ArticlePDF Available

Prebreeding selection of rice with colored pericarp based on genotyping Rc and Pb genes

Authors:

Abstract and Figures

The research was aimed at developing prebreeding resources of Kazakhstan rice varieties with colored pericarp for breeding. During the study, hybrid analysis of inheritance of the trait “colored pericarp” in breeding material used for the work was performed. Rice genotypes with colored pericarp, as well as white rice varieties possessing important breeding traits and maturing under conditions of the republic, were selected from the collection of the Institute of Plant Biology and Biotechnology, Republic of Kazakhstan. Identification of allelic status of Rc (red pericarp) and Pb (anthocyanin pericarp) genes was performed for selected samples using the PCR method. When selecting parental forms for crossing, foreign rice varieties with colored pericarp (Rubin, Mavr, Black rice, etc.) were used as recipient forms. As donors, we used local white rice varieties of Kazakhstan breeding adapted to the soil and climate conditions of rice growing regions (Madina, Marzhan, Bakanasskiy, PakLi) as well as foreign varieties. The ability to set hybrid caryopses and the percentage of sterility were determined in obtained F1 rice hybrids. As a result, the most promising prebreeding material was selected, which will be used for breeding Kazakhstan rice varieties with colored pericarp.
Content may be subject to copyright.
49
ISSN 1022-7954, Russian Journal of Genetics, 2017, Vol. 53, No. 1, pp. 49–58. © Pleiades Publishing, Inc., 2017.
Original Russian Text © A.B. Rysbekova, D.T. Kazkeyev, B.N. Usenbekov, Zh.M. Mukhina, E.A. Zhanbyrbaev, I.A. Sartbaeva, K.Zh. Zhambakin, Kh.A. Berkimbay, D.S. Batayeva,
2017, published in Genetika, 2017, Vol. 53, No. 1, pp. 43–53.
Prebreeding Selection of Rice with Colored Pericarp Based
on Genotyping Rc and Pb Genes
A. B. Rysbekovaa, *, D. T. Kazkeyevb, B. N. Usenbekova, Zh. M. Mukhinac, **,
E. A. Zhanbyrbaevb, I. A. Sartbaevad, K. Zh. Zhambakina, Kh. A. Berkimbaya, and D. S. Batayevae
aInstitute of Plant Biology and Biotechnology, Almaty, 050040 Kazakhstan
bKazakh National Agrarian University, Almaty, 050010 Kazakhstan
cAll-Russia Scientific Research Institute of Rice, Krasnodar, 350921 Russia
dKazakh National Al-Farabi University, Almaty, 050040 Kazakhstan
eKazakh State Women’s Pedagogical University, Almaty, 050000 Kazakhstan
*e-mail: bakdaulet7@yandex.ru
**e-mail: agroplazma@gmail.com
Received January 14, 2016
AbstractThe research was aimed at developing prebreeding resources of Kazakhstan rice varieties with col-
ored pericarp for breeding. During the study, hybrid analysis of inheritance of the trait “colored pericarp” in
breeding material used for the work was performed. Rice genotypes with colored pericarp, as well as white rice
varieties possessing important breeding traits and maturing under conditions of the republic, were selected
from the collection of the Institute of Plant Biology and Biotechnology, Republic of Kazakhstan. Identifica-
tion of allelic status of Rc (red pericarp) and Pb (anthocyanin pericarp) genes was performed for selected sam-
ples using the PCR method. When selecting parental forms for crossing, foreign rice varieties with colored
pericar p (Rub in, Mavr, B lack rice, etc. ) wer e us ed as r ecip ient f orms. As d onors, we used lo cal wh ite rice var i-
eties of Kazakhstan breeding adapted to the soil and climate conditions of rice growing regions (Madina,
Marzhan, Bakanasskiy, PakLi) as well as foreign varieties. The ability to set hybrid caryopses and the percent-
age of sterility were determined in obtained F1 rice hybrids. As a result, the most promising prebreeding mate-
rial was selected, which will be used for breeding Kazakhstan rice varieties with colored pericarp.
Keywords: colored rice, hybridization, Rc and Pb genes, initial breeding material
DOI: 10.1134/S1022795416110119
INTRODUCTION
Rice is the most common cereal crop in the world.
It is used as food by more than 3 billion people, meet-
ing the need for more than 30% of food calories. Rice
crops are produced in 112 countries around the world
on an area of more than 150 million hectares, and the
annual production is 740 million tons, ranking third
after maize (1.02 billion tons) and wheat (750 million
tons) [1].
Rice is an important import-substituting and
export crop for the Republic of Kazakhstan, which is
the second largest producer of rice in the CIS after the
Russian Federation. According to the standards devel-
oped by the Kazakh Academy of Nutrition, the annual
demand for rice in Kazakhstan is 132.6 kilotons per
year (8.5 kg/year per person).
Kazakhstan is in the northernmost rice-growing
area in the world. The total area of engineering and
furnished systems for the cultivation of rice in the
Republic of Kazakhstan is about 225000 ha; of this
amount, 175000 ha are located in the Kyzylorda
region, which has 90% of Kazakhstan rice crops;
25000 ha are in South Kazakhstan; and 25000 ha are
in Almaty oblast. From 280 to 350 kilotons of raw rice
is produced in Kazakhstan every year [2].
The state register of breeding achievements
approved for use on the territory of the Republic of
Kazakhstan includes 27 varieties of rice, 13 of which
are varieties of domestic breeding. In most cases, com-
mercial varieties do not have any coloring, because for
a long time the selection was aimed at obtaining white
grains. However, to ensure food security in Kazakh-
stan it is necessary to have varieties of a special pur-
pose: glutinous, high amylose, and long-grain variet-
ies, as well as varieties with colored pericarp, which
have a high nutritional quality and a number of useful
features.
The coloring of rice grains is caused by a pigmenta-
tion of sclerenchyma and pericarp. It can vary within
wide limits—from magenta, red, brown, and yellow to
violet. Pigments detected in the aleurone layer of rice
grains have been described by many authors as a mix-
PLANT
GENETICS
50
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
RYSBEKOVA et al.
ture of anthocyanin components that belong to the
class of flavonoids. Phenolic compounds within the
composition of the rice pigment, such as anthocya-
nins, have high antioxidant activity [3]. The following
types of anthocyanins were identified in rice: cyani-
din-3-glucoside and peonidin-3-glucoside [4]; malvi-
din, pelargonidin-3,5-diglucoside, cyanidin-3-gluco-
side, and cyanidin-3,5-diglucoside [5]; cyanidin-3-
glucoside and pelargonidin-3-glucoside [6]. It was
shown that the polyphenol content depended on the
genotype and environment [7].
