemia and B cell dysregulation that
characterizes this disease. Given the lack of effective vaccines to prevent PKD, the immunopro-
phylactic potential of BAFF / APRIL axis modulation could be explored in the future as an
alternative disease control strategy to vaccine development.
Supporting information
S1 Fig. Gating strategy for FACS isolation of IgM
+
B cells. Flow cytometry analysis of rain-
bow trout leukocytes isolated from trout tissues (spleen, blood, head kidney, PBLs, hindgut
and gills) and labeled with an anti-IgM mAb. For each individual tissue, FSC/SSC profiles
including a defined gate for lymphoid cells are shown (top row). IgM staining within the lym-
phoid gate is also shown (bottom row dot plots). Lymphoid IgM
+
(lower right corner gate)
cells were FACS isolated as described in the Methods. A representative experiment out of 3
independent assays is shown (n = 9).
(PDF)
S2 Fig. Rainbow trout BALM possesses lymphoproliferative effects. To test the effect of
BALM on IgM
+
B cell proliferation, head kidney leukocytes were incubated with BALM (3 μg/
ml), LPS (50 μg/ml), or left unstimulated (control) for 4 days at 20˚C. After this time, cells
were labeled with 10mM EdU and incubated for a further 2 h. Then, the cells were labelled
with an anti-IgM mAb, and treated for cell proliferation assays, as described in the Methods.
The percentage of proliferating (EdU
+
) IgM
+
B cells was then determined by flow cytometry
analysis. Quantification of the proliferating IgM
+
populations is shown as mean + SD (left,
n = 6), together with a representative dot plot of the flow cytometry analysis (right). Number
of proliferating IgM
+
cells are also indicated within the dot plots. Statistical differences were
evaluated by a two-tailed Student´s ttest, where p0.01 and p0.005.
(PDF)
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 20 / 24
Acknowledgments
We would like to thank Lucia Gonza
´lez for technical assistance and Rosario Castro for produc-
ing some of the cDNAs used in this study. This work was supported by the European Research
Council (ERC Starting Grant 2011 280469) and by the European Commission under the 7th
Framework Programme for Research and Technological Development (FP7) of the European
Union (Grant Agreement 311993 TARGETFISH) and under the Horizon H2020 research and
innovation programme (Grant H2020-634429 ParaFishControl). This work was also partially
funded by project AGL2014-54456-JIN from the Spanish Ministry of Economy and Competi-
tiveness (MINECO). JWH was supported by the Swiss National Science Foundation (grant ref-
erence CRSII3_147649–1).
Author Contributions
Conceptualization: CT.
Data curation: JP CT.
Formal analysis: AGG JP.
Funding acquisition: CT CJS AGG JWH.
Investigation: AGG JWH JP.
Methodology: AGG JWH JP.
Project administration: CT CJS AGG.
Resources: JWH AGG JP.
Supervision: CT.
Validation: CT.
Visualization: CT JP.
Writing – original draft: CT.
Writing – review & editing: CJS JWH.
References
1. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian
biology. Cell. 2001; 104(4):487–501. PMID: 11239407
2. Figgett WA, Vincent FB, Saulep-Easton D, Mackay F. Roles of ligands from the TNF superfamily in B
cell development, function, and regulation. Semin Immunol. 2014; 26(3):191–202. https://doi.org/10.
1016/j.smim.2014.06.001 PMID: 24996229
3. Elgueta R, Benson MJ, de Vries VC, Wasiuk A, Guo Y, Noelle RJ. Molecular mechanism and function
of CD40/CD40L engagement in the immune system. Immunol Rev. 2009; 229(1):152–72. https://doi.
org/10.1111/j.1600-065X.2009.00782.x PMID: 19426221
4. Huard B, Arlettaz L, Ambrose C, Kindler V, Mauri D, Roosnek E, et al. BAFF production by antigen-pre-
senting cells provides T cell co-stimulation. Int Immunol. 2004; 16(3):467–75. PMID: 14978020
5. Nardelli B, Belvedere O, Roschke V, Moore PA, Olsen HS, Migone TS, et al. Synthesis and release of
B-lymphocyte stimulator from myeloid cells. Blood. 2001; 97(1):198–204. PMID: 11133761
6. Mackay F, Schneider P. Cracking the BAFF code. Nat Rev Immunol. 2009; 9(7):491–502. https://doi.
org/10.1038/nri2572 PMID: 19521398
7. Schneider P. The role of APRIL and BAFF in lymphocyte activation. Curr Opin Immunol. 2005; 17
(3):282–9. https://doi.org/10.1016/j.coi.2005.04.005 PMID: 15886118
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 21 / 24
8. Ingold K, Zumsteg A, Tardivel A, Huard B, Steiner QG, Cachero TG, et al. Identification of proteogly-
cans as the APRIL-specific binding partners. J Exp Med. 2005; 201(9):1375–83. https://doi.org/10.
1084/jem.20042309 PMID: 15851487
9. Liang Z, Kong Y, Luo C, Shen Y, Zhang S. Molecular cloning, functional characterization and phyloge-
netic analysis of B-cell activating factor in zebrafish (Danio rerio). Fish Shellfish Immunol. 2010; 29
(2):233–40. https://doi.org/10.1016/j.fsi.2010.03.006 PMID: 20382231
10. Ai H, Shen Y, Min C, Pang S, Zhang J, Zhang S, et al. Molecular structure, expression and bioactivity
characterization of TNF13B (BAFF) gene in mefugu, Takifugu obscurus. Fish Shellfish Immunol. 2011;
30(6):1265–74. E https://doi.org/10.1016/j.fsi.2011.03.020 PMID: 21463693
11. Cui XW, Li JF, Xiao W, Xuan Y, Tian AY, Xu XZ, et al. Molecular cloning, expression and functional
analysis of TNF13b (BAFF) in Japanese sea perch, Lateolabrax japonicus. Int Immunopharmacol.
