Access to this full-text is provided by Springer Nature.
Content available from BMC Immunology
This content is subject to copyright. Terms and conditions apply.
R E S E A R C H A R T I C L E Open Access
Lipopolysaccharide mediates immuno-
pathological alterations in young chicken
liver through TLR4 signaling
Xi-Yao Huang
1†
, Abdur Rahman Ansari
1,2†
, Hai-Bo Huang
1
, Xing Zhao
1
, Ning-Ya Li
1
, Zhi-Jian Sun
1
, Ke-Mei Peng
1
,
Juming Zhong
1,3
and Hua-Zhen Liu
1*
Abstract
Background: Lipopolysaccharide (LPS) induces acute liver injury and the complex mechanisms include the activation of
toll like receptor 4 (TLR4) signaling pathway in many species. However, immuno-pathological changes during TLR4
signaling under LPS stress in acute liver injury is poorly understood in avian species. The present investigation was
therefore carried out to evaluate these alterations in TLR4 signaling pathway during acute liver injury in young chickens.
Results: After intraperitoneal injection of LPS or saline, liver samples were harvested at 0, 2, 6, 12, 24, 36, 72 and 120 h
(n= 6 at each time point) and the microstructures were analyzed by hematoxylin and eosin (H&E) staining. Alanine
aminotransferase (ALT) and caspase-3 enzyme activity was assessed by enzyme-linked immunosorbent assay (ELISA).
Proliferative cell nuclear antigen (PCNA), single stranded DNA (ssDNA) and TLR4 protein expressions were determined by
immunohistochemistry. Gene expressions of PCNA, caspase-3, caspase-8, TLR4 and its downstream molecules were
analyzed by quantitative polymerase chain reaction (qPCR). LPS injection induced significantly higher ALT activity, severe
fatty degeneration, necrotic symptoms, ballooning degeneration, congestion, enhanced inflammatory cell infiltration in
liver sinusoids, decreased proliferation, increased apoptosis and significant up-regulation in TLR4 and its downstream
molecules (MyD88, NF-κB, TNF-α,IL-1βand TGF-β) expression at different time points.
Conclusions: This study indicated that TLR4 signaling and its downstream molecules along with certain cytokines play a
key role in acute liver injury in young chickens. Hence, our findings provided novel information about the histopathological,
proliferative and apoptotic alterations along with changes in ALT and caspase-3 activities associated with acute liver injury
induced by Salmonella LPS in avian species.
Keywords: Lipopolysaccharide, Chicken, Liver, Acute injury, Toll-like receptor 4
Background
The liver is regarded as both metabolic as well as im-
munological lymphoid organ [1, 2]. It harbors many
kinds of resident immune cells and has capability for the
production of immune related defense mediators as well
as regulatory molecules [3]. It is responsible for the syn-
thesis of cytokines, chemokines, complement compo-
nents and acute phase proteins that play essential role in
innate immunity [3]. It is located at hemodynamic
converging place in the body and conjoins the arterial
system with portal venous system causing mixing of oxy-
genated blood with portal venous blood. The liver sinu-
soids have several components of nutrients, lymphocytes
and myeloid cells together with many kinds of antigens
and other microbial products as derived from intestinal
bacteria [4, 5]. The liver is also under constant exposure
of environmental toxins, food antigens and bacterial
components [6]. Lipopolysaccharride (LPS) or endotoxin
is a major component of cell wall in Gram negative bac-
teria. Under normal physiological conditions, LPS is not
detectable in systemic blood circulation. However its de-
tectable amount (about 1.0 ng/ml) is usually present in
portal venous circulation [5]. LPS stimulation has been
* Correspondence: lhz219@mail.hzau.edu.cn
†
Equal contributors
1
Department of Basic Veterinary Medicine, College of Animal Science and
Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei 430070,
China
Full list of author information is available at the end of the article
© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Huang et al. BMC Immunology (2017) 18:12
DOI 10.1186/s12865-017-0199-7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
widely used in several experimental models [7–9] for the
understanding of mechanisms involved in endotoxin-
mediated acute liver tissue damage [7]. However, LPS-
induced immuno-pathological and micro-morphological
alterations in chicken liver are poorly understood yet.
Toll like receptors (TLRs) are considered as evolution-
ary conserved pattern recognition receptors (PPRs) that
act as critical mediators of host response to many patho-
genic organisms [10, 11]. PPRs identify the pathogen
associated molecular patterns (PAMPs) and the appro-
priate localization of TLRs in cells is considered to be
important for the accessibility of ligand and the under-
standing of downstream signal transduction molecules
[12]. Until now 13 functional TLRs have been reported
in mouse [13] and as many as 10 in both human [12]
and chicken [14]. Out of these, TLR4 plays an important
role after LPS stimulation and induces host defense
mechanism that leads to the activation of intracellular
signaling pathways and production of co-stimulatory
molecules and cytokines [9, 15]. TLR4 expression has
been reported in both parenchymal and non-parenchymal
liver cells in response to injury [16]. Parenchymal cells of
liver undergo apoptotic changes during liver injury [17].
Deregulation of transforming growth factor β(TGF-β)is
also associated with liver cancer and fibrotic liver disease.
Activation of TGF-βsignaling pathway leads to immune
suppression, arrest of cell cycle at G1/S phase and induc-
tion of apoptosis in mouse model [18]. But the informa-
tion about the changed expression of these cytokines in
chicken liver under endotoxin stress is still scarce. More-
over, proliferative and apoptotic changes during TLR4
signaling need further characterization at tissue level in
LPS-induced chicken liver. Therefore, the current study
was designed for the better understanding of micro-
morphological changes and molecular events involved in
TLR4 mediated hepatic injury following intrapertoneal
LPS stimulation in time series manner in young chickens.