Rice with colored pericarp is useful to human
health. Cyanidin-3-glucoside and pelargonidin-3-
glucoside derived from rice pigment inhibit the activ-
ity of aldose reductase, preventing diabetes [6].
Anthocyanins, a part of black rice, which is used as a
dietary product, reduce the level of cholesterol and tri-
glycerides in the blood [8].
Unlike white polished rice, refined grains of col-
ored rice are rich in vitamins and minerals. Several
studies have revealed that black rice grains contain a
large amount of macro- and trace elements such as
iron, zinc, calcium, copper, and manganese [9].
Pericarp coloring of rice weevil is controlled by three
dominant genes: Prp-Purple pericarp; Rc-Brown peri-
carp; Rd-Red pericarp. Each gene has a dominant
gene inhibitor (I-Prp, I-Rc, and I-Rd, respectively),
which inhibits the formation of the colored pigment in
the pericarp and determines the white color. Pericarp
color intensity depends on the presence of genes and
their status in the genotype of the plant. Recessive
alleles rc, rd, and prp, as well as inhibitors genes, con-
trol white pericarp. It is known that the gene for red
grain color Rc provides a reddish brown pericarp. The
Rd gene is not capable of causing coloring by itself and
encodes a reddish brown coloring of the entire grain
surface in conjunction with Rc gene. Combinations of
different alleles of these loci are expressed in different
ways: RcRd—red coloring of the entire grain; Rcrd
gray-brown pericarp; rcRd—pink pericarp; Rc—brown-
ish red flecks. The Rc gene is localized in chromosome 7;
the Rd gene is located in chromosome 1 [10].
An intragenic marker of Rc gene was created
through the efforts of Russian scientists, which
improved the efficiency of the control of rice crops
from red-grain impurities in primary seed production
(in accordance with Russian GOST R 52325-2005,
red-grain forms are not allowed in crops of original
and elite rice seeds of white-grain varieties) [11].
Anthocyanin pigmentation of pericarp is the dom-
inant trait in rice and is pronounced in the period of
grain full maturity; it is controlled by two complemen-
tary genes PURPLE PERICARP A (Pp, Prpa, Prp1)
and PURPLE PERICARP B (Pb, Prpb, Prp2), which
are necessary for the pericarp coloring. The Pp gene is
localized in chromosome 1; the Pb gene is in chromo-
some 4 [12].
Intensive research works on rice with colored peri-
carp have been conducted at the International Rice
Research Institute (Philippines) and in China, Japan,
Thailand, Italy, the United States, and many rice-
growing countries.
Breeding work aimed at creating varieties with col-
ored pericarp with a high content of tocopherols,
which have antioxidant properties, has been carried
out in Russia (Institute of Rice, Krasnodar). Medium-
grain varieties Rubin and Karat and long-grain variety
Mars (red coloring of pericarp), as well as varieties
Mavr and Gagat (violet coloring of pericarp), were
taken to the state strain test.
The purpose of this work was studying the nature of
inheritance of the “colored pericarp” trait in the used
breeding material, hybridological analysis, and
molecular labeling of target genes, as well as creating
prebreeding resources of rice with colored pericarp for
the breeding of new Kazakhstan varieties.
MATERIALS AND METHODS
Varieties and collectible accessions of rice with
contrasting pericarp coloring served as studying mate-
rial (Table 1).
Experimental plants were seeded for hybridization
in three terms spaced by ten days to align the flowering
and grown in pots in the greenhouse. During hybrid-
ization, pneumo-castration of maternal forms and the
TVELL method of pollination were used. This
method consisted in the following. The paternal pani-
cle was placed in an isolator with a castrated maternal
panicle and pollinated by its shaking [13]. The result-
ing hybrids and parental forms were sown in the field,
in a hybrid nursery in Balkhash district of Almaty
oblast on an area of 0.5 ha. The analysis of structural
elements of hybrids and parental forms was performed
after harvesting.
DNA was isolated using chlorophyll-free seven-
day seedlings obtained by incubation on moistened
filter paper in the dark at 25–27°C. DNA was
extracted from the seedlings according to [14].
The following primers were used to identify the
allelic state of Rc gene in rice genotypes with contrast-
ing pericarp coloring:
(1) F1—GCAAGTGGAACGCGAAAAGT;
(2) R1—TTCCAATGTTCGTTAGAGGC;
(3) F2—ACAACACTGACACTGAAAGG;
(4) R2—GAAATCACCTTGGATGGCATCC [11].
Nucleotide primer sequence for Pb gene:
F 5'-GGGAGAAGCTCAACGAGATG;
R 5'-GGGTGGCAGATTCATCACTT [12].
PCR was performed in a T100 DNA thermocycler
(BioRad, United States). DNA amplification of Rc
gene marker was performed in the following way: 4
min at 94°C; 35 cycles at 94°C for 30 s, 58°C (62°C)
for 30 s, 72°C for 30 s; 8 min at 72°C. The annealing
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
PREBREEDING SELECTION OF RICE WITH COLORED PERICARP BASED 51
temperature was 62°C when two of the aforemen-
tioned primer pairs were used; it was 58°C when one
primer pair was used. Electrophoretic separation of
PCR products was performed in 1.5% agarose gel.
PCR was optimized experimentally for the identi-
fication of Pb gene. Electrophoretic separation of
PCR products of this marker was performed using 8%
polyacrylamide gel.
RESULTS
Identification of Allelic Status for Rc and Pb Genes
in Different Rice Genotypes
with Contrasting Pericarp Coloring by PCR
The rice collection at the Institute of Plant Biology
and Biotechnology consists of 300 samples obtained
from various local and foreign research institutions.
The gene pool of rice with colored pericarp has more
than 15 promising accessions. The vegetation period
of these accessions allows maturing under the condi-
tions of Almaty oblast of Kazakhstan, which makes it
possible to use them as the original parent material for
producing first Kazakhstan forms and lines of rice
with colored pericarp (Table 1).
PCR identification of Rc gene allelic status was
conducted using an allele-specific marker for three
accessions of white-grain and 11 accessions of red-
grain rice of Kazakhstan and foreign selection. The
results of identification are shown in Fig. 1.
The figure clearly shows that the PCR amplifica-
tion with only one pair of primers (F1, R1) clearly
amplified the 422 bp fragment of the dominant allele
of Rc gene only in red-grain accessions (Fig. 1a).
