Content uploaded by Zhigang Liu
Author content
All content in this area was uploaded by Zhigang Liu on Apr 13, 2018
Content may be subject to copyright.
THE
JOURNAL •RESEARCH •www.fasebj.org
Chicoric acid supplementation prevents systemic
inflammation-induced memory impairment and
amyloidogenesis via inhibition of NF-kB
Qian Liu, Yuwei Chen, Chun Shen, Yating Xiao, Yutang Wang, Zhigang Liu,
1
and Xuebo Liu
2
Laboratory of Functional Chemistry and Nutrition of Food, College of Food Science and Engineering, Northwest A&F University, Yangling,
China
ABSTRACT: Chicoric acid (CA), a natural phenolic acid extracted from chicory and the echinacea (purple coneflower)
plant (Echinacea purpurea), has been regarded as a nutraceutical that has powerful antioxidant and antiobesity
activities. We investigated the inhibitory effects of CA on systemic inflammation-induced neuroinflammation,
amyloidogenesis, and cognitive impairment. C57BL/6J mice were treated with 0.05% CA in the drinking water for
45 d. The mice were then treated by intraperitoneal injection of LPS (lipopolysaccharide). It was found that CA
prevented LPS-induced memory impairment and neuronal loss through behavioral tests and histological exam-
ination. Furthermore, amyloidogenesis in the CNS was detected. The results showed that CA prevented LPS-
induced increases in b-amyloid (1-42 specific) (Ab
1-42
) accumulation, levels of amyloid precursor protein, and
neuronal b-secretase 1 (BACE1), as well as the equilibrium cholinergic system in mouse brain. Moreover, CA down-
regulated LPS-induced glial overactivation by inhibiting the MAPK and NF-kB pathway. Consequently, CA re-
duced the levels of NF-kB transcriptionally regulated inflammatory mediators and cytokines such as iNOS,
cyclooxygenase-2 (COX-2), IL-1b,andTNF-ain both mouse brain and BV2 microglial cells. These results demon-
strated that CA alleviated memory impairment and amyloidogenesis triggered by LPS through suppressing NF-kB
transcriptional pathway, suggesting that CA might be a plausible therapeutic intervention for neuroinflammation-
related diseases such as Alzheimer disease.—Liu, Q., Chen, Y., Shen, C., Xiao, Y., Wang, Y., Liu, Z., Liu, X. Chicoric
acid supplementation prevents systemic inflammation-induced memory impairment and amyloidogenesis via
inhibition of NF-kB. FASEB J. 31, 000–000 (2017). www.fasebj.org
KEY WORDS: amyloid peptides accumulation •lipopolysaccharide •natural phenolic acid •neuroinflammation
•NF-kB transcriptional pathway
Neuroinflammation is well documented to be the culprit
of several neurodegenerative disorders, such as Alzheimer
disease (AD), Parkinson disease, and amyotrophic lateral
sclerosis (1, 2). In particular, the extracellular accumulation
of amyloid b(Ab), one of the neuropathological hallmarks
of AD, was stimulated by inflammation in the brain (3). As
the major immune cells in theCNS, microglia play pivotal
role in regulating neuroinflammation and the deposition
of Ab(4). Overactivation of microglia leads to excess re-
lease of proinflammatory cytokines such as TNF-aand
IL-1, which are also reported to augment amyloid pre-
cursor protein (APP) expression and Abformation (5).
Intraperitoneal injection of LPS, an endotoxin from
the outer membrane of gram-negative bacteria, trig-
gers neuroinflammation and evokes amyloidogenesis
in the brain (6). LPS administration up-regulates vari-
ous proinflammatory cytokines, including IL-1band
TNF-a, and inflammatory mediators such as iNOS and
cyclooxygenase-2 (COX-2) (7). Glial cells in the brain
can be activated by LPS through the CD14/TLR-4 re-
ceptor complex and thus activates the NF-kBtran-
scriptional pathway (8). NF-kB is the central master in
regulating the expressions of aforementioned proin-
flammatory cytokines and inflammatory mediator
genes. It also stimulates b-secretase 1 (BACE1) tran-
scription, which subsequently decomposes APP and leads
ABBREVIATIONS: Ab
1-42
,b-amyloid (1-42–specific); ACh, acetylcholine;
AChE, acetylcholine esterase; AD, Alzheimer disease; APP, amyloid pre-
cursor protein; BACE1, b-secretase 1; BDNF, brain-derived neurotrophic
factor; BrdU, bromodeoxyuridine; CA, chicoric acid; ChAT, choline acetyl-
transferase; COX-2, cyclooxygenase-2; DG, dentate gyrus; GFAP, glial
fibrillary acidic protein; HE, hematoxylin–eosin; IBA-1, ionized calcium-
binding adapter molecule 1; IHC, immunohistochemistry; LPS, lipopoly-
saccharide; MMP, matrix metalloproteinase; NeuN, neuronal nuclei; NGF,
nerve growth factor; NT, neurotrophin; PGE2, prostaglandin E2; qPCR,
quantitative PCR
1
Correspondence: College of Food Science and Engineering, Northwest
A&F University, Xinong Rd. 22, Yangling 712100, China. E-mail: zhigangliu@
nwsuaf.edu.cn
2
Correspondence: College of Food Science and Engineering, Northwest
A&F University, Xinong Rd. 22, Yangling 712100, China. E-mail: xueboliu@
aliyun.com
doi: 10.1096/fj.201601071R
0892-6638/17/0031-0001 © FASEB 1
The FASEB Journal article fj.201601071R. Published online December 22, 2016.
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
to the generation of Ab(9). Numerous reports in the liter-
ature have also demonstrated that an intraperitoneal
injection of LPS impairs memory performance and en-
hances amyloidogenesis via stimulating the NF-kB sig-
naling pathway (10).
It has been reported that natural phytochemicals, such as
resveratrol, curcumin, apigenin, and epigallocatechin gal-
late, could suppress LPS-induced neuroinflammation and
amyloidogenesis, and thus improve learning and memory
impairment (11). Chicoric acid (CA), a caffeic acid de-
rivative, existing extensively in echinacea (also known as
purple coneflower; Echinacea purpurea), chicory, lettuce,
dandelion, and other edible plants and vegetables, has been
regarded as a nutraceutical that has powerful antioxidant,
anti-HIV, and antiobesity activities (12, 13). CA and luteolin
were reported to synergistically attenuate inflammation
through the suppression of the PI3K/Akt and NF-kBsig-
naling pathways in LPS-induced RAW264.7 cells (14). It
was also demonstrated that CA remarkably inhibited a
high-fat diet–induced inflammation response (15). Previous
of our research illustrated that CA attenuated inflamma-
tory responses via redox-sensitive signaling, including the
PI3K/Akt, NF-kB, and MAPK pathways in glucosamine-
mediated HepG2 cells (16). Additional in vivo research
demonstrated that CA was partly metabolized to caffeic
acid and caftaric acid on cytochrome P450s in rat liver mi-
crosomes. CA was distributed rapidly in various tissues
after gavage administration, and it was verified to have the
ability to cross the blood–brain barrier (17).Therefore,we
hypothesized that CA might be a potential compound that
could inhibit LPS-induced systemic inflammation and
subsequent amyloidogenesis and memory deficits.
