ArticlePDF Available

Autologous Tenocyte Injection for the Treatment of Chronic Recalcitrant Gluteal Tendinopathy: A Prospective Pilot Study

Authors:

Abstract and Figures

Background: Gluteal tendinopathy is a common cause of lateral hip pain, and existing conservative treatment modalities demonstrate high symptom recurrence rates. Autologous tenocyte injection (ATI) is a promising cell therapy that may be useful for the treatment of gluteal tendinopathy. Purpose: To investigate the safety and effectiveness of ATI, specifically in patients with chronic recalcitrant gluteal tendinopathy. Study design: Case series; Level of evidence, 4. Methods: Twelve female patients with a clinical and radiological diagnosis of gluteal tendinopathy were recruited. Patients demonstrated a mean duration of symptoms of 33 months (range, 6-144 months), had undergone a mean 3.2 prior corticosteroid injections (range, 2-5), and had failed to respond to existing conservative treatments including physiotherapy and injections. In an initial procedure, tendon cells were harvested from a needle biopsy of the patella tendon and propagated in a certified Good Manufacturing Practice (GMP) laboratory. In a secondary procedure, a single injection of 2 mL autologous tenocytes (2-5 × 10(6) cells/mL) suspended in patient serum was injected into the site of the pathological gluteal tendons under ultrasound guidance. Patients were assessed pre- and postinjection (3, 6, 12, and 24 months) using the Oxford Hip Score (OHS), a visual analog pain scale (VAS), the Short Form-36 (SF-36), and a satisfaction scale. Magnetic resonance imaging (MRI) was undertaken at 8.7 months (range, 6-12 months) postinjection. Results: Molecular characterization of autologous tendon cells showed a profile of growth factor production in all cases, including platelet-derived growth factor α, fibroblast growth factor β, and transforming growth factor β. The OHS (mean, 24.0 preinjection to 38.9 at 12 months [14.9-point improvement]; 95% CI, 10.6-19.2; P < .001), VAS (mean, 7.2 preinjection to 3.1 at 12 months [4.1-point improvement]; 95% CI, 2.6-5.6; P < .001), and SF-36 (mean, 28.1 preinjection to 43.3 at 12 months [15.2-point improvement]; 95% CI, 9.8-20.5; P < .001) significantly improved to 12 months postinjection, sustained to 24 months. Eight patients were satisfied with their outcomes. Significant MRI-based improvement could not be demonstrated in the majority of cases. Conclusion: ATI for gluteal tendinopathy is safe, with improved and sustained clinical outcomes to 24 months.
Content may be subject to copyright.
Original Research
Autologous Tenocyte Injection for the
Treatment of Chronic Recalcitrant
Gluteal Tendinopathy
A Prospective Pilot Study
Thomas A. Bucher,*
MBBS, FRCS(Tr &Orth), MSc, Jay R. Ebert,
‡§
PhD, Anne Smith,
||
PhD,
William Breidahl,
{
MBBS, FRANZCR, Michael Fallon,
{
MBBS, FRANZCR, Tao Wang,
#
PhD,
Ming-Hao Zheng,
#
DM, PhD, FRCPath, and Gregory C. Janes,
MBBS, FRACS
Investigation performed at the University of Western Australia, Perth, Western Australia, Australia
Background: Gluteal tendinopathy is a common cause of lateral hip pain, and existing conservative treatment modalities dem-
onstrate high symptom recurrence rates. Autologous tenocyte injection (ATI) is a promising cell therapy that may be useful for the
treatment of gluteal tendinopathy.
Purpose: To investigate the safety and effectiveness of ATI, specifically in patients with chronic recalcitrant gluteal tendinopathy.
Study Design: Case series; Level of evidence, 4.
Methods: Twelve female patients with a clinical and radiological diagnosis of gluteal tendinopathy were recruited. Patients
demonstrated a mean duration of symptoms of 33 months (range, 6-144 months), had undergone a mean 3.2 prior corticosteroid
injections (range, 2-5), and had failed to respond to existing conservative treatments including physiotherapy and injections. In an
initial procedure, tendon cells were harvested from a needle biopsy of the patella tendon and propagated in a certified Good
Manufacturing Practice (GMP) laboratory. In a secondary procedure, a single injection of 2 mL autologous tenocytes (2-5 10
6
cells/mL) suspended in patient serum was injected into the site of the pathological gluteal tendons under ultrasound guidance.
Patients were assessed pre- and postinjection (3, 6, 12, and 24 months) using the Oxford Hip Score (OHS), a visual analog pain
scale (VAS), the Short Form–36 (SF-36), and a satisfaction scale. Magnetic resonance imaging (MRI) was undertaken at 8.7 months
(range, 6-12 months) postinjection.
Results: Molecular characterization of autologous tendon cells showed a profile of growth factor production in all cases, including
platelet-derived growth factor a, fibroblast growth factor b, and transforming growth factor b. The OHS (mean, 24.0 preinjection to
38.9 at 12 months [14.9-point improvement]; 95% CI, 10.6-19.2; P< .001), VAS (mean, 7.2 preinjection to 3.1 at 12 months
[4.1-point improvement]; 95% CI, 2.6-5.6; P< .001), and SF-36 (mean, 28.1 preinjection to 43.3 at 12 months [15.2-point
improvement]; 95% CI, 9.8-20.5; P< .001) significantly improved to 12 months postinjection, sustained to 24 months. Eight
patients were satisfied with their outcomes. Significant MRI-based improvement could not be demonstrated in the majority of cases.
Conclusion: ATI for gluteal tendinopathy is safe, with improved and sustained clinical outcomes to 24 months.
Keywords: autologous tenocyte implantation; gluteal tendinopathy; greater trochanteric pain syndrome; cellular therapy; clinical
outcomes
Greater trochanteric pain syndrome (GTPS) is a term used
to define the clinical condition of greater and peritrochan-
teric hip pain and tenderness,
12-14,17,23,28
affecting 10%to
25%of the general population.
18,23,28
While previously
reported as trochanteric bursitis, gluteus medius and/or
minimus tendinopathy is now accepted as the most preva-
lent pathology in those with pain and tenderness over the
greater trochanter.
11
Histological changes in tendinopathy
include decreased and disorganized collagen production,
deposition of adipose tissue, vascular hyperplasia charac-
terized by an absence of polymorphonucleocytes, variation
in cell populations, and disruption of the extracellular
matrix.
29
Apoptosis and autophagic tendon cell death
occurs in more severe cases,
3
and increased cell death rates
in chronic lateral epicondylitis and rotator cuff tendinopa-
thy indicate that the healing process is suppressed by a
lack of cellular components.
24
The depleted cell population
and reduced collagen synthesis accelerate collagen
The Orthopaedic Journal of Sports Medicine, 5(2), 2325967116688866
DOI: 10.1177/2325967116688866
ªThe Author(s) 2017
1
This open-access article is published and distributed under the Creative Commons Attribution - NonCommercial - No Derivatives License (http://creativecommons.org/
licenses/by-nc-nd/3.0/), which permits the noncommercial use, distribution, and reproduction of the article in any medium, provided the original author and source are
credited. You may not alter, transform, or build upon this article without the permission of the Author(s). For reprints and permission queries, please visit SAGE’s website at
http://www.sagepub.com/journalsPermissions.nav.
deterioration, compromising the ability of the tendon to
maintain structural integrity.
29
Conservative treatments for gluteal tendinopathy may
include rest, anti-inflammatory medication, ice and/or
heat, physical therapy, shock wave therapy, ultrasound,
and local corticosteroid injections.
8,15,22,28
However, a high
symptom recurrence rate at 1 year has been demonstrated
for all conservative treatment modalities in primary care,
18
and patients frequently undergo multiple courses of non-
operative treatment with only temporary pain relief.
19
Autologous tenocyte injection (ATI) is a novel cell therapy
that has shown restoration of functional tendon cells in
animal studies.
4,5
Clinical and radiological improvement
was documented in a single case report employing ATI for
rotator cuff tendinopathy,
26
while significant clinical and
radiological improvement was reported in a pilot study
investigating ATI for chronic lateral epicondylitis,
24,25
demonstrating a sustained reduction in pain and improve-
ment in function to 4.5 years postinjection in patients
who had failed nonoperative treatment.
24,25
The aim of
this pilot study was to investigate whether ATI is safe and
effective in more troublesome patients with clinical and
radiological diagnoses of gluteal tendinopathy who had
failed to respond to other nonsurgical treatments. We
hypothesized (1) that ATI is safe and well tolerated by
patients and (2) that patients will demonstrate a significant
clinical improvement sustained to 24 months postinjection.
METHODS
Participants
The first 12 patients (all female) that fit the below inclu-
sion/exclusion criteria were offered ATI as part of this pilot
trial, all recruited from a single orthopaedic surgeon’s
(G.C.J.) practice, with none refusing treatment. All
patients had symptomatic gluteal tendinopathy and had
previously undergone unsuccessful attempts at nonopera-
tive measures, including image-guided steroid injections
into the greater trochanteric bursa (n ¼12; mean, 3.2 injec-
tions; range, 2-5), platelet-rich plasma (PRP) (n ¼4), and
physiotherapy (n ¼12). After failure of other nonoperative
measures, patients were clinically assessed by a consultant
orthopaedic surgeon and underwent magnetic resonance
imaging (MRI) to confirm the diagnosis of gluteal tendino-
pathy as well as ensure the absence of a high-grade partial-
or full-thickness gluteal tendon tear. Patients were
excluded if they had undergone previous hip and/or gluteal
repair surgery, had hip osteoarthritis, and/or received ste-
roid injections within the preceding 3 months. The mean
age of patients was 52.6 years (range, 41-67 years), with an
average duration of symptoms of 33 months (range, 6-144
months) (Table 1). Prior to treatment, all patients were
counseled regarding the procedure(s), possible risks, and
postinjection recovery before consenting to ATI and com-
pleting study documentation. Ethical approval was
obtained, and all study procedures were undertaken
according to the Declaration of Helsinki 1975.
