Content uploaded by Marcelo Leite da Veiga
Author content
All content in this area was uploaded by Marcelo Leite da Veiga on Oct 04, 2017
Content may be subject to copyright.
Contents lists available at ScienceDirect
Redox Biology
journal homepage: www.elsevier.com/locate/redox
Research Paper
Chronic aspartame intake causes changes in the trans-sulphuration
pathway, glutathione depletion and liver damage in mice
Isabela Finamor
a
, Salvador Pérez
a
, Caroline A. Bressan
b
, Carlos E. Brenner
b
, Sergio Rius-Pérez
a
,
Patricia C. Brittes
c
, Gabriele Cheiran
d
, Maria I. Rocha
d
, Marcelo da Veiga
d
, Juan Sastre
a,⁎
, Maria
A. Pavanato
b,⁎
a
Department of Physiology, Faculty of Pharmacy, University of Valencia, Av. Vicente Andrés Estellés s/n, 46100 Burjassot, Valencia, Spain
b
Department of Physiology and Pharmacology, Federal University of Santa Maria, Av. Roraima, 1000, 97105900 Santa Maria, Rio Grande do Sul, Brazil
c
University Hospital of Santa Maria, Federal University of Santa Maria,, Av. Roraima, 1000, 97105900 Santa Maria, Rio Grande do Sul, Brazil
d
Department of Morphology, Federal University of Santa Maria, Av. Roraima, 1000, 97105900 Santa Maria, Rio Grande do Sul, Brazil
ARTICLE INFO
Keywords:
Aspartame
Cysteine
S-adenosylmethionine
N-acetylcysteine
ABSTRACT
No-caloric sweeteners, such as aspartame, are widely used in various food and beverages to prevent the
increasing rates of obesity and diabetes mellitus, acting as tools in helping control caloric intake. Aspartame is
metabolized to phenylalanine, aspartic acid, and methanol. Our aim was to study the effect of chronic
administration of aspartame on glutathione redox status and on the trans-sulphuration pathway in mouse liver.
Mice were divided into three groups: control; treated daily with aspartame for 90 days; and treated with
aspartame plus N-acetylcysteine (NAC). Chronic administration of aspartame increased plasma alanine
aminotransferase (ALT) and aspartate aminotransferase activities and caused liver injury as well as marked
decreased hepatic levels of reduced glutathione (GSH), oxidized glutathione (GSSG), γ-glutamylcysteine (γ-GC),
and most metabolites of the trans-sulphuration pathway, such as cysteine, S-adenosylmethionine (SAM), and S-
adenosylhomocysteine (SAH). Aspartame also triggered a decrease in mRNA and protein levels of the catalytic
subunit of glutamate cysteine ligase (GCLc) and cystathionine γ-lyase, and in protein levels of methionine
adenosyltransferase 1A and 2A. N-acetylcysteine prevented the aspartame-induced liver injury and the increase
in plasma ALT activity as well as the decrease in GSH, γ-GC, cysteine, SAM and SAH levels and GCLc protein
levels. In conclusion, chronic administration of aspartame caused marked hepatic GSH depletion, which should
be ascribed to GCLc down-regulation and decreased cysteine levels. Aspartame triggered blockade of the trans-
sulphuration pathway at two steps, cystathionine γ-lyase and methionine adenosyltransferases. NAC restored
glutathione levels as well as the impairment of the trans-sulphuration pathway.
1. Introduction
Nowadays, no-caloric sweeteners are widely used to prevent the
increasing rates of obesity and diabetes mellitus and to handle these
patients, acting as critical tools in helping control caloric intake. Among
them, aspartame stands out from all the others [1]. Aspartame is a
dipeptide derivative (L-aspartyl L-phenylalanine methyl ester) that is
used in a foods and beverages worldwide [2]. After its oral ingestion,
aspartame is absorbed from the intestinal lumen and hydrolyzed to
phenylalanine (50%) -the precursor for two neurotransmitters of the
catecholamine family-; aspartic acid (40%) -an excitatory amino acid-;
and methanol (10%) -which is oxidized to cytotoxic formaldehyde and
formic acid- [3]. Although the Food and Drug Administration (FDA)
approved aspartame consumption, its use has been controversial as it
has been associated with several adverse effects as hyperglycemia [4,5],
neurologic and behavioral disturbances [6] and hepatocellular lesions
[7]. Most of them were ascribed to the generation of aspartame
metabolites, particularly to methanol metabolites as formaldehyde
and formate.
