PosterPDF Available

Evolution of Flavivirus regulatory RNA elements

Authors:

Abstract

Arthropod-borne flaviviruses (FVs), including pathogens such as Dengue (DENV), Zika (ZIKV), Yellow fever (YFV), Japanese encephalitis virus (JEV) are a growing global health treat. FV are small (+)ssRNA viruses of 10-12kb length with highly structured untranslated regions (UTRs). The latter are associated with regulation of the viral life cycle, inducing genome circularization, replication, packaging, and modulating pathogenicity [1]. We present a computational approach for automatic annotation of conserved RNA structural elements in FV UTRs based on covariance models (CMs).
Evolution of Flavivirus regulatory RNA elements
MichaelT.Wolfinger1,3*,AndreaTanzer1,RomanOchsenreiter1,IvoL.Hofacker1,2
1Department of Theoretical Chemistry, University of Vienna, Währingerstraße 17, 1090 Vienna, Austria
2Bioinformatics and Computational Biology Research Group, University of Vienna, Währingerstraße 17, 1090 Vienna, Austria
3Center for Anatomy and Cell Biology, Medical Unversity of Vienna, Währingerstraße 13, 1090 Vienna, Austria
[1] Villordo, S.M., Carballeda, J.M.,Filomatori, C.V., Garmarnik, A.V. (2016), RNAStructureDuplicationsandFlavivirusHostAdaptation. TrendsMicrobiol24(4),270-283.
[2] Nawrocki, E.P., Eddy S.R. (2013), Infernal1.1:100-foldfasterRNAhomologysearches.Bioinformatics,29:2933-2935.
[3] Lorenz, R., Bernhart, S.H., Höner zu Siederdissen, C., Tafer, H., Flamm, C., Stadler, P.F., Hofacker, I.L. (2011), ViennaRNAPackage2.0, AlgorithmsforMolecularBiology6:1, 26
[4] Nawrocki, E.P., et al. (2015), Rfam12.0:updatestotheRNAfamiliesdatabase, NucleicAcidsReserach43 (D1): D130-D137.
[5] RNAaliSplit: http://github/com/mtw/Bio-RNA-RNAaliSplit
[6] Rivas, E. Clements, J. Eddy, S.R. (2016), A statistical test for conserved RNA structure shows lack of evidence for structure in lncRNAs. Nature Methods 14, 45-48
Contact: michael.wolfinger@univie.ac.at - http://www.tbi.univie.ac.at/~mtw
Background and Motivation
Covariance models
Automated genotyping of viruses
Flavivirus evolution
Fig 4. Phylogenetic network of 95 different FV species. Neighbor
net computed from ClustalO multiple sequence alignment of
annotated protein coding regions.
0.1
POTV_3.3.8.1
SABV_1.7.9.1
JUGV_1.7.8.1
BANV_1.7.4.1
UGSV_1.7.10.1
BOUV_1.7.6.1
YOKV_3.1.2.1
SOKV_3.1.3.1
EPEV_3.1.4.1
YFV_1.7.1.1
WESSV_1.7.2.1
SEPV_1.7.3.1
EHV_1.7.7.1
DONV_1.8.4.1
CHAOV_1.8.2.1
IGUV_1.1.3.1
NMV_1.4.2.1
STRV_1.4.6.2
TORV_1.4.5.1
BAIV_1.4.4.1
KOKV_1.4.1.1
NJLV_1.1.4.1
BSQV_1.1.2.1
AROAV_1.1.1.1
ITV_1.5.10.4
NTAV_1.5.3.1
DTMUV_1.5.7.8
DEDSV_1.5.6.7
BYDV_1.5.9.1
TMUV_1.5.5.1
DFVTAV_1.5.11.1
SV_1.5.8.1
KEDV_1.2.5.1
APCV_1.3.8.1
KOUV_1.3.10.1
WNV_1.3.2.1
KUNV_1.3.4.43
WNV_1.3.2.2
YAOV_1.3.9.1
JEV_1.3.1.1
USUV_1.3.7.1
MVEV_1.3.6.1
ALFV_1.3.5.1
SLEV_1.3.3.1
ILHV_1.5.2.1
ROCV_1.5.1.1
BAGV_1.5.4.1
NOUV_1.8.1.2
DENV1_1.2.1.1
DENV3_1.2.3.1