Patella Tendon Biopsy
Under sterile conditions, the patella tendon was marked,
and a suitable area was infiltrated with local anesthetic.
Under ultrasound, a 14-gauge Tru-Cut needle was placed
in the patella tendon, and 2 biopsy specimens were taken.
Tendon tissue was placed in transport medium (DMEM F12
with 20%fetal bovine serum). As part of the Code of Good
Manufacturing Practice (GMP) for human blood and tissues
(2000) protocol, a 60-mL sample of venous blood was taken
for infection and viral screening, including: human immuno-
deficiency virus, hepatitis B and C, human T-lymphotropic
virus, and syphilis. Patients were allowed immediate full
weightbearing after the patella tendon biopsy but were
advised to limit strenuous activities for 48 hours. The same
consultant radiologist performed all procedures.
Cultivation of Autologous Tenocytes
Tenocyte cultivation was performed at Orthocell Ltd. The
tendon tissue was digested enzymatically to extract the
tenocytes. These cells were expanded by in vitro culture
in a certified Therapeutic Goods Administration (TGA)
licensed facility. Tenocytes used for implantation were
characterized by quantitative real-time polymerase chain
reaction (PCR). It has previously been reported that this
technique maintains the tenocyte phenotype.
4,5
Quantitative Real-Time PCR
Previously, we have analyzed the profile of tendon-derived
cells and identified that they contain progenitor cells that
differ from bone marrow mesenchymal stem cells and fibro-
blasts.
26
To further examine whether these tendon progen-
itor cells have the capacity of producing anabolic growth
§
Address correspondence to Jay R. Ebert, PhD, School of Human Sciences, University of Western Australia, 35 Stirling Highway, Crawley, 6009, Western
Australia, Australia (email: jay.ebert@uwa.edu.au).
*Fremantle Hospital, Fremantle, Western Australia, Australia.
Perth Orthopaedic and Sports Medicine Centre, West Perth, Western Australia, Australia.
School of Human Sciences, University of Western Australia, Crawley, Perth, Western Australia, Australia.
||
The School of Physiotherapy and Curtin Health Innovation Research Institute, Curtin University, Bentley, Perth, Western Australia, Australia.
{
Perth Radiological Clinic, Subiaco, Perth, Western Australia, Australia.
#
School of Surgery (Orthopaedics), University of Western Australia, Crawley, Perth, Western Australia, Australia.
One or more of the authors has declared the following potential conflict of interest or source of funding: Orthocell supplied the autologous tenocyte
injection used in this trial. J.R.E. and M.H.Z. were reimbursed costs associated with attending a symposium from Orthocell. M.H.Z. and G.C.J. hold stock in
Orthocell.
Ethical approval for this study was obtained from the Hollywood Private Hospital Ethics Committee (HPH374), and the study was registered with the
Australia and New Zealand Clinical Trials Registry (ACTN12612000383864).
2Bucher et al The Orthopaedic Journal of Sports Medicine
factors that may induce matrix synthesis and cell prolifer-
ation after injection, we have examined the growth factor
profiles of these cells, including platelet-derived growth fac-
tor a(PDGFa), fibroblast growth factor b(FGFb), trans-
forming growth factor b(TGFb), bone morphogenetic
protein 2 (BMP-2), BMP-7, insulin-like growth factor 1
(IGF-1), and PDGFb. A portion of the cells from each
patient was harvested at the time of implant for cellular
characterization analysis using real-time PCR.
The total RNA was extracted from the cultured tendon-
derived cells from patients using the PureLink RNA Mini
Kit (Invitrogen; Life Technologies) according to the manu-
facturer’s instructions. The RNA from dermal fibroblast and
synovial fibroblasts was used as a control. Single-stranded
cDNA was synthesized from 1 mgofRNAusing200UofM-
MLV reverse transcriptase, 20 U of RNasin ribonuclease
inhibitor, 0.5 mM of deoxynucleotide triphosphate, and
0.5 mg of oligo-dT 15 primer (a short sequence of deoxy-
thymine nucleotides) in a total volume of 20 mL for each
sample (Promega). To determine the gene expression profile
of the tendon-derived cells from patients, relative quantita-
tive real-time PCR was performed on a Bio-Rad MyiQ real-
time PCR system (Bio-Rad Laboratories Pty Ltd). The total
volume of each PCR reaction was 25 mL, containing 12.5 mL
SensiMix (Bioline), 0.25 mL of probe (100 nM) (Roche
Diagnostics), 6.25 mL of double-distilled water, 5 mLof
cDNA, and 0.5 mL of each primer (400 nM). These are listed
in Table 2. Real-time PCR was carried out at 95Cfor
15 minutes, 40 cycles at 95C for 15 seconds, 60Cfor
60 seconds, and 72C for 15 seconds. Housekeeping GAPDH
(glyceraldehyde 3-phosphate dehydrogenase) was included
as an internal control. A cycle threshold value was obtained
for each sample, and the comparative 2-delta-delta-CT
method was used to calculate the relative expression level
of each target gene, as previously described.
Autologous Tenocyte Injection (ATI)
In a second-stage procedure, approximately 4 weeks after
the initial tendon biopsy, patients underwent a single
tenocyte injection. The patient was placed in the lateral
decubitus position, and the skin was prepared with a suit-
able antiseptic solution. Under ultrasound, 2 mL of autolo-
gous tenocytes (2-5 10
6
cells/mL) suspended with 10%
autologous human serum were injected into the tendino-
pathic area using a 22-gauge needle. The same consultant
radiologist again performed all procedures. The patient was
advised to rest for 48 hours postinjection but could mobilize
as tolerated.
Clinical Assessment
All patients were independently assessed preinjection and
at 3, 6, 12, and 24 months postinjection. The primary out-
come measure was the Oxford Hip Score (OHS), and a
TABLE 1
Patient Demographics and the Oxford Hip Score (OHS) at Baseline (Preinjection) and 12 Months Postinjection
a
Patient Side Age at Treatment, y Duration of Symptoms, mo OHS (Preinjection) OHS (12 mo) OHS Change Satisfaction
1 L 62 144 19 25 6 Not sure
2 L 48 12 20 27 7 Quite dissatisfied
3 L 41 18 24 32 8 Dissatisfied
4 L 58 24 32 41 9 Quite satisfied
5 L 43 60 35 45 10 Quite satisfied
6 R 54 9 32 46 14 Highly satisfied
7 L 65 18 14 31 17 Not sure
8 L 53 11 21 38 17 Satisfied
9 L 43 48 30 48 18 Highly satisfied
10 L 65 6 28 48 20 Highly satisfied
11 R 50 24 14 37 23 Highly satisfied
12 L 49 24 19 47 28 Highly satisfied
Mean N/A 52.6 33.2 24.0 38.9 14.9 N/A
a
L, left; N/A, not applicable; R, right.
TABLE 2
Growth Factor Primer Sequences
a
Target Gene Primer Sequence
BMP-2 Forward CGGACTGCGGTCTCCTAA
Reverse GGAAGCAGCAACGCTAGAAG
BMP-7 Forward TCCAAGACGCCCAAGAAC
Reverse ACAGCTCGTGCTTCTTACAGG
PDGFbForward CTGGCATGCAAGTGTGAGAC
Reverse CGAATGGTCACCCGAGTTT
PDGFaForward GCAGTCAGATCCACAGCATC
Reverse TCCAAAGAATCCTCACTCCCTA
IGF-1 Forward TGTGGAGACAGGGGCTTTTA
Reverse ATCCACGATGCCTGTCTGA
FGFbForward TTCTTCCTGCGCATCCAC
Reverse CCTCTCTCTTCTGCTTGAAGTTG
TGFbForward AGTGGTTGAGCCGTGGAG
Reverse TGCAGTGTGTTATCCCTGCT
GAPDH Forward AGCCACATCGCTCAGACAC
Reverse GCCCAATACGACCAAATCC
a
BMP, bone morphogenetic protein; FGF, fibroblast growth fac-
tor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IGF,
insulin-like growth factor; PDGF, platelet-derived growth factor;
TGF, transforming growth factor.
The Orthopaedic Journal of Sports Medicine Autologous Tenocyte Injection for Gluteal Tendinopathy 3
minimally important clinical change for this measure has
been estimated as 11 points in patients undergoing hip
arthroplasty.
1
A visual analog pain scale (VAS) was
employed to assess hip pain at rest, on a whole number
rating scale from 0 (no pain) to 10 (worst pain). Finally, the
36-item Short Form Health Survey (SF-36) was employed
to evaluate general health producing a mental component
score (MCS) and a physical component score (PCS). All
patients were asked how satisfied they were with the
results of their outcome using a 7-point satisfaction rating
scale (highly satisfied, quite satisfied, satisfied, not sure,
unsatisfied, quite dissatisfied, highly dissatisfied).