Methanol levels were found elevated after aspartame administra-
tion to humans [8] and rats [8–10]. However, there are some species
differences in the metabolism of methanol because humans metabolize
methanol to formaldehyde through alcohol dehydrogenase, whereas
rodents use catalase, which also has antioxidative activity [11].
Formaldehyde is converted to formate through a similar mechanism
in both species via formaldehyde dehydrogenase, which is a glu-
tathione-dependent enzyme [12]. Then, formate in metabolized to
carbon dioxide through a tetrahydrofolate-dependent pathway [13].
http://dx.doi.org/10.1016/j.redox.2017.01.019
Received 9 December 2016; Received in revised form 20 January 2017; Accepted 29 January 2017
⁎
Corresponding authors.
Redox Biology 11 (2017) 701–707
Available online 01 February 2017
2213-2317/ © 2017 Published by Elsevier B.V.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
MARK
Aspartame-derivative methanol has been linked to depletion of
reduced glutathione [9,10]. Indeed, GSH depletion in brain, liver, and
erythrocytes is a common feature of the long-term administration of
aspartame [5,7,9,10,14,15]. The aim of this work was to determine the
effect of chronic administration of aspartame on glutathione redox status
and on the trans-sulphuration pathway in mouse liver.
2. Materials and methods
2.1. Animals
Male Swiss mice (30 ± 6 g b.w.) were obtained from Central Animal
Facility of the Federal University of Santa Maria (Brazil). They were fed on
a standard rodent chow (Supra, São Leopoldo, Brazil) and tap water ad
libitum, in temperature- and humidity- controlled animal quarters under
a 12-h light-dark cycle. The Ethics Committee of the Federal University of
Santa Maria (Brazil) approved the study protocol (#001/2015).
2.2. Experimental protocol
Mice (n =18) were divided into three groups with six animals each
one: control; aspartame (Sigma-Aldrich, St Louis, USA); and aspartame
treated with N-acetylcysteine (NAC) (Sigma-Aldrich, St Louis, USA).
Control group received vehicle (0.9% NaCl) by gavage for 90 days,
whereas aspartame and aspartame treated with NAC groups received
aspartame (80 mg/kg, 2.5 ml/kg, prepared in 0.9% NaCl solution). From
day 60 until the 90 days immediately after administration of aspartame,
the mice of the third group received NAC (163 mg/kg, pH 6.8–7.2)
intraperitoneally, whereas the others received its vehicle intraperitoneally.
All treatments were prepared daily prior to administration. Prior to
sacrifice, mice were anesthetized with isoflurane inhaled at 3%, blood
was collected in heparinized tubes and subsequently the animals were
sacrificed through exsanguination 3 h after the last treatment.
2.3. Assays
2.3.1. Alanine amino transferase and aspartate amino transferase
activities
ALT and AST activities were determined in plasma using commer-
cial kits (Labtest, Lagoa Santa, Brazil). Results were expressed as UI/L.
2.3.2. Histology
Liver samples were fixed 10% formaldehyde and embedded in
paraffin. Next, 6 µm thick histological sections were cut and stained
with hematoxilin-eosin to detect microarquitecture and morphological
alterations.
2.3.3. Determination of sulfur-containing amino acids
Frozen liver samples were homogenized in 400 μl of phosphate
saline buffer containing 11 mM N-ethyl maleimide (NEM). Perchloric
acid (PCA) was then added to obtain a final concentration of 4% and
centrifuged at 15,000gfor 15 min at 4 °C. The concentrations of GSH,
oxidized glutathione (GSSG), glutamylcysteine (γ-GC), cysteine, cy-
stathionine, homocysteine, S-adenosyl homocysteine (SAH), S-adeno-
syl methionine (SAM) and methionine were determined in the super-
natants by high-performance liquid chromatography coupled to tan-
dem mass spectrometry (HPLC-MS/MS). The chromatographic system
consisted of a Micromass QuatroTM triple-quadrupole mass spectro-
meter (Micromass, Manchester, UK) equipped with a Zspray electro-
spray ionization source operating in the positive ion mode with a LC-
10A Shimadzu (Shimadzu, Kyoto, Japan) coupled to the MassLynx
software 4.1 for data acquisition and processing. Samples were
analyzed by reversed-phase HPLC with a C18 Mediterranea SEA
column (Teknokroma, Barcelona, Spain) (5.060.21 cm) with 3 mm
particle size. In all cases, 20 μl of the supernatant were injected onto
the analytical column. The mobile phase consisted of the following
gradient system (min/%A/%B) (A, 0.5% formic acid; B, isopropanol/
acetonitrile 50/50; 0,5% formic acid): 5/100/0, 10/0/100, 15/0/100,
15.10/100/0, and 60/100/0. The flow rate was set at 0.2 ml/min.