2012; 12(1):34–41. https://doi.org/10.1016/j.intimp.2011.10.009 PMID: 22032840
12. Pandit NP, Shen Y, Wang W, Chen Y, Li J. Identification of TNF13b (BAFF) gene from grass carp (Cte-
nopharyngodon idella) and its immune response to bacteria and virus. Dev Comp Immunol. 2013; 39
(4):460–4. https://doi.org/10.1016/j.dci.2013.01.004 PMID: 23352623
13. Xiao W, Long W, Liu GY, Sui CL, Guo XR, Tian A, et al. Molecular cloning, expressionand functional
analysis of B-cell activating factor (BAFF) in yellow grouper, Epinephelus awoara. Mol Immunol. 2014;
59(1):64–70. https://doi.org/10.1016/j.molimm.2014.01.005 PMID: 24491489
14. Meng F, Sun Y, Xu T. Comparative genomic of the BAFF and BAFF-like genes andimmune response
to bacteria of miiuy croaker (Miichthys miiuy). Fish Shellfish Immunol. 2015; 43(1):191–9. https://doi.
org/10.1016/j.fsi.2014.12.022 PMID: 25542380
15. Sun Y, Sun L. CsBAFF, a teleost B cell activating factor, promotes pathogen-induced innate immunity
and vaccine-induced adaptive immunity. PLoS One. 2015; 10(8):e0136015. https://doi.org/10.1371/
journal.pone.0136015 PMID: 26295165
16. Liu H, Zhang J, Li J, Song J, Zhang S. Molecular structure, distribution, and immunology function of
TNFSF13B (BAFF) in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2016; 51:240–50.
https://doi.org/10.1016/j.fsi.2016.02.026 PMID: 26915306
17. Godahewa GI, Perera NC, Umasuthan N, Wan Q, Whang I, Lee J. Molecular characterization and
expression analysis of B cell activating factor from rock bream (Oplegnathus fasciatus). Dev Comp
Immunol. 2016; 55:1–11. https://doi.org/10.1016/j.dci.2015.10.004 PMID: 26455464
18. Glenney GW, Wiens GD. Early diversification of the TNF superfamily in teleosts: genomic characteriza-
tion and expression analysis. J Immunol. 2007; 178(12):7955–73. PMID: 17548633
19. Basu M, Lenka SS, Paichha M, Patel B, Banerjee R, Das S, et al. B cell activating factor is induced by
toll-like receptor and NOD-like receptor-ligands and plays critical role in IgM synthesis in Labeo rohita.
Mol Immunol. 2016; 78:9–26. https://doi.org/10.1016/j.molimm.2016.08.010 PMID: 27568001
20. Ren W, Pang S, You F, Zhou L, Zhang S. The first BAFF gene cloned from the cartilaginous fish. Fish
Shellfish Immunol. 2011; 31(6):1088–96. https://doi.org/10.1016/j.fsi.2011.09.013 PMID: 21959037
21. Li R, Dooley H, Wang T, Secombes CJ, Bird S. Characterisation and expression analysis of B-cell acti-
vating factor (BAFF) in spiny dogfish (Squalus acanthias): cartilaginous fish BAFF has a unique extra
exon that may impact receptor binding. Dev Comp Immunol. 2012; 36(4):707–17. https://doi.org/10.
1016/j.dci.2011.11.010 PMID: 22155638
22. Li R, Redmond AK, Wang T, Bird S, Dooley H, Secombes CJ. Characterisation of the TNF superfamily
members CD40L and BAFF in the small-spotted catshark (Scyliorhinus canicula). Fish Shellfish Immu-
nol. 2015; 47(1):381–9. https://doi.org/10.1016/j.fsi.2015.09.033 PMID: 26386192
23. Das S, Sutoh Y, Hirano M, Han Q, Li J, Cooper MD, et al. Characterization of Lamprey BAFF-like Gene:
Evolutionary Implications. J Immunol. 2016; 197(7):2695–703. https://doi.org/10.4049/jimmunol.
1600799 PMID: 27543613
24. Hedrick RP, MacConnell E, de Kinkelin P. Proliferative kidney disease of salmonid fish. Annu Rev Fish
Dis. 1993; 3:277–90.
25. Grabner DS, El-Matbouli M. Tetracapsuloides bryosalmonae (Myxozoa:Malacosporea) portal of entry
into the fish host. Dis Aquat Organ. 2010; 90(3):197–206. https://doi.org/10.3354/dao02236 PMID:
20815328
26. Zwollo P, Cole S, Bromage E, Kaattari S. B cell heterogeneity in the teleost kidney: evidence for a matu-
ration gradient from anterior to posterior kidney. J Immunol. 2005; 174(11):6608–16. PMID: 15905499
27. Okamura B, Hartikainen H, Schmidt-Posthaus H, Wahli T. Life cycle complexity, environmental change
and the emerging status of salmonid proliferative kidney disease. Freshwat Biol. 2011; 56:735–53.