MRI Assessment
All patients underwent postinjection MRI at a mean of 8.7
months (range, 6-12 months). All scans were performed on
a Phillips Achieva 3T system (Phillips Healthcare). The
sequences utilized to evaluate the gluteal tendons were a
coronal proton density (repetition time [TR], 3500 ms; echo
time [TE], 30 ms; slice thickness, 3.5 mm), a coronal T2
fat-suppressed (TR, 4500 ms; TE, 60 ms; slice thickness,
3.5 mm), and an axial proton density fat-suppressed (TR,
3500 ms; TE, 20 ms; slice thickness, 4 mm), all obtained
with a field of view (FOV) of 18 cm.
In the absence of a recognized objective radiological scor-
ing system for gluteal tendinopathy, we adapted a scoring
tool employed by Pfirrmann et al.
21
In brief, the gluteus
minimus tendon and the lateral and posterior components
of the gluteus medius tendon were analyzed separately.
Hyperintense signals extending to both surfaces of the ten-
don defined tendon tears or detachments (absent or pre-
sent), and osseous detachment of the tendon was
recorded. Tendon diameter was qualitatively rated
(normal, thinned, or thickened) based on the radiologist’s
knowledge of normal tendon anatomy. Tendon signal inten-
sity was graded as normal (hypointense) or abnormal
(increased signal intensity) compared with normal tendon
signal intensity. Abductor tendon ossification was also
documented (absent or present). Bursal fluid collections
were rated as absent or present, as was a “fan sign,”
described by Pfirrmann et al
21
; the fan shape made by the
muscle tissue of the gluteus medius muscle reached
the bone outline of the greater trochanter, with a positive
response documenting the presence of a defect in the
muscle tissue.
Data and Statistical Analysis
Mixed-effects regression models with random intercept and
time as a factor variable were used to estimate changes in
clinical outcomes over time. In addition to the estimate of
degree of improvement at 12 and 24 months, change from
baseline to postinjection time points for the OHS was
dichotomized as a minimal clinically important change of
11 points.
1
Ninety-five percent confidence intervals and P
values are provided for all contrasts of interest. Due to the
small sample size, the nonparametric Friedman (repeated-
measures analysis of variance [ANOVA]) and Wilcoxon
signed rank test (paired ttest)werealsoperformedto
assess rank differences and confirm conclusions from
regression models. Spearman rho was used to assess
whether change in OHS at 12 months was associated with
age or duration of symptoms.
Changes in MRI measures pre- to postinjection were
assessed using the McNemar test. All pre- (n ¼12) and
postinjection (n ¼12) MRI scans were independently
reviewed and scored by 2 experienced musculoskeletal radi-
ologists, blinded to the clinical details of the cases, to eval-
uate interrater reliability. One radiologist rescored a
random sample of 20 pre-/postoperative scans to evaluate
intrarater reliability. Inter- and intrarater reliability was
assessed using the Cohen kappa and prevalence and bias-
adjusted kappa (PABAK).
2
Statistical analysis was per-
formed using SPSS software (version 17.0; IBM Corp).
RESULTS
Two patients missed their 3- and 6-month clinical evalua-
tions. No patient received additional treatment during the
study period. Figure 1 shows the study flowchart.
Growth Factor Profiles of Tendon Progenitor Cells
As previously described, cultured autologous tendon-
derived cells were characterized using flow cytometry and
real-time PCR for type I collagen, scleraxis, aggrecan,
MAGP2, and Mohawk (Table 2) to ensure the purity and
potency of tendon cell phenotype. To further investigate
whether autologous tenocytes express growth factors,
real-time PCR was used to examine numbers of growth
factors that have been shown to have an anabolic effect for
tendon, cartilage, and bone. Figure 2 shows that autologous
Figure 1. Study flowchart. ATI, autologous tenocyte injection;
MRI, magnetic resonance imaging; OHS, Oxford Hip Score;
SF-36, Short Form–36; VAS, visual analog scale.
4Bucher et al The Orthopaedic Journal of Sports Medicine
tendon-derived cells expressed growth factors mRNA at
different levels. The majority of these cases express high
levels of mRNA for PDGFa, FGFb, and TGFb, which have
been shown to induce tendon development.
10
Clinical Outcomes
Figure 3 demonstrates the incremental pattern of improve-
ment in the OHS from preinjection to 24 months. There
was statistically significant evidence for improvements
from baseline (preinjection) to 6 months postinjection
(change, 8.3 points; 95%CI, 3.9-12.8; P¼.009), with mean
improvement estimated to be 14.9 points by 12 months
(95%CI, 10.6-19.2; P< .001). Seven of 12 patients demon-
strated a clinically important change of 11 or more points
(Table1).ThedegreeofimprovementintheOHSwas
not estimated to be associated with age (Spearman rho,
–0.306; P¼.334) or the duration of symptoms (Spearman
rho, –0.182; P¼.572).
A pattern of incremental improvement was also observed
for the VAS and the PCS subscale of the SF-36, the majority
Figure 2. Gene expression of growth factors in autologous
tenocytes. BMP, bone morphogenetic protein; FBF, fibroblast
growth factor; GAPDH, glyceraldehyde 3-phosphate dehy-
drogenase; IGF, insulin-like growth factor; PDGF, platelet-
derived growth factor; TGF, transforming growth factor.
Figure 3. Mean (95% CI) pre- and postinjection patient-reported clinical outcomes including the (A) Oxford Hip Score, (B) visual
analog pain scale (VAS), and (C) the physical component subscale (PCS) of the 36-item Short Form Health Survey.
The Orthopaedic Journal of Sports Medicine Autologous Tenocyte Injection for Gluteal Tendinopathy 5
of which occurred in the first 3 months (Figure 3). Evidence
of improvement from baseline to 3 months postinjection
was observed for the VAS (change, –2.8 points; 95%CI,
–4.4 to –1.2; P¼.001) and PCS (change, 8.8 points; 95%
CI: 3.2-14.5; P¼.002). An estimated mean change in the
VAS from baseline to 12 months was –4.1 (95%CI, –2.6 to
–5.6; P< .001). The mean (SD) for the PCS subscale of the
SF-36 preintervention was 28.1 (8.5) and ranged from 17.4 to
46.1. An estimated mean change in the PCS from baseline to
12 months was 15.2 (95%CI, 9.8-20.5; P< .001). The
improvement for the VAS and PCS was maintained to
24 months, with the estimated change from baseline to
24 months being –4.5 points (95%CI, –6.1 to –2.9; P< .001) for
the VAS and 12.8 points (95%CI, 7.3-18.3; P< .001) for PCS.
All 12 patients completed the patient satisfaction ques-
tionnaire at 12 months postsurgery; 5 were highly satisfied,
3 were satisfied or quite satisfied, 2 were unsure, and 2
were dissatisfied with the outcomes of their procedure.
Satisfaction at 12 months showed good concordance with
improvements at 12 months, with those patients with the
most improvement being highly satisfied and those with
the lowest being dissatisfied or unsure (see Table 1).
TABLE 3
Pre- and Postinjection MRI-Based Changes
Postinjection
Preinjection Present Absent PValue
a
Tendon defect
Gluteus minimus Present 0 0 >.999
Absent 0 12
Gluteus medius (lateral) Present 0 0 >.999
Absent 0 12
Gluteus medius (posterior) Present 0 0 >.999
Absent 0 12
Tendon ossification
Gluteus minimus Present 0 0 >.999
Absent 0 12
Gluteus medius (lateral) Present 0 0 >.999
Absent 0 12
Gluteus medius (posterior) Present 0 0 >.999
Absent 0 12
Bursal fluid collection and fan sign
Bursal fluid collection Present 3 4 .125
Absent 0 5
Fan sign Present 0 1 >.999
Absent 0 11
Normal Abnormal
Tendon signal intensity
Gluteus minimus Normal 1 0 >.999
Abnormal 1 10
Gluteus medius (lateral) Normal 3 0 >.999
Abnormal 1 8
Gluteus medius (posterior) Normal 8 1 >.999
Abnormal 1 2
Thinning Normal Thickening
Tendon diameter
Gluteus minimus Thinning 3 0 0
>.999
b
Normal 0 0 0
Thickening 1 1 7
Gluteus medius (lateral) Thinning 3 0 0
>.999
b
Normal 0 5 0
Thickening 0 0 4
Gluteus medius (posterior) Thinning 0 0 0
>.999
b
Normal 0 10 1
Thickening 0 0 1
a
McNemar exact test.
b
To perform McNemar test, data collapsed to thinning yes/no.
6Bucher et al The Orthopaedic Journal of Sports Medicine
MRI Outcomes
We sought to examine whether the pathological features of
tendinopathy seen on MRI were correlated with the clinical
outcome after ATI. We observed no significant improve-
ment from pre- to postinjection in any tendon features mea-
sured by MRI (Table 3). Intrarater agreement was absolute
or high for all MRI measures (PABAK range from 0.727 to
1.00). Interrater agreement was absolute or high for all
MRI measures, with the exception of tendon signal inten-
sity for the lateral portion of the gluteus medius (Table 4).
Figure 4 shows the pre- and postinjection MRI for 1 patient,
demonstrating improved appearances.
