802C>T NOD2/CARD15 SNP is associated to Crohn's disease in Italian patients.

Article (PDF Available) · January 2015with 110 Reads 
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
DOI: 10.4172/2161-1041.S7-005
Cite this publication
Abstract
The incidence of Crohn’s Disease (CD), a complex inflammatory bowel disease, is rapidly increasing. NOD2/ CARD15 gene variants have been associated with early CD onset, terminal ileal involvement, and structuring disease. We comparatively analyzed, by PCR and direct sequencing, the exons 4, 8 and 11 of NOD2/CARD15 gene in CD Italian patients (n=42) and in healthy controls (n= 66). Our results show that the frequency of the allele T of the c.802C>T (p.P268S) SNP (rs2066842) results in linkage disequilibrium with allele T of the c.1377 C>T (p. R459R) SNP. Moreover, the frequency of the allele T of the c.802C>T (p.P268S) SNP (rs2066842) is significantly higher in CD’s patients than in control subjects (p=0.018; OR=2.02). Similarly, the frequency of the insertion c.3020insC (p.L1007fs) is significantly higher (p=0.0347; OR=14.59) in CD patients. Our results suggest that molecular analysis of the NOD2/CARD15 gene could represent a contributory tool for the identification of subjects genetically predisposed to CD.
Advertisement
ISSN: 2161-1041
H
e
r
e
d
i
t
a
r
y
G
e
n
e
t
i
c
s
:
C
u
r
r
e
n
t
R
e
s
e
a
r
c
h
Hereditary Genetics
Scudiero et al., Hereditary Genetics 2015, S7
http://dx.doi.org/10.4172/2161-1041.S7-005
Short Communication Open Access
Hereditary Genetics ISSN:2161-1041 Genetics an open access journal Genetic Diseases
C.802C>T NOD2/CARD15 SNP is Associated to Crohns Disease in Italian
Patients
Scudiero O1,2, Nigro E2, Monaco ML2, Polito R2, Capasso M1,2, Canani BR2,3, Castaldo G1,2 and Daniele A2,4*
1Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico II, Naples, Italy
2CEINGE Advanced Biotechnology, Naples, Italy
3Dipartimento of Medical Sciences and Translational European Laboratory for the Study of Diseases Induced by Food, University of Naples Federico II, Naples, Italy
4Department of Environmental Sciences and Technologies Biological Pharmaceutical, Second University of Naples, Caserta, Italy
*Corresponding authors: Aurora Daniele, PhD., Professor of Human
Nutrition, Department of Environmental Sciences and Technologies Biological
Pharmaceutical, Second University of Naples, Caserta, Italy, CEINGE Advanced
Biotechnology, Naples, Italy, Tel: 39 081 3737856; gsm: +39 3311847942; Fax: 39
081 3737808, E-mail: aurora.daniele@unina2.it
Received October 05, 2015; Accepted October 24, 2015; Published October 27,
2015
Citation: Scudiero O, Nigro E, Monaco ML, Polito R, Capasso M, et al. (2015)
C.802C>T NOD2/CARD15 SNP is Associated to Crohn’s Disease in Italian
Patients. Genetics S7: 005. doi:10.4172/2161-1041.S7-005
Copyright: © 2015 Scudiero O, et al. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited.