28. Gorgoglione B, Wang T, Secombes CJ, Holland JW. Immune gene expression profiling of Proliferative
Kidney Disease in rainbow trout Oncorhynchus mykiss reveals a dominance of anti-inflammatory,
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 22 / 24
antibody and T helper cell-like activities. Vet Res. 2013; 44:55. https://doi.org/10.1186/1297-9716-44-
55 PMID: 23865616
29. Zahl IH, Samuelsen O, Kiessling A. Anaesthesia of farmed fish: implications for welfare. Fish Physiol
Biochem. 2012; 38:201–18. https://doi.org/10.1007/s10695-011-9565-1 PMID: 22160749
30. Farrell AP, MacLeod KR, Driedzic WR, Wood S. Cardiac performance in the in situ perfused fish heart
during extracellular acidosis: interactive effects of adrenaline. J Exp Biol. 1983; 107:415–29. PMID:
6668460
31. Abos B, Castro R, Pignatelli J, Luque A, Gonzalez L, Tafalla C. Transcriptional heterogeneity of IgM(+)
Cells in rainbow trout (Oncorhynchus mykiss) tissues. PLoS One. 2013; 8(12):e82737. https://doi.org/
10.1371/journal.pone.0082737 PMID: 24324826
32. Castro R, Martinez-Alonso S, Fischer U, Haro NA, Soto-Lampe V, Wang T, et al. DNA vaccination
against a fish rhabdovirus promotes an early chemokine-related recruitment of B cells to the muscle.
Vaccine. 2014; 32(10):1160–8. https://doi.org/10.1016/j.vaccine.2013.11.062 PMID: 24291197
33. Cuesta A, Meseguer J, Esteban MA. The antimicrobial peptide hepcidin exerts an important role in the
innate immunity against bacteria in the bony fish gilthead seabream. Mol Immunol. 2008; 45(8):2333–
42. https://doi.org/10.1016/j.molimm.2007.11.007 PMID: 18164062
34. Wang T, Bird S, Koussounadis A, Holland JW, Carrington A, Zou J, et al. Identification of a novel IL-1
cytokine family member in teleost fish. J Immunol. 2009; 183(2):962–74. https://doi.org/10.4049/
jimmunol.0802953 PMID: 19553537
35. DeLuca D, Wilson M, Warr GW. Lymphocyte heterogeneity in the trout, Salmo gairdneri, defined with
monoclonal antibodies to IgM. Eur J Immunol. 1983; 13(7):546–51. https://doi.org/10.1002/eji.
1830130706 PMID: 6347695
36. Clifton-Hadley RS, D. B, Richards RH. A study of the sequential clinical and pathological changes dur-
ing proliferative kidney disease in rainbow trout, Salmo gairdneri Richardson. J Fish Dis. 1987; 10:335–
52.
37. Magis C, van der Sloot AM, Serrano L, Notredame C. An improved understanding of TNFL/TNFR inter-
actions using structure-based classifications. Trends Biochem Sci. 2012; 37(9):353–63. https://doi.org/
10.1016/j.tibs.2012.06.002 PMID: 22789664
38. Smith CA, Farrah T, Goodwin RG. The TNF receptor superfamily of cellular and viral proteins: activa-
tion, costimulation, and death. Cell. 1994; 76(6):959–62. PMID: 8137429
39. Thompson JS, Bixler SA, Qian F, Vora K, Scott ML, Cachero TG, et al. BAFF-R, a newly identified TNF
receptor that specifically interacts with BAFF. Science. 2001; 293(5537):2108–11. https://doi.org/10.
1126/science.1061965 PMID: 11509692
40. Bossen C, Schneider P. BAFF, APRIL and their receptors: structure, function and signaling. Semin
Immunol. 2006; 18(5):263–75. https://doi.org/10.1016/j.smim.2006.04.006 PMID: 16914324
41. Ni CZ, Oganesyan G, Welsh K, Zhu X, Reed JC, Satterthwait AC, et al. Key molecular contacts promote
recognition of the BAFF receptor by TNF receptor-associated factor 3: implications for intracellular sig-
naling regulation. J Immunol. 2004; 173(12):7394–400. PMID: 15585864
42. Hymowitz SG, Patel DR, Wallweber HJ, Runyon S, Yan M, Yin J, et al. Structures of APRIL-receptor
complexes: like BCMA, TACI employs only a single cysteine-rich domain for high affinity ligand binding.
J Biol Chem. 2005; 280(8):7218–27. https://doi.org/10.1074/jbc.M411714200 PMID: 15542592
43. Chilmonczyk S, Monge D, de Kinkelin P. Proliferative kidney disease: cellular aspects of the rainbow
trout, Oncorhynchus mykiss (Walbaum), response to parasitic infection. J Fish Dis. 2002; 25:217–26.
44. O’Connor BP, Raman VS, Erickson LD, Cook WJ, Weaver LK, Ahonen C, et al. BCMA is essential for
the survival of long-lived bone marrow plasma cells. J Exp Med. 2004; 199(1):91–8. https://doi.org/10.
1084/jem.20031330 PMID: 14707116
45. Abos B, Wang T, Castro R, Granja AG, Leal E, Havixbeck J, et al. Distinct differentiation programs trig-
gered by IL-6 and LPS in teleost IgM(+) B cells in the absence of germinal centers. Sci Rep. 2016;
6:30004. https://doi.org/10.1038/srep30004 PMID: 27481356
46. Darce JR, Arendt BK, Chang SK, Jelinek DF. Divergent effects of BAFF on human memory B cell differ-
entiation into Ig-secreting cells. J Immunol. 2007; 178(9):5612–22. PMID: 17442944
47. Pinto D, Montani E, Bolli M, Garavaglia G, Sallusto F, Lanzavecchia A, et al. A functional BCR in human
IgA and IgM plasma cells. Blood. 2013; 121(20):4110–4. https://doi.org/10.1182/blood-2012-09-
459289 PMID: 23550036
48. Treml LS, Carlesso G, Hoek KL, Stadanlick JE, Kambayashi T, Bram RJ, et al. TLR stimulation modifies
BLyS receptor expression in follicular and marginal zone B cells. J Immunol. 2007; 178(12):7531–9.