DENV2_1.2.2.1
DENV4_1.2.4.1
SPOV_1.6.1.1
AEFV_4.1.3.1
CFAG_4.1.2.1
PaRV_4.1.4.1
HANV_4.1.6.1
PCV_4.1.11.1
QBV_4.1.7.1
MFV_4.1.8.1
CTFV_4.1.12.2
BCV_3.3.7.1
PPBV_3.3.5.1
RBV_3.3.6.1
MMLV_3.3.4.1
MODV_3.2.4.1
JUTV_3.2.3.1
CxFV_4.1.1.1
MECDV_4.1.5.1
TABV_3.4.1.1
TYUV_2.2.1.1
SREV_2.2.4.1
KAMV_2.2.3.1
MEAV_2.2.2.1
KADV_2.3.1.1
GGV_2.1.9.1
DTV_2.1.4.1
POWV_2.1.10.1
LGTV_2.1.1.1
SSEV_2.1.15.1
SGEV_2.1.14.1
NEGV_2.1.5.1
LIV_2.1.12.1
TBEV_2.1.11.1
GGEV_2.1.17.1
TSE_2.1.8.1
OHFV_2.1.7.1
KFDV_2.1.13.4
ALKV_2.1.2.1
KSIV_2.1.3.1
RFV_2.1.6.1
APOIV_3.2.1.1
KRV_4.1.9.1
YFVG
MBFVRVG
KOKVG
AROVG
NTAVG
JEVG
SPOVG
DENVG
MBFVRVG
ENTVG
STBVG
MTBVG
MODVG
RBG
ISFV
TABVG
MBFV
NKV
NKV
TBFV
Structured non-coding RNAs are evolutionary conserved. Their fun-
ction depends more on their secondary or tertiary structure than on
their primary sequence. Finding homologs of a set of structurally rela-
ted RNAs can be achieved with covariance models (CMs) [2], i.e.
statistical models of RNA structural alignments based on profile sto-
chastic context free grammars (SCFG). Contrary to Hidden Markov
models, paired positions in CMs depend on each other, thus allowing
the profile to model covariation in base pairs.
Covariation is observed both at inter- and intra-species levels in FV.
We built highly specific CMs for FV 5'UTR (SLA, SLB) and 3'UTR (SL,
DB, 3'SL) elements based on all FV genomes listed in NCBI. Our
data set includes CMs for virus groups, species and serotypes that fit
nicely into the concept of Rfam clans [4].
Our CMs allow for automated identification and characterization
of conserved RNA elements in viral genomes with high specificity. We
could e.g. show that ZIKV SL2 is homologous to DENVG SL1, and
DENV4 SL is a SL2 element, i.e. DENV4 has lost its SL1.
Construction of genotype-/serotype-specific CMs is facilitated by
RNAaliSplit [5], a novel approach for classification of RNA multiple se-
quence alignments that explicitly considers structural conservation.
Arthropod-borne flaviviruses (FVs), including pathogens such as Den-
gue (DENV), Zika (ZIKV), Yellow fever (YFV), Japanese encephalitis
virus (JEV) are a growing global health treat. FV are small (+)ssRNA
viruses of 10-12kb length with highly structured untranslated re-
gions (UTRs). The latter are associated with regulation of the viral life
cycle, inducing genome circularization, replication, packaging, and
modulating pathogenicity [1]. We present a computational approach
for automatic annotation of conserved RNA structural ele-
ments in FV UTRs based on covariance models (CMs).
Upon FV infection, accumulation of stable long non-coding viral RNAs,
termed subgenomic flaviviral RNAs (sfRNAs) is observed. sfRNAs
modulate cellular function and are linked to pathogenicity. They are
produced by stalling the 5'-3' host exoribonuclease Xrn1 at stable
structural elements in the 3’UTR, termed Xrn1-resistant RNA (xrRNA).