Positive ion electrospray tandem mass spectra were recorded with the
electrospray capillary set at 3 keV and a source block temperature of
120 °C. Nitrogen was used as the drying and nebulizing gas at flow
rates of 500 and 30 L/h, respectively. Argon at 1.5610–3mbar was
used as the collision gas for collision-induced dissociation. An assay
based on LC-MS/MS with multiple reaction monitoring was developed
using the transitions m/z, cone energy (V), collision energy (eV) and
retention time (min) for each compound that represents favorable
fragmentation pathways for these protonated molecules. Calibration
curves were obtained using six-point (0.01–100 mmol/l) standards
(purchased from Sigma-Aldrich, St Louis, USA) for each compound.
The concentrations of metabolites were expressed as nmol/mg of
protein.
2.3.4. RT-PCR
A small piece of liver was excised and immediately immersed in
RNA-later solution (Ambion, Thermo Fisher Scientific, Waltham, USA)
to stabilize the RNA. Total RNA was isolated using Trizol (Sigma-
Aldrich, St Louis, USA). The cDNA for amplification in the PCR assay
was constructed by reversion transcription reaction using Revertaid H
Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific,
Waltham, USA). Real time-PCR was performed using SYBR Green PCR
Master Mix (Takara, Kusatsu, Japan) in an iQ5 real-time PCR detection
Table 1
ALT and AST activities in plasma of aspartame-treated mice. Effect of NAC.
Control ASP ASP+NAC
ALT (IU/L) 45.6 ± 3.5 78.4 ± 6.8
*
56 ± 2.7
#
AST (IU/L) 209 ± 46 304 ± 26
*
284 ± 41
The number of mice per group was 6. Results are expressed as mean ± SD. The statistical
difference is indicated as follows:
*
P< 0.05 versus control.
#
P< 0.05 versus ASP. ASP, aspartame; NAC, N-acetylcysteine.
Fig. 1. Representative images of hematoxylin-eosin histological staining in liver of control (A), aspartame-treated mice (B) and mice treated with aspartame plus NAC (C). Leukocyte
infiltration (asterisk), reduction in nuclear volume and degeneration of hepatocytes (arrows) are shown in aspartame-treated mice (B).
I. Finamor et al. Redox Biology 11 (2017) 701–707
702
system (BioRad, Hercules, USA). Each reaction was performed in
duplicate and the melting curves were constructed to ensure that a
single product was amplified. GAPDH was analyzed as real time RT-
PCR control. The following primers were used: Gclc: forward 5′-
CCATCACTTCATTCCCCAGA-3′and reverse 5′-GATGCCGGATG
TTTCTTGTT-3′;Cth: forward 5′- TCGTTTCCTGCAGAATTCACT −3′
and reverse 5′-CTGCTCTTTCAGGGCCTCTT-3′;Gapdh: forward 5′-
GGGCATCTTGGGCTACAC-3′and reverse 5′-GGTCCAGGGT
TTCTTACTCC-3′. The threshold cycle (CT) was determined and the
relative gene expression was expressed as follows: fold change =2
-Δ
(ΔCT)
, where ΔCT = CT
target
–CT
housekeeping
, and Δ(ΔCT) =ΔCT
treated
-
ΔCT
control
.
2.3.5. Western blotting
Frozen liver samples were homogenized on ice in Hepes lysis buffer
(100 mg/mL) containing 75 mM NaCl, 750 μM magnesium chloride,
25 mM Hepes (pH 7.4), 500 μM EGTA, 5% glycerol, 0,5% Igepal, 1 mM
dithiothreitol, 30 mM sodium pyrophosphate, 50 mM sodium fluoride,
and 1 mM sodium orthovanadate. A protease inhibitor cocktail (Sigma-
Aldrich, St Louis, USA) was added before its use at a concentration of
5μL/mL. All debris was removed through centrifugation at 15,000gat
4 °C for 15 min, and the supernatant obtained was used for analysis.