PMID: 17548587
49. Chang SK, Arendt BK, Darce JR, Wu X, Jelinek DF. A role for BLyS in the activation of innate immune
cells. Blood. 2006; 108(8):2687–94. https://doi.org/10.1182/blood-2005-12-017319 PMID: 16825497
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 23 / 24
50. Chang SK, Mihalcik SA, Jelinek DF. B lymphocyte stimulator regulates adaptive immune responses by
directly promoting dendritic cell maturation. J Immunol. 2008; 180(11):7394–403. PMID: 18490739
51. von Bulow GU, van Deursen JM, Bram RJ. Regulation of the T-independent humoral response by
TACI. Immunity. 2001; 14(5):573–82. PMID: 11371359
52. Mackay F, Schneider P. TACI, an enigmatic BAFF/APRIL receptor, with new unappreciated biochemi-
cal and biological properties. Cytokine Growth Factor Rev. 2008; 19(3–4):263–76. https://doi.org/10.
1016/j.cytogfr.2008.04.006 PMID: 18514565
53. le Gouvello R, Pobel T, Richards RH, Gould C. Field efficacy of a 10-day treatment of fumagillin against
proliferative kidney disease in rainbow trout Oncorhynchus mykiss. Aquaculture. 1999; 171:27–40.
54. Yonar ME. Changes in selected immunological parameters and antioxidant status of rainbow trout
exposed to malachite green (Oncorhynchus mykiss, Walbaum, 1792). Pestic Biochem Physiol 2010;
97:19–23.
55. Cheema GS, Roschke V, Hilbert DM, Stohl W. Elevated serum B lymphocyte stimulator levels in
patients with systemic immune-based rheumatic diseases. Arthritis Rheum. 2001; 44(6):1313–9.
https://doi.org/10.1002/1529-0131(200106)44:6<1313::AID-ART223>3.0.CO;2-S PMID: 11407690
56. Davidson A. The rationale for BAFF inhibition in systemic lupus erythematosus. Curr Rheumatol Rep.
2012; 14(4):295–302. https://doi.org/10.1007/s11926-012-0258-2 PMID: 22535567
57. Liu Z, Davidson A. BAFF inhibition: a new class of drugs for the treatment of autoimmunity. Exp Cell
Res. 2011; 317(9):1270–7. https://doi.org/10.1016/j.yexcr.2011.02.005 PMID: 21333645
Trout BAFF and APRIL subfamily ligands and receptors in PKD
PLOS ONE | https://doi.org/10.1371/journal.pone.0174249 March 21, 2017 24 / 24
... In this case, we did observe a significant increase in the levels of transcription of TWEAK 1 in the most severe grades of the disease (grades 2 and 3). It is noteworthy mentioning that other members of TNFSF such as BAFF and APRIL were also significantly up-regulated during PKD (52). In particular, BAFF was significantly up-regulated in grade 3 whereas APRIL was significantly up-regulated in all disease grades in comparison with healthy fish. ...
... In particular, BAFF was significantly up-regulated in grade 3 whereas APRIL was significantly up-regulated in all disease grades in comparison with healthy fish. Interestingly, the levels of transcription of BAFF and APRIL correlated with total IgM mRNA levels, known to be highly augmented during the course of PKD (52). Additionally, BAFF transcription correlated with secreted IgT mRNA levels (52). ...
... Interestingly, the levels of transcription of BAFF and APRIL correlated with total IgM mRNA levels, known to be highly augmented during the course of PKD (52). Additionally, BAFF transcription correlated with secreted IgT mRNA levels (52). These results suggested that BAFF and APRIL were at least in part responsible for this increased Ig production. ...
Article
Full-text available
Tumor necrosis factor (TNF)-like weak inducer of apoptosis or TWEAK is a member of the TNF superfamily involved in the regulation of many biological processes. In mammals, TWEAK has been shown to play a role in some autoimmune or inflammatory conditions, but its immune role is not yet clearly defined. In teleost fish, although a few studies have identified homologues to mammalian TWEAK, their biological effects have never been investigated. In the current study, we have studied the transcriptional regulation of two TWEAK homologues (TWEAK 1 and 2) identified in rainbow trout (Oncorhynchus mykiss) throughout different tissues, in response to parasitic or viral infections, or in head kidney (HK) leukocytes stimulated with different stimuli. Although the transcription of both homologues was modulated when HK leukocytes were exposed to several immune stimuli, only TWEAK 1 was significantly modulated upon pathogenic exposure. Thus, we performed a characterization of the functions exerted by this cytokine in HK leukocytes. Recombinant TWEAK 1 strongly up-regulated the transcription of pro-inflammatory genes and antimicrobial peptides in HK leukocytes, with differential transcriptional effects in IgM+ B cells, IgM- lymphocytes and myeloid cells. TWEAK 1 also increased the survival and promoted the differentiation of B cells in HK leukocyte cultures. Our results demonstrate that in teleost fish, TWEAK 1 is involved in the response to different types of pathogens, through the modulation of antimicrobial and pro-inflammatory genes in different leukocytes subsets. Furthermore, a role for TWEAK as a B cell differentiation factor has also been established in rainbow trout.
... The B cell response that initiated recovery here extends the findings of Chilmonczyk et al. (7), Abos et al. (11), and Granja et al. (33) which all provided some evidence of a decrease of B cell mechanisms during advanced PKD pathogenesis. For example, Chilmonczyk et al. (7) showed that at week 16-20 post -T. ...
... Abos et al. (11) reported that the presence of IgM, IgD, and IgT+ B cells were greater in rainbow trout with grade 1-2 clinical swelling than in kidneys in which the disease pathology had progressed to grade 3-4 swelling. While, Granja et al. (33) reported a decreasing trend in baff transcripts correlating with levels 3-4 of kidney swelling grade. Likewise, in the present study there was a significant decrease in baff transcripts over time. ...