Mosquito-borne FV (MBFV) typically have more than one xrRNA ele-
ment, each having different capacity of stalling Xrn1, thus enabling
production of sfRNAs of different lengths. Stem-loop (SL) and
Dumbbell (DB) elements have been attributed xrRNA functionality in
MBFV.
Acknowledgements: This work was partly funded by the Austrian Science Fund FWF projects F43, FWF-I-1303 and FWF-I-1804-N28.
A
U
Y
C
U
G
Y
G
U
G
C
U
A
AU
Y
G
R
C
R
U
U
RGU
C
Y
G
Y
R
R
A
Y
G
AGYU
CUA
A
R
U
R
Y
A
A
Y
Y
G
U
C
A
G
C
C
C
A
G
R
A
Y
C
RGRGUYYUGCC
A
C
Y
G
C
U
A
AGCUG
U
G
A
G
G
C
R
G
U
G
C
R
G
G
C
U
G
C
A
G
C
C
C
A
G
A
A
A
C
C
C
G
C
GUGGGUUCUGCC
A
C
U
G
C
U
A
AGCUG
U
G
A
R
G
Y
A
G
U
G
C
A
G
G
C
U
G
SL1 SL2 SL1
SL1 SL2 SL1 SL2
X
C
R
C
G
G
C
C
C
A
R
C
C
Y
G
G
R
U
G
YACRGG
G
AAGG
ACU A GA
GGUUAG
A
G
G
A
G
A
C
C
C
C
G
Y
G
G
R
Y
R
C
G
G
C
C
C
A
A
C
Y
Y
Y
G
A
A
G
C
U
GUARR
RG
G
GAAGG
ACU A GA
GGUUAG
A
G
G
A
G
A
C
C
C
C
G
Y
R
Y
G
G
G
A
G
G
C
Y
R
C
A
A
C
C
R
U
G
G
A
A
G
C
U
G
UACGCAYGG
GUAGYRG
ACU A GY
GGUUAG
A
G
G
A
G
A
C
C
C
C
U
C
C
C
G
G
G
G
C
C
C
A
A
R
Y
R
G
R
G
A
A
G
C
U
GUAYYURY
G
AAGG
ACUAGA
GGUUAG
A
G
G
A
G
A
C
C
C
C
C
C
C
U
G
G
G
G
C
C
U
G
A
A
C
U
G
G
A
G
A
U
Y
A
G
C
U
G
UGRAUCUCCAG
AGAGG
G
ACUAG
U
GGUUAG
A
G
G
A
G
A
C
C
C
C
C
C
G
G
X
G
G
A
G
C
C
U
C
C
G
C
Y
C
C
Y
C
C
RCGYGGRG
A
AAG
A
YGGGG
UCUAG
A
GGUUAG
A
G
G
A
G
A
C
C
C
U
C
C
G
X
X
X
5'UTR SLA
3'UTR SL 3'UTR DB1 3'UTR DB2
R G
C
Y
C
R
G
C
R
Y
G
Y
U
U
Y
RG
C
A
G
Y
R
G
Y
RGC
Y
G
R
Y
Y
Y
R
Y
G
A
R
C
R
Y
GU
U
G
R
G
A
AAR5'
RU
U
Y
Y
C
U
G
Y
G
U
G
A
RC
U
R
R
C
U
Y
AGYA
U
G
U
U
R
A
GGAUYR
R
R
A
U
U
A
A
Y
R
C
A
GU
Y
R
A
RC5' U
G
U
U
R
U
U
U
G
A
U
C
A
G
A
C
U
G
C
G
A
C
AGU
UCGAGUUUGA AGC
GAR
A
G
C
U
A
R
C
A
A
C
A
GU
A
U
C
A
A
C
A
5'
Y
U
G
U
U
A
G
C
U
R
Y
G
U
G
R
RC
C
R
AAG
R
CAG
U
Y
C
G
GRAGYU
C
U
Y
A
A
C
R
U
A
GU
C
U
A
A
C
A
G
C
A
G
G
C
C
R
G
R
CYGCC
A
C
C
G
G
A
GYUGR
G
U
A
G
A
C
G
G
U
G
C
U
G
C
C
U
G
C
A
G
R
C
C
A
C
YGUGCY
A
C
U
C
YG
R
R
G
A
G
U
G
C
R
G
Y
C
U
G
C
A
G
G
C
CU
G
C
U
A
G
U
C
A
GC
C
A
C
A
GYU
U
G
G
G
GA
A
A
G
C
U
GU
G
C
A
G
C
C
U
G
C
A
G
G
C
C
G
A
G
AACG
C
CA
U
G
G
C
A
C
GGAAR
A
A
G
C
C
A
U
G
C
U
G
C
C
U
G
C
A
G
G
Y
C
R
A
UUAA
G
C
CA
Y
A
G
U
A
C
GGAR
R
A
R
C
U
R
U
G
C
U
R
C
C
U
G
C
A
G
G
C
C
AA
G
C
CA
Y
R
G
YU
U
G
AGY
A
A
A
C
Y
G
U
G
C
G
C
C
U
G
JEVG DENVG SPOVG YFVG TBVG
Fig 5. Regulatory elements in MBFV. Tick-borne FV have a 5'UTR SLA, but lack SL and DB elements. Consensus struc-
tures computed with RNAalifold [3]. Base pairs with significant covariation according to R-scape [6] are shown in green.