This study was aimed at uncovering the effects of di-
etary CA supplementation on an intraperitoneal injection
of LPS-stimulated neuroinflammation mouse model and
BV2 microglial cells by determining the effects of CA on
glial activation and inflammatory cytokines generation;
investigating the effects of CA on cognitive deficits and
neuron damage; and examining the effects of CA on LPS-
induced amyloidogenesis and cholinergic dysfunction.
This study provided novel insights into the mechanisms of
CA on the intervention of LPS-induced neuroinflammation
and Abaccumulation.
MATERIALS AND METHODS
Animals and treatments
The CA ($98%) was purchased from Weikeqi Biological Tech-
nology (Chengdu, Sichuan, China). Its chemical structure is
shown in Fig. 1A. LPS (L2630) and all other chemicals were the
purest grade available from Sigma-Aldrich (St. Louis, MO, USA).
Three-month-old C57BL/6J mice, provided by Xi’an Jiaotong
University (Xi’an, Shaanxi, China), were housed in the animal
facility under standard conditions (humidity 50 615%, tem-
perature 22 62°C, 12/12 light–dark cycle) and fed a standard
diet (AIN-93M). Mice were divided into 3 groups (n=10per
group): control, LPS, and CA + LPS groups. The CA treatment
group received 0.05% CA in drinking water for 45 d. The LPS and
CA + LPS group mice were intraperitoneally injected with LPS
(0.25 mg/kg body weight per day, dissolved in saline) for 9 d.
Control group animals were intraperitoneally injected with the
same volume of saline alone. The cell proliferation marker bro-
modeoxyuridine (BrdU; 0.1 g/kg) was intraperitoneally injected
on d 28 before the animals were humanely killed. The behavioral
tests of learning and memory capabilities were evaluated using
Figure 1. Timeline illustrating CA treatment
and evaluations of cognitive functions of mice.
A) Chemical structure of CA. B) Experimental
scheme for effects of CA on mouse memory
loss induced by LPS. Three-month-old male
C57BL/6J mice were treated with CA (0.05%)
in drinking water for 45 d. Then LPS (0.25 mg/kg)
was administered intraperitonally for 9 consec-
utive days. Learning and memory capabilities
of mice were determined by Y-maze. Effect of CA
on spontaneous alternation (C) and number of
total arm entries (D) in Y-maze task were recorded.
Data are presented as means 6SEM,n=10.*P,
0.05, **P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
2 Vol. 31 April 2017 LIU ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
2 separate behavioral tests (Y-maze and Morris water maze) 4 h
after LPS injection. Subsequently, the mice were humanely killed
after anesthesia by an intraperitoneal injection of 400 mg/kg
chloral hydrate (Sigma-Aldrich). Plasma and brain samples were
collected and stored at 280°C for further detection(Fig. 1B). All of
the experimental procedures followed the 8th edition of theGuide
for the Care and Use of Laboratory Animals (National Institutes of
Health, Bethesda, MD, USA), and the animal protocol was ap-
proved by the Animal Ethics Committee of Xi’an Jiaotong
University.
Y-maze task
The Y-maze task was performed 4 h after LPS injection for the
determination of learning and memory capabilities. Briefly, the
experimenter was blinded to the medication status. Spontaneous
alternation was defined as successive entries into the 3 arms in
overlapping triplet sets and was assessed in the Y-maze task.
Each arm of the maze was 35 cm long, 15 cm high, and 5 cm wide,
and converged to an equal angle (Shanghai Xinruan Information
Technology, Shanghai, China). The mouse was placed in the
center of the apparatus and allowed to explore the maze for
8 min. The total numbers of arm entries and alternation were
scored. The total number of arm entries was collected cumula-
tively over 8 min. The percentage alternation was calculated as
the ratio of actual to possible alternations, defined as: (total
number of arm entries 22) 3100%.
Morris water maze test
A spatial memory test was performed as previously described
with minor modifications (10). The Morris water maze is a white
circular pool (150 cm in diameter and 35 cm high) with a fea-
tureless inner surface (Shanghai Xinruan Information Technol-
ogy). The swimming route of the mouse was monitored and
analyzed by a video tracking system (SuperMaze software;
Shanghai Xinruan Information Technology, Shanghai, China).
The circular pool was divided into quadrants and filled with
nontoxic water and kept at 23 to 25°C. Four habituation training
sessions were performed on d 3, and test trials were conducted
for5d(d4–8). For each daily trial, the mouse was placed into the
water maze at 1 of 3 randomly determined locations and re-
leased, allowing the animal to find the hidden platform. After
the mouse found and climbed onto the platform, the trial was
stopped and the escape latency recorded. The maximum trial
length was 60 s. If animals did not locate the platform within 60 s,
the experimenter guided the mouse to the platform by using a
stick. Then the mouse was kept on the escape platform for 30 s,
and an escape latency of 60 s was recorded. Toassess the spatial
retention of thelocation of the hidden platform, a probe trial was
conducted24 h after the last acquisition session.During this trial,
the platform was removed from the maze, and each mouse was
allowed to search the pool for 60 s before being removed. The
time spent in the target quadrant was used as a measure of
consolidated spatial memory.
Hematoxylin–eosin and
immunohistochemical staining
Brain tissues were fixed in 4% (v/v) paraformaldehyde and
embedded in paraffin. The brain sections were cut into 5 mm
sections by microtome and then rehydrated by xylene and de-
clining grades of ethanol (100, 90, 80, and 70% ethanol) for 5 min
in each grade, and after 3 washes in PBS (pH 7.4) for 5 min each.
For hematoxylin–eosin (HE) staining, the brain slides were
stained with HE. For immunohistochemical (IHC) staining, 0.5%
Triton X-100 was used to permeabilize the tissues, and the boiling
method was carried out to perform antigen retrieval. Endoge-
nous peroxidases were quenched by 3% H
2
O
2
,andtheslides
were blocked with normal goat serum blocking solution for
20 min and incubated overnight at 4°C with a mouse polyclonal
antibody against glial fibrillary acidic protein (GFAP) (1:400;
Abcam, Cambridge, MA, USA), a rabbit polyclonal antibody
against ionized calcium-binding adapter molecule 1 (IBA-1)
(1:8000; Abcam), and b-amyloid (1-42 specific) (Ab
1-42
)(1:1600;
Cell Signaling Technology, Danvers, MA, USA). After washing
3 times with PBS, the brain sections were incubated for 20 min
at 37°C with the corresponding secondary antibody diluted
according to the manufacturer’s recommendations, reacted with
horseradish peroxidase–streptavidin (Streptavidin Peroxidase
Link Detection Kits; Zhongshan Golden Bridge Biotechnology,
Beijing, China) for 20 min at room temperature, and visualized
by the chromogen DAB kit (Zhongshan Golden Bridge Bio-
technology) reaction for 8 min. The brain slides were coun-
terstained with Mayer hematoxylin solution and observed
with a light microscope (Olympus, Tokyo, Japan) (3200 or 400
magnification).
Thioflavin S and immunofluorescence
staining
For thioflavin S staining, the brain sections were rehydrated and
stained with thioflavin S (0.5%, dissolved in saline) for 8 min. The
brain sections were then dehydrated through ascending grades
of ethanol (70, 90, and 100% ethanol) for 1 min in each grade and
sealed with a mounting medium containing DAPI (Solarbio,
Beijing, China). The thioflavin S staining was determined by a
fluorescence microscope (Olympus) (3200 magnification).