Keywords: NOD2/CARD15 gene; Variants; Molecular analysis;
Crohn disease
Introduction
Crohn’s Disease (CD) is a chronic relapsing inammatory disorder
of the gastrointestinal tract carrying a high morbidity and a poor quality
of life [1,2]. In the last two decades, the incidence of CD is rapidly
increasing [3]. Crohn’s disease diagnosis is oen established following
considerable diagnostic delay. An European study reported that the
median diagnostic delay in CD was 9 months with 75% of all study
subjects receiving a nal diagnosis within 24 months [4]. Delay in CD
diagnosis not only reduces the quality of life of the patients, but also has
important clinical implications, such as signicantly reduced response to
medical therapy. It has been demonstrated that the length of diagnostic
delay correlates with an increased risk of bowel stenosis and CD-related
intestinal surgery. For these reasons, eorts should be undertaken to
shorten the diagnostic delay [5]. e pathogenesis of CD is still largely
unclear, it meanly derives from interaction of environmental factors
and genetic predisposition. Genetically predisposed individuals have a
dysregulated mucosal immune response to commensal gut microbiota
which determines chronic bowel inammation. Moreover genome
wide association studies indicated several genetic factors associated
with CD susceptibility [6-9]. Nucleotide-binding Oligomerization
domain (NOD2)/Caspase-Recruiment Domain (CARD15) was the
rst gene identied as susceptibility gene for CD. It is located on
chromosome 16q12-21 and constituted by 12 exons encoding a protein
involved both in defence against microbial infections and in regulation
of inammation and apoptosis [10,11]. NOD2 protein contains 4
functional domains: 2 regions called CARD, involved in apoptosis,
located at the N-terminus; a central domain NBD (nucleotide-binding
domain), which possesses ATPase activity and is important for the
oligomerization of the protein; a region of 10 leucine-rich repeat
sequences (LRR), located at the C-terminal, involved in the interaction
with the muramyl dipeptide [12]. A number of polymorphisms
has been described in the NOD2 gene with a wide heterogeneity
between dierent ethnic CD groups [10,13-15]. However, the variants
associated with CD are c.2104 C>T (p.R702W), c.2722G>C (p.G908R),
and 3020insC (p.L1007fs) localized in exons 4, 8 and 11, corresponding
to LRR protein domain or adjacent region [16,17]. e impact of these
mutations, two amino acid substitutions and one single base insertion,
are still unclear [6,11,16,17].
In order to investigate the possible association between
polymorphisms in NOD2/CARD15 gene and CD Italian patients, we
comparatively analyzed by direct sequencing of the 4, 8 and 11 exons a
cohort of CD patients and healthy controls.
Materials and Methods
Subjects
Consecutive forty-two subjects (11–69 years, mean 26.6 years) with
a well-established CD diagnosis, according to standardized criteria
[4,5], observed at Department of Translational Medical Science at
the University of Naples Federico II were invited to participate into
the study. All patients accepted to participate and a blood sampling was
performed during routine visit for the follow up of CD (6 ml of whole
blood from venipuncture). e control group consists of 65 healthy
unrelated adults consecutively observed at the same Department without
rst and second degree family members of these subjects had an history
of suspected or dened diagnosis of inammatory bowel disease. A blood
sampling was performed in these healthy subjects during a screening
program. All study subjects were Caucasians. All subjects enrolled in the
study, provided written informed consent. e study was approved by the
Ethics Committee of our Institution.
DNA extraction and PCR
Genomic DNA was extracted from whole blood samples using a
commercial kit (Nucleon BACC-2; Amersham Biosciences). e exons
Abstract
The incidence of Crohn’s Disease (CD), a complex inammatory bowel disease, is rapidly increasing. NOD2/
CARD15 gene variants have been associated with early CD onset, terminal ileal involvement, and structuring disease.
We comparatively analyzed, by PCR and direct sequencing, the exons 4, 8 and 11 of NOD2/CARD15 gene in CD
Italian patients (n=42) and in healthy controls (n= 66). Our results show that the frequency of the allele T of the
c.802C>T (p.P268S) SNP (rs2066842) results in linkage disequilibrium with allele T of the c.1377 C>T (p. R459R)
SNP. Moreover, the frequency of the allele T of the c.802C>T (p.P268S) SNP (rs2066842) is signicantly higher
in CD’s patients than in control subjects (p=0.018; OR=2.02). Similarly, the frequency of the insertion c.3020insC
(p.L1007fs) is signicantly higher (p=0.0347; OR=14.59) in CD patients. Our results suggest that molecular analysis of
the NOD2/CARD15 gene could represent a contributory tool for the identication of subjects genetically predisposed
to CD.