... Although a body of work has unraveled some of the B cell mechanisms involved in PKD pathogenesis (8,10,11,16,33), still less is known about the role of T cell subsets. We did not see an increase of any T cell markers in terms of CD8α+ T cells in the FACS analysis or in the mRNA levels of cd4, cd8α, cd8β, and tcrβ or of Th-1 or Th-2-like master regulators (t-bet, gata3) in the AK and PK during recovery. ...
Article
Full-text available
Proliferative kidney disease (PKD) caused by the myxozoan parasite Tetracapsuloides bryosalmonae is one of the most serious infectious diseases negatively impacting farmed and wild salmonids throughout Europe and North America. PKD pathogenesis results in a massive B cell proliferation and dysregulation with aberrant immunoglobulin production and plasma cell differentiation along with a decrease in myeloid cells and inhibition of innate pathways. Despite the huge immunopathological reaction in the kidney during infection, under specific conditions, fish can survive and return to full fitness. Fish are unique in this ability to recover renal structure and functionality from extensive tissue damage in contrast to mammals. However, only limited knowledge exists regarding the host immune response coinciding with PKD recovery. Moreover, almost no studies of the immune response during disease recovery exist in fish. We utilized the rainbow trout–T. bryosalmonae system as an immunological model of disease recovery. Our results demonstrated that recovery is preceded by an intense immune response at the transcript level, decreasing parasite burden, and an increased degree of kidney inflammation. Later in the recovery phase, the immune response transpired with a significant decrease in lymphocytes and an increase in myeloid cells. These lymphocytes populations contained lower levels of B cells comparative to the control in the anterior and posterior kidney. Additionally, there was downregulation of several transcripts used as markers for plasma cells (blimp1, igt sec, igm sec, igd sec, and cd38) and T cell subsets (cd4, cd8α, cd8β, and tcrβ). The decrease in these T cell transcripts significantly correlated with decreasing parasite intensity. Alternatively, there was strong upregulation of pax-5 and igt mem. This suggests a change in B cell processes during the recovery phase relative to clinical PKD may be necessary for the host to re-establish homeostasis in terms of an arrest in the dominant antibody like response transitioning to a transcriptional profile associated with resting B cells. The knowledge generated here in combination with earlier studies illuminates the full power of analyzing the entire trajectory of disease from the normal healthy state to recovery enabling the measurement of an immune response to pinpoint a specific disease stage.
... In this same species, the transcription of BALM was shown to be upregulated locally in lymphocytes after the i.p. administration of virus particles (17). Additionally, a significant correlation between the transcription of BALM and the progression of the proliferative kidney disease, a parasitic disease known to profoundly dysregulate B cell responses, was found in rainbow trout (18). Regarding functional studies, rainbow trout APRIL and BALM but not BAFF were shown to increase the number of total IgM 1 B cells in peritoneal leukocyte cultures (17), whereas BALM and not BAFF and APRIL promoted the survival and proliferation of IgM 1 B cells in the kidney (18). ...
... Additionally, a significant correlation between the transcription of BALM and the progression of the proliferative kidney disease, a parasitic disease known to profoundly dysregulate B cell responses, was found in rainbow trout (18). Regarding functional studies, rainbow trout APRIL and BALM but not BAFF were shown to increase the number of total IgM 1 B cells in peritoneal leukocyte cultures (17), whereas BALM and not BAFF and APRIL promoted the survival and proliferation of IgM 1 B cells in the kidney (18). ...
Article
Full-text available
TNF superfamily (TNFSF) members, such as BAFF and a proliferation-inducing ligand (APRIL), emerged in vertebrates as key regulators of B cell homeostasis and activation. Many cartilaginous and teleost fish contain an additional gene, designated as BAFF- and APRIL-like molecule (BALM), of unknown function and lost in tetrapods. In this study, we have performed a wide characterization of the functions of BALM on naive B cells for the first time, to our knowledge, in teleosts using rainbow trout (Oncorhynchus mykiss) as a model. Similar to BAFF and APRIL, BALM increased the survival and promoted the proliferation of peripheral blood IgM+ B cells and cooperated with BCR cross-linking to increase the proliferation rate of IgM+ B cells. BALM also seemed to be a differentiating factor for trout IgM+ B cells, as it increased IgM secretion and increased cell size. Additionally, BALM appeared to increase the Ag-presenting properties of IgM+ B cells, augmenting MHC class II surface expression and upregulating the phagocytic capacity of these cells. Finally, the fact that there was no synergy between BALM and BAFF/APRIL in any of these functions strongly suggests that BALM signals through the same receptors as BAFF and APRIL to carry out its functions. This hypothesis was further supported in competitive BALM binding assays. The results presented provide relevant information for understanding how these TNFSF members cooperate in teleost fish to regulate B cell functionality, helping us to interpret the evolutionary relations between molecules of this family.
... Negative controls with no template and minus reverse transcription controls (-RT) were included in all experiments. Gene expression was normalized to the relative expression of the rainbow trout elongation factor (EF-1a) amplified using primers previously used (42,43). Expression levels were calculated using the 2 -DCt method, where DCt is determined by subtracting the reference gene value from the target Ct as described previously (42,43). ...
... Gene expression was normalized to the relative expression of the rainbow trout elongation factor (EF-1a) amplified using primers previously used (42,43). Expression levels were calculated using the 2 -DCt method, where DCt is determined by subtracting the reference gene value from the target Ct as described previously (42,43). ...