The procedure of immunofluorescence staining was similar to
IHC staining. The brain sections were incubated with the fol-
lowing primary antibodies: neuronal nuclei (NeuN) (1:500; Cell
Signaling Technology) and BrdU (1:1400; Cell Signaling Tech-
nology) at 4°C overnight. After 3 washes with PBS, anti-rabbit or
mouse secondary antibody conjugated to Alexa Fluor 555 or 488
(Cell Signaling Technology) was added at 37°C for 20 min. Im-
munofluorescence images were acquired with an inverted fluo-
rescence microscope (Olympus) (3200 magnification).
Measurement of Ab
1-42
, cytokines, level of ACh,
and activities of AChE and
choline acetyltransferase
The content of Ab
1-42
in the mouse brain was determined by an
ELISA kit (Mouse Ab
1-42
kit; Xinle Biology Technology, Shang-
hai, China). The levels of acetylcholine (ACh) and the activities
of acetylcholine esterase (AChE) and choline acetyltransferase
(ChAT) in mouse brain homogenates were measured using
a commercially available kit from Nanjing Jiancheng Bioen-
gineering Institute (Nanjing, Jiangsu, China) according to the
manufacturer’s protocol. In addition, the content of TNF-aand
IL-1bin BV2 cell culture medium and mouse plasma, and the
level of prostaglandin E2 (PGE2) in the medium, were detected
using commercial ELISA kits (Mouse PGE2 kit, Mouse TNF-a
kit, Mouse IL-1bkit; Xinle Biology Technology).
RNA preparation and quantitative PCR
Total RNA was extracted from brain tissue using the RNA
Extraction Kit (TaKaRa MiniBest Universal RNA Extraction
Kit; TaKaRa Biotechnology, Dalian, China). In addition, the
purity and integrity of RNA was evaluated using a Quawell
5000 UV-Vis spectrophotometer (Quawell Technology, San
Jose, CA, USA). RNA (1 mg) was reverse transcribed into
cDNA using the PrimeScript RT Master Mix reverse
CA SUPPLEMENTATION AND MEMORY 3
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
transcription kit (PrimeScript RT Master Mix; TaKaRa Bio-
technology), and gene-specific mouse primers were used as
illustrated in Table 1. The mRNA expressions were quanti-
fied by quantitative PCR (qPCR) using the SYBR Green PCR kit
(SYBR Premix Ex Taq II; TaKaRa Biotechnology) and CFX96TM
Real-Time System (Bio-Rad, Hercules, CA, USA). C
t
values were
normalized to GAPDH, and the relative gene expression was
calculated with the 2
2DDCt
method.
Cell culture
BV2 microglial cells were provided by Kunming Institute of
Zoology, Chinese Academy of Sciences (Kunming, Yunnan,
China), and cultured in DMEM (Thermo Fisher Scientific,
Waltham, MA, USA) supplemented with 10% fetal bovine
serum, 100 IU/ml penicillin, and 100 mg/ml streptomycin at
37°C in a humidified atmosphere with 5% CO
2
.BV2micro-
glial cells were pretreated with CA for 4 h, and then treated
with LPS for 12 h after washing with PBS. Except for Akt,
MAPKs, and NF-kB cell signaling phosphorylation de-
tection, the cells were pretreated with CA for 4 h, then treated
with LPS for 30 min. The 1,9-pyrazoloanthrone (SP600125),
1,4-diamino-2,3-dicyano-1,4-bis (o-aminophenyl-mercapto)
butadiene (U0126), 4-(4-fluorophenyl)- 2-(4-methylsulfinylphenyl)-
5-(4-pyridyl)-1H-imidazole (SB203580), 2-(4-morpholinyl)-
8-phenyl-4H-1-benzopyran-4-one (LY294002), and pyrrolidine
dithiocarbamate (Sigma-Aldrich) were pretreated before CA
for 30 min to further investigate the interactions among these
signaling pathways.
Measurement of NO production
BV2 cells were pretreated with 80 mMCAfor4h,thentreated
with LPS (1 mg/ml) for 12 h. The content of NO in the supernatant
was measured by the Griessmethod. Samples were reacted with
thesamevolumeoftheGriessreagent[0.1%(w/v)N-(1-
naphathyl)-ethylenediamine and 1% (w/v) sulfanilamide in 5%
(v/v) phosphoric acid] at 37°C for 10 min. The optical density at
540 nm was measured with a microplate reader (Bio-Rad).
Western blot analysis
Mouse brain tissues were homogenized and extracted with
normal sodium. The treated BV2 cells were lysed with cell lysis
buffer (Beyotime Institute of Biotechnology, Jiangsu, China) and
nuclear extraction reagent (Xianfeng Biotechnology, Xi’an,
China) to yield a cytosolic extract (cytosol) and nuclear extract
(nucleus). The total protein concentrations were determined us-
ing the BCA Protein Kit (Thermo Fisher Scientific). Brain tissue
homogenates and cell lysates were solubilized in SDS sample
buffer and then heated at 95°C for 10 min. The proteins were
separated by SDS-PAGE and transferred onto PVDF mem-
branes. Using appropriate antibodies, the immunoreactive bands
were visualized with an enhanced chemiluminescence reagent.
Antibodies against COX-2, GAPDH, lamin B, and horseradish
peroxidase–conjugated secondary antibodies were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-
bodies against iNOS (2982); NF-kB (8242); p-p44/42 MAPK
(ERK1/2) (9101); p44/42 MAPK (ERK1/2) (9102); p-SAPK/JNK
(Thr183/Tyr185) (9251); SAPK/JNK (9252); p-p38 MAPK (9211);
p38 MAPK (9212); IkB (9242); p-IkB (9246S); APP (2452); p-NF-kB
(Ser 536) (93H1) 3033; BACE1 (D10E55606); p50 (13586s); p-AKT
(9271); and AKT (9272) were purchased from Cell Signaling
Technology.
Data analysis
Before statistical analysis, data were tested for homogeneity of
variances by the Levene test. For multiple comparisons, 1-way
ANOVA was followed by the Bonferroni test when variances
were homogeneous or by the Tamhane test when variances were
not homogeneous by SPSS 18.0 software (IBM SPSS, Chicago, IL,
USA). In vivo data are reported as the means 6SEM of at least 3
independent experiments. In addition, in vitro data are reported
as the means 6SD of at least 3 independent experiments. The
means were considered to be statistically distinct if P,0.05.
RESULTS
Y-maze test
The behavior tests were performed as scheduled (Fig. 1B).