Fifty micrograms of protein were separated in Criterion Gel 4–15%
(BioRad, Hercules, USA) by electrophoresis and transferred to Trans-
Blot Turbo Nitrocellulose membranes (BioRad, Hercules, USA). Western
blotting and chemiluminescence detection using Luminata Clássico
Western HRP Substrate (Millipore, Billerica, USA) were utilized to
determine the catalytic subunit of glutamate cysteine ligase (GCLc),
cystathionine gamma-lyase (CTH) and methionine adenosyltransferase
1A (MAT1A) and 2A (MAT2A) and GAPDH. The following antibodies
were used: antibody against GCLc (1/1000) (Abcam, Cambridge, UK),
antibody against CTH (1/500) (Abcam, Cambridge, UK), antibody
against MAT1A (1/500) (Abcam, Cambridge, UK), antibody against
MAT2A (1/500) (Abcam, Cambridge, UK) and antibody against GAPDH
(1/1000) (Cell Signaling Technology, Danvers, USA).
Fig. 2. GSH (A), GSSG (B), GGSG/GSH*1000 ratio (C) and γ-GC (D) levels in liver of aspartame-treated mice. Effect of NAC. The number of mice per group was 6. Results are expressed
as mean ± SD. The statistical difference is indicated as follows: *, P< 0.05 versus control; #, P< 0.05 versus ASP. Abbreviations: ASP, aspartame; NAC, N-acetylcysteine; GSH, reduced
glutathione; GSSG, oxidized glutathione; γ-GC, γ-glutamylcysteine.
Fig. 3. Gclc mRNA relative expression versus gapdh (A), representative Western
blotting image and densitometry of GCLc protein relative expression versus GAPDH
protein (B) in liver of aspartame-treated mice. Effect of NAC. The number of mice per
group was 6. Results are expressed as mean ± SD. The statistical difference is indicated as
follows: *, P< 0.05 versus control; #, P< 0.05 versus ASP. Abbreviations: ASP,
aspartame; NAC, N-acetylcysteine; GCLc, catalytic subunit of glutamate cysteine ligase.
I. Finamor et al. Redox Biology 11 (2017) 701–707
703
2.4. Statistical analysis
The data were compared by one-way ANOVA followed by the
Tukey-Kramer Multiple Comparisons Test. Results are reported as
mean ± standard deviation (SD) and differences were considered to be
significant at P<0.05.
3. Results
3.1. Effect of aspartame on plasma aminotransferase activities
Chronic aspartame administration produced an elevation in ALT
and AST activities in the plasma. ALT activity returned to normal levels
after chronic NAC treatment. All data are shown in Table 1.
3.2. Effect of aspartame on the liver histology
Aspartame administration increased hepatocellular injury, trigger-
ing leukocyte infiltration, reduction in nuclear area, and degeneration
of hepatocytes with increased liver sinusoidal diameter in different
areas of the liver (Fig. 1B). NAC treatment restored the normal
histological architecture, showing preserved hepatocyte and sinusoidal
morphology after aspartame treatment (Fig. 1C), which was similar to
the hepatic histology of control mice (Fig. 1A). Hence, chronic
aspartame may lead to toxic hepatitis.
3.3. Effect of aspartame on the glutathione levels and redox status in
the liver
Aspartame administration caused a 30% decrease in GSH levels in
the liver, which was prevented by NAC treatment (Fig. 2A). However,
GSH depletion was not associated with glutathione oxidation in the
liver as aspartame also induced a parallel GSSG depletion maintaining
the normal GSSG/GSH ratio (Fig. 2B,C).
3.4. Effect of aspartame on γ-glutamylcysteine and the glutamate
cysteine ligase
The levels of γ-GC were decreased in the liver upon administration
of aspartame (Fig. 2D). NAC administration restored the normal γ-GC
Fig. 4. Cysteine (A), cystathionine (B), homocysteine (C), SAH (D), SAM (E) and methionine (F) levels in liver of aspartame-treated mice. Effect of NAC. The number of mice per group
was 6. Results are expressed as mean ± SD. The statistical difference is indicated as follows: *, P< 0.05 versus control; #, P< 0.05 versus ASP. Abbreviations: ASP, aspartame; NAC, N-
acetylcysteine; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine.
I. Finamor et al. Redox Biology 11 (2017) 701–707
704
hepatic levels. Aspartame administration also triggered down-regula-
tion of both the gclc mRNA (Fig. 3A) and GCLc protein (Fig. 3B,C)
levels in the liver. GCLc protein levels returned to the control levels
after treatment with NAC (Fig. 3B).