Complications
There were no injection or biopsy site infections, though 3
patients reported some immediate discomfort at the patella
tendon biopsy site, all of which responded to topical nonste-
roidal anti-inflammatory gel. There have been no long-term
complications related to the biopsy site. There were no com-
plications after the ATI injection. One patient (patient 1,
Table 1) did not respond to ATI treatment and has since
undergone surgery to repair her gluteal tendon, after her
12-month review. This patient reported a change in the
OHS from 19 to 25 (pre- to 12 months postinjection), though
also reported a prior duration of symptoms of 12 years.
TABLE 4
Evaluation of inter-rater reliability of the MRI-based scoring variables using Cohen’s kappa and Prevalence and Bias
Adjusted Kappa (PABAK).
Radiologist 2
Cohen’s
Kappa PABAK
a
Radiologist 1 Present Absent
Tendon Defect
Gluteus Minimus Present 0 0 1.000 1.000
Absent 0 24
Gluteus Medius (Lateral) Present 0 0 1.000 1.000
Absent 0 24
Gluteus Medius (Posterior) Present 0 0 1.000 1.000
Absent 0 24
Tendon Ossification
Gluteus Minimus Present 0 0 1.000 1.000
Absent 0 24
Gluteus Medius (Lateral) Present 0 0 1.000 1.000
Absent 0 24
Gluteus Medius (Posterior) Present 0 0 1.000 1.000
Absent 0 24
Bursal Fluid Collection & Fan Sign
Bursal Fluid Collection Present 7 3 0.731 0.752
Absent 0 14
Fan Sign Present 1 0 1.000 1.000
Absent 0 23
Normal Abnormal
Tendon Signal Intensity
Gluteus Minimus Normal 3 0 0.704 0.830
Abnormal 2 19
Gluteus Medius (Lateral) Normal 5 2 0.442 0.500
Abnormal 4 13
Gluteus Medius (Posterior) Normal 17 1 0.500 0.670
Abnormal 3 3
Thinning Normal Thickening
Tendon Diameter
Gluteus Minimus Thinning 7 0 0
0.586 0.625Normal 0 1 0
Thickening 2 4 10
Gluteus Medius (Lateral) Thinning 6 0 0
0.936 0.938Normal 0 10 0
Thickening 0 1 7
Gluteus Medius (Posterior) Thinning 0 0 0
0.000 0.812Normal 0 21 0
Thickening 0 3 0
a
Prevalence and bias adjusted kappa.
The Orthopaedic Journal of Sports Medicine Autologous Tenocyte Injection for Gluteal Tendinopathy 7
DISCUSSION
Gluteus medius and/or minimus tendinopathy is now
accepted as the most prevalent pathology in those with pain
and tenderness over the greater trochanter,
11
though
conservative treatment modalities demonstrate high
symptom recurrence rates.
18,19
In an attempt to explore
advanced therapeutic options, we have conducted the first
prospective case study of ATI specifically in patients with
chronic gluteal tendinopathy. In this study, we have dem-
onstrated that ATI significantly improved early clinical
patient-reported outcomes, with further improvement and
sustained benefit to 24 months. All patients in this study
reported improvement in the OHS, with 7 of 12 patients
demonstrating a clinically important change of 11 or more
points by 12 months. A similar pattern of incremental
improvement was observed for the VAS and the PCS sub-
scale of the SF-36.
Currently,steroid injections arethe mainstay of treatment
for gluteal tendinopathy,
22
and while they have demon-
strated good short-term efficacy,
15
recurrence of pain is com-
mon.
8
This was reflected in this study, with patients
undergoing an average of 3.2 prior injections (range, 2-5),
with no benefit from their most recent injection. It has been
shown that apoptosis and autophagic cell death are common
in other tendinopathic conditions.
3
This, coupled with the
lack of inflammation seen with tendinopathic conditions,
may explain why steroid injections do not give long-lasting
relief of symptoms and provides rationale for investigating
the potential benefit of ATI. In comparison with a study by
Labrosse et al,
15
who showed only short-term benefits after
steroid injections, patients in this pilot trial displayed
early improvement in pain scores that were sustained up
to 24 months after ATI. Our data demonstrate promise in
the use of ATI in the treatment of gluteal tendinopathy.
Recently, other injection therapies such as PRP or auto-
logous blood have become increasingly popular for their
potential application in the treatment of tendinopathy.
Although the product of ATI contains 10%patient serum
without platelets and white blood cells, it is very unlikely
that 10%autologous human serum will have any effect on
the clinical outcome. This is supported by a recent meta-
analysis on the effect of PRP in tendinopathy, which dem-
onstrated that only leukocyte-rich PRP has a therapeutic
effect on tendinopathy.
9
According to manufacture require-
ments, the presence of 10%patient serum within ATI is
used for cell stability as it contains a high concentration
of human albumin. The fact that 4 of these patients had
previously received intratendon PRP injections without
benefit also reiterates the minimum therapeutic impact of
10%serum in the injection media.
Animal studies have demonstrated that autologous teno-
cytes are effective in treating chronic tendon degenera-
tion.
4,5
Others have injected tenocyte-like cells cultured
from skin fibroblasts into tendinopathic tendons.
6,7
The
presented ATI technique differs from previously published
methods in that tenocytes are prepared from the same cell
line rather than collagen-producing tenocyte cells used
from skin fibroblasts. ATI has already demonstrated
improved clinical (and radiological) outcomes in patients
with chronic lateral epicondylitis.
24,25
A similar benefit has
also been shown for ATI in the rotator cuff.
26
Given the
apoptosis and autophagic cell death seen in chronic tendi-
nopathy,
3
one of the potential mechanisms of action of ATI
contributing to the clinical improvement observed may be
the incorporation of Feridex-labeled injected tenocytes into
the tendon matrix, seen previously in an animal study.
4
In
addition, this study also showed that injected autologous
tenocytes may produce growth factors, including FGFb,
TGFb, and PDGFa, that can act in the autocrine and para-
crine actions for the induction of tendon cell proliferation
and matrix production.
Despite the statistically significant improvement in clinical
scores, we failed to demonstrate obvious MRI-based
Figure 4. Coronal magnetic resonance image of the same patient (A) preinjection and (B) at 6 months after autologous tenocyte
injection demonstrating a reduction in both gluteus medius tendon thickness (arrow) and the extent of intratendon T2 high signal
intensity.
8Bucher et al The Orthopaedic Journal of Sports Medicine
improvement in the majority of cases. A recent review by
McMahon et al
20
suggested that while a paucity of data exist
for the management and imaging of these conditions, MRI
should be the imaging modality of choice in the investigation
of GTPS. However, studies tend to concentrate on the effec-
tiveness of MRI for predicting the presence of a tear rather
than tendinopathy. Furthermore, while MRI has demon-
strated benefit in the pretreatment diagnosis and planning
for a patient with clinical signs of GTPS, to our knowledge,
there are no studies evaluating the appearance of gluteal
tendons after treatments such as injections, nor is there a
preexisting validated tool to evaluate improvement from an
intervention. MRI performed after surgical repair of glu-
teal tendons often demonstrates ongoing tendon abnormal-
ity and thickening,
16
while a recent systematic review
found that false positives were common when assessing the
accuracy of MRI for gluteal tendon tears.
27
Westacott
et al
27
concluded that better designed studies demonstrate
poor accuracy and that ultrasound in skilled hands may be
the investigation of choice. This becomes relevant when
considering our inability to demonstrate obvious radiolog-
ical improvement in the majority of cases, despite the
reported clinical improvement.
Our study does have several limitations. Firstly, small
case numbers were investigated given the primary out-
comewassafetyspecificallyintheuseofATIforgluteal
tendinopathy. While a safety study has been previously
undertaken for lateral epicondylitis,
24,25
the gluteal ten-
don is a different and weightbearing tendon and may
behave in a different way to the upper limb. Second, we
acknowledge the lack of a comparative group and the
potential for clinical changes that could occur purely as a
result of placebo or the natural recovery time line (partic-
ularly in those with a shorter duration of symptoms). How-
ever, it should also be noted that statistically significant
evidence for improvements was noted by 6 months postin-
jection, and the shortest symptom duration reported was 6
months. Furthermore, all 12 patients had failed to obtain
benefit from other conservative treatments such as struc-
tured exercise, had received no benefit (or were worse)
from their most recent cortisone injections (with patients
undergoing an average of 3.2 prior injections), and had a
duration of symptoms of on average 33.2 months (mini-
mum, 6 months; 9 patients at least 12 months; 6 patients
at least 24 months). Furthermore, the improvements
obtained were sustained for 24 months, which, combined
with the history of failed prior treatment in these patients,
may well show benefit beyond a placebo response in the
absence of a control group. Third, we employed the OHS, a
clinical measure specific for hip osteoarthritis, as our pri-
mary outcome clinical tool. While it would appear that the
OHS has good face validity for GTPS, there is currently no
validated patient-reported outcome measure for gluteal
tendinopathy or GTPS. Finally, we sought to investigate
MRI-based changes in addition to clinical improvement.
We acknowledge that obvious radiological improvement
in the majority of cases could not be demonstrated despite
the reported clinical improvement. This may be limited by
our lack of a preexisting validated tool to evaluate MRI
improvement from an intervention or that postinjection
MRI was undertaken too early, given that 1- and 4.5-
year MRI improvement has been reported using ATI for
lateral epicondylitis.
24,25
These are areas for future
research.