Methods
Healthy one-day-old commercial Cobb strain (genetic-
ally Cobb 500) broiler chicks were purchased from
Zhengda chicken breeding company (Wuhan, China)
and chicks with uniform body weight were selected and
provided with commercial chick-starter feed and water
ad libitum along with supplementary heating without
any vaccinations [19]. All the birds were intraperitone-
ally (i.p.) injected at the same peritoneal location by lift-
ing the skin over mid-abdominal line, immediately
anterior to the pubic bones with LPS derived from
Salmonella enterica serovar Typhimurium (STm) (L7261;
Sigma-Aldrich, St. Louis, MO, USA) at 50 mg/kg of body
weight in 0.5 mL avian saline solution (0.75% NaCl) [19].
Birds in the control group were exposed to mock infection
with 0.5 mL avian saline solution only.
The chickens (n=6 at each time point) were eutha-
nized by CO
2
inhalation and sacrificed by dissecting the
abdominal cavity at 0, 2, 6, 12, 24, 36, 72 and 120 h.
After dissection, liver samples were immediately har-
vested from the birds for morphological and molecular
studies. A portion of liver samples were fixed in 4%
paraformaldehyde solution in PBS, dehydrated and then
embedded in paraffin wax for morphological analysis.
After that, 4-μm tissue sections were cut using a Leica
microtome (Nussloch Gmbh, Germany) and mounted
on polylysine-coated slides (Boster Corporation, China).
The rest of fresh liver samples were also frozen quickly
in liquid nitrogen and then stored at −70 °C for qPCR
and ELISA analysis.
H&E staining was performed by routinely used proto-
col. Stained tissue sections were examined by light mi-
croscopy (Olympus BX51, Tokyo, Japan) with a digital
camera (DP72; Olympus).
The tissue sections were immunostained by following
the same steps as described previously [19, 20]. In brief,
serial liver tissue sections were deparaffinized twice in
xylene and rehydrated in a graded series of ethanol. Heat
antigen retrieval was accomplished using a microwave
oven (MYA-2270 M, Haier, Qindao, China) and tissue
sections were microwaved in citrate acid buffer solution
(pH 6.0) for 20 min (5 min at high level i.e., 700 W and
15 min at low level i.e., 116 W). Following heat-induced
antigen retrieval, tissue section were allowed to cool
down at room temperature for 2–3 h. Endogenous per-
oxidase activity was quenched by treating tissue sections
with 3% H
2
O
2
for 10 min at room temperature. To
block non-specific antibody binding, the tissue sections
were then incubated with 5% bovine serum albumin
(BSA) at 37 °C for half an hour. Liver tissue sections
were then incubated with primary antibodies using
rabbit anti-TLR4 antibody (1:100) and PCNA (1:200)
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA).
Subsequently, tissue sections were incubated at 37 °C
with suitable horseradish peroxidase (HRP)-conjugated
secondary antibodies (Boster, Wuhan, China) for 30 min.
In situ detection of cell apoptosis was accomplished by
using a mouse IgM anti-ssDNA monoclonal antibody
(1:30; EMD Millipore, Billerica, USA), following same
steps as described above with the exception of treatment
of tissue sections with 0.1 mg/ml saponin and 20 μg/ml
proteinase K in PBS for 20 min at 37 °C, incubation in
50% (v/v) formamide in distilled water for 20 min at 56 °C.
These sections were then cooled in cold PBS for 5 min, in-
stead of heat induced antigen retrieve in a micro oven, and
employed anti-mouse IgM SABC kit (Boster, Wuhan,
China) instead of other secondary antibodies kit.
Immunostaining for all the tissue sections was accom-
plished using chromogenic marker, diaminobenzidine
(DAB) (Boster, Wuhan, China) and counterstaining was
Huang et al. BMC Immunology (2017) 18:12 Page 2 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
performed using hematoxylin. Finally, sections were
washed, dried, dehydrated, cleared, and mounted with a
coverslip. In the current study, isotype serum of primary
antibodies was used for both LPS stimulated and saline
treated (negative control) groups.
Serial sections were examined under a light microscope
(BH-2; Olympus, Japan) with a digital camera (DP72;
Olympus), and the fields of vision were chosen according
to different regions of the liver tissue in each section. The
distribution and expression level of different proteins were
measured in high-power fields selected at random. All of
the images were taken using the same microscope and
camera set. Image-Pro Plus (IPP) 6.0 software (Media Cy-
bernetics, USA) was used to calculate the integral optical
density (IOD) for positive staining (Additional file 1) and
the graphs were prepared by Prism software version 5.0
(GraphPad Software, Inc., San Diego, USA).
The expression level of alanine aminotransferase
(ALT) and caspase-3 activity of liver tissues were deter-
mined by following previously described modified ELISA
method [21].
The tissue homogenate for ALT activity assay was pre-
pared according to the manufacturer’s instructions.
Briefly, the samples of liver from the ultra-low
temperature freezer were weighed and homogenized
(0.1 g of tissue in 0.90 ml of 4 °C pre-cooled physio-
logical saline). The homogenate was centrifuged at
1000 × g for 10 min and then aliquots supernatants were
stored at −70 °C. The expression level of alanine amino-
transferase (ALT) of liver tissues was assessed using ALT
assay kit (C009-2, Nanjing Institute of Jiancheng, China).