Article
Full-text available
In mammals, Blimp1 (B lymphocyte-induced maturation protein 1) encoded by the prdm1 gene and its homolog Hobit (homolog of Blimp1 in T cells) encoded by znf683, represent key transcriptional factors that control the development and differentiation of both B and T cells. Despite their essential role in the regulation of acquired immunity, this gene family has been largely unexplored in teleosts to date. Until now, one prdm1 gene has been identified in most teleost species, whereas a znf683 homolog has not yet been reported in any of these species. Focusing our analysis on rainbow trout (Oncorhynchus mykiss), an in silico identification and characterization of prdm1-like genes has been undertaken, confirming that prdm1 and znf683 evolved from a common ancestor gene, acquiring three gene copies after the teleost-specific whole genome duplication event (WGD) and six genes after the salmonid-specific WGD. Additional transcriptional studies to study how each of these genes are regulated in homeostasis, in response to a viral infection or in B cells in different differentiation stages, provide novel insights as to how this gene family evolved and how their encoded products might be implicated in the lymphocyte differentiation process in teleosts.
... Amongst different immune molecules, TNFSF members have been cloned and characterized in avian and mammalian species, which play an important role in different aspects of immune functioning and organization (Khare et al. 2000;Schneider et al. 2004;Gilbert et al. 2006;Ettinger et al. 2007), including survivability of B cells and T cells along with activation of signaling pathways (Mackay and Ambrose 2003). Apart from these vertebrates, TNFSF members have also been characterized in various piscine species, which includes zebrafish, miiuy croaker, rohu, and rainbow trout Meng et al. 2015;Basu et al. 2016;Granja et al. 2017). Previous reports confirmed the role of TNFSF members such as BAFF and APRIL in B-cell maintenance and maturation and proved to be a good candidate for development of B cells in fish (Li et al. 2012). ...
... The role of recombinant BAFF on B cells were mainly studied in zebrafish, fugu, rohu, rainbow trout, and some other teleosts Ai et al. 2011;Basu et al. 2016;Granja et al. 2017). In C. catla, recombinant BAFF production has been confirmed by Western blotting. ...
Article
Full-text available
Tumor necrosis factor superfamily (TNFSF) molecules are important inflammatory cytokines, which are involved in diverse immunological functions such as B-cell regulation and B-cell-mediated immune responses. Existence of numerous tumor necrosis factor (TNF) members in the evolutionary lower vertebrate species has been reported; however, their immune functions are yet to be explored. Therefore, the existence of TNFSF members such as B-cell activating factor (BAFF) and a proliferation-inducing ligand (APRIL) were identified in the freshwater carp, Catla catla. The BAFF and APRIL of C. catla (CcBAFF) and (CcAPRIL) were confirmed with the help of bioinformatic analysis. The CcBAFF showed higher structural identity with the BAFF of Xenopus laevis (amphibian) and BAFF-human. Further, the phylogenetic analysis ensured the conserved sequence similar to that of other teleosts. CcBAFF protein sequence had a predicted transmembrane domain and a typical TNF homology domain. CcBAFF and CcAPRIL were found to be constitutively expressed in all the immunological tissues. Spleen and gill had shown an elevated expression compared with other tissues in all the infected/stimulated (bacterial, viral antigen, and parasitic) fish. Stimulation by ligands (Poly I:C, LPS, PGN, and FLA) in C. catla had shown an elevation in the expression of CcBAFF and CcAPRIL in spleen and gill at different time intervals. The expression of recombinant CcBAFF has been confirmed with the immunoblotting. Thus, this is the first report that indicates the presence of BAFF and APRIL in Catla catla and its potential role in immunity.
... Much of the knowledge of host immunity during PKD pathogenesis is generated from studies using a model species, the non-native rainbow trout Oncorhynchus mykiss, exposed to the European strain of the parasite for which it acts as a dead-end host (Abos et al., 2018;Chilmonczyk et al., 2002;Gorgoglione et al., 2013;Granja et al., 2017). This emphasis on rainbow trout is due to the severe economic constraints PKD places on the rainbow trout industry in Western Europe (Okamura et al., 2011). ...
Article
Full-text available
Heterogeneity in immunity occurs across numerous disease systems with individuals from the same population having diverse disease outcomes. Proliferative kidney disease (PKD) caused by Tetracapsuloides bryosalmonae , is a persistent parasitic disease negatively impacting both wild and farmed salmonids. Little is known of how PKD is spread or maintained within wild susceptible populations. We investigated an aspect of fish disease that has been largely overlooked, that is, the role of the host phenotypic heterogeneity in disease outcome. We examined how host susceptibility to T. bryosalmonae infection, and the disease PKD, varied across different infection life‐history stages and how it differs between naïve, re‐infected and persistently infected hosts. We investigated the response to parasite exposure in host phenotypes with (a) different ages and (b) heterogeneous infection life histories. Among (a) the age phenotypes were young‐of‐the‐year (YOY) fish and juvenile 1+ fish (fish older than one) and, for (b) juvenile 1+ infection survivors were either re‐exposed or not re‐ exposed to the parasite and response phenotypes were assigned post‐hoc dependant on infection status. In fish not re‐exposed this included fish that cleared infection (CI) or had a persistent infection (PI). In fish re‐exposed these included fish that were re‐infected (RI), or re‐exposed and uninfected (RCI). We assessed both parasite‐centric (infection prevalence, parasite burden, malacospore transmission) and host‐centric parameters (growth rates, disease severity, infection tolerance and the immune response). In (a), YOY fish, parasite success and disease severity were greater and differences in the immune response occurred, demonstrating an ontogenetic decline of susceptibility in older fish. In (b), in PI and RI fish, parasite success and disease severity were comparable. However, expression of several adaptive immunity markers was greater in RI fish, indicating concomitant immunity, as re‐exposure did not intensify infection. We demonstrate the relevance of heterogeneity in infection life history on disease outcome and describe several distinctive features of immune ontogeny and protective immunity in this model not previously reported. The relevance of such themes on a population level requires greater research in many aquatic disease systems to generate clearer framework for understanding the spread and maintenance of aquatic pathogens.