CONCLUSION
This study demonstrated safety in using ATI specifically in
the treatment of recalcitrant gluteal tendinopathy. There
were no persistent complications as a result of the tendon
biopsy or tenocyte injection. Furthermore, this prospective
case series revealed significant and sustained improvement
in clinical scores to 24 months after ATI in patients who had
previously undergone unsuccessful conservative treat-
ments. Given that gluteal tendinopathy remains a chal-
lenging condition to treat, especially when conventional
conservative measures fail, this pilot study has provided
useful data and shown sufficient promise for the design of
a randomized controlled study investigating ATI for gluteal
tendinopathy.
REFERENCES
1. Beard DJ, Harris K, Dawson J, et al. Meaningful changes for the
Oxford hip and knee scores after joint replacement surgery. J Clin
Epidemiol. 2015;68:73-79.
2. Byrt T, Bishop J, Carlin JB. Bias, prevalence and kappa. JClin
Epidemiol. 1993;46:423-429.
3. Chen J, Wang A, Xu J, Zheng M. In chronic lateral epicondylitis, apo-
ptosis and autophagic cell death occur in the extensor carpi radialis
brevis tendon. J Shoulder Elbow Surg. 2010;19:355-362.
4. Chen J, Yu Q, Wu B, et al. Autologous tenocyte therapy for experi-
mental Achilles tendinopathy in a rabbit model. Tissue Eng Part A.
2011;17:2037-2048.
5. Chen JM, Willers C, Xu J, Wang A, Zheng MH. Autologous tenocyte
therapy using porcine-derived bioscaffolds for massive rotator cuff
defect in rabbits. Tissue Eng. 2007;13:1479-1491.
6. Clarke AW, Alyas F, Morris T, Robertson CJ, Bell J, Connell DA. Skin-
derived tenocyte-like cells for the treatment of patellar tendinopathy.
Am J Sports Med. 2011;39:614-623.
7. Connell D, Datir A, Alyas F, Curtis M. Treatment of lateral epicondylitis
using skin-derived tenocyte-like cells. Br J Sports Med. 2009;43:293-298.
8. Del Buono A, Papalia R, Khanduja V, Denaro V, Maffulli N. Manage-
ment of the greater trochanteric pain syndrome: a systematic review.
Br Med Bull. 2012;102:115-131.
9. Fitzpatrick J, Bulsara M, Zheng MH. The effectiveness of platelet-rich
plasma in the treatment of tendinopathy: a meta-analysis of random-
ized controlled clinical trials. Am J Sports Med. 2016;44:NP55-NP56.
10. Goncalves AI, Rodrigues MT, Lee SJ, et al. Understanding the role of
growth factors in modulating stem cell tenogenesis. PLoS One. 2013;
8:e83734.
11. Grimaldi A, Fearon A. Gluteal tendinopathy: integrating pathomecha-
nics and clinical features in its management. J Orthop Sports Phys
Ther. 2015;45:910-922.
12. Karpinski MR, Piggott H. Greater trochanteric pain syndrome. A
report of 15 cases. J Bone Joint Surg Br. 1985;67:762-763.
13. Kingzett-Taylor A, Tirman PF, Feller J, et al. Tendinosis and tears of
gluteus medius and minimus muscles as a cause of hip pain: MR
imaging findings. AJR Am J Roentgenol. 1999;173:1123-1126.
14. Klauser AS, Martinoli C, Tagliafico A, et al. Greater trochanteric pain
syndrome. Semin Musculoskelet Radiol. 2013;17:43-48.
15. Labrosse JM, Cardinal E, Leduc BE, et al. Effectiveness of
ultrasound-guided corticosteroid injection for the treatment of glu-
teus medius tendinopathy. AJR Am J Roentgenol. 2010;194:202-206.
The Orthopaedic Journal of Sports Medicine Autologous Tenocyte Injection for Gluteal Tendinopathy 9
16. Lequesne M, Djian P, Vuillemin V, Mathieu P. Prospective study of
refractory greater trochanter pain syndrome. MRI findings of gluteal
tendon tears seen at surgery. Clinical and MRI results of tendon
repair. Joint Bone Spine. 2008;75:458-464.
17. Lequesne M, Mathieu P, Vuillemin-Bodaghi V, Bard H, Djian P. Glu-
teal tendinopathy in refractory greater trochanter pain syndrome:
diagnostic value of two clinical tests. Arthritis Rheum. 2008;59:
241-246.
18. Lievense A, Bierma-Zeinstra S, Schouten B, Bohnen A, Verhaar J,
Koes B. Prognosis of trochanteric pain in primary care. Br J Gen
Pract. 2005;55:199-204.
19. Lustenberger DP, Ng VY, Best TM, Ellis TJ. Efficacy of treatment of
trochanteric bursitis: a systematic review. Clin J Sport Med. 2011;21:
447-453.
20. McMahon SE, Smith TO, Hing CB. A systematic review of imaging
modalities in the diagnosis of greater trochanteric pain syndrome.
Musculoskeletal Care. 2012;10:232-239.
21. Pfirrmann CW, Notzli HP, Dora C, HodlerJ, Zanetti M. Abductor tendons
and muscles assessed at MR imaging after total hip arthroplasty in
asymptomatic and symptomatic pati ents. Radiology.2 005;235:969-976.
22. Rompe JD, Segal NA, Cacchio A, Furia JP, Morral A, Maffulli N. Home
training, local corticosteroid injection, or radial shock wave therapy
for greater trochanter pain syndrome. Am J Sports Med. 2009;37:
1981-1990.
23. Segal NA, Felson DT, Torner JC, et al; Multicenter Osteoar-
thritis Study Group. Greater trochanteric pain syndrome: epidemi-
ology and associated factors. Arch Phys Med Rehabil. 2007;88:
988-992.
24. Wang A, Breidahl W, Mackie KE, et al. Autologous tenocyte injection
for the treatment of severe, chronic resistant lateral epicondylitis: a
pilot study. Am J Sports Med. 2013;41:2925-2932.
25. Wang A, Mackie K, Breidahl W, Wang T, Zheng MH. Evidence for the
durability of autologous tenocyte injection for treatment of chronic
resistant lateral epicondylitis: mean 4.5-year clinical follow-up. Am J
Sports Med. 2015;43:1775-1783.
26. Wang AW, Bauer S, Goonatillake M, Breidahl W, Zheng MH. Autolo-
gous tenocyte implantation, a novel treatment for partial-thickness
rotator cuff tear and tendinopathy in an elite athlete. BMJ Case Rep.
2013;2013:007899.
27. Westacott DJ, Minns JI, Foguet P. The diagnostic accuracy of mag-
netic resonance imaging and ultrasonography in gluteal tendon
tears—a systematic review. Hip Int. 2011;21:637-645.
28. Williams BS, Cohen SP. Greater trochanteric pain syndrome: a review
of anatomy, diagnosis and treatment. Anesth Analg. 2009;108:
1662-1670.
29. Wu B, Chen J, Dela Rosa T, et al. Cellular response and extracellular
matrix breakdown in rotator cuff tendon rupture. Arch Orthop Trauma
Surg. 2011;131:405-411.
10 Bucher et al The Orthopaedic Journal of Sports Medicine
... Recent advances in cell therapy concentrate on addressing the underlying pathology of tendon degeneration [15], emerging as a promising non-surgical management option for tendinopathies [16][17][18][19][20][21]. Among of them, autologous tendon cell injection (ATI) is a promising non-surgical treatment for tendinopathies. ...
... Among of them, autologous tendon cell injection (ATI) is a promising non-surgical treatment for tendinopathies. The procedure involves harvesting autologous tendon tissue, the isolation of the tendon cells, expansion under quality assured good manufacture practice (GMP) cell laboratory and the injection of the tendon cells via ultrasound guided into the degenerative tendon tissue [18][19][20]. This is the first review summarising and discussing the current progress and challenges in the clinical use of tendon-derived cell therapy. ...
... Tendon-derived cell therapy has been used for treatment of late-stage tendinopathy and tear in different anatomical sites including elbow, gluteal and rotator cuff. The mechanisms of action are multi-factorial including (1) to replenish the local tendon cell population; (2) to promote tissue regeneration by counteracting the intrinsically slow healing process; and (3) to stimulate the production of growth factors [20] and the synthesis of matrix proteins (e.g., type I collagen) [16,17,32,33]. Current clinical studies have not specifically identified their cell sources as TDSC or well-differentiated tenocytes and thus require further confirmation. ...
Article
Full-text available
Tendon is composed of dense fibrous connective tissues, connecting muscle at the myotendinous junction (MTJ) to bone at the enthesis and allowing mechanical force to transmit from muscle to bone. Tendon diseases occur at different zones of the tendon, including enthesis, MTJ and midsubstance of the tendon, due to a variety of environmental and genetic factors which consequently result in different frequencies and recovery rates. Self-healing properties of tendons are limited, and cell therapeutic approaches in which injured tendon tissues are renewed by cell replenishment are highly sought after. Homologous use of individual’s tendon-derived cells, predominantly differentiated tenocytes and tendon-derived stem cells, is emerging as a treatment for tendinopathy through achieving minimal cell manipulation for clinical use. This is the first review summarizing the progress of tendon-derived cell therapy in clinical use and its challenges due to the structural complexity of tendons, heterogeneous composition of extracellular cell matrix and cells and unsuitable cell sources. Further to that, novel future perspectives to improve therapeutic effect in tendon-derived cell therapy based on current basic knowledge are discussed.