Regarding the behavioral performance of mice in the
Y-maze task, there were no significant differences in the
number of total arm entries among the different mouse
groups, suggesting that the endotoxin or CA did not affect
the motor activities of the mice (Fig. 1C). LPS significantly
decreased spontaneous alternation compared to control
TABLE 1. Primer sequences used for qPCR analysis
Primer, 59–39
Gene Forward Reverse
Gapdh TGGAGAAACCTGCCAAGTATGA TGGAAGAATGGGAGTTGCTGT
Cox-2 GAAGTCTTTGGTCTGGTGCCT GCTCCTGCTTGAGTATGTCG
Nos2 GGAGCGAGTTGTGGATTG CCAGGAAGTAGGTGAGGG
IL-1bTGACGGACCCCAAAAGAHTGA TCTCCACAGCCACAATGAGT
Tnf-aCCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG
IL-6 TTCCATCCAGTTGCCTTCTTG TATCCTCTGTGAAGTCTCCTCTC
IL-10 GCTCCAAGACCAAGGTGTCTACAA CCGTTAGCTAAGATCCCTGGATCA
Bace1 CCGGCGGGAGTGGTATTATGAAGT GATGGTGATGCGGAAGGACTGATT
MMP1 GTGAATGGCAAGGAGATGATGG ACGAGGATTGTTGTGAGTAATGG
MMP3 GTCCTCCACAGACTTGTCCC AGGACATCAGGGGATGCTGT
MMP9 CATTCGCGTGGATAAGGAGT ACCTGGTTCACCTCATGGTC
Bdnf CTCCGCCATGCAATTTCCACT GCCTTCATGCAACCGAAGTA
Ngf CGACTCCAAACACTGGAACTCA GCCTGCTTCTCATCTGTTGTCA
NT3 GTTCCAGCCAATGATTGCAA GGGCGAATTGTAGCGTCTCT
NT4 CAAGGCTAAGCAGTCCTATGT CAGTCATAAGGCACGGTAGAG
4 Vol. 31 April 2017 LIU ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
group, indicating a loss of working memory, while CA
markedly stimulated the decreased spontaneous alterna-
tion induced by LPS (Fig. 1D).
Morris water maze test
The Morris water maze test was used to determine the
intervention of CA on spatial memory impairment in-
duced by LPS. As illustrated in Fig. 2A, LPS-treated mice
took a longer time to find the platform compared to the
control group, whereas supplementation of CA signifi-
cantly decreased the escape latency. There has no signifi-
cant difference in escape distance among these different
groups, indicating no effects of endotoxin or CA on motor
activities, which was consistent with the results of the
Y-maze test (Fig. 2B).
Next, the hidden platform was removed to perform a
probe trial. As shown in Fig. 2C–E,comparedtothe
control group, the mice stimulated by LPS swam across
the entire pool and spent less time in the target quadrant
with a lower number of platform crossings. Treatment
with CA + LPS exhibited a significant increase in the av-
erage time spent in the target quadrant with more cross-
ing of the platform location, retained the LPS-induced
spatial memory loss.
Inhibition effects of CA on neuron damage
and neurotropic factor expression
To uncover whether CA supplementation could protect
neurons from LPS-induced damage, HE staining was used
to observe the histopathological changes in the hippocam-
pus and cortex, and BrdU/NeuN immunofluorescence
staining was applied to determine adult hippocampal
neurogenesis. The histology of the cortex and hippo-
campus in Fig. 3Aindicated that an intraperitoneal in-
jection of LPS led to cell shrinkage and increased the level
of apoptotic neurons compared to the control group, while
supplementation of CA markedly reversed this trend.
Moreover, CA elevated the number of BrdU-positive cells
(survival of newborn neurons) that was decreased by LPS
treatment (Fig. 3A). As shown in Fig. 3B–E,themRNA
expressions of neurotrophic factors including brain-
derived neurotrophic factor (BDNF), nerve growth factor
(NGF), neurotrophin (NT) 3, and NT4 were determined.
The results demonstrated that after 9 d of LPS treatment,
the mRNA expressions of BDNF and NGF significantly
increased, and CA + LPS treatment ameliorated these gene
expressions increases. However, there were no statistically
significant differences between NT3 and NT4 mRNA
expressions.
Figure 2. Suppression of CA on LPS-induced memory loss by water maze test. Passive avoidance tests and Morris water maze tests
were completed. Escape latency (A), escape distance during place navigation test (B), time spent in target quadrant (C), number
of platform crossings (D), and percentage of distance in target quadrant (E) in probe trial were recorded. Data are presented as
means 6SEM,n= 10. *P,0.05, **P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
CA SUPPLEMENTATION AND MEMORY 5
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
Effects of CA on amyloidogenesis in
mouse brain
Amyloidogenesis is known to contribute to the pathogen-
esis of AD. To investigate whether CA could reduce LPS-
triggered Abaccumulation and thus recover learning and
memory function, thioflavin S immunofluorescence and
Ab
1-42
IHC staining were carried out for the determination
of Abaccumulation. As illustrated in Fig. 4A,ahigher
accumulation of Ab
1-42
was observed in the LPS-injected
group, while a lower accumulation of Ab
1-42
was detected
in the brain cortex of mice who received CA. Similarly, the
fluorescence intensity of thioflavin S, a dye that interacts
with the bsheet–rich structures of Ab, were consistent with
theresultofAb
1-42
IHC staining. In addition, the ELISA
results also showed that CA significantly reduced the LPS-
elevated Ab
1-42
levels in mouse brain (Fig. 4B). Addition-
ally, CA substantially down-regulated the expressions of
APP and BACE1 induced by LPS, thereby intervening in
the generation of Ab(Fig. 4C, D).
Numerous studies have shown that impairments in learning
and memory associated with aging or AD have been attributed
primarily to cholinergic dysfunction, including impaired ACh
release, decreased ChAT activity, and increased AChE activity
in the CNS (18). Therefore, the effects of CA on the cholinergic
system balance were also detected. As shown in Fig. 4E–G,CA
Figure 3. Effects of CA on
preventing neuron damage and
neurotropic factors expression
induced by LPS. HE staining of
cortex and DG region (A), and
representative images of double
fluorescence staining for NeuN
(red) and BrdU (green) in DG.
mRNA levels of neurotrophic fac-
tors, including BDNF (B), NGF
(C), NT3 (D), and NT4 (E)in
mouse brain, were measured by
qPCR. Data are presented as
means 6SEM,n$5. *P,0.05,
**P,0.01 vs. control group,
#
P,
0.05,
##
P,0.01 vs. LPS group.
6 Vol. 31 April 2017 LIU ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
normalized the unbalanced cholinergic system by elevating
ACh level and ChAT activity, and suppressing AChE activity.
Effects of CA on microglia and
astrocyte activation
To investigate whether CA could suppress glial activation,
IHC staining was performed with IBA-1 (a marker of
microglial activation) and GFAP (a marker of astrocytes ac-
tivation) antibody. As illustrated in Fig. 5A, the expression of
IBA-1 in mice cortex, dentate gyrus (DG), and hippocampal
CA1 and CA3 regions treated with LPS were enormously
increased compared to control. However, CA supplemen-
tation decreased IBA-1 expressions in these regions. Simi-
larly, the expressions of GFAP in all aforementioned regions
of the brain were normalized by CA treatment compared to
the LPS group (Fig. 5B). Consistent with the result from IHC
staining, the Western blot analysis results in Fig. 5Calso
demonstrated that CA inhibited the elevated protein ex-
pressions of IBA-1 and GFAP induced by LPS.