... These cytokines help in the regulation of B-cells via the induction of TLR pathway. This is well established in the MyD88-deficient mice (Enghard et al 2007;Mackay and Schneider 2009;Granja et al. 2017). ...
Article
Toll-like receptors (TLRs) in innate immune system act as primary sensors in detecting the microbial components and activate their signaling cascades to induce NF-κB (nuclear factor NF-κB) towards the augmentation of immunoglobulin (Ig) synthesis. To gain insights into the efficacy of NF-κB pathway in immunoglobulin D (IgD) synthesis in the Indian Major Carp Catla catla, cloning and sequencing of TLR-signaling downstream molecules [TRAF3 (TNF receptor-associated factor 3), NEMO (nuclear factor-kappa B essential modulator), NF-κB and BAFF (B cell activating factor)] were performed by infecting the fish with pathogens. mRNA expression analysis of the downstream molecules and IgD showed significant up-regulation of these genes in kidney (P ≤ 0.001) as compared to spleen (P ≤ 0.05). To ascertain the role of NF-κB pathway in IgD synthesis, the primary cell culture of kidney and spleen in monolayer cell suspension was treated with NF-κB inhibitor (BAY 11-7082) and down-regulation of BAFF, NEMO, NF-κB, and IgD gene was observed. These results highlight the importance of NF-κB signaling pathway in augmenting the IgD gene expression in the freshwater carp, Catla catla.
Article
Full-text available
The differentiation of B cells into antibody-secreting cells is fundamental for the generation of humoral immunity. In mammals, this process involves a series of metabolic and intracellular changes, not studied to date in teleost fish, where a clear distinction between naïve B cells and plasmablasts/ plasma cells (PCs) is still missing. Thus, in the current study, we have established that upon activation, teleost B cells undergo an expansion of the endoplasmic reticulum (ER) but experience no significant changes in mitochondria content. In parallel, the transcription of genes implicated in B cell differentiation increase, while that of mitochondrial genes decrease. In this context, ER monitoring has allowed us to distinguish between small cells with low amounts of ER (FSCloERlo B cells), that correspond to undifferentiated cells, and large cells with expanded ER (FSChiERhi B cells), characterized as plasmablasts. The results shed new light on the B cell differentiation process in teleosts and provide us with novel tools to study B cell function in these species.
Article
Full-text available
With the exception of a few signaling incompetent decoy receptors, the receptors of the tumor necrosis factor receptor superfamily (TNFRSF) are signaling competent and engage in signaling pathways resulting in inflammation, proliferation, differentiation, and cell migration and also in cell death induction. TNFRSF receptors (TNFRs) become activated by ligands of the TNF superfamily (TNFSF). TNFSF ligands (TNFLs) occur as trimeric type II transmembrane proteins but often also as soluble ligand trimers released from the membrane-bound form by proteolysis. The signaling competent TNFRs are efficiently activated by the membrane-bound TNFLs. The latter recruit three TNFR molecules, but there is growing evidence that this is not sufficient to trigger all aspects of TNFR signaling; rather, the formed trimeric TNFL–TNFR complexes have to cluster secondarily in the cell-to-cell contact zone for full TNFR activation. With respect to their response to soluble ligand trimers, the signaling competent TNFRs can be subdivided into two groups. TNFRs of one group, designated as category I TNFRs, are robustly activated by soluble ligand trimers. The receptors of a second group (category II TNFRs), however, failed to become properly activated by soluble ligand trimers despite high affinity binding. The limited responsiveness of category II TNFRs to soluble TNFLs can be overcome by physical linkage of two or more soluble ligand trimers or, alternatively, by anchoring the soluble ligand molecules to the cell surface or extracellular matrix. This suggests that category II TNFRs have a limited ability to promote clustering of trimeric TNFL–TNFR complexes outside the context of cell–cell contacts. In this review, we will focus on three aspects on the relevance of receptor oligomerization for TNFR signaling: (i) the structural factors which promote clustering of free and liganded TNFRs, (ii) the signaling pathway specificity of the receptor oligomerization requirement, and (iii) the consequences for the design and development of TNFR agonists.
Article
Tumor necrosis factors (TNFs) are a group of cytokines that play critical roles in regulating a diverse range of physiological processes in vertebrates. TNFs function by activating a large number of structurally related receptors, leading to TNF mediated biological processes which are evolutionarily conserved. Fish have a much diversified TNF family, partly due to the whole genome duplication events which have occurred in this lineage, providing an excellent model to investigate the neo- and sub-functionalised properties of TNF superfamily. Fish possess most of the TNFs and receptors found in mammals and also some homologues exclusively present in fish. It seems that TNFSF4 (OX40), TNFSF7 (CD27) and TNFSF8 (CD30) and their cognate receptors are absent in teleosts. It has been shown that fish viruses are able to produce TNFR homologues to establish infection by manipulating the host immune system. Understanding the roles of TNFSFs in fish immune defence and the pathogenesis of fish diseases will provide insights into the functions of TNFSFs from an evolutionary perspective and better strategies for improving fish health and welfare in aquaculture. This review summarises recent advances in the study offish TNF biology and focuses on the molecular properties and immunological functions of the TNF and TNFR superfamily.