Briefly, standards and supernatants obtained from the
processed liver tissues were pipetted into the wells. The
absorbencies were read at 492 nm wave length. For each
set of reference standards, samples and control, the aver-
age absorbance values (A
492
) were calculated with the
help of standard curve.
The cell lysate for casepase-3 activity assay was pre-
pared according to the manufacturer’s instructions.
Briefly, the 100 mg solid liver tissues were cut into small
pieces and then 100 μl lysate pre-cooled working fluid
was added in an ice bath and homogenized with a glass
homogenizer. Centrifugation was performed at 12,000 × g
for 10 min at 4 °C and then the supernatant (lysate con-
taining protein) was transferred to a new tube and placed
on ice until needed. The expression level of caspase-3 ac-
tivity in liver tissues was determined using caspase-3 activ-
ity assay kit (G007, Nanjing Institute of Jiancheng, China).
Briefly, cell lysate obtained from the processed liver tissues
and standard solutions from the kit were pipetted into the
wells according to the recommended experimental setting.
After 4 h incubation at 37 °C, the color changes were
obvious. The absorbencies were measured at 405 nm on
microplate reader. The final caspase-3 activity levels were
determined by comparing optical density (OD) values
from apoptosis inducer and negative control wells.
Total RNA was extracted from liver tissues according
to the manufacturer’s instructions. Then total RNA were
treated with RNase-free DNase I (Fermentas, Opelstrasse,
Germany) to remove contaminating genomic DNA. The
first strand cDNA was synthesized using the RevertAid
First Strand cDNA Synthesis Kit (Fermentas, Opelstrasse,
Germany). The reaction mixture (10 μl) for qPCR con-
tained of 5 μL SYBR Select Master Mix for CFX (Applied
Biosystems), 0.2 μL of each forward and reverse primer
and 1 μL of template cDNA. The qPCR reactions were
performed on a Bio-Rad CFX Connect real-time PCR de-
tection system (Bio-Rad, Hercules, CA, USA). The qPCR
conditions were as follows: pre-denaturation at 95 °C for
5 min, followed by 40 cycles of denaturation at 95 °C for
30 s, annealing at 60 °C for 30 s, and elongation at 72 °C
for 20 s. The primer sequences used in this experiments
are listed in Table 1. All samples were run in triplicate and
gene expression levels were quantified (Additional file 2)
using the ΔΔCt method [22].
Data were expressed as the mean ± standard deviation
(SD) and the statistical analyses were performed using
the GraphPad Prism version 5.0. The arithmetic mean
was calculated and any significant differences between
groups in the same tissue regions were analyzed using
the independent-samples ttest for group means (Fig. 2b,
Fig. 3b and Fig. 4b). The statistical significance in the
comparison of multiple sample sets versus control was
performed with Bonferroni’s multiple comparisons test
after one-way ANO VA test (Fig. 1b, Fig. 2c, Fig. 3c,
Table 1 Primers used for Real-time PCR
Gene Primer sequences (5′to3′) Accession no.
actin beta f-TTGTTGACAATGGCTCCGGT
r-TCTGGGCTTCATCACCAACG
NM_205518.1
TLR4 f-TGAAAGAGCTGGTGGAACCC
r-CCAGGACCGAGCAATGTCAA
NM_001030693.1
MyD88 f-AGGATGGTGGTCGTCATTTC
r-TTGGTGCAAGGATTGGTGTA
NM_001030962.2
NF-κB f-CTACTGATTGCTGCTGGAGTTG
r-CTGCTATGTGAAGAGGCGTTGT
M86930.1
TNF-αf-CAGATGGGAAGGGAATGAAC
r-CACACGACAGCCAAGTCAAC
AY765397.1
IL-1βf-ACCTACAAGCTAAGTGGGCG
r-ATACCTCCACCCCGACAAGG
NM_204524.1
TGF-βf-ATGTGTTCCGCTTTAACGTGTC
r-GCTGCTTTGCTATATGCTCATC
NM_205454.1
caspase-3 f- TCCACCGAGATACCGGACTG
r- ACAAAACTGCTTCGCTTGCT
NM_204725.1
caspase-8 f- CGGATCAATCGAATAGACCTTC
r- CGGCATTGTAGTTTCAGGACTT
NM_204592.2
PCNA f- TCTGAGGGCTTCGACACCTA
r- AACCTTTTCCTGATTTGGTGCTT
NM_204170.2
Huang et al. BMC Immunology (2017) 18:12 Page 3 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Fig. 4c and Fig. 5). Differences were considered signifi-
cant if P< 0.05. *P< 0.05, **P< 0.01 and ***P< 0.001.