Inhibitory effects of CA on expressions of
serum and brain inflammatory mediators
Inflammation has been described as the culprit of dis-
ease or an attempt by the immune system to contain
the accumulation of Abplaques in the brain (19). Ac-
cumulated studies revealed that excessive activation of
glial cells leads to the release of a large amount of proin-
flammatory factors. To investigate the effects of CA on the
LPS-induced systemic and brain inflammatory responses,
the levels of inflammatory mediators, including ILs and
Figure 4. Inhibition of CA on LPS-induced amyloidogenesis in mouse brain. A) Accumulation of Abwas detected by thioflavin S
staining and Ab
1-42
immunostaining in cortex. B)LevelsofAb
1-42
in brain were measured by ELISA. C) Expressions of APP and
BACE1 in mouse brain were measured by Western blot analysis. Densitometry analysis shown at right. D) mRNA levels of BACE1 in
mouse brain were measured by qPCR; also measured were AChE activity (E), ChAT activity (F), and levels of ACh (G) in mouse
brain. Data are presented as means 6SEM,n$5. *P,0.05, **P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
CA SUPPLEMENTATION AND MEMORY 7
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
TNFs, were measured. As shown in Fig. 6A, B,the content
of IL-1band TNF-ain serum were significantly increased
in the LPS-treated group, whereas supplementation
of CA remarkably inhibited them. Moreover, CA sup-
pressed the LPS-triggered up-regulated mRNA expres-
sions of inflammatory mediators IL-6, IL-1b, and TNF-a,
and promoted antiinflammatory mediator IL-10 mRNA
expression in mouse brain (Fig. 6C–F). In addition, ma-
trix metalloproteinases (MMPs), a family of neutral en-
dopeptidases, play a vital role in a variety of pathological
inflammatory conditions. The results in Fig. 6G–Iindicated
that LPS injection enormously increased the mRNA
expressions of MMP1 and MMP9, with little effect on
MMP3, compared to the control group. CA treatment
significantly down-regulated the mRNA expressions of
MMP1 and MMP9.
Effects of CA on the MAPK and NF-kB
signaling pathways in vivo and in vitro
NF-kB is a multidirectional transcription regulation fac-
tor that triggers the release of inflammatory mediators
including IL-1, IL-6, TNF-a, COX-2, and iNOS and that
regulates the cellular inflammatory responses. As dem-
onstrated in Fig. 7A–C, CA supplementation substan-
tially suppressed the LPS-induced elevated proportions
of pIkB/IkB and p-NF-kB/NF-kB, and the relative ex-
pressions of iNOS, COX-2, and TLR-4. In addition, the
mRNA expressions of iNOS and COX-2 were consistent
with their protein translation levels (Fig. 7E, F). Further-
more, MAPKs were one of the important signals mediating
the cellular response involved in survival, proliferation,
andapoptosis,andalsocontributedtoinflammatoryre-
sponse. It was shown that CA significantly down-regulated
the phosphorylation of JNK, ERK, and p38 in brain tissues
compared to LPS-treated mice (Fig. 7D).
Similar results were also found in the in vitro study. CA
suppressed the LPS-induced protein expressions of COX-2
and iNOS, and the secretion of NO in BV2 microglial cells
in a dose-dependent manner (Fig. 8A, B). As shown in
Fig. 8C–E, the stimulation of cells with LPS improved the
levels of PGE2, TNF-a, and IL-1bsecreted in the cell cul-
ture medium, while pretreatment with CA notably re-
strained the release of these proinflammatory cytokines
(P,0.05). In Fig. 9A, LPS notably enhanced the
Figure 5. Suppression of CA on activation of microglia and astrocytes induced by LPS. IHC images of IBA-1 (marker of microglial
activation) (A) and GFAP (marker of astrocytes activation) (B) in mouse cortex, and CA1, CA3, and DG regions of hippocampus.
(C) Expressions of IBA-1 and GFAP in mouse brain. Densitometry analysis is at right. Data are presented as means 6SEM,n$5.
*P,0.05, **P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
8 Vol. 31 April 2017 LIU ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
phosphorylation of AKT, ERK1/2, JNK, and p38, while
CA significantly weakened it. Furthermore, 80 mMCA
dramatically reduced LPS-induced phosphorylation of
IkB and blocked the translocation of NF-kB from the cy-
tosol to the nucleus in BV2 cells (Fig. 9B).
Additionally, to look for a potent linkage between the
MAPK, PI3K/Akt, and NF-kB signaling pathways, BV2
microglial cells were pretreated with MAPK inhibitors
(U0126, SP600125, or SB203580) or PI3K/Akt inhibitor
(LY294002) before LPS stimulation in the presence of CA.
Figure 9C, D shows that the JNK inhibitor (SP600125) and
p38 inhibitor (SB203580) suppressed the phosphorylation
of IkB and translocation of NF-kB, and reinforced the
antiinflammatory effect of CA, which was consistent with
LY294002, while the ERK1/2 inhibitor U0126 showed no
obvious promoting role in it. Fig. 10 illustrates the effects of
CA on suppression of systemic inflammation–induced
amyloidogenesis and memory loss.
DISCUSSION
Numerous reports suggest that neuroinflammation and
Abplay essential roles in the pathogenesis of AD (20). Our
present study showed that CA, a natural polyphenol
from purple coneflower and chicory, rescued systemic
LPS-induced learning and memory loss. Significantly,
CA alleviated LPS-stimulated amyloidogenesis, restrained
neuronal damage and neurogenesis loss, suppressed cy-
tokine overrelease, and maintained the balance of cholin-
ergic signaling in brain, which might be related to the
cognitive function enhancement. Moreover, our study
Figure 6. Inhibitory effects of CA on LPS-induced up-regulation of inflammatory mediators in plasma and brain. Levels of IL-1b
(A) and TNF-a(B) in plasma were measured by ELISA kits. mRNA levels of inflammatory mediators including IL-6 (C), IL-1b
(D), IL-10 (E), and TNF-a(F), and MMPs including MMP1 (G), MMP3 (H), and MMP9 (I) in mouse brain were detected by
qPCR. Data are presented as means 6SEM,n$5. *P,0.05, **P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
CA SUPPLEMENTATION AND MEMORY 9
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
also indicated that the antiamyloidogenic effects of CA
might result from suppressing glial cell activation and
inhibiting the NF-kB pathway, which regulates the tran-
scription of inflammatory mediators as well as BACE1.
A metabonomic study demonstrated that CA has the
ability to cross the blood–brain barrier (17). We did not
observe any adverse effects of CA during the present study.
Consistent with the present research, CA was also reported
to improve cognitive loss in other animal models. CA at
1 mg/kg exhibited a significant decrease in immobility
period in the Porsolt swim stress–induced behavioral de-
spair test and escape failures in the learned helplessness
test, which indicates that CA has considerable antidepres-
sant activities (21). In our study, an intraperitoneal injection
of LPS impaired working memory and reference memory
without perturbing locomotor activity. However, the
treatment of CA in the drinking water for 45 d rescued LPS-
triggered deterioration of spatial learning abilities.