When PCR amplification was performed with two
pairs of primers (F1, R1 and F2, R2), both the domi-
nant allele Rc with a length of 422 bp and a recessive allele
rc with a length of 790 bp were amplified (Fig. 1b). PCR
analysis showed also that all studied red-grain acces-
sions of rice were homozygous for Rc gene, and white-
grain rice varieties were, of course, homozygous for rc
recessive allele.
The genetic difference in the Pb gene allele between
white-grain rice accessions and rice accessions with
anthocyanin pericarp was determined by optimized
PCR (Fig. 2). The following amplification mode was
optimal for identifying the Pb gene: 4 min at 94°C;
35 cycles at 94°C for 45 s, 60°C for 60 s, 72°C for
2min; 10 min at 72°C. PCR products were then incu-
bated at 37°C with the restriction enzyme BamHI
(Thermo Scientific). Composition of the PCR mix:
10 μL of PCR products; 18 μL of DNase and RNase-
free water; 2 μL of 10× Buffer BamHI; 1.5 μL of
BamHI enzyme.
Figure 2a shows clearly that the size of the PCR
product is 1200 bp for white-grain genotypes (Anait,
Bakanasskiy, Akdala), molecular polymorphism of
which is characterized by GT insertion in the locus.
BamH1 restriction enzyme cut the PCR product into
two fragments of 700 and 500 bp in the accessions with
anthocyanin coloring—Mavr, Black rice (China), and
Black rice (Philippines), which had the GT deletion
(Fig, 2b).
Table 1. Rice accessions with contrasting coloring of pericarp used for hybridization
* n/a—not named.
Accession Pericarp coloring Origin Subspecies Vegetation period, days
Mavr Anthocyanin Russia japonica 110 112
Black rice "Philippines "110 115
Yi r 5815 Red Ukrai ne "115 117
n/a Italy* "Italy indica 118 120
Rubin "Russia japonica 107– 110
Bakanasskyi White Kazakhstan "100– 105
Marzhan """ 110 115
KazNIIR 5 """ 105– 110
Madina """ 110 112
PakLi ""indica 112 115
Viola "Russia japonica 115 117
Lider """ 120125
Yan tar """ 11 4 117
Liman """ 115 117
Kurchanka """ 118 120
Anait """ 100– 106
52
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
RYSBEKOVA et al.
Obtaining Prebreeding Accessions of Rice
with Colored Pericarp Using Hybridization
In 2013, the hybridization of rice genotypes with
colored pericarp with white-grain Kazakhstan and
foreign varieties was carried out at the Institute of
Plant Biology and Biotechnology, using pneumo-cas-
tration and the TVELL method of pollination.
Use of the TVELL method increased significantly
the formation of hybrid kernels. Among 19 combina-
tions, 786 ovaries were pollinated and 270 F1 hybrid
kernels were obtained. The formation rate of hybrid
kernels in a greenhouse ranged from 4 to 72%; the
average value was 34% (Table 2).
The efficiency of hybridization, i.e., the formation
and filling of hybrid grains, dropped significantly and
Fig. 1. PCR identification of the allelic state of Rc gene in different rice genotypes with contrasting pericarp coloring. White-grain:
(1) PakLi; (3) Akdala; (6) VNIIR 10178; red-grain: (2) K1323, Uzbekistan; (4) n/a Italy; (5) K487, Kyrmyzy; (7) Yir 5818; (8) Ko
298 R; (9) Ko 296 R; (10) Red rice, Philippines; (11) Fisht krasnozernyi; (12) Krasnyi Miks, Kuban; (13) Rubin; (14) V 20 Red;
(15) Marzhan. (a) PCR with F1, R1 primers; (b) PCR with two primer pairs: F1, R1 and F2, R2.
123456 7 89101112131415M
1234567891011121314M
(a)
(b)
1000 bp
500 bp
Fig. 2. Identification of the allelic state of Pb gene in different rice genotypes with contrasting pericarp coloring using PCR (а)
and BamHI-restriction of Pb gene (b). White-grain: (1) Anait; (2) Bakanasskyi; (3) Akdala; with anthocyanin coloring: (4) Mavr;
(5) Black rice, China; (6) Black rice, Philippines.
123456M
(a) (b)
1000 bp
500 bp
Restriction enzyme BamHI
DNA fragments of gene Pb
Gene Pb
500 bp 700 bp
1200 bp
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
PREBREEDING SELECTION OF RICE WITH COLORED PERICARP BASED 53
sterility increased under uncontrolled conditions of
elevated temperature (Table 3).
The experiment showed that the highest formation
rate of hybrid kernels was observed in the following
combinations: n/a Italy/Marzhan, n/a Italy/Madina,
and Mavr/Lider (61–72%). The following combina-
tions had an average value of the formation rate (40–
55%): Black rice/Marzhan, Yir 5815/Bakanasskiy,
Mavr/Anait, Black rice/Anait, and Rubin/Marzhan.
Combinations Black rice/Yantar, Black rice/Viola,
and Black rice/KazNIIR 5 had the lowest formation
rate (4–40%). This work resulted in obtaining 270 full
hybrid grains.
In 2014, the hybrid grains were sown in the green-
house for reproduction of the first generation hybrids.
After maturing, each hybrid combination was har-
vested separately and the sterility of F1 plants was
determined. The highest fertility in comparison with
rice accessions of anthocyanin coloring (Black rice,
Mavr) was shown by F1 red-grain accessions, for
which this indicator ranged from 6 4 to 26%. A total of
4003 F1 hybrid kernels were obtained, which have been
a valuable raw material for further research on the
breeding of Kazakh rice varieties with colored peri-
carp.
Hybridological Analysis of the Inheritance
of Pericap Coloring in F2 Hybrids
In 2015, a hybrid nursery of F1 rice hybrids with
colored pericarp and their parental forms was laid in
field conditions of Almaty oblast for the selection of
promising forms from disjoining F2 populations.
To study the nature of inheritance and the disjoin-
ing of pericarp coloring in F2, 2320 plants from 19
hybrid combinations were analyzed.
Hybridological analysis on the red coloring of peri-
carp showed that all obtained hybrid grains had a red
pericarp color in the F1 generation. The disjoining of
the phenotype into two groups with red and white
pericarp was observed in the F2 generation. Pericarp
coloring became pronounced at the end of wax ripe-
ness of grains. After full ripening, each F2 plant was
individually visually analyzed for pericarp coloring by
separating the lemmas (Fig. 3).