3.5. Effect of aspartame on the trans-sulphuration pathway in the
liver
Aspartame administration caused a severe depletion in most metabo-
lites of the trans-sulphuration pathway in the liver. Indeed, cysteine
(Fig. 4A), homocysteine (Fig. 4C), SAH (Fig. 4D), and SAM (Fig. 4E)
hepatic levels were severely depleted by aspartame, whereas methionine
(Fig. 4F) and cystathionine levels (Fig. 4B) did not change. NAC
administration restored these changes in aspartame-treated mice leading
to normal levels of all metabolites of the trans-sulphuration pathways.
3.6. Effect of aspartame on expression of cystathionine gamma-lyase
and methionine adenosyltransferases in the liver
Aspartame administration led to a decrease in the cth mRNA
(Fig. 5A) and CTH (Fig. 5B) protein levels as well as in MAT1A
(Fig. 6A) and MAT2A (Fig. 6B) protein levels in the liver.
4. Discussion
Aspartame is present in more than 6000 food products around the
world [2]. However, most aspartame consumers are unaware about its
potentially detrimental metabolites and controversial safety [7].
Aspartame was also related to non-alcoholic fatty liver disease asso-
ciated to metabolic syndrome [16,17]. Aspartame and other artificial
sweeteners may drive the development of glucose intolerance, fatty
liver disease linked to metabolic syndrome through induction of
compositional and functional alterations of the intestinal microbiota
in mice and humans [17]. Aspartame adverse effects also have been
ascribed to the toxic actions of methanol and its metabolites generated
from aspartame metabolism [18,19]. Indeed, methanol levels were
elevated in rat plasma after long-term intake of aspartame at high
doses [12], and even at similar doses to those expected in humans [10].
Methanol metabolism produces formaldehyde, which was found to be
even more toxic than methanol itself and formate [19]. Formaldehyde
can form adducts with proteins and nucleic acids, which accumulate in
rat liver during chronic treatment with high doses of aspartame [18].
Formaldehyde also decreases hepatic GSH content and induces cell
death in rat thymocytes, being pointed as possible responsible at least
for part of aspartame toxicity [19].
Aspartame-induced liver inflammation and necrosis is associated
with GSH depletion and a decrease in glutathione peroxidase and
glutathione reductase activities [7]. Aspartame also provokes adrenal
cell apoptosis in vitro [20] and brain apoptosis in vivo [10] via
mitochondrial oxidative stress. Hence, GSH depletion and changes in
GSH-related enzymes are considered main features linked to aspar-
Fig. 5. Cth mRNA relative expression versus gapdh (A), representative Western blotting
image and densitometry of CTH protein relative expression versus GAPDH protein (B) in
liver of aspartame-treated mice. Effect of NAC. The number of mice per group was 6.
Results are expressed as mean ± SD. The statistical difference is indicated as follows: *, P
< 0.05 versus control; #, P< 0.05 versus ASP. Abbreviations: ASP, aspartame; NAC, N-
acetylcysteine; CTH, cystathionine γ-lyase.
Fig. 6. Representative Western blotting image and densitometry of MAT1A (A) and
MAT2A (B) protein relative expression versus GAPDH protein in liver of aspartame-
treated mice. Effect of NAC. The number of mice per group was 6. Results are expressed
as mean ± SD. The statistical difference is indicated as follows: *, P< 0.05 versus control.
Abbreviations: ASP, aspartame; NAC, N-acetylcysteine; MAT1A, methionine adenosyl-
transferase 1A; MAT2A, methionine adenosyltransferase 2A.
I. Finamor et al. Redox Biology 11 (2017) 701–707
705
tame-induced oxidative stress and injury [5,7,9,10,14,15]. Moreover,
methanol may cause oxidative stress and is considered the major
contributor to it upon aspartame administration.
Nevertheless, the effects of chronic aspartame administration on
glutathione redox status and on the trans-sulphuration pathway
(Fig. 7) were still unknown. The aspartame doses used here in this
research (80 mg/kg), when extrapolated to human equivalent doses
using the body surface area normalization method [21], correspond to
6 mg/kg i.e., the daily intake of 360 mg of aspartame or 360 mL of soft
drink (2 cans of 355 ml), by a 60 kg individual.
Hepatocytes are those cells with the most active trans-sulphuration
pathway able to use methionine for GSH synthesis through this
pathway (Fig. 7), where methionine is converted to cysteine and thus
is used for GSH synthesis [22–24]. Under normal physiological
conditions the rate of GSH synthesis in the liver is mainly determined
by two factors: the activity of GCL [25] and the availability of its
substrate cysteine [26]. Aspartame-induced GSH depletion should be
ascribed to both events (Fig. 7), since we report here a decrease in Gclc
mRNA and GCLc protein levels as well as a severe reduction in cysteine
levels, which is likely to be due to a marked decrease in Cth mRNA and
CTH protein levels. The cystathionine levels were preserved likely due
to decrease in its hydrolysis as cystathionine gamma-lyase, which
converts cystathionase into cysteine, exhibited a marked decrease in
both its mRNA and protein levels after aspartame administration.