Many factors contribute to the risk of cognitive im-
pairment. The increase of extraneuronal senile plaques
and neurofibrillary tangles are the major modes of path-
ogenesis of cognitive impairment in AD (22). Abis cleaved
from the precursor APP by secretases. In our study, CA
markedly decreased the expressions of APP and BACE1 in
the whole brain, which partly explains how CA inhibited
Ab
1-42
accumulation in the cortex and hippocampus. Al-
though amyloid increases alone might not quantitatively
explain the decrease in cognitive function in transgenic
AD mice (23), amyloidogenesis also triggers cholinergic
system unbalance in CNS, which is another molecular
mechanism of LPS-induced memory loss (24). The balance
of the cholinergic system plays an essential role in regu-
lating cognitive function in AD (25). A systematic review
and metaanalysis demonstrated that individual anticho-
linergic drugs could increase the risks of cognitive deficits
in older people (26). ACh, an essential neurotransmitter, is
synthesized from choline and acetyl-CoA via stimulation of
ChAT, and hydrolyzed by AChE to generate acetate and
choline in the synaptic cleft (27). Injection of LPS was re-
ported to perturb cholinergic gene expressions in the con-
text of peripheral inflammation (28). Consistently, we
demonstrated that intraperitoneal injection of LPS signifi-
cantly decreased ACh levels accompanied by elevating
AChE activity and inhibiting ChAT activity in the mouse
brain. It was reported that caftaric acid, a metabolite of
CA, was an efficient butyrylcholinesterase inhibitor (29). In
Figure 7. Prevention of CA on LPS-induced NF-kB and MAPKs activation in mouse brain. A) Expressions of inflammatory
signaling pathways including NF-kB, MAPKs, and inflammatory related proteins iNOS, COX-2, and TLR-4 in mouse brain. B–D)
Densitometry analysis. mRNA levels of COX-2 (E) and iNOS (F) were detected by qPCR. Data are presented as means 6SEM,n$
5. *P,0.05, **P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
10 Vol. 31 April 2017 LIU ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
our study, treatment with CA normalized the cholinergic
system in the mouse CNS. Recent studies have proved
that neurotrophic factors such as BDNF and NGF could
reduce amyloidogenesis in AD (30). Unexpectedly, we
found that BDNF, NGF, NT3, and NT4 mRNA expres-
sions of neurotrophic factors exhibited no changes after
CA treatment. Moreover, assembly of Abmight cause
hippocampal synaptic dysfunction (31). Additionally,
substantial evidence exists demonstrating that adult neu-
rogenesis contributes to learning and memory consolida-
tion (32). Dupret et al. (33) indicated that apoptosis and
neurogenesis of hippocampal neurons play crucial roles in
spatial learning–related memory formation. In the present
study, CA supplementation reversed the LPS-induced
neuron damage and loss of neurogenesis in the cortex
and hippocampus, subserving the mouse cognitive abil-
ity. Interestingly, accumulated studies have described
that cytokines including TNF-a,IL-1b, and IL-6 exert their
effects directly on synaptic plasticity and neurogenesis,
which are involved in cognitive processes (34, 35). It was
found that CA significantly inhibited LPS-induced ex-
cretion of these inflammatory mediators both in mouse
brain and BV2 microglia, suggesting another underlying
mechanism for CA to promote learning and spatial cog-
nitive abilities.
LPS primarily binds to the CD14/TLR-4 receptor
complex on glial cells in the CNS and subsequently acti-
vates the NF-kB pathway (36). With respect to CNS glia, it
has long been acknowledged that LPS serves as a potent
stimulus for microglial activation, typified by the robust
production of numerous proinflammatory mediators via
activating downstream of the TLR-4 and NF-kBtran-
scriptional pathways. Overactivation of microglia leads to
severe inflammatory responses in the CNS. It has been
demonstrated that lutein suppresses LPS-induced BV2
microglial cell activation by inhibiting NF-kB activation
and the downstream expression of iNOS, COX-2, IL-1b,
and TNF-a(37). 3,4,5-Trihydroxycinnamic acid, also a
kind of caffeic acid derivative, was reported to inhibit BV2
cell inflammation via inhibition of iNOS (38). Similar re-
sults were also found in our study. Another caffeic acid
derivative, CA, dramatically suppressed the LPS-induced
activation of both microglia and astrocytes, and also
inhibited LPS-elevated expressions of inflammatory-
related protein COX-2 and iNOS, and inflammatory me-
diators including IL-1b, IL-6, and TNF-ain mouse brain.
Moreover, BACE1 transduction was also controlled by
NF-kB. We found that CA dramatically reversed the LPS-
induced up-regulation of BACE1 mRNA and protein level
as well as the APP expression via the inactivation of NF-kB
Figure 8. Inhibition effects of CA on inflammatory responses induced by LPS in BV2 microglial cells. BV2 cells were pretreated
with CA at indicated concentration (20, 40, 80 mM) for 4 h, then exposed to LPS (1 mg/ml) for 12 h. A) Protein expressions of
iNOS and COX-2 were measured by Western blog analysis. B) Content of NO in supernatant was determined by Griess method.
Content of PGE2 (C) , IL-1b(D), and TNF-a(E) were measured by ELISA. Data are presented as means 6SD,n$6. *P,0.05,
**P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
CA SUPPLEMENTATION AND MEMORY 11
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
in mouse brain. Interestingly, CA also down-regulated the
mRNA levels of MMPs in LPS-treated mice, which might
provide another clue for the explanation of the anti-
amyloidosis effects of CA (39).
Redox-sensitive cytoplasmic signaling MAPKs path-
ways are also excessively activated in AD. JNK1 deficiency
has been demonstrated to reduce BACE1 expression and
cause alterations in the amyloidogenic pathway (40). Akt,
another redox-sensitive signaling molecule, is also involved
in regulating amyloidogenesis. Hydrogen sulfide down-
regulates BACE1 through activating the PI3K/Akt signal-
ing pathway in the brain of a transgenic mouse (41).
Moreover, reports have indicated that activation of the
PI3K/Akt and MAPK signaling cascades implicates a
neuroprotection role via altering the binding activity and
nuclear translocation of NF-kB (42). In the present study, we
found that CA could suppress the LPS-stimulated MAPKs
signaling both in vivo and in vitro. The in vitro study also
suggested that CA suppressed inflammatory responses
through inactivating MAPKs/PI3K/Akt/NF-kB pathways
in LPS-activated BV2 cells, which could also partly explain
how CA inhibited inflammatory responses in microglia.
In summary, our study demonstrated that CA alleviated
systemic inflammation-induced amyloidogenesis and cog-
nitive deficits through preventing neuron damage, sup-
pressing glia activation, and down-regulating inflammatory
responses in CNS. The underlying mechanism of anti-
neuroinflammatoryeffectsofCAmightbebyblockingthe
translocation of NF-kB and inhibiting the phosphorylation
of MAPKs and PI3K/Akt. Therefore, the natural phenolic
acid CA can be used as a treatment for amyloidogenesis and
neuroinflammation disease such as AD. Further research is
required to evaluate the mechanistic role of CA in various
neurodegenerative disorders.
Figure 9. Inhibitory effects of CA on MAPKs, PI3K/Akt, and NF-kB pathways in LPS-activated BV2 cells. BV2 microglial cells were
pretreated with 80 mM CA for 4 h, then exposed to LPS (1 mg/ml) for 30 min expressions of phosphorylated and total forms of AKT,
ERK1/2,JNK,andp38MAPKs(A),andIkBandNF-kB(B) in cytosol and nucleus were measured by Western blot analysis. C,D) BV2
cells were preincubated with LY294002 (AKT inhibitor, 20 mM), U0126 (ERK1/2 inhibitor, 10 mM), SP600125 (JNK inhibitor, 20 mM),
and SB203580 (p38 inhibitor, 20 mM) for 30 min, then treated with or without 80 mMCAfor4handfinally treated with LPS (1 mg/
ml) for 30 min. Expressions of phosphorylated or total forms of IkBandNF-kB in cytosol and nucleus were measured by Western blot
analysis. Data are presented as means 6SD,n$6. *P,0.05, **P,0.01 vs. control group,
#
P,0.05,
##
P,0.01 vs. LPS group.
12 Vol. 31 April 2017 LIU ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
ACKNOWLEDGMENTS
The authors thank the National Key Research and Develop-
ment Program of China (Grant 2016YFD0400601), the National
Natural Science Foundation of China (Grant 31671859), and
Scientific Startup Funds for Doctors of Northwest Agriculture
and Forestry University (Grant Z109021611).