Plants carrying the dominant genes had intensely
colored weevils, which were assigned to the red-grain
class. In F2 hybridological analysis, the χ2 (chi-square)
test was used to ensure the reliability of the detected
deviation from the theoretically expected distribution
(Table 4). The disjoining of all analyzed F2 hybrids
(Yir 5815/Bakanasskiy, Yir 5815/Marzhan, Yir
5815/Kurchanka, n/a Italy/Madina, n/a Italy/Lider,
n/a Italy/Marzhan, Rubin/Marzhan, Rubin/PakLi,
Table 2. Hybridization of promising rice genotypes with colored pericarp in greenhouse using TVELL method
Cross combination Number of pollinated ovaries Number of formed kernels Percentage of setting
Yir 5815/Bakanasskyi 76 41 54
Yi r 5815 /Mar zhan 79 16 18
Yi r 5815 /Ku rch anka 48 15 31
n/a Italy/Madina 18 12 66
n/a Italy/Lider 41 6 14
n/a Italy/Marzhan 44 32 72
Rubin/Marzhan 30 12 40
Rubin/PakLi 33 7 21
Rubin/Anait 22 5 23
Mavr/Lider 26 16 61
Mavr/Madina 59 20 34
Mavr/Anait 25 12 48
Mavr/Bakanasskyi 70 23 32
Black rice/Liman 35 8 22
Black rice/Yantar 62 7 10
Black rice/KazNIIR 5 24 1 4
Black rice/Anait 61 26 42
Black rice/Marzhan 18 10 55
Black rice/Viola 15 1 6
Total for 19 combinations 786 270 34
54
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
RYSBEKOVA et al.
Table 3. The amount of obtained F1 hybrid kernels and their sterility under uncontrolled conditions
Cross combination Obtained kernels, pcs. Sterility, %
Yir 5815/Bakanasskyi 565 62.4
Yi r 5815 /Marzha n 92 6 4 .4
Yir 5815/Kurchanka 55 52.1
n/a Italy/Madina 50 48.4
n/a Italy/Lider 88 57.8
n/a Italy/Marzhan 674 72.1
Rubin/Marzhan 608 40.6
Rubin/PakLi 52 26.7
Mavr/Lider 217 74.2
Mavr/Madina 108 86.1
Mavr/Anait 213 52.7
Mavr/Bakanasskyi 114 86.6
Black rice/Liman 228 36.1
Black rice/Yantar 160 59.2
Black rice/KazNIIR 5 80 54.0
Black rice/Anait 53 55.4
Black rice/Marzhan 504 51.1
Black rice/Viola 142 40.5
and Rubin/Anait) in the second generation with the
dominant red and recessive white pericarp was statisti-
cally consistent with the ratio of 3 : 1 at high reliability
of actually obtained and theoretically expected values
(0.20 > P > 0.95).
It can be seen from Fig. 4 that F1 hybrids obtained
by crossing variety Mavr (purple pericarp) and white-
grain forms had incomplete anthocyanin coloring of
pericarp. F2 hybrids obtained by different combina-
tions Mavr/Lider, Mavr/Madina, Mavr/Anait,
Mavr/Bakanasskiy, Mavr/Kurchanka, Black rice/
Liman, Black rice/Yantar, Black rice/KazNIIR 5,
Black rice/Anait, and Black rice/Marzhan had three
different colorings of pericarp—complete anthocy-
anin, partly anthocyanin, and white.
Thus, when rice with anthocyanin coloring was
crossed with white-grain varieties, the inheritance of col-
oring in F1 was observed to be incompletely dominant or
intermediate (co-dominant). The results of calculations
for the hybridological analysis of the F2 generation
between anthocyanin and white colorings of pericarp
showed that the ratio between grains with colored and
uncolored pericarp was nearly 3 : 1 in all hybrids; χ2 was
within 0–0.547 at probability 0.90 > P > 0.2 (Table 5).
Further work with the hybrid material was carried
out according to pedigree. Lines with colored pericarp
(red and anthocyanin) and with the desired beneficial
economically valuable traits were selected from the sec-
ond generation for breeding. Lines were classified into
Oryza sativa L. rice varieties according to A.G. Lyak-
Fig. 3. Disjoining of pericarp coloring in F2 hybrids of
cross combination Yir 5815 × Bakanasskyi.
Yir 5815 ×♂ Bakanasskyi
F1
F2
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
PREBREEDING SELECTION OF RICE WITH COLORED PERICARP BASED 55
Table 4. Disjoining of F2-generation hybrids by red and white pericarp coloring
RP—red pericarp; WP—white pericarp. Upper line—the actual number; lower line—the expected number (for Tables 4, 5).
Cross combinations
Amount of plants, pcs. χ2 (3 : 1) Р
RP WP total
Yir 5815/Bakanasskyi 94 32 126 0.003 0.95
94.5 31.5 126
Yi r 5815 /Marzha n 64 21 85 0.003 0.95
63.75 21.25 85
Yi r 5815 /Ku rchank a 47 14 61 0.136 0.95–0.90
45.75 15.25 61
n/a Italy/Madina 155 62 217 1.476 0.50–0.20
162.75 54.25 217
n/a Italy/Lider 16 4 20 0.266 0.90–0.50
15 5 20
n/a Italy/Marzhan 215 78 293 0.410 0.90–0.50
219.75 73.25 293
Rubin/Marzhan 218 63 281 0.997 0.50–0.20
210.75 70.25 281
Rubin/PakLi 182 61 243 0.001 0.95
182.25 60.75 243
Rubin/Anait 33 8 41 0.658 0.50–0.20
30.75 10.25 41
Table 5. Disjoining of F2-generation hybrids by anthocyanin and white pericarp coloring
AP—anthocyanin pericarp; WP—white pericarp.
Cross combinations
The amount of plants, pcs. χ2 (3 : 1) Р
AP WP total
Mavr/Anait 18 6 24 00
18 6 24
Mavr/Bakanasskyi 27 11 38 0.315 0.90–0.50
28.5 9.5 38
Black rice/Yantar 69 25 94 0.127 0.90–0.50
70.5 23.5 94
Black rice/KazNIIR 5 41 17 58 0.547 0.50–0.20
43.5 14.5 58
Black rice/Anait 40 11 51 0.320 0.90–0.50
38.25 12.75 51
Black rice/Marzhan 52 20 72 0.296 0.90–0.50
54 18 72
Black rice/Viola 81 23 104 0.461 0.50–0.20
78 26 104
56
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
RYSBEKOVA et al.
Fig. 4. Disjoining of hybrid F2 populations in anthocyanin coloring of pericarp.
Mavr ×♂ PakLi
F1
F2
Fully
anthocyanin
Partially
anthocyanin
White
Mavr ×♂ Kurchanka
F1
F2
Fully
anthocyanin
Partially
anthocyanin
White
hovkin (2005) to facilitate the work with an extensive
amount of hybrid material (Table 6).