Results
Acute liver injury after Salmonella lipopolysaccharide
stimulation
In comparison to saline group, histopathology of liver
showed prominent stellate macrophages (Kupffer cells)
in peri-sinusoidal areas, diffuse infiltration of fat vacu-
oles indicating fatty infiltration, dilation of both central
veins and sinusoidal capillaries and reduction in size of a
few hepatocytes at 6 h post LPS stimulation. Liver cells
were seen dissociated from each other in hepatic cords,
hepatic sinusoids were dilated at many places along with
fibrocyte proliferation in peri-sinusoidal areas and intra-
cytoplasmic infiltration of variable size and shape fat
vacuoles was seen at 12 h post LPS stimulation. Hepatic
sinusoids were dilated in many areas with severe vascu-
lar congestion, cytoplasmic fat vacuoles have pushed
hepatocyte nuclei at periphery at some places and reduc-
tion in size of a few hepatocytes was also seen at 24 h
post LPS stimulation. Obvious pathological changes
Fig. 1 Effect of lipopolysaccharide on histomorphology and ALT activity and in chicken liver. Following intraperitoneal LPS treatment in chickens
at different time points, H&E staining was performed on liver serial tissue sections. Stellate macrophages (Kupffer cells) in perisinusoidal areas ①,
diffuse infiltration of fat vacuoles indicating fatty infiltration ②, dilated central vein ③and sinusoidal capillaries ④, reduction in size of a few
hepatocytes ⑤, dissociated liver cells from each other in hepatic cords ⑥, dilated hepatic sinusoids along with fibrocytes proliferation in perisinusoidal
areas ⑦, intracytoplasmic infiltration of variable size and shape fat vacuoles ⑧, dilated hepatic sinusoids ⑨, infiltration of oval shaped nucleated RBCs
⑩, cytoplasmic fat vacuoles have pushed hepatocyte nuclei at periphery ⑪, reduction in size of a few hepatocytes ⑫and intense inflammatory cells
infiltration around the portal area ⑬(a). After LPS stimulation, alanine aminotransferase (ALT) activity was measured from liver tissues at 0 h, 2 h, 6 h, 12 h,
24 h, 36 h, 72 h and 120 h by ELISA technique (b). The letter C represents saline (control) group and L represents LPS group. The numbers represent the
hours after stimulation. **P<0.01
Fig. 2 Effect of LPS stimulation on hepatic cell proliferation in chicken liver. After intraperitoneal LPS injection in chicks at different time points,
PCNA protein expression was assessed in liver tissue by immunohistochemistry using anti-PCNA antibody, PCNA positive product was mainly
distributed around the portal and biliary epithelial cells and more concentrated expression was present on epithelial cell near portal area in saline
group at 6 h, 12 h, 24 h, and 72 h as compared to LPS group (a). Quantification of PCNA expression from liver tissue images was accomplished
by image-pro plus (IPP) computer software where IOD represents integrated optical density (b). The analysis of PCNA gene expression was performed
by real-time quantitative RT-PCR and normalized by the expression of actin beta (ACTB) (c). The letter C represents saline (control) group and L
represents LPS group. The numbers represent the hours after stimulation. *P< 0.05, **P<0.01
Huang et al. BMC Immunology (2017) 18:12 Page 4 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Fig. 3 Effect of LPS stimulation on hepatocyte apoptosis in chicken liver. Following intraperitoneal LPS injection in chicks at different time points,
single stranded DNA (ssDNA) protein expression was assessed in liver tissues by immunohistochemistry using anti-ssDNA antibody, ssDNA positive
product was extensively distributed in biliary epithelial cells and hepatic sinosoidal endothelial cells in LPS group at 6 h, 12 h, 24 h, and 72 h as
compared to PBS (saline) group (a). Quantification of ssDNA expression from liver tissue images was accomplished by image-pro plus (IPP) computer
software where IOD represents integrated optical density (b). The activity of caspase-3 enzyme was measured by ELIZA technique and the expressions
of caspase-3 and caspase-8 genes were also determined by quantitative RT-PCR and normalized by the expression of actin beta (ACTB) (c). The letter C
represents saline (control) group and L represents LPS group. The numbers represent the hours after stimulation. *P< 0.05, **P<0.01
Fig. 4 Effect of LPS stimulation on TLR4 expression in chicken liver. After intraperitoneal LPS injection in chicks at different time points, TLR4 protein
expression was assessed in liver tissue by immunohistochemistry using anti-TLR4 antibody, TLR4 positive product was mainly distributed on hepatocytes.
In LPS group, strong TLR4 expression was present at 6 h, 12 h, 24 h, and 72 h as compared to saline group (a). Quantification of TLR4 expression from liver
tissue images was accomplished by image-pro plus (IPP) computer software where IOD represents integrated optical density (b). The analysis of TLR4 gene
expression was performed by quantitative RT-PCR and normalized by the expression of actin beta (ACTB) (c). The letter C represents saline (control) group
and L represents LPS group. The numbers represent the hours after stimulation. *P<0.05,**P<0.01
Huang et al. BMC Immunology (2017) 18:12 Page 5 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
(inflammatory cell infiltration around the portal area)
were present at 72 h post LPS stimulation (Fig. 1a;
Additional file 3). Following LPS treatment, ALT activity
was significantly higher than that of control group. It
reached the peak at 12 h after LPS stimulation, and then
gradually returned to normal level (Fig. 1b).
PCNA expression was remarkably decreased after LPS
stimulation in chicken liver
In the control (saline) group, the PCNA positive
products showed brownish shades under microscope
and mainly distributed around the portal and biliary
epithelial cells and more concentrated expression was
present on epithelial cell near portal area (Fig. 2a).
PCNA expression was remarkably decreased after LPS
stimulation (P< 0.01) at 6 h, 12 h, 24 h, and 36 h as
compared to saline group (Fig. 2b). Consistent with
the results of PCNA by immunohistochemistry,
mRNA expression of PCNA following LPS stimulation
exhibited first decrease and then slightly returned to-
wards the normal level and showed significant differ-
ence at 6 h, 12 h, 24 h (P< 0.05) and 36 h (P< 0.01)
as compared to control group (Fig. 2c).