Citation: Scudiero O, Nigro E, Monaco ML, Polito R, Capasso M, et al. (2015) C.802C>T NOD2/CARD15 SNP is Associated to Crohn’s Disease in
Italian Patients. Genetics S7: 005. doi:10.4172/2161-1041.S7-005
Page 2 of 3
Hereditary Genetics ISSN:2161-1041 Genetics an open access journal Genetic Diseases
4, 8, 11 of NOD2/CARD15 gene were amplied using the following
primers, designed by Primer3 soware:
Exon 4F 5’AGTGCACAGCTTGTGAATGG 3’,
Exon 4R 5’GCTCCCACACTTAGCCTTGA3’,
Exon 8F 5’CCACTCTGGGATTGAGTGGT3’,
Exon 8R 5’TCCATTGCCTAACATTGTGG3’,
Exon 11F 5’GGACAGGTGGGCTTCAGTAG3’,
Exon 11R 5’CCTCAAAATTCTGCCATTCC 3’
Protocol was performed as previously described [18,19]. For the
amplication reaction was used a touchdown PCR protocol, consisting
in 1 cycle of 3 min of denaturation at 94°C, aer which the DNA was
amplied during 39 cycles, of which 14 cycles consisted of 20s of
denaturation at 94°C, 40s of annealing at 62°C, decreasing 0.5°C each
cycle, and 45s of extension at 72°C; then 25 cycles of denaturation at
94°C for 20s, 40s of annealing at 55°C and 45s of extension at 72°C.
Aer amplication, the reaction mixture was subjected to a nal cycle
of 7 min of extension at 72°C. PCR products were sunjected to sequence
analysis performed on both strands with an automated procedure
using the 3100 Genetic Analyzer (Applied Biosystems). PCR fragments
were sequenced using the same primers used for PCR amplication.
Statistical analysis
Hardy-Weinberg equilibrium was evaluated using the goodness-of-
t chi-square test in control subjects. For genotyped SNPs, two-sided
chi-square tests were used to evaluate dierences in the distributions
of allele frequencies between all patients and controls. ORs and 95%
CIs were calculated to assess the relative disease risk conferred by a
specic allele.
Results
We amplied by PCR and direct sequenced exons 4, 8, 11 of NOD2/
CARD15 gene to analyze the allele genotype in control subjects and CD
patients. Molecular analysis revealed the following variants: c.802C>T
(p.P268S), c.1377 C>T (p.R459R), c.1761 T>G (p.R587R), c.2104 C>T
(p.R702W), c.2722G>C (p.G908R), and 3020insC (p.L1007fs).
e frequency of the allele T of the c.802C>T (p.P268S) SNP
(rs2066842) results in linkage disequilibrium with allele T of the c.1377
C>T (p.R459R) SNP. Moreover, the frequency of the allele T of the
c.802C>T (p.P268S) SNP (rs2066842) is signicantly higher in CD’s
patients than in control subjects (p = 0.018; OR=2.02). In addition, the
C insertion of the c.3020insC (p.L1007fs) is signicantly higher (p =
0.0347; OR=14.59) in CD patients.
No signicant dierences of the allelic frequency were observed for
the variants c.1761 T>G (p.R587R), c.2104 C>T (p.R702W), c.2722G>C
(p.G908R) (Table 1). e genotype frequencies of the c.802C>T
(p.P268S) SNP and variant 3020insC (p.L1007fs) were dierently
distributed between cases and controls (p =0.03 and p =0.01).
Discussion
Epidemiological and linkage studies suggest that genetic factors
play a signicant role in determining CD susceptibility [6-9], among
these the most associated is NOD2/CARD15 gene [10,11,13-17].
Polymorphisms in NOD2 gene reduce NOD2/CARD15 protein
function impairing a balanced inammatory response to external
stimuli [14,20]. Several variants were identied as genetic determinants
of CD susceptibility, even if with a remarkable heterogeneity among
racial and geographical groups [11,16,17,20]. e most frequent
variants in CD are c.2104 C>T (p.R702W), c.2722G>C (p.G908R), and
SNP/ genotypes Location Control frequencies, % CD frequencies, % Control MAF CD MAF Armitage's trend test p value OR (C.I.)