DISCUSSION
Genotypes of rice with colored pericarp and white-
grain rice varieties from the genetic collection of the
Institute of Plant Biology and Biotechnology having
important breeding characteristics and maturing
under the conditions of Kazakhstan were selected
during the study.
Identification of the allelic status of Rc (red peri-
carp) and Pb (anthocyanin pericarp) genes was carried
out in selected samples using PCR. It was shown in
Fig. 1 that all studied original parental forms with red
pericarp are homozygous for Rc gene.
Results for Pb gene alleles identified by PCR
showed that white-grain accessions were characterized
by one band of 1200 bp, whereas the accessions with
anthocyanin coloring had two bands—700 and 500 bp.
Thus, the allelic difference detected in the studied
loci using indicated PCR markers made it possible to
rank the breeding accessions of rice according to peri-
carp coloring and determine the allelic status of these
loci in studied rice genotypes.
The value of the technology lies in the fact that
such a ranking is available at any stage of ontogeny,
including a long time before the phenotypic expres-
sion of the feature (the formation of a weevil). This
opens up the prospects for an active use of this method
in breeding and seed production, for example, to
monitor the purity of the original seeds from red-grain
impurities in the breeding nurseries even in the early
stages of germination as soon pips appear on the soil
surface.
Foreign accessions of rice with colored pericarp
(Rubin, Mavr, Black rice, etc.) were used as recipient
forms for the selection of parental pairs to increase the
technological and biochemical properties of grain.
Local white-grain varieties of Kazakhstan breeding
adapted to soil and climatic conditions of rice-growing
regions (Madina, Marzhan, Bakanasskiy, and PakLi)
and foreign varieties were used as donors. Among red-
grain forms, the accession n/a Italy had the greatest
ability to form hybrid kernels; the average percentage
of formation in three combinations was 50.66. An
average value of this trait was detected in the Yir 5815
genotype (34.33%). The smallest percentage of kernels
was detected in the Rubin variety (28%). The ability of
Russian variety Mavr to form hybrid kernels averaged
40.3%, while it was 23.1% for the accession Black rice
(Philippines) (Table 2).
The percentage of obtained sterile F1 rice hybrids
was determined during the study (Table 3). The high-
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
PREBREEDING SELECTION OF RICE WITH COLORED PERICARP BASED 57
Table 6. The botanical classification of obtained rice hybrids according to varieties
Combination Variety, number of panicles
F2 Rubin/Marzhan gilvas, 94
miliacea, 31
subfusca, 13
sundensis Koern., 17
pyrocarpo Alef., 53
subpyrocarpo, 10
F2 n/a Italy/Marzhan bansmatica Gust., 42
subphilippensis Port., 28
chombhanica Gust., 141
F2 n/a Italy/Lider bansmatica Gust., 16
F2 n/a Italy/Madina mutica Vav., 24
aristata Vav., 55
breviaristata Vav., 45
F2 n/a Italy/Kurchanka subphilippensis Port., 5
bansmatica Gust., 26
F2 Rubin/PakLi sundensis Koern., 114
subpyrocarpo Koern., 50
F2 Rubin/Anait pyrocarpo Alef., 9
subpyrocarpo Koern., 9
sundensis Koern., 15
F2 Black rice/Marzhan atrofusca Koern., 8
pyrocarpo Alef., 6
F2 Black rice/Madina atrofusca Koern., 21
pyrocarpo Alef., 3
pseudovialonica, 24
F2 Black rice/Barakat para-Gastral Port., 13
pseudovialonica, 11
F2 Black rice/Anait atrofusca Koern., 4
pseudovialonica, 5
sundensis Koern., 1
F2 Black rice/Liman pseudovialonica, 96
F2 Black rice/Yantar sundensis Koern., 9
F2 Black rice/KazNIIR 5 sundensis Koern., 3
F2 Mavr/Yantar peradenica Gust., 10
F2 Mavr/Arborio sordidal Gust., 75
F2 Mavr/Anait peradenica Gust., 18
F2 Mavr/Kurchanka subpyrocarpo Koern., 29
F2 Mavr/Lider peradenica Gust., 22
F2 Arborio/Black rice pseudovialonica, 16
para-gastral Port., 6
F2 Yir 5815/Kurchanka sundensis Koern., 47
F2 Yir 5815/Bakanasskyi pyrocarpo Alef., 57
sundensis Koern., 36
F2 Yir 5815/Marzhan pyrocarpo Alef., 57
sundensis Koern., 36
F3 Yir 5815/Bakanasskyi pyrocarpo Alef., 55
sundensis Koern., 8
58
RUSSIAN JOURNAL OF GENETICS Vol. 53 No. 1 2017
RYSBEKOVA et al.
est sterility was shown by hybrids with Mavr and n/a
Italy maternal forms. It is known that the accession
n/a Italy belongs to the indica subspecies. Low plump-
ness is a serious problem in the implementation of
intersubspecific rice hybrids in production. The num-
ber of filled spikelets in intersubspecific hybrids does
not exceed 40%; it is much higher in intraspecific
hybrids—up to 90% for indica/indica and up to 92%
for japonica/japonica [15].
A high level of sterility was noted for cross combi-
nations involving n/a Italy and Mavr genotypes: 59.43
and 74.9%, respectively. Sterility of cross combina-
tions with Rubin and Black rice genotypes was lower
than that for n/a Italy and Mavr.
All obtained F1-generation hybrids were uniform.
Hybrids with a red pericarp had a full dominance of
the trait, and hybrids with anthocyanin coloring were
characterized by incomplete dominance. Further
study of the nature of inheritance and disjoining of
pericarp coloring in the obtained 2320 plants from 19
hybrid combinations of F2 hybrids showed that the dis-
joining with a dominant red (or black) and a recessive
white pericarp corresponds statistically to 3 : 1.
Thus, the most promising prebreeding material was
selected according to the research results, which will
be used in breeding new Kazakhstan varieties of rice
with colored pericarp.
REFERENCES
1. Dzyuba, V.A., Genetika risa (Genetics of Rise), Kras-
nodar, 2004.
2. Strategicheskii plan razvitiya risovodstva v RK: novye gor-
izonty risovodstva (Strategic Plan for the Development
of Rice Growing in Kazakhstan: New Horizons of Rice
Growing). http://dknews.kz/novye-gorizonty-
risovodstva.htm (Accessed November 8, 2012)
3. Goffman, F.D. and Bergman, C.J., Rice kernel phenolic
content and its relationship with antiradical efficiency, J.
Sci. Food Agric., 2004, vol. 84, no. 10, pp. 1235–1240.