Effect of LPS stimulation on hepatocyte apoptosis
The single stranded DNA (ssDNA) positive products
showed brownish shades under microscope and mainly
distributed in the hepatocytes, biliary epithelial cells and
hepatic sinosoidal endothelial cells (Fig. 3a). IPP analysis
indicated that ssDNA expression changed after LPS
stimulation and showed significant up-regulation (P<
0.05 or P< 0.01) at 2 h, 6 h, 12 h and 36 h, while signifi-
cant down regulation (P< 0.05) at 24 h as compared to
control group (Fig. 3b). The activity of caspase-3 as mea-
sured by ELISA, was considerably enhanced at 2 h, 6 h
and 12 h (P< 0.01) in LPS stimulated group as compared
to control group. The levels of mRNA expression of
caspase-3 following LPS stimulation exhibited first in-
creased, then decreased and again a little increased
trends and showed significant increase at 2 h, 6 h (P<
0.01) and significant decrease at 12 h and 24 h (P< 0.05
or P< 0.01) as compared to control group. The statistical
analysis of mRNA expression of caspase-8 following LPS
stimulation exhibited similar events as of caspase-3 i.e.,
first increased, then slightly decreased and again a little
increased trends and showed significant increase at 2 h
(P< 0.01) and significant decrease at 12 h (P< 0.05) as
compared to control group (Fig. 3c).
Effect of LPS stimulation on TLR4 expression in chicken
liver
TLR4 protein expression in chicken liver tissue sections
was determined by immunoperoxidase–hematoxylin
staining. In TLR4-positive hepatocytes, the cytoplasm
and plasma membrane were stained light brown by DAB
and nucleus was stained blue with hematoxylin. In con-
trol group, the weak TLR4 expression was only present
in portal bile duct epithelial cells. After LPS stimulation
TLR4 expression was more concentrated and presented
in hepatocytes in the liver (Fig. 4a). IPP analysis showed
that TLR4 expression was remarkably increased after
LPS stimulation at 6 h, 72 h and 120 h (P<0.05 or
P< 0.01) ) while significantly decreased at 24 h and
36 h (P< 0.05) as compared to control group (Fig. 4b).
The statistics of mRNA expression of TLR4 following
LPS stimulation exhibited first increase, then decrease
and again increase trends and showed significant
increase at 6 h, 12 h and 120 h (P< 0.01) and signifi-
cant decrease at 24 h and 36 h (P< 0.05) as compared
to control group (Fig. 4c).
Fig. 5 Effect of LPS stimulation on downstream molecules of TLR4 signaling and cytokines in chicken liver. Following intraperitoneal LPS stimulation in
chicks at 0 h, 2 h, 6 h, 12 h, 24 h, 36 h, 72 h and 120 h, the expressions of MyD88, NF-κB, TNF-α,TGF-βand IL-1βgenes were determined by real-time
quantitative PCR (qRT-PCR) and normalized by the expression of actin beta (ACTB). The letter C represents saline (control) group and L represents LPS
group. The numbers represent the hours after stimulation. *P<0.05,**P< 0.01
Huang et al. BMC Immunology (2017) 18:12 Page 6 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Effect of LPS stimulation on downstream molecules of
TLR4 signaling pathway and cytokines in chicken liver
Following LPS stimulation in chickens, the statistics of
mRNA expression of MyD88 exhibited first drastic in-
crease, then considerable decrease and again slight in-
crease trends and showed very significant increase at 2 h
and 6 h (P< 0.01) and significant decrease at 36 h (P<
0.05) while NF-κB demonstrated increasing trends at all
the time points and showed significant difference at 2 h,
6 h and 12 h (P< 0.05 or P< 0.01) as compared to con-
trol group. The gene expressions of cytokines (TNF-α,
TGF-βand IL-1β) exhibited increasing trends at all the
time points after LPS stimulation illustrating significant
difference (P< 0.05 or P< 0.01) at several time points as
compared to saline group (Fig. 5).
Discussion
Alanine aminotransferase (ALT) is an important liver
enzyme and exists in cytosol of hepatocytes. ALT activity
has been reported about 3000 times in liver tissues than
that in serum. Increased level of ALT is present during
acute hepatocellular injury, therefore the direct measure-
ment of ALT activity is more efficient and accurate for
the damaged liver tissue [23]. Bacterial LPS is well
known and critical cofactor that is usually implicated in
liver injury [24]. In previous studies, LPS stimulation
was found to be linked with considerable increase in
serum ALT release in both mice [25] and chicken [26].
In the current investigation, we found significantly
higher ALT release in liver tissue after intraperitoneal
LPS stimulation that attained its peak at 12 h of treat-
ment in young chicken as compared to control group.
All these facts indicated that LPS could disrupt liver
function particularly at early stages of pathological
stimulation.
LPS administration has been found to disrupt liver
architecture and leads to significant alteration in histo-
logical organization along with fatty degenerations and
irregular and loose arrangement of hepatic cells in mice
[25]. In the present study, liver showed fatty degener-
ation, necrotic symptoms, ballooning degeneration, con-
gestion and enhanced inflammatory cell infiltration at
different time points of LPS treatment as compared to
saline injected control group in young chickens. In a previ-
ous study, LPS treatment exhibited considerable morpho-
logical changes such as necrosis, lymphocytic infiltration,
Kupffer cell hyperplasia and portal triaditis in murine ex-
perimental models [27]. Hence, it seems that LPS stimula-
tion may cause similar histo-pathological alteration in both
murine and chicken liver. However underlying molecular
mechanism needs further investigation.
In this study, both mRNA levels and cellular expres-
sion of proliferative cell nuclear antigen (PCNA) by
immunohistochemistry were remarkably decreased at
certain time points after LPS stimulation. In a prior re-
port, LPS stimulation also showed decreased expression
of PCNA in murine model with acute liver damage [28].