c.802 C>T (p.P268S)
CC 60.6 (40) 42.8 (18)
CT exon 4 30.3 (20) 35.7 (15) 0.24 0.39 0.03 0.018 2.022 (1.119-3.654)
TT 9.1 (6) 21.4 (9)
c.1377 C>T (p.R459R)
CC 60.6 (40) 45.2 (19)
CT exon 4 30.3 (20) 35.7 (15) 0.24 0.37 0.07 0.045 1.828 (1.007-3.316)
TT 9.1 (6) 19.0 (8)
c.1761 T>G (p.R587R)
TT 50 (33) 52.4 (22)
TG exon 4 33.3 (22) 35.7 (15) 0.33 0.30 0.62 0.580 0.847 (0.469-1.531)
GG 16.6 (11) 12 (5)
c.2104 C>T (p.R702W)
CC 92.4 (61) 83.3 (35)
CT exon 4 7.6 (5) 14.3 (6) 0.04 0.09 0.10 0.083 2.674 (0.844-8.469)
TT 0 (0) 2.4 (1)
c.2722 G>C (p.G908R)
GG 95.4 (63) 90.5 (38)
GC exon 8 4.5 (3) 7.1 (3) 0.02 0.06 0.21 0.269 2.722 (0.633-11.701)
CC 0 (0) 2.4 (1)
c.3020insC (p.L1007fs)
WT 66 (100) 90.5 (38)
WT/INS exon 11 0 (0) 9.5 (4) 0.01 0.05 0.01 0.0347 14.590 (0.775-274.584)
INS/INS 0 (0) 0 (0)
INS= insertion; WT= wild type; MAF= Minor allele frequency; OR= Odds Ratio; CI= condence interval. The statistical signicance was established at p < 0.05.
Table 1: Allele and genotype frequencies of NOD2/CARD15 gene polymorphisms in CD and control subjects
Citation: Scudiero O, Nigro E, Monaco ML, Polito R, Capasso M, et al. (2015) C.802C>T NOD2/CARD15 SNP is Associated to Crohn’s Disease in
Italian Patients. Genetics S7: 005. doi:10.4172/2161-1041.S7-005
Page 3 of 3
Hereditary Genetics ISSN:2161-1041 Genetics an open access journal Genetic Diseases
3020insC (p.L1007fs) [16,17]. ese polymorphisms alter the structure
of the protein at the level of the LRR domain or the adjacent regions,
interfering with bacteria recognition and increasing the production of
IL-12, IL13, IL23 and IFN- pro-inammatory cytokines leading to a
state of chronic inammation [12]. In presence of one NOD2/CARD15
allele mutation, the risk of developing CD increases to 2-4 times, and
even up to 20-40 in the case of a double mutation (heterozygous or
homozygous) [14,15]. e present study conrms that molecular
analysis of NOD2/CARD15 gene could represent an eective
diagnostic tool for the identication of subject genetically predisposed
to CD. In fact, our ndings revealed a signicant association between
the allele T of c.802C>T (p.P268S) SNP and CD. Moreover, our data
show linkage disequilibrium of c.802C>T (p.P268S) with c.1377 C>T
(p.R459R). In addition, we found that the variant 3020insC (p.L1007fs)
is signicantly associated with CD susceptibility. Our results are in
agreement with recent data reporting a genetic association between
allele T of c.802C>T (p.P268S) and CD in Chinese patients [6,10]
In conclusion, our results suggest that molecular analysis of the
NOD2/CARD15 gene could represent an indicative diagnostic tool for
the identication of subject genetically predisposed to CD.
Acknowledgements
Grants from Regione Campania (DGRC 1901/09 and POR, FSE 2007-13,
project CREME) are gratefully acknowledged.
References
1. Fakhoury M, Negrulj R, Mooranian A, Al-Salami H (2014) Inammatory bowel
disease: clinical aspects and treatments. J Inamm Res 7: 113-120.
2. Geremia A, Biancheri P, Allan P, Corazza GR, Di Sabatino A (2014) Innate and
adaptive immunity in inammatory bowel disease. Autoimmun Rev 13: 3-10.
3. Baumgart DC, Sandborn WJ (2012) Crohn’s disease. Lancet 380: 1590-1605.
4. Vavricka SR, Spigaglia SM, Rogler G, Pittet V, Michetti P, et al. (2012)
Systematic evaluation of risk factors for diagnostic delay in inammatory bowel
disease. Inamm Bowel Dis 18: 496-505.
5. Schoepfer AM, Dehlavi MA, Fournier N, Safroneeva E, Straumann A, et al. (2013)
Diagnostic delay in Crohn’s disease is associated with a complicated disease
course and increased operation rate. Am J Gastroenterol 108: 1744-1753.
6. Chua KH, Hilmi I, Ng CC, Eng TL, Palaniappan S, et al. (2009) Identication
of NOD2/CARD15 mutations in Malaysian patients with Crohn’s disease. J Dig
Dis 10: 124-130.