Article
Full-text available
Although originally identified as a B cell differentiation factor, it is now known that mammalian interleukin-6 (IL-6) only regulates B cells committed to plasma cells in response to T-dependent (TD) antigens within germinal centers (GCs). Even though adaptive immunity is present in teleost fish, these species lack lymph nodes and GCs. Thus, the aim of the present study was to establish the role of trout IL-6 on B cells, comparing its effects to those induced by bacterial lipopolysaccharide (LPS). We demonstrate that the effects of teleost IL-6 on naïve spleen B cells include proliferation, activation of NF-κB, increased IgM secretion, up-regulation of Blimp1 transcription and decreased MHC-II surface expression that point to trout IL-6 as a differentiation factor for IgM antibody-secreting cells (ASCs). However, LPS induced the secretion of IgM without up-regulating Blimp1, driving the cells towards an intermediate activation state in which antigen presenting mechanisms are elicited together with antibody secretion and expression of pro-inflammatory genes. Our results reveal that, in trout, IL-6 is a differentiation factor for B cells, stimulating IgM responses in the absence of follicular structures, and suggest that it was after follicular structures appeared that this cytokine evolved to modulate TD responses within the GC.
Article
Full-text available
B cell activating factor (BAFF) is a member of the tumor necrosis factor family that is known to play an important role in B cell activation, proliferation, and differentiation in mammals. However, studies of BAFF in teleosts are very limited and its function, in particular that under in vivo conditions, is essentially unknown. In this study, we conducted in vivo as well as in vitro functional analyses of a BAFF homologue (CsBAFF) from the teleost fish tongue sole (Cynoglossus semilaevis). CsBAFF is composed of 261 residues and shares moderate sequence identities with known BAFFs of other teleosts. CsBAFF expression was most abundant in immune organs and was upregulated during bacterial infection. Purified recombinant CsBAFF (rCsBAFF) bound to tongue sole lymphocytes and promoted cellular proliferation and survival. The results of an in vivo study showed that CsBAFF overexpression in tongue sole significantly enhanced macrophage activation and reduced bacterial infection in fish tissues, whereas knockdown of CsBAFF expression resulted in increased bacterial dissemination and colonization in fish tissues. Furthermore, vaccination studies showed that CsBAFF enhanced the immunoprotection of a DNA vaccine and augmented the production of specific serum antibodies. Taken together, these results provide the first in vivo evidence to indicate that teleost BAFF is an immunostimulator that significantly contributes to the innate antibacterial immune response and vaccine-induced adaptive immune response.
Article
B-cell activating factor (BAFF), an important member of the tumor necrosis factor superfamily, plays critical roles in the modulation of B-cell functions and enhancement of immune response in the host. Like higher vertebrates, the important role of BAFF in boosting immune response against diverse pathogens was also envisaged in fishes. We therefore, studied BAFF in rohu (Labeo rohita), a freshwater food fish species of highest economic importance in the Indian subcontinent. Full-length rohu-BAFF- cDNA comprised of 804 bp nucleotide long ORF, encoding 267 amino acid residues, and shared high structural similarity with human-BAFF. It was expressed in the embryonic developmental stages suggesting its key role in immune response at the early life of fish. In Aeromonas hydrophila infection and rhabdoviral antigen stimulation, BAFF-gene expression in rohu was induced across the organs/tissues. Stimulation of un-treated healthy rohu fish leukocytes, and viral or bacterial or BSA (bovine serum albumin) antigen stimulated rohu fish leukocytes with recombinant-BAFF (r-BAFF) resulted in enhanced expression of immunoglobulin (Ig)M. Both in-vitro and in-vivo treatment with toll-like receptor (TLR)- ligand (poly I:C) or nod-like receptor (NLR)- ligands (iE-DAP and MDP) resulted in TLR and NLR activation and BAFF-gene expression. This is the first report showing BAFF-expression by innate immune receptor-ligands and its critical role in enhancing adaptive immune response in fish.
Article
BAFF (TNF superfamily [TNFSF] 13B/Blys) and APRIL (TNFSF13) are important regulatory factors for lymphocyte activation and survival in mammals. A BAFF/APRIL-like relative called BAFF- and APRIL-like molecule (BALM) has also been identified in cartilaginous and bony fishes, and we report in this study a BAFF-like gene in lampreys. Our phylogenetic analysis of these genes and a related TNFSF12 gene called TNF-like weak inducer of apoptosis (TWEAK) suggest that, whereas an ancestral homolog of BAFF and APRIL was already present in a common ancestor of jawed and jawless vertebrates, TWEAK evolved early on in the jawed vertebrate lineage. Like mammalian BAFF and APRIL, the lamprey BAFF-like gene is expressed in T-like, B-like, and innate immune cells. The predicted protein encoded by this BAFF-like gene in lampreys exhibits higher sequence similarity with mammalian BAFF than APRIL. Correspondingly, we find BAFF orthologs in all of the jawed vertebrate representatives that we examined, although APRIL and/or BALM orthologs are not identifiable in certain jawed vertebrates. For example, BALM is not identifiable in tetrapods, and APRIL is not identifiable in several bony fishes or in birds, the latter of which also lack a TWEAK-like gene. Our analysis further suggests that a hybrid molecule called TWE-PRIL, which is a product of an in-genomic fusion between APRIL and TWEAK genes evolved early in mammalian evolution.
Article
The tumour necrosis factor superfamily (TNFSF) members CD40L and BAFF play critical roles in mammalian B cell survival, proliferation and maturation, however little is known about these key cytokines in the oldest jawed vertebrates, the cartilaginous fishes. Here we report the cloning of CD40L and BAFF orthologues (designated ScCD40L and ScBAFF) in the small-spotted catshark (Scyliorhinus canicula). As predicted both proteins are type II membrane-bound proteins with a TNF homology domain in their extracellular region and both are highly expressed in shark immune tissues. ScCD40L transcript levels correlate with those of TCRα and transcription of both genes is modulated in peripheral blood leukocytes following in vitro stimulation. Although a putative CD40L orthologue was identified in the elephant shark genome the work herein is the first molecular characterisation and transcriptional analysis of CD40L in a cartilaginous fish. ScBAFF was also cloned and its transcription characterised in an attempt to resolve the discrepancies observed between spiny dogfish BAFF and bamboo shark BAFF in previously published studies.