4. Hu, C., Zawistowski, J., Ling, W., and Kitts, D.D.,
Black rice (Oryza sativa L. indica) pigmented fraction
suppresses both reactive oxygen species and nitric oxide
in chemical and biological model systems, J. Sci. Food
Agric., 2003, vol. 51, pp. 5271–5277.
5. Zhang, M.W., Guo, B.J., Zhang, R.F., et al., Separa-
tion, purification and identification of antioxidant com-
positions in black rice, Agric. Sci. China, 2006, vol. 5,
no. 6, pp. 431–440.
6. Yawadio, R., Tanimori, S., and Morita, N., Identifica-
tion of phenolic compounds isolated from pigmented
rice’s and their aldose reductase inhibitory activities,
Food Chem., 2007, vol. 101, no. 4, pp. 1616—1625.
7. Nyein N. Htwe, Varit Srilaong, Krittika Tanprasert,
et al., Effects of storage time and temperature on radical
scavenging activities and bioactive compounds in colored
rice varieties, J. Food, Agric. Environ., 2010, vol. 8,
no. 3–4, pp. 26–31.
8. Zawistowski, J., Kopec, A., and Kitts, D.D., Effects of
a black rice extract (Oryza sativa L. indica) on choles-
terol levels and plasma lipid parameters in Wistar Kyoto
rats, J. Funct. Foods, 2009, vol. 1, no. 1, pp. 50–56.
9. Meng, F., Wei, Y., and Yang, X., Iron content and bio-
availability in rice, J. Trace Elem. Med. Biol., 2005, vol. 18,
no. 4, pp. 333–338.
10. Sweeney, M.T., Thomson, M.J., Pfeil, B.E., and
McCouch, S., Red-handed: Rc encodes a basic helix—
loop—helix protein conditioning red pericarp in rice,
Plant Cell, 2006, vol. 18, pp. 283–294.
11. Tokmakov, S.V., Mukhina, Zh.M., Bogomaz, D.I.,
and Matveeva, T.V., Development of molecular marker
for assessment of intraspecific polymorphism of Rc
gene conditioning red pericarp in rice, Oryza sativa L.,
Ekol. Genet., 2011, vol. 9, no. 3, pp. 57–67.
12. Md Mominur Rahman, Kyung Eun Lee, Eun Sun Lee,
et al., The genetic constitutions of complementary genes
Pp and Pb determine the purple color variation in peri-
carps with cyanidin-3-O-glucoside depositions in black
rice, J. Plant. Biol., 2013, vol. 56, pp. 24–31.
13. Los’, G.D., A promising method of rice hybridization,
S.-kh. Biol., 1987, no. 12, pp. 107–109.
14. Murray, M.G. and Thompson, W.F., Rapid isolation of
high molecular weight plant DNA, Nucleic Acids Res.,
1980, vol. 10, pp. 4321–4325.
15. Zhang, Q., Zhou, Z.Q., and Yang, G.P., Molecular
marker heterozygosity and hybrid performance in
indica and japonica rice, Theor. Appl. Genet., 1996,
vol. 93, p p. 1218– 1224.
Translated by M. Shulskaya
... In Japan, improved pigmented rice variety was developed by crossing black rice variety 'Okunomurasaki' with high quality-white rice variety 'Koshihikari' [137]. In Kazakhstan, adapted pigmented rice variety was developed by crossing pigmented and non-pigmented rice varieties [138]. In Thailand, a new deep purple rice variety 'Riceberry' was developed by crossing between non-glutinous purple rice and an aromatic white jasmine rice variety [139][140]. ...
Article
Full-text available
Rice (Oryza sativa L.) is the primary staple food for half of the world population. It is generally classified based on the grain color into black, red, purple, brown, green, and white. These colored rice are determined by the composition and concentration of anthocyanin pigments in different layers of aleurone, pericarp, and seed coat. Anthocyanins are also accumulated in various tissues of the rice plants, mostly in the grain, but are also presents in leaves, leaf sheath, floral organ, and hull. The type and concentration of the anthocyanins in rice tissues are influenced by the cultivars and developmental stages. Anthocyanin-enriched rice is related to the health effects, including antioxidant, antibacterial, and anti-inflammation activities that potentially use as functional food ingredients, dietary supplements, and natural colorants. Structural and regulatory genes are involved in anthocyanin biosynthesis of rice. Various molecular biology techniques have been applied to improve productivity, nutritional contents, and market value of pigmented rice. This review focused on the genetics, biochemistry and biophysical analysis of anthocyanin in rice that will facilitate rice breeding program to develop new high-yield pigmented rice varieties.
... The result was similar with Yang et al. (2009) in Rc gene which RID14, an InDel marker developed based on the 14-bp deletion, cosegregated with the color of the pericarp in F 2 population of the weedy rice line W16 (red pericarp) and 02428 (white pericarp) in which homozygous red pericarp genotype, homozygous white pericarp genotype and heterozygous red pericarp genotype individuals can be identified. Rysbekova et al. (2017) analyze several crosses of red and white cultivars. All the parental forms with red pericarp are homozygous for Rc gene. ...
Thesis
Full-text available
Red pericarp color in rice is increasing in popularity due to its antioxidant source which promotes several health benefits. The functional Rc gene located in chromosome 7, is a domestication-related gene which is reported to control the red color in the pericarp. However, Rc together with Rd gene is also reported to involve in increasing the red color in the pericarp. The study aimed to find and evaluate DNA marker for Rc gene from published journals, develop marker for Rd gene and validate Rc and Rd markers using the segregating BC 1 F 2 population of RD49 (white pericarp) and Red Hawm (red pericarp). Results showed that the reported Indel-Rc-F/Indel-Rc-R and the designed Rd-F3/Rd-R3 for Rc and Rd gene, respectively, can distinguished between donor parent Red Hawm and recurrent parent RD49. Moreover, Indel-Rc and Rd-F3/ Rd-R3 markers accurately anneal to Rc and Rd gene, respectively. Results in validation showed that Indel-Rc-F/Indel-Rc-R primer in BC 1 F 2 plant population and BC 1 F 3 seed families followed the 1:2:1 genotypic ratio and 3:1 phenotypic ratio respectively, for single dominant gene. Indel-Rc marker showed cosegregation in the phenotype of the BC 1 F 3 seed families which have red and white pericarp. The designed Rd-F3/Rd-R3 marker for Rd gene failed to cosegregate with the phenotype resulting in both red and white pericarp in each Rd H Rd H , Rd H Rd D and Rd D Rd D genotypes. Based from these results, only Rc/rc gene is involved in red and white pericarp coloration in Red Hawm and RD49 population. The efficiency and accuracy of Indel-Rc marker can be used in molecular-assisted backcrossing to improve RD49 white to red pericarp in the future.