Another important metabolite of the trans-sulphuration pathway
(Fig. 7) is SAM, which is synthetized by MAT1A (liver-specific) and
MAT2A (non-liver-specific) enzymes. It has been shown a reduction in
MAT1A in the liver induces GSH depletion [27,28]. We show here that
aspartame triggers downregulation of both enzymes, MAT1A and
MAT2A, and induces a marked decrease in SAM levels. MAT1A is
considered crucial for hepatic function, since its absence in mice liver
produces marked depletion of hepatic SAM levels, making the liver
more susceptible to damage [28]. Therefore, since SAM is involved in
methylating reactions and in the critical protection of hepatocytes, our
findings open a new scenario to explore further consequences of
aspartame side effects that may better explain its adverse effects.
Considering that GSH plays an important role in detoxification of
electrophilic xenobiotics and in the protection against oxidative stress,
and taking into account the aspartame-induced depletion of GSH
levels, pharmacological strategies to maintain GSH levels may be
important for people who regularly need to consume foods and
beverages with sweeteners. A compound widely used in the clinic to
protect against acetaminophen-induced GSH depletion and toxicity is
NAC [5]. NAC is also used as a mucolytic agent and in the treatment of
diseases such as cystic fibrosis, chronic obstructive pulmonary disease,
diabetes mellitus, and immunodeficiency virus/AIDS [29]. The bioa-
vailability of NAC (below 5%) is related to its N-deacetylation in the
intestinal mucosa and first-pass metabolization in the liver [30]. This
last process releases cysteine [31,32],which may taken up by epithelial
cells and maintain GSH synthesis [33]. Therefore, the beneficial effects
of NAC have been ascribed to its capability to scavenge reactive oxygen
species and increase cellular GSH levels, since NAC is a precursor for
cysteine whose availability is a limiting factor for GSH synthesis. Our
findings suggest that administration of N-acetyl cysteine may be
beneficial in subjects consuming regularly foods and beverages with
sweeteners.
In conclusion, chronic administration of aspartame caused marked
hepatic GSH depletion, which should be ascribed to GCLc down-
regulation and decreased cysteine levels. Aspartame triggered blockade
of the trans-sulphuration pathway at two steps (Fig. 7), cystathionine
γ-lyase and methionine adenosyltransferases. NAC restored glu-
tathione levels as well as the impairment of the trans-sulphuration
pathway.
Conflict of interest
The authors declare that there are no conflict of interest.
Acknowledgements and funding
Grant SAF2015-71208-R with FEDER funds from the Spanish
Ministry of Economy and Competitiveness supported this work. I.F.
received a fellowship from Programa de Pós-Doutorado no Exterior,
which belongs to the Conselho Nacional de Desenvolvimento Científico
e Tecnológico. C.A.B. and C.E.B received a fellowship from Programa
de Demanda Social, which belongs to the Comissão de
Aperfeiçoamento de Pessoal de Nível Superior.
References
[1] B.A. Magnuson, M.C. Carakostas, N.H. Moore, S.P. Poulos, A.G. Renwick,
Biological fate of low-calorie sweeteners, Nutr. Rev. 74 (2016) 670–689. http://
dx.doi.org/10.1093/nutrit/nuw032.
[2] H.H. Butchko, W.W. Stargel, C.P. Comer, D.A. Mayhew, C. Benninger,
G.L. Blackburn, L.M.J. de Sonneville, R.S. Geha, Z. Hertelendy, A. Koestner,
A.S. Leon, G.U. Liepa, K.E. McMartin, C.L. Mendenhall, I.C. Munro, E.J. Novotny,
A.G. Renwick, S.S. Schiffman, D.L. Schomer, B.A. Shaywitz, P.A. Spiers,
T.R. Tephly, J.A. Thomas, F.K. Trefz, Aspartame: review of safety, Regul. Toxicol.
Pharmacol. RTP 35 (2002) S1–93.
[3] R.E. Ranney, J.A. Oppermann, E. Muldoon, F.G. McMahon, Comparative meta-
bolism of aspartame in experimental animals and humans, J. Toxicol. Environ.
Health 2 (1976) 441–451. http://dx.doi.org/10.1080/15287397609529445.