7. Van Limbergen J, Russell RK, Nimmo ER, Satsangi J (2007) The genetics of
inammatory bowel disease. Am J Gastroenterol 102: 2820-2831.
8. Vermeire S, Rutgeerts P (2005) Current status of genetics research in
inammatory bowel disease. Genes Immun 6: 637-645.
9. Ek WE, D’Amato M, Halfvarson J (2014) The history of genetics in inammatory
bowel disease. Ann Gastroenterol 27: 294-303.
10. Long WY, Chen L, Zhang CL, Nong RM, Lin MJ, et al. (2014) Association
between NOD2/CARD15 gene polymorphisms and Crohn’s disease in Chinese
Zhuang patients. World J Gastroenterol 20: 4737-4744.
11. Cavanaugh J (2006) NOD2: ethnic and geographic differences. World J
Gastroenterol 12: 3673-3677.
12. Strober W, Watanabe T (2011) NOD, an intracellular innate immune sensor
involved in host defense and Crohn’s disease. Mucosal Immunol 4: 484-495.
13. Vermeire S, Van Assche G, Rutgeerts P (2008) Should family members of IBD
patients be screened for CARD15/NOD2 mutations? Inamm Bowel Dis 14
Suppl 2: S190-191.
14. Cuthbert AP, Fisher SA, Mirza MM, King K, Hampe J, et al. (2002) The
contribution of NOD2 gene mutations to the risk and site of disease in
inammatory bowel disease. Gastroenterology 122: 867-874.
15. van der Linde K, Boor PP, Houwing-Duistermaat JJ, Crusius BJ, Wilson PJ,
et al. (2007) CARD15 mutations in Dutch familial and sporadic inammatory
bowel disease and an overview of European studies. Eur J Gastroenterol
Hepatol 19: 449-459.
16. Vavassori P, Borgiani P, Biancone L, D’Apice MR, Blanco Gdel V, et al. (2004)
CARD15 mutation analysis in an Italian population: Leu1007fsinsC but neither
Arg702Trp nor Gly908Arg mutations are associated with Crohn’s disease.
Inamm Bowel Dis 10: 116-121.
17. Giachino D, van Duist MM, Regazzoni S, Gregori D, Bardessono M, et al.
(2004) Analysis of the CARD15 variants R702W, G908R and L1007fs in Italian
IBD patients. Eur J Hum Genet 12: 206-212.
18. Scudiero O, Monaco ML, Nigro E, Capasso M, Guida M, et al. (2014) Mannose-
binding lectin genetic analysis: possible protective role of the HYPA haplotype
in the development of recurrent urinary tract infections in men. Int J Infect Dis
19: 100-102.
19. Daniele A, Cammarata R, Pasanisi F, Finelli C, Salvatori G, et al. (2008)
Molecular analysis of the adiponectin gene in severely obese patients from
southern Italy. Ann Nutr Metab 53: 155-161.
20. Bhullar M, Macrae F, Brown G, Smith M, Sharpe K (2014) Prediction of Crohn’s
disease aggression through NOD2/CARD15 gene sequencing in an Australian
cohort. World J Gastroenterol 20: 5008-5016.
This article was originally published in a special issue, Genetic Diseases
handled by Editor(s). Dr. Steven J. Fliesler, Buffalo VA Medical Center, USA;
Dr. Jijing Pang, University of Florida, USA
Citation: Scudiero O, Nigro E, Monaco ML, Polito R, Capasso M, et al. (2015)
C.802C>T NOD2/CARD15 SNP is Associated to Crohn’s Disease in Italian
Patients. Genetics S7: 005. doi:10.4172/2161-1041.S7-005
OMICS International: Publication Benefits & Features
Unique features:
Increased global visibility of articles through worldwide distribution and indexing
Showcasing recent research output in a timely and updated manner
Special issues on the current trends of scientic research
Special features:
700 Open Access Journals
50,000 editorial team
Rapid review process
Quality and quick editorial, review and publication processing
Indexing at PubMed (partial), Scopus, EBSCO, Index Copernicus and Google Scholar etc
Sharing Option: Social Networking Enabled
Authors, Reviewers and Editors rewarded with online Scientic Credits
Better discount for your subsequent articles
Submit your manuscript at: http://www.omicsonline.org/submission/
  • ... In recent years, the incidence of CD, a complex IBD, has been reported to increase rapidly. Scudiero et al. [21] comparatively analyzed, by PCR and direct sequencing, the exons 4, 8 and 11 of NOD2/CARD15 gene in Italian patients with CD (n = 42) and in controls (n = 66). Furthermore, these investigators found that the allele T frequency of c.802C > T (p.P268S) SNP (rs2066842) was significantly higher than that of healthy controls in CD patients (p = 0.018; OR = 2.02) [21]. ...