JEVG YFVG SPOVG DENVG NTAVG
Fig 3. Annotation of conserved RNA structural elements in 3' UTRs of selected mosquito-borne (MBFV) groups.
Homologous RNAs are color-coded (red: SL1, pink: SL2, cyan: DB1, blue: DB2, yellow: 3'SL). ZIKV SL2 is homolo-
gous to DENVG SL1, whereas ZIKV SL1 developed most likely from an independent ZIKV-specific duplication.
TBFV
MBFV
ISFV
NKV
6900 6391
239 170
53 3
27 12
7219 6576
total
genomes hits
5'3'
3'
5'3'
CDS
SL1 SL2 DB1 DB2 3'-SL
SLA SLB
A U
--
P3
P2
P1
C
A
5' 3'
C
RCS2
Fig 1. Schematic representation of FV genome organization (top right). Conserved
xrRNA elements SL and DB (left) are located in single or tandem within 3'UTRs and
efficiently stall host exonuclease Xrn1 (red pac-man). A pseudoknot interaction has
been reported for some SL and DB elements (orange, left).
((((((((...((((((((..............))))))))....))......((((......))))))))))
WNV.01 GCGCAGCCAUAACCUUGGUGA--AGGUGUUA--GCCAAGGAGAAGGGACUAGAGGUUAGCAGAGAUCCUGCGC 69
KUNV.02 ACGCGGCCCUAGCUCUGGCAA--UGGUGUUA--ACCAGAGUGAAAGGACUAGAGGUUAGAGGAGACCCCGCGU 69
APCV.03 CCGCGGCCCAACCAGUUCAGACU-GAUGCUA--UGAACUGGGUAAGGACUAGAGGUUAGAGGAGACCCCGCGG 70
JEV.04 CCACGGCCCAAGCUUCGUCUA-G-GAUGCAAUAGACGAGGUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.05 CCACGGCCCAAGUCUCGUCCA-G-GAUGCAAUGGACGAGAUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.06 CCACGGCCCAAACCUCAUCUA-G-GAUGCAAUAGAUGAGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
WNV.07 ACGCGGCCCAAAUCCUGGUGA-U-GGUGUUA-UGCCAGGGUGGAAGGACUAGAGGUUAGAGGAGACCCCGCGU 70
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.12 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.13 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.14 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
CCGCGG
C
C
C
A
AG
C
C
A
U
G
G
C
G
A
_
G
_GAUGC
G
A
_
A
G
C
C
A
U
G
G
UG
U
A
A
G
G
A
C
U
A
G
A
G
G
U
UA
G
A
G
G
A
G
A
C
C
C
C
G
C
G
G
U
G
C
G
G
C
g Co a a o a s uc u a a g e o e e e s J G u o s
Fig 2. Coraviation in a structural alignment of JEVG viruses (left). Paired positions show
a high amount of compensatory mutations. Consensus structure (right) computed with
RNAalifold [3].
ResearchGate has not been able to resolve any citations for this publication.
ResearchGate has not been able to resolve any references for this publication.