... One study excluded male participants 22 ; for the remaining studies, the female-to-male sex ratio was calculated as 7:1. Information on laterality was provided in 7 studies, 9,10,29,33,38,50,53 with 54.3% of left hips treated. Table 3 shows a summary of the descriptive data. ...
... 4,14 Outcome Measures A variety of outcome measures was used across the included studies to assess treatment success. Pain was most commonly assessed using a visual analog scale (VAS; 16 studies {{ ) or numeric rating scale (NRS; 2 studies 10,42,51 8,9,17 ), and Patient Acceptable Symptom State (3 studies 4,25,26 ). Rarely used measures for the determination of outcomes were the Lower Extremity Functional Scale, 10,18 Nonarthritic Hip Score, 29,53 and Merle D'Aubigné-Postel score 17,55 in 2 studies each. ...
... Patient outcomes measured using the mHHS peaked at 6 weeks after a single CSI according to data published by Fitzpatrick et al 25,26 (LoE 1b) and thereafter declined. However, the mHHS scores obtained from this References 8,9,17,18,21,22,29,31,38,[40][41][42]50,51,53,55. {{ References 4,8,9,14,17,22,23,29,31,33,36,38,39,42,50,53. ...
Article
Full-text available
Background: Gluteal tendinopathy is the most common lower limb tendinopathy. It presents with varying severity but may cause debilitating lateral hip pain. Purpose: To review the therapeutic options for different stages of gluteal tendinopathy, to highlight gaps within the existing evidence, and to provide guidelines for a stage-adjusted therapy for gluteal tendinopathy. Study design: Systematic review; Level of evidence, 4. Methods: We screened Scopus, Embase, Web of Science, PubMed, PubMed Central, Ovid MEDLINE, CINAHL, UpToDate, and Google Scholar databases and databases for grey literature. Patient selection, diagnostic criteria, type and effect of a therapeutic intervention, details regarding aftercare, outcome assessments, complications of the treatment, follow-up, and conclusion of the authors were recorded. An assessment of study methodological quality (type of study, level of evidence) was also performed. Statistical analysis was descriptive. Data from multiple studies were combined if they were obtained from a single patient population. Weighted mean and range calculations were performed. Results: A total of 27 studies (6 randomized controlled trials) with 1103 patients (1106 hips) were included. The mean age was 53.7 years (range, 17-88 years), and the mean body mass index was 28.3. The ratio of female to male patients was 7:1. Radiological confirmation of the diagnosis was most commonly obtained using magnetic resonance imaging. Reported treatment methods were physical therapy/exercise; injections (corticosteroids, platelet-rich plasma, autologous tenocytes) with or without needle tenotomy/tendon fenestration; shockwave therapy; therapeutic ultrasound; and surgical procedures such as bursectomy, iliotibial band release, and endoscopic or open tendon repair (with or without tendon augmentation). Conclusion: There was good evidence for using platelet-rich plasma in grades 1 and 2 tendinopathy. Shockwave therapy, exercise, and corticosteroids showed good outcomes, but the effect of corticosteroids was short term. Bursectomy with or without iliotibial band release was a valuable treatment option in grades 1 and 2 tendinopathy. Insufficient evidence was available to provide guidelines for the treatment of partial-thickness tears. There was low-level evidence to support surgical repair for grades 3 (partial-thickness tears) and 4 (full-thickness tears) tendinopathy. Fatty degeneration, atrophy, and retraction can impair surgical repair, while their effect on patient outcomes remains controversial.
... The biologic treatment options in the management of LE are designed to intervene and change the balance of injury and repair, generally be inducing a new injury or inflammatory process that may activate and accelerate a new cycle of repair and remodeling. These include injection of hyperosmolar dextrose for prolotherapy, platelet-rich plasma (PRP), culture-expanded autologous tenocytes, various types of progenitor cells (including BMAC, adipose derivatives, culture expanded mesenchymal stromal cells (MSCs)), and incubated autologous conditioned serum such as gold-induced cytokines at the site of the tendon lesion [28,29,30,31,32,33,34,35,36]. ...
... If effective, they are thought to primarily work through a paracrine mechanism, stimulating local and perhaps distant host cells. Injected cells produce PDGF-alpha, FGF-beta, and TGF-beta in a similar fashion to PRP to restore the normal biologic and mechanical properties to the tendon by promoting collagen synthesis, extracellular matrix, and tendon repair [31,32,40]. ...
Chapter
Given this new understanding of the physiopathology of LE, treatment approaches have shifted toward novel biological therapies to restore tendon biology through reactivation of a healing response that may stimulate local tendon repair and/or regeneration, rather than just treating inflammation and pain. The developing treatment strategies include local injection of platelet-rich plasma (PRP), collagen-producing tenocyte-like cells, mixed cell preparations containing connective tissue progenitor cells from different sources (mostly bone marrow and adipose tissue), and autologous conditioned serum (ACS).
... Biological therapies such as platelet-rich plasma [PRP] injections which are hypothesized to introduce cellular mediators such as growth factors into the tendon, promoting natural healing have shown benefit in Grade II GT [12,13] . Autologous tenocyte implantation [ATI] has also shown benefit in refractory gluteal tendinopathies [14] . This case introduces a 63year-old female with an extensive history of lateral hip pain and treatment refractory tendinopathy who has gained significant improvements in her quality of life with the assistance of autologous tenocyte implantation [ATI] in conjunction with collagen scaffold technology. ...
... Animal studies have demonstrated ATI improves both the histological parameters such as tendon structure, reduced vascular hyperplasia and improved cellular morphology and biomechanical function with improved tensile strength due to improved arrangement of collagen fibers and improved collagen content [18] . This has been reproduced in human trials such as Bucher et al's prospective pilot study showing ATI in the treatment of chronic recalcitrant gluteal tendinopathy to be safe with improved and sustained clinical outcomes to 24 months [14] . This was demonstrated at a cellular level with improved local growth factor production in all cases and clinical improvement quantified by the Oxford Hip Score [OHS], with a statically significant improvement from baseline at six months. ...
Article
Full-text available
Background: Ortho-biological therapies such as platelet-rich plasma and autologous tenocyte implantation injections are hypothesized to introduce cellular mediators such as growth factors into tendons, promoting natural healing. Methods: This case introduces a 63-year-old female with an extensive history of lateral hip pain and treatment refractory tendinopathy with tearing. She underwent open surgery to repair the gluteus medius tendon, using supplementary autologous tenocyte implantation (ATI) in conjunction with a Celgro (Orthocell, Perth, Australia) collagen scaffold. Level of evidence: 4 Results: She had normal function in the hip at 12 months. MRI scans post-operatively at 12 months showed a marked reduction in inflammation, an intact tendon and a reduction in atrophic changes in the muscle belly. Conclusion: Surgical repair of a large degenerate tear of the gluteus medius tendon, augmented with autologous tenocyte implantation in a collagen scaffold led to an excellent patient outcome and MRI findings demonstrated tendon healing with improved tendon structure and reduced inflammation.
... Autologous tenocyte implantation (ATI) is a minimally-invasive, bioengineered treat-ment that is designed to address the underlying pathology of chronic degenerative ten-dinopathy by replenishing the local tenocyte population with cultured autologous tenocytes. The Australian Therapeutic Goods Administration approved the manufacture and supply of ATI in 2010, and promising results have been obtained in human studies of lateral epicondylitis, gluteal tendinopathy [8][9][10][11][12] and rotator cuff tendinopathy in elite athletes. 8 9 ...
... 29 30 Previous studies using ATI have shown promising results for the treatment of lateral elbow, gluteal, and shoulder tendinopathy, with improvement noted in pain, strength, and function in both human and animal studies. [8][9][10][11] Whilst not all studies demonstrated MRI changes following ATI injection, 10 11 one recent study demonstrated both improved clinical and radiological outcomes in patients with rotator cuff injuries following ATI. 9 Whilst the patient in our study made excellent clinical improvements following ATI, there are several limitations to this case report. ...
Article
Full-text available
The use of injectable cell therapies to treat tendon pathology has become significantly more popular in recent years. They are appealing treatment modalities as they are minimally invasive, autologous, non-surgical management options which theoretically allow tendon regeneration and return to function. This case report will focus on the use of autologous tenocyte implantation (ATI) injection therapy to treat chronic degenerative rotator cuff tendinopathy.
... 6 The addition of percutaneous needle tenotomy did not have any benefit over PRP injection alone, and evidence for needle tenotomy as a stand-alone treatment is limited. 6 In a small series of 12 patients, Bucher and colleagues 6,15 showed that ATI resulted in improved pain and functional outcomes scores at 1 and 2 years, but more data is needed on ATI. ...
Article
- Greater trochanteric pain syndrome is common both prior to and after total hip replacement surgery. - Endoscopic abdutor tendon repair has a lower complication rate when compared to open repair. - Iliopsoas tendon infiltration is effective in almost half of patients with iliopsoas tendonitis.
... ; Wang et al. (2015) reported to utilize autologous tenocyte injection (ATI) as a treatment for severe, chronic resistant lateral epicondylitis and autologous tenocyte implantation for tendinopathy and partial-thickness rotator cuff tear in an elite athlete (Wang A.W. et al., 2013). Bucher et al. (2017) used ATI for the treatment of chronic recalcitrant gluteal tendinopathy. All of the treatment have had some effects. ...