    ... Scudiero et al. [21] comparatively analyzed, by PCR and direct sequencing, the exons 4, 8 and 11 of NOD2/CARD15 gene in Italian patients with CD (n = 42) and in controls (n = 66). Furthermore, these investigators found that the allele T frequency of c.802C > T (p.P268S) SNP (rs2066842) was significantly higher than that of healthy controls in CD patients (p = 0.018; OR = 2.02) [21]. Our results are similar to the results of these researchers in P268S polymorphism. ...
    Article
    Full-text available
    We aimed to determine P268S and M863V polymorphisms in NOD2/CARD15 genes associated with an increased risk of developing Crohn’s disease (CD) and ulcerative colitis (UC) and to establish correlations between P268S and M863V genotypes in Turkish population. This study included 152 healthy controls and 138 patients (62 CD and 76 UC) with IBD. Our results, the P268S CC genotype was prevalent on patients and controls (45 vs. 66%), followed by genotypes CT (48 vs. 28%) and TT (7 vs. 6%) in CD. The prevalence of genotypes of CC (wild-type), CT (heterozygous mutant) and TT (homozygous mutant) profiles for the P268S polymorphism were 68, 25 and 7% respectively in UC patients, and 66, 28 and 6% respectively in healthy control groups. We were found in wild-type M863V in all subjects and no other mutant band. P268S polymorphism may be associated with CD susceptibility in Turkish population, whereas there is not associated between M863V polymorphisms and patients with IBD in Turkish population.
  • Article
    Full-text available
    The influence of genetics in the etiology of inflammatory bowel disease (IBD) was initially demonstrated by epidemiological data, including differences in prevalence among different ethnic groups, familial aggregation of IBD, concordance in twins, and association with genetic syndromes. These early observations paved the way to molecular genetics in IBD, and culminated in the identification of nucleotide-binding oligomerization domain containing 2 (NOD2) gene as an IBD risk gene in 2001. As in other complex diseases, the advent of Genome Wide Association studies has dramatically improved the resolution of the IBD genome and our understanding of the pathogenesis of IBD. However, the complexity of the genetic puzzle in IBD seems more pronounced today than ever previously. In total, 163 risk genes/loci have been identified, and the corresponding number of possible causal variants is challenging. The great majority of these loci are associated with both Crohn's disease and ulcerative colitis, suggesting that nearly all of the biological mechanisms involved in one disease play some role in the other. Interestingly, a large proportion of the IBD risk loci are also shared with other immune-mediated diseases, primary immunodeficiencies and mycobacterial diseases.
  • Article
    Full-text available
    Inflammatory bowel disease (IBD) is defined as a chronic intestinal inflammation that results from host-microbial interactions in a genetically susceptible individual. IBDs are a group of autoimmune diseases that are characterized by inflammation of both the small and large intestine, in which elements of the digestive system are attacked by the body's own immune system. This inflammatory condition encompasses two major forms, known as Crohn's disease and ulcerative colitis. Patients affected by these diseases experience abdominal symptoms, including diarrhea, abdominal pain, bloody stools, and vomiting. Moreover, defects in intestinal epithelial barrier function have been observed in a number of patients affected by IBD. In this review, we first describe the types and symptoms of IBD and investigate the role that the epithelial barrier plays in the pathophysiology of IBD as well as the major cytokines involved. We then discuss steps used to diagnose this disease and the treatment options available, and finally provide an overview of the recent research that aims to develop new therapies for such chronic disorders.