It is also reported that LPS treatment can trigger the ac-
tivation of apoptosis related genes and the activated
caspase-3 ultimately causes the cell apoptosis [29, 30].
Herein, we found significant up regulation in the expres-
sion of apoptosis related genes, caspase-3 and caspase-8
at different time points after LPS stimulation. Moreover,
single stranded DNA (ss-DNA) protein expressions by
immunohistochemistry were also decreased significantly
after LPS treatment in the current investigation. Previ-
ously hepatocyte apoptosis has been observed after
intravenous treatment of LPS in experimental shock
models and the activated caspase-3 in liver tissue corre-
sponds to apoptotic index in hepatocytes [31, 32].
Hence, it is concluded that decreased proliferation and
increased apoptosis are associated with LPS induced
acute liver injury in young chickens.
Complex mechanisms are involved in LPS induced
acute liver damage [33]. High expression of TLR4 and
down streaming molecules such as MyD88 play an es-
sential role in progression of LPS induced acute liver in-
jury and act as powerful mediator of inflammatory
process and innate immune activation [34–36]. Herein,
strong TLR4 expression was present on hepatocytes in
liver and both protein and mRNA expressions levels of
TLR4 were remarkably increased at certain time points
after LPS stimulation. Previously, liver mRNA of chicken
was sequenced for the determination of the entire
chTLRs (chicken TLRs) sequences [8]. The expression of
TLR4 has been reported in activated hepatic stellate cells
(HSCs) as well as on parenchymal and non-parenchymal
hepatic cells during acute liver damage [16]. In the
current study, mRNA expressions of MyD88 and NF-κB
are significantly increased at certain time points follow-
ing LPS stimulation in chicken liver. During TLR4 sig-
naling, both myeloid differentiation primary response
gene 88 (MyD88)-dependent and MyD88-independent
pathways are activated upon LPS stimulation in mam-
mals and MyD88-dependent pathway leads to produc-
tion of transcription factors such as nuclear factor
kappaB (NF-kB) along with expressions of tumor necro-
sis factor (TNF) and interleukin (IL) while MyD88-
independent pathway arbitrates the induction of type-I
interferones and interferon-inducible genes [37–39]. In
contrast, only MyD88-dependent signaling is involved in
response to TLR4-MD2 complex activation under LPS
stress in chicken [9]. Therefore, it is concluded that
LPS/TLR4-MyD88-dependent signaling along with its
downstream molecules is involved in acute liver injury
in young chickens.
Determination of cytokine expressions during bacterial
infection not only helps in the understanding of
Huang et al. BMC Immunology (2017) 18:12 Page 7 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
appropriate induction of immune response but also as-
sists in the devising innovative therapeutic strategies
[40]. In the present investigation, the statistical analysis
of mRNA expression of different inflammatory cytokines
such as TNF-α, IL-1βand TGF-βshowed significant in-
crease at different time points after LPS treatment in
young chicken liver. In a previous study, several inflam-
matory cytokines such as interleukin-1 (IL-1), tumor ne-
crosis factor-α(TNF-α) along with reactive oxygen
intermediates are produced by liver in response to LPS
exposure and play critical roles in its injury [24]. Hepatic
injury in response to LPS exposure is also caused by
TNF-αthat is secreted from Kupffer cells [31]. Taken to-
gether, it is concluded that LPS/TLR4 signaling along
with its downstream molecules and cytokines may play
key role in acute liver injury in avian species.
Conclusions
This study demonstrated that LPS is involved in acute
liver injury and significantly altered the liver’s structure
and function in young chickens. It was found that TLR4
signaling and its downstream molecules along with cer-
tain cytokines play a key role in hepatocyte apoptosis
during acute liver injury in young chickens. Hence, our
findings provided novel information about the histo-
pathological, proliferative and apoptotic alterations along
with changes in ALT and caspase-3 activities associated
with acute liver injury induced by Salmonella LPS in
avian species.
Additional files
Additional file 1: Integral optical density (IOD) values for TLR4, anti-ssDNA
& PCNA expression. (XLSX 13 kb)
Additional file 2: Relative values of genes for qPCR expression. (XLSX 20 kb)
Additional file 3: Images of Fig. 1a, at 6 h, 12 h, 24 h and 72 h post LPS
stimulation. (PDF 1713 kb)
Abbreviations
ALT: Alanine aminotransferase; BSA: Bovine serum albumin; CFU: Colony
forming unit; DAB: 3,3′-diaminobenzidine; ELIZA: Enzyme-linked immunosorbent
assay; G1: Growth 1 phase; H&E: Hematoxylin and Eosin; h: Hour/hours;
HRH: Horseradish peroxidase; IHC: Immunohistochemistry; IL: Interleukin;
IOD: Integrated optical density; IPP: Image-Pro-plus; LPS: Lipopolysaccharide;
MyD88: Myeloid differentiation primary response gene 88; NF-kB: Nuclear factor-
κB; PAMPs: Pathogen associated molecular patterns; PBS: Phosphate buffered
saline; PCNA: Proliferating cell nuclear antigen; PRRs: Pattern recognition receptors;
qRT-PCR: Quantitative real time polymerase chain reaction; S phase: DNA synthesis
phase; SABC: StreptAvidin-Biotin Complex; SD: Standard deviation; ssDNA: Single
stranded DNA; STm: Salmonella enterica serovar Typhimurium; TLRs: Toll like
receptors; TNF-α: Tumour necrosis factor-alpha
Acknowledgements
None.