AUTHOR CONTRIBUTIONS
Q. Liu, Z. Liu, Y. Chen, Y. Wang, and X. Liu conceived of
and designedthe research; Q. Liu, Z. Liu,Y. Chen, C. Shen,
and Y. Xiao performed the experiments; Q. Liu and Z. Liu
analyzed thedata; Q. Liu, Z. Liu, and X. Liu interpreted the
results of the experiments; Q. Liu prepared the figures;
Z. Liu and Q. Liu drafted the article; and all authors read
and approved the final article.
REFERENCES
1. Heneka, M. T.,Carson, M. J.,El Khoury, J.,Landreth,G. E., Brosseron,
F.,Feinstein,D.L.,Jacobs,A.H.,Wyss-Coray,T.,Vitorica,J.,
Ransohoff, R. M., Herrup, K., Frautschy, S. A., Finsen, B., Brown,
G.C.,Verkhratsky,A.,Yamanaka,K.,Koistinaho,J.,Latz,E.,Halle,A.,
Petzold, G. C., Town, T., Morgan, D., Shinohara, M. L., Perry, V. H.,
Holmes, C., Bazan, N. G., Brooks, D. J., Hunot, S., Joseph, B.,
Deigendesch,N.,Garaschuk,O.,Boddeke,E.,Dinarello,C.A.,
Breitner, J. C., Cole, G. M., Golenbock, D. T., and Kummer, M. P.
(2015) Neuroinflammation in Alzheimer’sdisease.Lancet Neurol. 14,
388–405
2. Hooten, K. G., Beers, D. R., Zhao, W., and Appel, S. H. (2015)
Protective and toxic neuroinflammation in amyotrophic lateral
sclerosis. Neurotherapeutics 12,364–375
3. Minter,M.R.,Taylor,J.M.,andCrack,P.J.(2016)Thecontribution
of neuroinflammation to amyloid toxicity in Alzheimer’s disease.
J. Neurochem. 136,457–474
4. Villegas-Llerena, C., Phillips, A., Garcia-Reitboeck, P., Hardy, J., and
Pocock,J.M.(2016)Microglialgenesregulatingneuroinflammation
in the progression of Alzheimer’sdisease.Curr. Opin. Neurobiol. 36,
74–81
5. Lee, M., McGeer, E., and McGeer, P. L. (2015) Activated human
microglia stimulate neuroblastoma cells to upregulate production of
beta amyloid protein and tau: implications for Alzheimer’sdisease
pathogenesis. Neurobiol. Aging 36,42–52
6. Lee,J.W.,Lee,Y.K.,Yuk,D.Y.,Choi,D.Y.,Ban,S.B.,Oh,K.W.,and
Hong,J.T.(2008)Neuro-inflammation induced by lipopolysaccha-
ride causes cognitive impairment through enhancement of beta-
amyloid generation. J. Neuroinflammation 5,37
7. Catorce, M. N., and Gevorkian, G. (2016) LPS-induced murine neu-
roinflammation model: main features and suitability for pre-clinical
assessment of nutraceuticals. Curr. Neuropharmacol. 14,155–164
8. Okun, E., Griffioen, K. J.,and Mattson, M.P. (2011) Toll-like receptor
signaling in neural plasticity and disease. Trends Neurosci. 34,269–281
9. Chen,C.H.,Zhou,W.,Liu,S.,Deng,Y.,Cai,F.,Tone,M.,Tone,Y.,
Tong, Y., and and Song, W. (2012) Increased NF-kappaB signalling
up-regulates BACE1 expression and its therapeutic potential in Alz-
heimer’sdisease.Int. J. Neuropsychopharmacol. 15,77–90
10. Gu,S.M.,Park,M.H.,Hwang,C.J.,Song,H.S.,Lee,U.S.,Han,S.B.,
Oh, K. W., Ham, Y. W.,Song, M. J., Son, D. J., and Hong, J. T. (2015)
Bee venom ameliorates lipopolysaccharide-induced memory loss by
preventing NF-kappaB pathway. J. Neuroinflammation 12,124
11. Spagnuolo, C., Napolitano, M., Tedesco, I., Moccia, S., Milito, A., and
Russo,G. L. (2016)Neuroprotective roleof naturalpolyphenols.Curr.
Top. Med. Chem. 16,1943–1950
12. Xiao, H., Wang, J., Yuan, L., Xiao, C., Wang, Y., and Liu, X. (2013)
Chicoric acid induces apoptosis in 3T3-L1 preadipocytes through
ROS-mediated PI3K/Akt and MAPK signaling pathways. J. Agric. Food
Chem. 61, 1509–1520
13. Liu, Q., Wang, Y., Xiao, C., Wu, W., and Liu, X. (2015) Metabolism of
chicoric acid by rat liver microsomes and bioactivity comparisons of
chicoric acid and its metabolites. Food Funct. 6,1928–1935
14. Park,C.M.,Jin,K.S.,Lee,Y.W.,andSong,Y.S.(2011)Luteolinand
chicoric acid synergistically inhibited inflammatory responses via
inactivation of PI3K-Akt pathway and impairment of NF-kB trans-
location in LPS stimulated RAW 264.7 cells. Eur. J. Pharmacol. 660,454–459
15. Xiao,H.F.,Xie,G.,Wang,J.W.,Hou,X.F.,Wang,X.,Wu,W.Q.,and
Liu,X. B. (2013) Chicoric acidprevents obesity byattenuatinghepatic
steatosis, inflammation and oxidative stress in high-fat diet–fed mice.
Food Res. Int. 54,345–353
16. Zhu,D.,Wang,Y.,Du,Q.,Liu,Z.,andLiu,X.(2015)Cichoricacid
reverses insulin resistance and suppresses inflammatory responses in
the glucosamine-induced HepG2 cells. J. Agric. Food Chem. 63,
10903–10913
17. Wang, Y., Xie, G., Liu, Q., Duan, X., Liu, Z., and Liu, X. (2016)
Pharmacokinetics, tissue distribution, and plasma protein binding
study of chicoric acid by HPLC-MS/MS. J. Chromatogr. B Analyt.
Technol. Biomed. Life Sci. 1031,139–145
Figure 10. Illustration of effects of CA on suppression of systemic inflammation induced amyloidogenesis and memory loss.
CA SUPPLEMENTATION AND MEMORY 13
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
18. Plotkin, D. A., and Jarvik, L. F. (1986) Cholinergic dysfunction in
Alzheimer disease: cause or effect? Prog. Brain Res. 65,91–103
19. Fernandez-Perez, E. J., Peters, C., and Aguayo, L. G. (2016)
Membrane damage induced by amyloid beta and a potential link
with neuroinflammation. Curr.Pharm.Des.22,1295–1304
20. D´
a Mesquita, S., Ferreira, A.C., Sousa, J. C., Correia-Neves, M., Sousa,
N., and Marques, F. (2016) Insights on the pathophysiology of
Alzheimer’s disease: the crosstalk between amyloid pathology,
neuroinflammation and the peripheral immune system. Neurosci.