  • Article
    Full-text available
    To investigate the association between mutations in oligomerisation domain 2/caspase recruitment domains 15 (NOD2/CARD15) and the natural history of Crohn's disease (CD) to identify patients who would benefit from early aggressive medical intervention. We recruited thirty consecutive unrelated CD patients with a history of ileo-caecal or small bowel resection during the period 1980-2000; Fifteen patients of these had post-operative relapse that required further surgery and fifteen did not. Full sequencing of the NOD2/CARD15 gene using dHPLC for exons 3, 5, 7, 10 and 12 and direct sequencing for exons 2, 4, 6, 8, 9 and 11 was conducted. CD patients categorized as carrying variants were anyone with at least 1 variant of the NOD2/CARD15 gene. About 13.3% of the cohort (four patients) carried at least one mutant allele of 3020insC of the NOD2/CARD15 gene. There were 20 males and 10 females with a mean age of 43.3 years (range 25-69 years). The mean follow up was 199.6 mo and a median of 189.5 mo. Sixteen sequence variations within the NOD2/CARD15 gene were identified, with 9 of them occurring with an allele frequency of greater than 10 %. In this study, there was a trend to suggest that patients with the 3020insC mutation have a higher frequency of operations compared to those without the mutation. Patients with the 3020insC mutation had a significantly shorter time between the diagnosis of CD and initial surgery. This study included Australian patients of ethnically heterogenous background unlike previous studies conducted in different countries. These findings suggest that patients carrying NOD2/CARD15 mutations follow a rapid and more aggressive form of Crohn's disease showing a trend for multiple surgical interventions and significantly shorter time to early surgery.
  • Article
    To assess the relationship between the P268S, JW1 and N852S polymorphisms and Crohn's disease (CD) susceptibility in Zhuang patients in Guangxi, China. Intestinal tissues from 102 Zhuang [48 CD and 54 ulcerative colitis (UC)] and 100 Han (50 CD and 50 UC) unrelated patients with inflammatory bowel disease and 72 Zhuang and 78 Han unrelated healthy individuals were collected in the Guangxi Zhuang Autonomous Region from January 2009 to March 2013. Genomic DNA was extracted using the phenol chloroform method. The P268S, JW1 and N852S polymorphisms were amplified using polymerase chain reaction (PCR), detected by restriction fragment length polymorphism (RFLP), and verified by gene sequencing. Heterozygous mutation of P268S in the NOD2/CARD15 gene was detected in 10 CD cases (six Zhuang and four Han), two Han UC cases, and one Zhuang healthy control, and P268S was strongly associated with the Chinese Zhuang and Han CD populations (P = 0.016 and 0.022, respectively). No homozygous mutant P268S was detected in any of the groups. No significant difference was found in P268S genotype and allele frequencies between UC and control groups (P > 0.05). Patients with CD who carried P268S were likely to be ≤ 40 years of age (P = 0.040), but were not significantly different with regard to race, lesion site, complications, and other clinical features (P > 0.05). Neither JW1 nor N852S polymorphisms of the NOD2/CARD15 gene were found in any of the subjects (P > 0.05). P268S polymorphism may be associated with CD susceptibility in the Zhuang population in the Guangxi Zhuang Autonomous Region, China. In contrast, JW1 and N852S polymorphisms may not be related to CD susceptibility in these patients.
  • Article
    Full-text available
    Factors related to bacterial virulence and/or to the host have been implicated in the pathogenesis of recurrent urinary tract infections (rUTI), but in most cases the cause is unknown. Mannose binding lectin (MBL) is an acute phase glycoprotein that exerts immunological functions by binding to the surface of a variety of pathogens. Some human gene variants reduce MBL activity thereby predisposing the host to bacterial and viral infections. The aim of this study was to investigate MBL2 gene variants in relation to rUTI risk. Six MBL gene variants and seven haplotypes were analyzed by PCR and direct sequencing in rUTI patients (n=83) and in healthy subjects from southern Italy (n=642). The frequencies of the L allele (-550) and the HYPA haplotype were higher in controls than in patients stratified according to sex (p<0.05). Our data indicate that the HYPA haplotype in the MBL2 gene could be associated with a minor risk of developing rUTI in males.