Article
Full-text available
Restoring the normal structure and function of injured tendons is one of the biggest challenges in orthopedics and sports medicine department. The discovery of tendon-derived stem cells (TDSCs) provides a novel perspective to treat tendon injuries, which is expected to be an ideal seed cell to promote tendon repair and regeneration. Because of the lack of specific markers, the identification of tenocytes and TDSCs has not been conclusive in the in vitro study of tendons. In addition, the morphology of tendon derived cells is similar, and the comparison and identification of tenocytes and TDSCs are insufficient, which causes some obstacles to the in vitro study of tendon. In this review, the characteristics of tenocytes and TDSCs are summarized and compared based on some existing research results (mainly in terms of biomarkers), and a potential marker selection for identification is suggested. It is of profound significance to further explore the mechanism of biomarkers in vivo and to find more specific markers.
... On the other hand, there are fewer reports exploring tenocytes for cell-based therapy [1,10,11], which might be due to the scarcity of donor tendons or loss of phenotype during in vitro expansion [12]. However, several studies describe the positive effects of autologous human tenocyte transplantation on tendon healing [13][14][15]. This suggests the need for tenocyte expansion and optimization of the expansion protocols before application, addressing increased proliferation, matrix synthesis, and phenotype retention in order to make them suitable for cell therapy. ...
Article
Full-text available
Cell-based tendon therapies with tenocytes as a cell source need effective tenocyte in vitro expansion before application for tendinopathies and tendon injuries. Supplementation of tenocyte culture with biomolecules that can boost proliferation and matrix synthesis is one viable option for supporting cell expansion. In this in vitro study, the impacts of ascorbic acid or PDGF-BB supplementation on rabbit Achilles tenocyte culture were studied. Namely, cell proliferation, changes in gene expression of several ECM and tendon markers (collagen I, collagen III, fibronectin, aggrecan, biglycan, decorin, ki67, tenascin-C, tenomodulin, Mohawk, α-SMA, MMP-2, MMP-9, TIMP1, and TIMP2) and ECM deposition (collagen I and fibronectin) were assessed. Ascorbic acid and PDGF-BB enhanced tenocyte proliferation, while ascorbic acid significantly accelerated the deposition of collagen I. Both biomolecules led to different changes in the gene expression profile of the cultured tenocytes, where upregulation of collagen I, Mohawk, decorin, MMP-2, and TIMP-2 was observed with ascorbic acid, while these markers were downregulated by PDGF-BB supplementation. Vice versa, there was an upregulation of fibronectin, biglycan and tenascin-C by PDGF-BB supplementation, while ascorbic acid led to a downregulation of these markers. However, both biomolecules are promising candidates for improving and accelerating the in vitro expansion of tenocytes, which is vital for various tendon tissue engineering approaches or cell-based tendon therapy.
Chapter
Disorders of the lateral gluteal tendons are a common cause of lateral hip pain and can be simplified to two primary clinical entities: greater trochanteric pain syndrome (GTPS) and snapping hip syndrome. GTPS, which was traditionally misdiagnosed as trochanteric bursitis, involves the gluteus minimus and medius tendons. Patients will often complain of lateral hip pain that may radiate down the thigh and worsens with pressure over the area. Physical examination may reveal point tenderness over the greater trochanter and a Trendelenburg gait. In addition to the examination, diagnosis can be augmented with magnetic resonance imaging or sonographic evaluation. Treatment options range from physical therapy to injections to surgical repair, with varying levels of success. Meanwhile, external snapping hip syndrome often involves primarily the gluteus maximus tendon and iliotibial band. It is a syndrome of mechanical snapping as these structures slide over the greater trochanter and can also lead to lateral hip pain. The snapping sensation can be reproduced on physical exam and seen directly via dynamic ultrasound examination. While most cases can be adequately treated with physical therapy and occasional corticosteroid injections, effective surgical options also exist and range from open to endoscopic surgeries.
Article
Full-text available
Background Gluteal tendinopathy is commonly reported in the literature, but there is a need for a validated magnetic resonance imaging (MRI)-based scoring system to grade the severity of the tendinopathy. Purpose To use intra- and interobserver reliability to validate a new scoring system, the Melbourne Hip MRI (MHIP) score, for assessing the severity of gluteal tendinopathy. Study Design Cohort study (diagnosis); Level of evidence, 3. Methods The MHIP score assesses gluteal tendinopathy according to each 1 of 5 categories: (1) extent of tendon pathology (maximum 5 points); (2) muscle atrophy (maximum 4 points); (3) trochanteric bursitis (maximum 4 points); (4) cortical irregularity (maximum 3 points); and (5) bone marrow edema (maximum 1 point), with an overall range of 0 to 17 (most severe). A total of 41 deidentified MRI scans from 40 patients diagnosed with gluteal tendinopathy (mean baseline age, 57.44 ± 25.26 years; 4 male, 36 female) were read and graded according to MHIP criteria by 2 experienced musculoskeletal radiologists. The radiologists were blinded to previous reports, and the scans were read twice within a 2-month period. Statistical analysis using the intraclass correlation coefficient (ICC) was used to determine intra- and interobserver reliability and mean/range for the MHIP scores. Results Of a total of 123 readings, the mean MHIP score (±SD) was 3.93 ± 2.24 (range, 0-17 points). The MHIP score demonstrated excellent reliability for determining the severity of gluteal tendinopathy on MRI. The ICC for intra- and interobserver reliability was 0.81 (95% CI, 0.67-0.89) and 0.78 (95% CI, 0.62-0.87), respectively. Conclusion The MHIP score had excellent intra- and interobserver reliability in scoring gluteal tendinopathy. This score allows gluteal tendon pathology to be graded prior to treatment and to be used for standardized comparisons between results in future research undertaking radiological review of gluteal tendinopathy.
Article
Full-text available
Background: Tendinopathy is very common in the general population. There are increasing numbers of clinical studies referring to platelet-rich plasma (PRP) and platelet-poor plasma (PPP) as treatments for tendinopathy. Purpose: To perform a meta-analysis of the outcomes of the PRP groups by preparation method and injection technique in tendinopathy. To determine the clinical effectiveness of the preparations and to evaluate the effect of controls used in the studies reviewed. Study design: Systematic review and meta-analysis. Methods: The PubMed, EMBASE, CINAHL, and Medline databases were searched in March 2012, April 2014, and August 2015, and randomized controlled trials using autologous blood, PRP, PPP, or autologous conditioned plasma in tendinopathy with outcome measures of pain and follow-up time of 3 months were included in this review. Trials including surgery, tendon tears, and muscle or ligament injuries were excluded. Study quality was assessed using the Cochrane Collaboration risk-of-bias tool by 2 reviewers. Data were pooled using random-effects meta-analysis. The primary outcome measure was a change in pain intensity. Where more than 1 pain scale was included, a functional score was selected ahead of a visual analog scale score. Results: A total of 18 studies (1066 participants) were included. Eight studies were deemed to be at low risk of bias. The most significant outcomes in the PRP groups were seen in those treated with highly cellular leukocyte-rich PRP (LR-PRP) preparations: GPS kit (standardized mean difference [SMD], 35.75; 95% CI, 28.40-43.10), MyCells kit (SMD, 31.84; 95% CI, 17.56-46.13), Prosys kit (SMD, 42.99; 95% CI, 37.73-48.25), and unspecified LR-PRP (SMD, 34.62; 95% CI, 31.69-37.55). When the LR-PRP system types were grouped, there was a strongly positive effect (SMD, 36.38; 95% CI, 34.00-38.77) when compared with leukocyte-poor PRP (SMD, 26.77; 95% CI, 18.31-35.22). In assessing the control groups, there was no clear difference between different types of control injections: saline (SMD, 14.62; 95% CI, 10.74-18.50), local anesthetic (SMD, 15.00; 95% CI, 7.66-22.34), corticosteroid (SMD, 23.82; 95% CI, 10.74-18.50), or dry needling (SMD, 25.22; 95% CI, 21.27-29.16). Conclusion: There is good evidence to support the use of a single injection of LR-PRP under ultrasound guidance in tendinopathy. Both the preparation and intratendinous injection technique of PRP appear to be of great clinical significance.
Article
Full-text available
Synopsis Gluteal tendinopathy is now believed to be the primary local source of lateral hip pain, or greater trochanteric pain syndrome, previously referred to as trochanteric bursitis. This condition is prevalent, particularly in post-menopausal women, and has a considerable negative influence on quality of life. Improved prognosis and outcomes in the future for those with gluteal tendinopathy will be underpinned by advances in diagnostic testing, a clearer understanding of risk factors and co-morbidities, and evidence based management programs. High quality studies that meet these requirements are still lacking. This clinical commentary provides direction to assist the clinician with assessment and management of the patient with gluteal tendinopathy, based on currently limited available evidence on this condition and the wider tendon literature, in addition to the combined clinical experience of the authors. J Orthop Sports Phys Ther, Epub 17 Sep 2015. doi:10.2519/jospt.2015.5829.