Biobehav. Rev. 68, 547–562
21. Kour, K., and Bani, S. (2011) Chicoric acid regulates behavioral and
biochemical alterations induced by chronic stress in experimental
Swiss albino mice. Pharmacol. Biochem. Behav. 99, 342–348
22. Lloret, A., Fuchsberger, T., Giraldo, E., and Viña, J. (2015) Molecular
mechanisms linking amyloid btoxicity and Tau hyperphosphorylation
in Alzheimer’sdisease.Free Radic. Biol. Med. 83, 186–191
23. Foley,A.M.,Ammar,Z.M.,Lee,R.H.,andMitchell,C.S.(2015)
Systematic review of the relationship between amyloid-blevels and
measures of transgenic mouse cognitive deficit in Alzheimer’s disease.
J. Alzheimers Dis. 44,787–795
24. Baker-Nigh, A., Vahedi, S., Davis, E. G., Weintraub, S., Bigio, E. H.,
Klein, W.L., and Geula, C. (2015) Neuronal amyloid-baccumulation
within cholinergic basal forebrain in ageing and Alzheimer’s disease.
Brain 138, 1722–1737
25. Tata, A. M., Velluto, L., D’Angelo, C., and Reale, M. (2014)
Cholinergic system dysfunction and neurodegenerative diseases:
cause or effect? CNS Neurol. Disord. Drug Targets 13,1294–1303
26. Ruxton, K.., Woodman, R. J., and Mangoni, A. A. (2015) Drugs with
anticholinergic effects and cognitive impairment, falls and all-cause
mortality in older adults: a systematic review and meta-analysis. Br. J.
Clin. Pharmacol. 80,209–220
27. Soreq, H. (2015) Checks and balances on cholinergic signaling in
brain and body function. Trends Neurosci. 38,448–458
28. Silverman, H. A., Dancho, M., Regnier-Golanov, A., Nasim, M.,
Ochani,M.,Olofsson,P.S.,Ahmed,M.,Miller,E.J.,Chavan,S.S.,
Golanov, E., Metz, C. N., Tracey, K. J., and Pavlov, V. A. (2015) Brain
region–specific alterations in the gene expression of cytokines,
immune cell markers and cholinergic system components during
peripheral endotoxin-induced inflammation. Mol. Med. 20, 601–611
29. Szwajgier, D. (2013) Anticholinesterase activity of phenolic acids and
their derivatives. Z. Naturforsch. C 68,125–132
30. Triaca, V., Sposato, V., Bolasco, G., Ciotti, M. T., Pelicci, P., Bruni,
A.C.,Cupidi,C.,Maletta,R.,Feligioni,M.,Nistic`o,R.,Canu,N.,and
Calissano, P. (2016) NGF controls APP cleavage by downregulating
APP phosphorylation at Thr668: relevance for Alzheimer’s disease.
Aging Cell 15,661–672
31. Selkoe, D. J. (2002) Alzheimer’s disease is a synaptic failure. Science
298,789–791
32. Siwak-Tapp, C. T., Head, E., Muggenburg, B. A., Milgram, N. W., and
Cotman, C. W. (2007)Neurogenesis decreases with age in the canine
hippocampus and correlates with cognitive function. Neurobiol. Learn.
Mem. 88, 249–259
33. Dupret, D., Fabre, A., D¨obr¨ossy,M.D.,Panatier,A.,Rodr´ıguez,
J.J.,Lamarque,S.,Lemaire,V.,Oliet,S.H.R.,Piazza,P.V.,and
Abrous, D. N. (2007) Spatial learning depends on both the
addition and removal of new hippocampal neurons. PLoS Biol. 5,
e214
34. McAfoose, J., and Baune, B. T. (2009) Evidence for a cytokine model
of cognitive function. Neurosci. Biobehav. Rev. 33,355–366
35. Terrando, N., Monaco, C., Ma, D., Foxwell, B. M. J., Feldmann, M.,
and Maze, M. (2010) Tumor necrosis factor-alpha triggers a cytokine
cascade yielding postoperative cognitive decline. Proc. Natl. Acad. Sci.
USA 107,20518–20522
36. Jiang,Y.,Chen,G.,Zheng,Y.,Lu,L.,Wu,C.,Zhang,Y.,Liu,Q.,and
Cao,X. (2008) TLR4signalinginduces functional nerve growthfactor
receptor p75NTR on mouse dendritic cells via p38MAPK and NF-
kappa B pathways. Mol. Immunol. 45, 1557–1566
37. Wu, W., Li, Y., Wu, Y., Zhang, Y., Wang, Z., and Liu, X. (2015) Lutein
suppresses inflammatory responses through Nrf2 activation and NF-
kB inactivation in lipopolysaccharide-stimulated BV-2 microglia. Mol.
Nutr. Food Res. 59,1663–1673
38. Lee, J. W., Bae, C. J., Choi, Y. J., Kim, S. I., Kim, N. H., Lee, H. J., Kim,
S. S., Kwon, Y. S., and Chun, W. (2012) 3,4,5-Trihydroxycinnamic
acid inhibits LPS-induced iNOS expression by suppressing NF-kB
activation in BV2 microglial cells. Korean J. Physiol. Pharmacol. 16,
107–112
39. Hernandez-Guillamon, M., Mawhirt, S., Blais, S., Montaner, J.,
Neubert, T. A., Rostagno, A., and Ghiso, J. (2015) Sequential
amyloid-bdegradation by the matrix metalloproteases MMP-2 and
MMP-9. J. Biol. Chem. 290, 15078–15091
40. Petrov, D., Luque, M., Pedros, I., Ettcheto, M., Abad, S., Pallas, M.,
Verdaguer, E., Auladell, C., Folch, J., and Camins, A. (2016)
Evaluation of the role of JNK1 in the hippocampus in an experi-
mental model of familial Alzheimer’sdisease.Mol. Neurobiol. 53,
6183–6193
41. He,X.L.,Yan,N.,Chen,X.S.,Qi,Y.W.,Yan,Y.,andCai,Z.(2016)
Hydrogen sulfide down-regulates BACE1 and PS1 via activating
PI3K/Akt pathway in the brain of APP/PS1 transgenic mouse. Phar-
macol. Rep. 68, 975–982 doi:10.1016/j.pharep.2016.05.006
42. Shi,Z.M.,Han,Y.W.,Han,X.H.,Zhang,K.,Chang,Y.N.,Hu,Z.M.,
Qi, H. X., Ting, C., Zhen, Z., and Hong, W. (2016) Upstream
regulators anddownstream effectorsof NF-kB in Alzheimer’s disease.
J. Neurol. Sci. 366,127–134
Received for publication September 20, 2016.
Accepted for publication December 12, 2016.
14 Vol. 31 April 2017 LIU ET AL.The FASEB Journal xwww.fasebj.org Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
10.1096/fj.201601071RAccess the most recent version at doi:
published online December 21, 2016FASEB J
Qian Liu, Yuwei Chen, Chun Shen, et al.
Bκ inhibition of NF-via
inflammation-induced memory impairment and amyloidogenesis
Chicoric acid supplementation prevents systemic
Subscriptions
http://www.faseb.org/The-FASEB-Journal/Librarian-s-Resources.aspx
is online at The FASEB JournalInformation about subscribing to
Permissions
http://www.fasebj.org/site/misc/copyright.xhtml
Submit copyright permission requests at:
Email Alerts
http://www.fasebj.org/cgi/alerts
Receive free email alerts when new an article cites this article - sign up at
© FASEB
Vol., No. , pp:, February, 2017The FASEB Journal. 128.122.230.148 to IP www.fasebj.orgDownloaded from