  • Article
    Objectives: The impact of diagnostic delay (a period from appearance of first symptoms to diagnosis) on the clinical course of Crohn's disease (CD) is unknown. We examined whether length of diagnostic delay affects disease outcomes. Methods: Data from the Swiss IBD cohort study were analyzed. Patients were recruited from university centers (68%), regional hospitals (14%), and private practices (18%). The frequencies of occurrence of bowel stenoses, internal fistulas, perianal fistulas, and CD-related surgery (intestinal and perianal) were analyzed. Results: A total of 905 CD patients (53.4% female, median age at diagnosis 26 (20-36) years) were stratified into four groups according to the quartiles of diagnostic delay (0-3, 4-9, 10-24, and ≥25 months, respectively). Median diagnostic delay was 9 (3-24) months. The frequency of immunomodulator and/or antitumor necrosis factor drug use did not differ among the four groups. The length of diagnostic delay was positively correlated with the occurrence of bowel stenosis (odds ratio (OR) 1.76, P=0.011 for delay of ≥25 months) and intestinal surgery (OR 1.76, P=0.014 for delay of 10-24 months and OR 2.03, P=0.003 for delay of ≥25 months). Disease duration was positively associated and non-ileal disease location was negatively associated with bowel stenosis (OR 1.07, P<0.001, and OR 0.41, P=0.005, respectively) and intestinal surgery (OR 1.14, P<0.001, and OR 0.23, P<0.001, respectively). Conclusions: The length of diagnostic delay is correlated with an increased risk of bowel stenosis and CD-related intestinal surgery. Efforts should be undertaken to shorten the diagnostic delay.
  • Article
    Inflammatory bowel disease (IBD) includes Crohn's disease (CD) and ulcerative colitis (UC). The exact cause of IBD remains unknown. Available evidence suggests that an abnormal immune response against the microorganisms of the intestinal flora is responsible for the disease in genetically susceptible individuals. The adaptive immune response has classically been considered to play a major role in the pathogenesis of IBD. However, recent advances in immunology and genetics have clarified that the innate immune response is equally as important in inducing gut inflammation in these patients. In particular, an altered epithelial barrier function contributes to intestinal inflammation in patients with UC, while aberrant innate immune responses, such as antimicrobial peptides production, innate microbial sensing and autophagy are particularly associated to CD pathogenesis. On the other hand, besides T helper cell type (Th)1 and Th2 immune responses, other subsets of T cells, namely Th17 and regulatory T (Treg) cells, are likely to play a role in IBD. However, given the complexity and probably the redundancy of pathways leading to IBD lesions, and the fact that Th17 cells may also have protective functions, neutralization of IL-17A failed to induce any improvement in CD. Studying the interactions between various constituents of the innate and adaptive immune systems will certainly open new horizons in the knowledge about the immunologic mechanisms implicated in gut inflammation.
  • Article
    Crohn's disease is a relapsing systemic inflammatory disease, mainly affecting the gastrointestinal tract with extraintestinal manifestations and associated immune disorders. Genome wide association studies identified susceptibility loci that-triggered by environmental factors-result in a disturbed innate (ie, disturbed intestinal barrier, Paneth cell dysfunction, endoplasmic reticulum stress, defective unfolded protein response and autophagy, impaired recognition of microbes by pattern recognition receptors, such as nucleotide binding domain and Toll like receptors on dendritic cells and macrophages) and adaptive (ie, imbalance of effector and regulatory T cells and cytokines, migration and retention of leukocytes) immune response towards a diminished diversity of commensal microbiota. We discuss the epidemiology, immunobiology, amd natural history of Crohn's disease; describe new treatment goals and risk stratification of patients; and provide an evidence based rational approach to diagnosis (ie, work-up algorithm, new imaging methods [ie, enhanced endoscopy, ultrasound, MRI and CT] and biomarkers), management, evolving therapeutic targets (ie, integrins, chemokine receptors, cell-based and stem-cell-based therapies), prevention, and surveillance.
  • Article
    Nucleotide-binding oligomerization domain 2 (NOD2) is an intracellular sensor for small peptides derived from the bacterial cell wall component, peptidoglycan. Recent studies have uncovered unexpected functions of NOD2 in innate immune responses such as induction of type I interferon and facilitation of autophagy; moreover, they have disclosed extensive cross-talk between NOD2 and Toll-like receptors, which has an indispensable role both in host defense against microbial infection and in the development of autoimmunity. Of particular interest, polymorphisms of CARD15 encoding NOD2 are associated with Crohn's disease and other autoimmune states such as graft vs. host disease. In this review, we summarize recent findings regarding normal functions of NOD2 and discuss the mechanisms by which NOD2 polymorphisms associated with Crohn's disease lead to intestinal inflammation.