Article
Full-text available
Objectives To present estimates of clinically meaningful or minimal important changes for the Oxford Hip Score (OHS) and the Oxford Knee Score (OKS) after joint replacement surgery. Study Design and Setting Secondary data analysis of the NHS patient-reported outcome measures data set that included 82,415 patients listed for hip replacement surgery and 94,015 patients listed for knee replacement surgery was performed. Results Anchor-based methods revealed that meaningful change indices at the group level [minimal important change (MIC)], for example in cohort studies, were ∼11 points for the OHS and ∼9 points for the OKS. For assessment of individual patients, receiver operating characteristic analysis produced MICs of 8 and 7 points for OHS and OKS, respectively. Additionally, the between group minimal important difference (MID), which allows the estimation of a clinically relevant difference in change scores from baseline when comparing two groups, that is, for clinical trials, was estimated to be ∼5 points for both the OKS and the OHS. The distribution-based minimal detectable change (MDC90) estimates for the OKS and OHS were 4 and 5 points, respectively. Conclusion This study has produced and discussed estimates of minimal important change/difference for the OKS/OHS. These estimates should be used in the power calculations and the interpretation of studies using the OKS and OHS. The MDC90 (∼4 points OKS and ∼5 points OHS) represents the smallest possible detectable change for each of these instruments, thus indicating that any lower value would fall within measurement error.
Article
Full-text available
Current treatments for tendon injuries often fail to fully restore joint biomechanics leading to the recurrence of symptoms, and thus resulting in a significant health problem with a relevant social impact worldwide. Cell-based approaches involving the use of stem cells might enable tailoring a successful tendon regeneration outcome. As growth factors (GFs) powerfully regulate the cell biological response, their exogenous addition can further stimulate stem cells into the tenogenic lineage, which might eventually depend on stem cells source. In the present study we investigate the tenogenic differentiation potential of human- amniotic fluid stem cells (hAFSCs) and adipose-derived stem cells (hASCs) with several GFs associated to tendon development and healing; namely, EGF, bFGF, PDGF-BB and TGF-β1. Stem cells response to biochemical stimuli was studied by screening of tendon-related genes (collagen type I, III, decorin, tenascin C and scleraxis) and proteins found in tendon extracellular matrix (ECM) (Collagen I, III, and Tenascin C). Despite the fact that GFs did not seem to influence the synthesis of tendon ECM proteins, EGF and bFGF influenced the expression of tendon-related genes in hAFSCs, while EGF and PDGF-BB stimulated the genetic expression in hASCs. Overall results on cellular alignment morphology, immunolocalization and PCR analysis indicated that both stem cell source can be biochemically induced towards tenogenic commitment, validating the potential of hASCs and hAFSCs for tendon regeneration strategies.
Article
Full-text available
BACKGROUND:Severe chronic lateral epicondylitis (LE) is associated with degenerative tendon changes, extracellular matrix breakdown, and tendon cell loss. On the basis of positive outcomes from preclinical studies, this study is the first clinical trial of autologous tenocyte injection (ATI) on severe tendinopathy associated with chronic LE. HYPOTHESIS:Autologous tenocyte injection is a safe and effective procedure that enables a reduction in pain and improvement in function in resistant LE. STUDY DESIGN:Case series; Level of evidence, 4. METHODS:Patients with severe refractory LE underwent clinical evaluation and magnetic resonance imaging (MRI) before intervention. A patellar tendon needle biopsy was performed under local anesthetic, and tendon cells were expanded by in vitro culture. Tenocytes used for the injection were characterized by flow cytometry and real-time polymerase chain reaction. Autologous tenocytes were injected into the site of tendinopathy identified at the origin of the extensor carpi radialis brevis tendon under ultrasound guidance on a single occasion. Patients underwent serial clinical evaluations and repeat MRI at 12 months after intervention. RESULTS:A total of 20 consecutive patients were included in the study. Three patients withdrew consent after enrollment and before ATI. No adverse event was reported at either biopsy or injection sites. Furthermore, no infection or excessive fibroblastic reaction was found in any patient at the injection site. Clinical evaluation revealed an improvement in mean visual analog scale scores, for a maximum pain score from 5.94 at the initial assessment to 0.76 at 12 months (P < .001). Mean quick Disabilities of the Arm, Shoulder and Hand (QuickDASH) and grip strength scores also significantly improved over the 12-month follow-up (QuickDASH score, 45.88 [baseline] to 3.84; grip strength, 20.17 kg [baseline] to 37.38 kg; P < .001). With use of a validated MRI scoring system, the grade of tendinopathy at the common extensor origin improved significantly by 12 months (P < .001). One patient elected to proceed to surgery 3 months after ATI following a reinjury at work. CONCLUSION:In this study, patients with chronic LE who had previously undergone an unsuccessful full course of nonoperative treatment showed significantly improved clinical function and structural repair at the origin of the common extensor tendon after ATI. This novel treatment is encouraging for the treatment of tendinopathy and warrants further evaluation.
Article
Full-text available
Pain around the greater trochanter is still a common clinical problem that may be secondary to a variety of either intra-articular or periarticular pathologies. Gluteal tendon pathologies are one of the primary causes of greater trochanteric pain, with attrition of the fasciae latae against the gluteus medius and minimus tendons, and the trochanteric bursa being possible causes. Key sonographic findings of gluteal tendinopathy, bursitis, and differential diagnosis are described in this overview. Clinical diagnosis and treatment of greater trochanteric pain syndrome is still challenging; therefore ultrasound is helpful to localize the origin of pain, determine underlying pathology, and, based on these findings, to guide local aspiration and/or injection in cases of tendinopathy and/or bursitis.
Article
Full-text available
Tendinopathy and small partial-thickness tears of the rotator cuff tendon are common presentations in sports medicine. No promising treatment has yet been established. Corticosteroid injections may improve symptoms in the short term but do not primarily treat the tendon pathology. Ultrasound-guided autologous tenocyte implantation (ATI) is a novel bioengineered treatment approach for treating tendinopathy. We report the first clinical case of ATI in a 20-year-old elite gymnast with a rotator cuff tendon injury. The patient presented with 12 months of increasing pain during gymnastics being unable to perform most skills. At 1 year after ATI the patient reported substantial improvement of clinical symptoms. Pretreatment and follow-up MRIs were reported and scored independently by two experienced musculoskeletal radiologists. Tendinopathy was improved and the partial-thickness tear healed on 3 T MRI. The patient was able to return to national-level competition.
Article
Fifteen patients with identical symptoms of pain and tenderness at the tip of the greater trochanter are reviewed. Diagnosis by the referring doctor was usually osteoarthritis of the hip or sciatica, but localised tenderness and pain on resisted abduction were the only clinical signs. Radiographs were usually normal. Most cases were relieved by one or more local steroid injections. This disorder has much in common with tennis elbow, golfer's elbow, coccydynia and policeman's heel. We suggest that all these conditions may be traction syndromes.
Article
Chronic lateral epicondylitis (LE) induces cell apoptosis and autophagy, which lead to the reduction of tendon-derived cells in the torn tendon. Our previous study has shown that ultrasound-guided autologous tenocyte injection (ATI) to the torn tendon in patients with chronic resistant LE significantly improves pain, function, and structural repair at 1 year. This report is the continued assessment of the clinical outcomes of these patients at mean 4.5-year follow-up. Improvements in LE clinical function and structural repair after ATI will be maintained at mean 4.5-year follow-up. Case series; Level of evidence, 4. Patients with severe refractory LE underwent clinical evaluation and MRI before intervention. A patellar tendon needle biopsy was performed under local anesthetic, and tendon cells were expanded by in vitro culture. Autologous tenocytes were injected into the central tendinopathy identified at the common extensor tendon origin under ultrasound guidance on a single occasion. Patients underwent serial clinical evaluations for up to 5 years after ATI, including the visual analog scale (VAS) for pain, Quick Disabilities of the Arm, Shoulder and Hand (QuickDASH), Upper Extremity Functional Scale (UEFS), and grip strength. Post-ATI MRI scanning was performed at 1 year and final follow-up. A total of 16 patients (9 male, 7 female), aged between 37 and 63 years, were included in the study. The mean duration of symptoms before study recruitment was 29.24 months (range, 6-240 months). One patient elected to proceed to surgery 3 months after ATI due to reinjury at work, and 1 patient died of prostate cancer with metastases during the follow-up period. The mean final follow-up time for the remaining 15 patients was 4.51 years (range, 3.08-5.17 years). No complications were observed at the patellar tendon biopsy site for any patient. No adverse events, infection, or excessive fibroblastic reactions were observed in any patient at the injection site. Clinical evaluation revealed significant (P < .001) improvement in mean VAS pain score from 5.73 at initial assessment to 1.21 (78% improvement) at final follow-up. Mean QuickDASH, UEFS, and grip strength scores also significantly (P < .001) improved from initial assessment to final follow-up (from 45.88 to 6.61 [84%], from 31.73 to 9.20 [64%], and from 19.85 to 46.60 [208%], respectively). There was no difference in mean QuickDASH and UEFS scores at 1 year and final follow-up (P > .05); however, grip strength continued to improve (P < .001). A validated MRI scoring system indicated that the mean grade of tendinopathy at the common extensor origin improved significantly (P < .001) from initial assessment (4.31) to 1 year (2.88) and was maintained (P > .05) at final follow-up (2.87). At final follow-up, 93% of patients were either highly satisfied or satisfied with their ATI treatment. ATI significantly improved clinical function and MRI tendinopathy scores for up to 5 years in patients with chronic resistant LE who had previously undergone unsuccessful nonsurgical treatment. This study provides evidence for the midterm durability of ATI for treatment of LE tendinopathy. © 2015 The Author(s).