[4] K.S. Collison, N.J. Makhoul, M.Z. Zaidi, R. Al-Rabiah, A. Inglis, B.L. Andres,
R. Ubungen, M. Shoukri, F.A. Al-Mohanna, Interactive effects of neonatal exposure
to monosodium glutamate and aspartame on glucose homeostasis, Nutr. Metab. 9
(2012) 58. http://dx.doi.org/10.1186/1743-7075-9-58.
[5] I.A. Finamor, G.M. Ourique, T.S. Pês, E.M.H. Saccol, C.A. Bressan, T. Scheid,
B. Baldisserotto, S.F. Llesuy, W.A. Partata, M.A. Pavanato, The protective effect of
N-acetylcysteine on oxidative stress in the brain caused by the long-term intake of
Fig. 7. The trans-sulphuration pathway coupled with glutathione synthesis.
Abbreviations: MAT1A, methionine adenosyltransferase 1A; MAT2A, methionine ade-
nosyltransferase 2A; SAM, S-adenosylmethionine; SAH, S-adenosylhomocysteine;
SAHH, S-adenosylhomocysteine hydrolase; CBS, cystathionine β-synthase; CTH, cy-
stathionine γ-lyase; GS, glutathione synthetase.
I. Finamor et al. Redox Biology 11 (2017) 701–707
706
aspartame by rats, Neurochem. Res. 39 (2014) 1681–1690. http://dx.doi.org/
10.1007/s11064-014-1360-9.
[6] R.A. Coulombe, R.P. Sharma, Neurobiochemical alterations induced by the artificial
sweetener aspartame (NutraSweet), Toxicol. Appl. Pharmacol. 83 (1986) 79–85.
[7] M. Abhilash, M.V.S. Paul, M.V. Varghese, R.H. Nair, Effect of long term intake of
aspartame on antioxidant defense status in liver, Food Chem. Toxicol. Int. J. Publ.
Br. Ind. Biol. Res. Assoc. 49 (2011) 1203–1207. http://dx.doi.org/10.1016/
j.fct.2011.02.019.
[8] E. Davoli, L. Cappellini, L. Airoldi, R. Fanelli, Serum methanol concentrations in
rats and in men after a single dose of aspartame, Food Chem. Toxicol. Int. J. Publ.
Br. Ind. Biol. Res. Assoc. 24 (1986) 187–189.
[9] A. Iyyaswamy, S. Rathinasamy, Effect of chronic exposure to aspartame on
oxidative stress in the brain of albino rats, J. Biosci. 37 (2012) 679–688.
[10] I. Ashok, R. Sheeladevi, Biochemical responses and mitochondrial mediated
activation of apoptosis on long-term effect of aspartame in rat brain, Redox Biol. 2
(2014) 820–831. http://dx.doi.org/10.1016/j.redox.2014.04.011.
[11] A.I. Cederbaum, A. Qureshi, Role of catalase and hydroxyl radicals in the oxidation
of methanol by rat liver microsomes, Biochem. Pharmacol. 31 (1982) 329–335.
[12] C. Harris, S.-W. Wang, J.J. Lauchu, J.M. Hansen, Methanol metabolism and
embryotoxicity in rat and mouse conceptuses: comparisons of alcohol dehydro-
genase (ADH1), formaldehyde dehydrogenase (ADH3), and catalase, Reprod.
Toxicol. 17 (2003) 349–357.
[13] T.R. Tephly, The toxicity of methanol, Life Sci. 48 (1991) 1031–1041.
[14] M.D. Prokic, M.G. Paunovic, M.M. Matic, N.Z. Djordjevic, B.I. Ognjanovic,
A.S. Stajn, Z.S. Saicic, Prooxidative effects of aspartame on antioxidant defense
status in erythrocytes of rats, J. Biosci. 39 (2014) 859–866.
[15] M. Abhilash, M.V. Sauganth Paul, M.V. Varghese, R.H. Nair, Long-term con-
sumption of aspartame and brain antioxidant defense status, Drug Chem. Toxicol.
36 (2013) 135–140. http://dx.doi.org/10.3109/01480545.2012.658403.
[16] W. Nseir, F. Nassar, N. Assy, Soft drinks consumption and nonalcoholic fatty liver
disease, World J. Gastroenterol. 16 (2010) 2579–2588.