Funding
This work was supported by the Fundamental Research Funds for the Central
Universities (2662016PY011, 2014PY046), grants from the National Natural
Science Foundation of China (30800808).
Availability of data and materials
The raw data that is summarized in graphs and supported the conclusion in
this study has been provided as Additional files.
Authors’contributions
HZL and KMP and JMZ planned and conceived the experiments. XYH, ARA,
HBH, NYL and ZJS performed the experiments and carried out other laboratory
works. HZL, XYH and ARA analyzed data, designed the figures and wrote the
manuscript. HZL, JMZ and KMP performed the proof reading. XYH and ARA
have contributed equally as first-coauthors. All the authors read and approved
the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
Not applicable.
Ethics approval
All the animal procedures were conducted according to protocols approved
by the Animal Care and Use Committee for Biological Studies, Hubei Province,
PR China.
Author details
1
Department of Basic Veterinary Medicine, College of Animal Science and
Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei 430070,
China.
2
Section of Anatomy and Histology, Department of Basic Sciences,
College of Veterinary and Animal Sciences (CVAS) Jhang, University of
Veterinary and Animal Sciences (UVAS), Lahore, Pakistan.
3
Department of
Anatomy, Physiology and Pharmacology, College of Veterinary Medicine,
Auburn University, Auburn, USA.
Received: 10 September 2016 Accepted: 17 February 2017
References
1. Nemeth E, Baird AW, O’Farrelly C. Microanatomy of the liver immune
system. Semin Immunopathol. 2009;31(3):333–43.
2. Knolle PA, Wohlleber D. Immunological functions of liver sinusoidal endothelial
cells. Cell Mol Immunol. 2016;13(3):347–53.
3. Robinson MW, Harmon C, O’Farrelly C. Liver immunology and its role in
inflammation and homeostasis. Cell Mol Immunol. 2016;13(3):267–76.
4. Racanelli V, Rehermann B. The liver as an immunological organ. Hepatology.
2006;43 Suppl 1:S54–62.
5. Crispe IN. The liver as a lymphoid organ. Annu Rev Immunol. 2009;27:147–63.
6. Gao B. Basic liver immunology. Cell Mol Immunol. 2016;13(3):265–6.
7. Masaki T, Chiba S, Tatsukawa H, Yasuda T, Noguchi H, Seike M, Yoshimatsu
H. Adiponectin protects LPS-induced liver injury through modulation of
TNF-αin KK-Ay obese mice. Hepatology. 2004;40(1):177–84.
8. Fukui A, Inoue N, Matsumoto M, Nomura M, Yamada K, Matsuda Y, Toyoshima
K, Seya T. Molecular cloning and functional characterization of chicken toll-like
receptors: a single chicken toll covers multiple molecular patterns. J Biol Chem.
2001;276(50):47143–9.
9. Keestra AM, van Putten JPM. Unique properties of the chicken TLR4/MD-2
complex: selective lipopolysaccharide activation of the MyD88-dependent
pathway. J Immunol. 2008;181(6):4354–62.
10. Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate
and acquired immunity. Nat Immunol. 2001;2(8):675–80.
11. Medzhitov R. Toll-like receptors and innate immunity. Nat Rev Immunol.
2001;1(2):135–45.
12. Kawai T, Akira S. The role of pattern-recognition receptors in innate
immunity: update on Toll-like receptors. Nat Immunol. 2010;11(5):373–84.
13. Reuven EM, Fink A, Shai Y. Regulation of innate immune responses by
transmembrane interactions: lessons from the TLR family. Biochim Biophys
Acta. 2014;1838(6):1586–93.
14. Kannaki T, Reddy M, Verma P, Shanmugam M. Differential Toll-Like receptor
(TLR) mRNA expression patterns during chicken embryological development.
Anim Biotechnol. 2015;26(2):130–5.
15. Karnati HK, Pasupuleti SR, Kandi R, Undi RB, Sahu I, Kannaki T, Subbiah M,
Gutti RK. TLR-4 signalling pathway. MyD88 independent pathway up-regulation
in chicken breeds upon LPS treatment. Vet Res Commun. 2010;39(1):73–8.
Huang et al. BMC Immunology (2017) 18:12 Page 8 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
16. Guo J, Friedman SL. Toll-like receptor 4 signaling in liver injury and hepatic
fibrogenesis. Fibrogenesis Tissue Repair. 2010;3:21.
17. Schuppan D, Kim YO. Evolving therapies for liver fibrosis. J Clin Invest. 2013;
123(5):1887–901.
18. Muñoz NM, Katz LH, Shina J-H, Gi YJ, Menon VK, Gagea M, Rashid A, Chen J,
Mishra L. Generation of a mouse model of T-cell lymphoma based on
chronic LPS challenge and TGF-βsignaling disruption. Genes Cancer. 2014;
5(9–10):348–52.
19. Ansari AR, Ge X-H, Huang H-B, Huang X-Y, Zhao X, Peng K-M, Zhong J-M,
Liu H-Z. Effects of lipopolysacharide on the histomorphology and expression
of toll like receptor 4 in the chicken trachea and lung. Avian Pathol. 2016;45(5):
530–7.
20. Ansari AR, Ge X-H, Huang H-B, Wang J-X, Peng K-M, Yu M, Liu H-Z. Expression
patterns of Toll-Like receptor 4 in pig uterus during pregnancy. Pak Vet J. 2015;
35(4):466–9.
21. Ehrnhoefer DE, Skotte NH, Savill J, Nguyen YTN, Ladha S, Cao L-P, Dullaghan
E, Hayden MR. A quantitative method for the specific assessment of caspase-6
activity in cell culture. PLoS One. 2011;6:e27680.