... A black rice line has been developed in the genetic background of a leading Japanese white rice variety (Koshihikari); which has eating quality superior to that of the widely cultivated black rice variety "Okunomurasaki" (Maeda et al., 2014). Crosses have been initiated between pigmented and non-pigmented varieties to develop pigmented varieties adapted to the growing conditions in Kazakhstan (Rysbekova et al., 2017). The Thai aromatic, deep purple indica-type rice variety "Riceberry" has developed a reputation for its healthpromoting properties. ...
Article
Full-text available
Improving the nutritional quality of rice grains through modulation of bioactive compounds and micronutrients represents an efficient means of addressing nutritional security in societies which depend heavily on rice as a staple food. White rice makes a major contribution to the calorific intake of Asian and African populations, but its nutritional quality is poor compared to that of pigmented (black, purple, red orange, or brown) variants. The compounds responsible for these color variations are the flavonoids anthocyanin and proanthocyanidin, which are known to have nutritional value. The rapid progress made in the technologies underlying genome sequencing, the analysis of gene expression and the acquisition of global ‘omics data, genetics of grain pigmentation has created novel opportunities for applying molecular breeding to improve the nutritional value and productivity of pigmented rice. This review provides an update on the nutritional value and health benefits of pigmented rice grain, taking advantage of both indigenous and modern knowledge, while also describing the current approaches taken to deciphering the genetic basis of pigmentation.
... The second method for scoring Rc was based off the protocol of Rysbekova et al. (2017) and used 2 sets of primer pairs: Rc_wtF1 with Rc_wtR1, and Rc_delF3 with Rc_delR3 (Supplementary Table S2). Thermocycler conditions for both reactions were as follows: denaturation at 94 °C for 2 min followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s, and elongation at 72 °C for 30 s. PCR was finished with elongation at 72 °C for 7 min and held at 4 °C. ...
Article
Full-text available
Weedy relatives of crop species infest agricultural fields worldwide, reducing harvests and threatening global food security. These weeds can potentially evolve and adapt through gene flow from both domesticated crop varieties and reproductively compatible wild relatives. We studied populations of weedy rice in Thailand to investigate the role of introgression from cultivated and wild rice in their evolution. We examined 2 complementary sources of genetic data: allelic variation at 3 rice domestication genes (Bh4, controlling hull color; Rc, controlling pericarp color and seed dormancy; and sh4, controlling seed shattering), and 12 previously published SSR markers. Sampling spanned 3 major rice growing regions in Thailand (Lower North, North East, and Central Plain) and included 124 cultivated rice accessions, 166 weedy rice accessions, and 98 wild rice accessions. Weedy rice strains were overall closely related to the cultivated varieties with which they co-occur. Domestication gene data revealed potential adaptive introgression of sh4 shattering alleles from wild rice. Introgression of potentially maladaptive rc crop alleles (conferring reduced dormancy) was also detected, with the frequency of the crop allele highest in northern populations. Although SSR markers also indicated introgression into weed populations from wild and cultivated rice, there was little overlap with domestication genes in the accessions showing admixed ancestry. This suggests that much of the introgression we detected at domestication genes most likely reflects past introgression rather than recent gene flow. This finding has implications for understanding long-term gene flow dynamics between rice and its weedy and wild relatives, including potential risks of transgene escape.
Article
Full-text available
Red rice is the worst field weed in all rice-cultivation areas. Early diagnosis of red rice in primary seed breeding program is an overriding task, which solution directly influences the quality of the rice seeds. Red and red-brown colors of pericarp are determined by two loci at least: Rc and Rd, expressing in conjunction with the Rc gene. In this study we have developed an intragenic codominant molecular marker for the Rc gene and tested it with contrasting as to the seed colour rice varieties examined feature. The efficacy of the marker has been shown for 1142 families of rice, each sample containing 120 plants.
Article
Full-text available
Colored rice is a potential source of antioxidants and bioactive compounds, particularly anthocyanins, polyphenols and carotenoids, which have potent radical scavenging property. In this study, we investigated the radical scavenging activity, total anthocyanin, β-carotene and free, soluble conjugated and insoluble bound phenolic contents of two colored (black and red) rice varieties, Red Hom Mali and Khao Hom Nil, during storage at 20, 30 and 40°C for up to four months. The radical scavenging activity of both rice cultivars and β-carotene content of black rice increased during storage. Black rice stored at 40°C and red rice stored at 20°C showed the highest radical scavenging activity. Total anthocyanin contents of both varieties decreased only slightly with storage with no significant differences with that before storage. In contrast, free, soluble conjugated and insoluble bound forms of polyphenols significantly decreased with storage but storage temperature had no significant effect. The results illustrate the beneficial effect of storage on radical scavenging activity of colored rice due mainly to increased carotenoid content together with relatively stable levels of anthocyanins. Storage temperature had differential effects on the two varieties. These findings could guide growers and traders in enhancing the nutraceutical value of colored rice.
Article
Full-text available
The purple pericarp color in rice was controlled by two dominant complementary genes, Pb and Pp. Crossing black rice ‘Heugnambyeo’ variants with three varieties of white pericarp rice gave a segregation ratio of 9 purple: 3 brown: 4 white. The Pp genes were segregated by homozygous PpPp alleles for the dark purple pericarps, heterozygous Pppp alleles for the medium and mixed purple pericarps, and homozygous pppp alleles for either brown or white pericarps with a 1 PpPp: 2 Pppp: 1 pppp segregation ratio, indicating that the Pp allele in rice is incompletely dominant to the recessive pp allele. Among the purple seeds, the amount of cyanidin-3-O-glucoside was higher in the dark purple seeds (Pb_PpPp) than in the medium purple seeds (Pb_Pppp). Moreover, no cyanidin-3-glucoside was detected in brown (Pb_pppp) or white pericarp seeds (pbpbpppp). These findings indicated that the level of cyanidin-3-glucoside was determined by the copy number of the Pp allele. Further genotype investigation of the F3 progeny demonstrated that the dominant Pb allele was present in either purple or brown pericarp. A 2-bp (GT) deletion from the DNA sequences of the dominant and functional Pb was found in the same DNA sequences of the recessive and non-functional pb allele. These findings suggested that the presence of at least a dominant Pb allele was an essential factor for color development in rice pericarps. In conclusion, the Pp allele in rice is incompletely dominant to the recessive pp allele; thus, the number of dominant Pp alleles determines the concentration of cyanidin-3-O-glucoside in black rice.