[17] J. Suez, T. Korem, D. Zeevi, G. Zilberman-Schapira, C.A. Thaiss, O. Maza, D. Israeli,
N. Zmora, S. Gilad, A. Weinberger, Y. Kuperman, A. Harmelin, I. Kolodkin-Gal,
H. Shapiro, Z. Halpern, E. Segal, E. Elinav, Artificial sweeteners induce glucose
intolerance by altering the gut microbiota, Nature 514 (2014) 181–186. http://
dx.doi.org/10.1038/nature13793.
[18] C. Trocho, R. Pardo, I. Rafecas, J. Virgili, X. Remesar, J.A. Fernández-López,
M. Alemany, Formaldehyde derived from dietary aspartame binds to tissue
components in vivo, Life Sci. 63 (1998) 337–349.
[19] Y. Oyama, H. Sakai, T. Arata, Y. Okano, N. Akaike, K. Sakai, K. Noda, Cytotoxic
effects of methanol, formaldehyde, and formate on dissociated rat thymocytes: a
possibility of aspartame toxicity, Cell Biol. Toxicol. 18 (2002) 43–50.
[20] Y. Horio, Y. Sun, C. Liu, T. Saito, M. Kurasaki, Aspartame-induced apoptosis in
PC12 cells, Environ. Toxicol. Pharmacol. 37 (2014) 158–165. http://dx.doi.org/
10.1016/j.etap.2013.11.021.
[21] S. Reagan-Shaw, M. Nihal, N. Ahmad, Dose translation from animal to human
studies revisited, FASEB J. 22 (2008) 659–661. http://dx.doi.org/10.1096/fj.07-
9574LSF.
[22] N. Kaplowitz, T.Y. Aw, M. Ookhtens, The regulation of hepatic glutathione, Annu.
Rev. Pharmacol. Toxicol. 25 (1985) 715–744. http://dx.doi.org/10.1146/annur-
ev.pa.25.040185.003435.
[23] S.C. Lu, Regulation of hepatic glutathione synthesis: current concepts and
controversies, FASEB J. 13 (1999) 1169–1183.
[24] D.M. Townsend, K.D. Tew, H. Tapiero, The importance of glutathione in human
disease, Biomed. Pharmacother. Biomed. Pharmacother. 57 (2003) 145–155.
[25] D. Díaz, C.M. Krejsa, T.J. Kavanagh, Expression of glutamate-cysteine ligase during
mouse development, Mol. Reprod. Dev. 62 (2002) 83–91. http://dx.doi.org/
10.1002/mrd.10076.
[26] N. Tateishi, T. Higashi, S. Shinya, A. Naruse, Y. Sakamoto, Studies on the
regulation of glutathione level in rat liver, J. Biochem. 75 (1974) 93–103.
[27] S.C. Lu, S-Adenosylmethionine, Int. J. Biochem. Cell Biol. 32 (2000) 391–395.
[28] S.C. Lu, L. Alvarez, Z.Z. Huang, L. Chen, W. An, F.J. Corrales, M.A. Avila, G. Kanel,
J.M. Mato, Methionine adenosyltransferase 1A knockout mice are predisposed to
liver injury and exhibit increased expression of genes involved in proliferation,
Proc. Natl. Acad. Sci. USA 98 (2001) 5560–5565. http://dx.doi.org/10.1073/
pnas.091016398.
[29] Y. Samuni, S. Goldstein, O.M. Dean, M. Berk, The chemistry and biological
activities of N-acetylcysteine, Biochim. Biophys. Acta 1830 (2013) 4117–4129.
http://dx.doi.org/10.1016/j.bbagen.2013.04.016.
[30] M.R. Holdiness, Clinical pharmacokinetics of N-acetylcysteine, Clin.
Pharmacokinet. 20 (1991) 123–134. http://dx.doi.org/10.2165/00003088-
199120020-00004.
[31] S. Whillier, J.E. Raftos, B. Chapman, P.W. Kuchel, Role of N-acetylcysteine and
cystine in glutathione synthesis in human erythrocytes, Redox Rep. Commun. Free
Radic. Res. 14 (2009) 115–124. http://dx.doi.org/10.1179/135100009×392539.
[32] K.K. Radtke, L.D. Coles, U. Mishra, P.J. Orchard, M. Holmay, J.C. Cloyd,
Interaction of N-acetylcysteine and cysteine in human plasma, J. Pharm. Sci. 101
(2012) 4653–4659. http://dx.doi.org/10.1002/jps.23325.
[33] H. Sies, Glutathione and its role in cellular functions, Free Radic. Biol. Med. 27
(1999) 916–921.
I. Finamor et al. Redox Biology 11 (2017) 701–707
707