22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25(4):
402–8.
23. Kim W, Flamm SL, Di Bisceglie AM, Bodenheimer HC. Serum activity of alanine
aminotransferase (ALT) as an indicator of health and disease. Hepatology. 2008;
47(4):1363–70.
24. Su GL. Lipopolysaccharides in liver injury: molecular mechanisms of Kupffer
cell activation. Am J Physiol Gastrointest Liver Physiol. 2002;283(2):G256–65.
25. Gao L-N, Yan K, Cui Y-L, Fan G-W, Wang Y-F. Protective effect of Salvia
miltiorrhiza and Carthamus tinctorius extract against lipopolysaccharide-
induced liver injury. World J Gastroenterol. 2015;21(30):9079–92.
26. GUO F-x, LIU T-f, GENG Z-x, JIANG F, YU Z-g. Immunoregulatory effects of
compound ammonium glycyrrhizin soluble powder on liver injury induced
by enrofloxacin and LPS in chickens. Sci Agric Sin. 2013. http://en.cnki.com.
cn/Article_en/CJFDTOTAL-ZNYK201312020.htm. Accessed 15 May 2016.
27. Bharrhan S, Chopra K, Rishi P. Vitamin E supplementation modulates endotoxin-
induced liver damage in a rat model. Am J Biomed Sci. 2010;2(1):51–62.
28. Cai Y, Zou Z, Liu L, Chen S, Chen Y, Lin Z, Shi K, Xu L, Chen Y. Bone marrow-
derived mesenchymal stem cells inhibits hepatocyte apoptosis after acute liver
injury. Int J Clin Exp Pathol. 2015;8(1):107–16.
29. Xiao K, Zou W-H, Yang Z, ur Rehman Z, Ansari AR, Yuan H-R, Zhou Y, Cui L,
Peng K-M, Song H. The role of visfatin on the regulation of inflammation
and apoptosis in the spleen of LPS-treated rats. Cell Tissue Res. 2015;359(2):
605–18.
30. Hongmei Z. Extrinsic and intrinsic apoptosis signal pathway review.
Apoptosis and Medicine, InTech. 2012. http://www.intechopen.com/books/
apoptosis-and-medicine/extrinsic-and-intrinsic-apoptosis-signal-pathway-
review. Accessed 09 Sept 2016.
31. Hamada E, Nishida T, Uchiyama Y, Nakamura J-i, Isahara K, Kazuo H, Huang
T-P, Momoi T, Ito T, Matsuda H. Activation of Kupffer cells and caspase-3
involved in rat hepatocyte apoptosis induced by endotoxin. J Hepatol.
1999;30:807–18.
32. Wang JH, Redmond HP, Watson R, Bouchier-Hayes D. Role of lipopolysaccharide
and tumor necrosis factor-alpha in induction of hepatocyte necrosis. Am J Physiol.
1995;269(2):G297–304.
33. Yao H, Hu C, Yin L, Tao X, Xu L, Qi Y, Han X, Xu Y, Zhao Y, Wang C. Dioscin
reduces lipopolysaccharide-induced inflammatory liver injury via regulating
TLR4/MyD88 signal pathway. Int Immunopharmacol. 2016;36:132–41.
34. Zhao Y, Liu Q, Yang L, He D, Wang L, Tian J, Li Y, Zi F, Bao H, Yang Y. TLR4
inactivation protects from graft-versus-host disease after allogeneic
hematopoietic stem cell transplantation. Cell Mol Immunol. 2013;10(2):165–75.
35. Wang Y, Tu Q, Yan W, Xiao D, Zeng Z, Ouyang Y, Huang L, Cai J, Zeng X,
Chen Y-J. CXC195 suppresses proliferation and inflammatory response in
LPS-induced human hepatocellular carcinoma cells via regulating TLR4-
MyD88-TAK1-mediated NF-κB and MAPK pathway. Biochem Biophys Res
Commun. 2015;456(1):373–9.
36. Imamura M, Tsutsui H, Yasuda K, Uchiyama R, Yumikura-Futatsugi S, Mitani
K, Hayashi S, Akira S, Taniguchi S-i, Van Rooijen N. Contribution of TIR
domain-containing adapter inducing IFN-β-mediated IL-18 release to LPS-
induced liver injury in mice. J Hepatol. 2009;51(2):333–41.
37. Lu Y-C, Yeh W-C, Ohashi PS. LPS/TLR4 signal transduction pathway. Cytokine.
2008;42(2):145–51.
38. Janeway Jr CA, Medzhitov R. Innate immune recognition. Annu Rev Immunol.
2002;20:197–216.
39. Kawai T, Kawasaki T. Toll-like receptor signaling pathways. Front Immunol.
2014;5:461.
40. Im YB, Jung M, Shin M-K, Kim S, Yoo HS. Expression of cytokine and apoptosis-
related genes in bovine peripheral blood mononuclear cells stimulated with
Brucella abortus recombinant proteins. Vet Res. 2016;47:30.
• We accept pre-submission inquiries
• Our selector tool helps you to find the most relevant journal
• We provide round the clock customer support
• Convenient online submission
• Thorough peer review
• Inclusion in PubMed and all major indexing services
• Maximum visibility for your research
Submit your manuscript at
www.biomedcentral.com/submit
Submit your next manuscript to BioMed Central
and we will help you at every step:
Huang et al. BMC Immunology (2017) 18:12 Page 9 of 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
Available via license: CC BY 4.0
Content may be subject to copyright.