Article
An essential assumption underlying markerbased prediction of hybrid performance is a strong linear correlation between molecular marker heterozygosity and hybrid performance or heterosis. This study was intended to investigate the extent of the correlations between molecular marker heterozygosity and hybrid performance in crosses involving two sets of rice materials, 9 indica and 11 japonica varieties. These materials represent a broad spectrum of the cultivated rice gene pool including landraces, primitive cultivars, historically important cultivars, modern elite cultivars and parents of superior hybrids. Varieties within each set were intermated in all possible nonreciprocal pairs resulting in 36 crosses in the indica set and 55 in the japonica set. The F1s and their parents, 111 entries in total, were examined for performance of seven traits in a replicated field trial. The parents were surveyed for polymorphisms using 96 RFLP and ten SSR markers selected at regular intervals from a published molecular marker linkage map. Molecular marker genotypes of the F1 hybrids were deduced from the parental genotypes. The analysis showed that, with very few exceptions, correlations in the indica dataset were higher than in that of their japonica counterparts. Among the seven traits analyzed, plant height showed the highest correlation between heterozygosity and hybrid performance and heteorsis in both indica and japonica datasets. Correlations were low to intermediate between hybrid performance and heterozygosity (both general and specific) in yield and yield component traits in both indica and japonica sets, and also low to intermediate between specific heterozygosity and heterosis in the indica set, whereas very little correlation was detected between heterosis and heterozygosity (either general or specific) in the japonica set. In comparison to the results from our previous studies, we concluded that the relationship between molecular marker heterozygosity and heterosis is variable, depending on the genetic materials used in the study, the diversity of rice germplasms and the complexity of the genetic basis of heterosis.
Article
This study was designed to evaluate the efficacy of an anthocyanin pigmented rice (e.g. black rice) to mitigate the onset of hypercholesterolemia in rats-fed atherogenic diets. Male Wistar (n=10/group) rats were fed with atherogenic diets containing 0.5% cholesterol in the presence and in the absence of bile salt (e.g. 0.05% cholic acid) along with a standardized black rice extract (BRE) (e.g. 3%, w/w). All animals were individually housed in stainless steel cages and fed with the experimental diets during a 12-h period for 10weeks. Body weights of rats were measured every week of the experiment. After 10weeks fed on experimental diets, rats were sacrificed and plasma total cholesterol, HDL and LDL cholesterol and triacylglycerols were measured immediately. The total cholesterol (TC) content in the liver, heart and aorta, and the concentration of triacylglycerol (TAG) were measured after lipid extraction using Folch method. Rats fed with 0.5% cholesterol containing diets which also included bile salt exhibited a considerably more severe hypercholesterolemia than counterparts fed diets containing only 0.5% cholesterol. The inclusion of the BRE in diets significantly (p
Article
To separate, purify and identify the antioxidative compositions of black rice, using total antioxidation capacity (TAC) as an activity-monitoring parameter, different fractions of black rice antioxidative extracts were obtained using solvents of different polarities such as petroleum ether, chloroform, ethyl acetate and normal butyl alcohol. The main antioxidative components were separated from the strongest antioxidative fractions by using Sephadex LH-20 resin and the structures were analyzed by ultraviolet-vis, infra-red, ESI-MS, 1H-NMR and 13C-NMR spectrums. Results showed that the water fraction and normal butyl alcohol antioxidative extract fraction of black rice had the strongest antioxidation capacities and their TACs reached 383 and 392 ku g−1, respectively. Four main antioxidative components were separated from the water fraction and their TACs reached 976, 878, 1134 and 1 087 ku g−1, respectively. The spectroscopy analysis indicated that the four active components of the antioxidative extract of black rice were four anthocyanin compounds of malvidin, pelargonidin-3, 5-diglucoside, cyaniding-3-glucoside and cyaniding-3, 5-diglucoside. It is concluded that the anthocyanin compounds are the most important substantial foundations for antioxidation.
Article
Two anthocyanins (cyanidin-3-O-β-glucoside and peonidin-3-O-β-glucoside) and other phenolic (ferulic acid) were, respectively isolated from black and pigmented brown rices (Oryza sativa L. japonica) and their complete structures were determined by spectroscopic analyses (H NMR, C NMR and MALDI MASS). The HPLC profile of anthocyanins extracted from black rice showed cyanidin-3-O-β-glucoside as the first peak (85%) and peonidin 3-O-β-d-glucoside as the second (15%), while that of pigmented brown rice showed ferulic acid as the first peak (85.7%) and tocols as the second (14.3%). Several tocols were isolated and identified from the unsaponifiable fractions of both rices having some difference on their structures and amounts. The aldose reductase inhibitory activity of isolated compounds was in the following decreasing order: cyanidin-3-glucoside > quercetin > ferulic acid > peonidin-3-glucoside > tocopherol.All isolated compounds showed significant inhibitory activity against aldose reductase suggesting that both pigmented rices might contribute significantly in combating diabetic complications as health-promoting food ingredients in food processing.
Article
Plant phenolics exert beneficial effects on human health and may also prevent oxidative deterioration of food. Two field experiments were carried out for characterising phenolics in rice. The first assay was conducted in 1999 and 2000 in Beaumont, TX and included five light-brown, two purple and 10 red pericarp coloured cultivars. 'Bran colour' was highly statistically significant for both bran phenolic concentration and antiradical efficiency (p < 0.001). 'Year' and its interaction with bran colour were not significant for the analysed traits, suggesting that seasonal differences and their interactions may not affect phenolic content or antiradical efficiency. The accessions ranged from 3.1 to 45.4 mg gallic acid equivalents (GAE) g-1 bran and from 10.0 to 345.3 micromolar trolox equivalents (TE) g-1 bran for total phenolic content and antiradical efficiency respectively. The light-brown bran genotypes exhibited the lowest values for phenolic content and antiradical efficiency, whereas red bran ones displayed ca 10 times higher total phenolic content and more than 50 times higher tannin content than light-brown ones. The two purple lines showed either low or high values for the studied traits. Antiradical efficiency of rice bran extracts was highly positively correlated with total phenolic content (r = 0.99***), suggesting that phenolics are the main compounds responsible for the free radical-scavenging activity in rice bran extracts. In the second field experiment (Stuttgart, AR, 2001 and Beaumont, TX, 2000), 133 coloured rice cultivars were analysed for total phenolic content in whole grain. The accessions showed a large variation for total phenolics, ranging from 0.69 to 2.74 mg GAE g-1 grain. The data confirmed previous results suggesting bran colour as the main factor affecting phenolic concentration in rice kernel and seasonal effects and their interactions as not significant. The results also confirm that within red and purple bran groups can be found the highest phenolic concentrations in rice kernel.