Content uploaded by Martín Ramírez
Author content
All content in this area was uploaded by Martín Ramírez on Sep 28, 2017
Content may be subject to copyright.
The spider tree of life: phylogeny of Araneae based on target-gene
analyses from an extensive taxon sampling
Ward C. Wheeler
a,
*, Jonathan A. Coddington
b
, Louise M. Crowley
a
, Dimitar Dimitrov
c,d
,
Pablo A. Goloboff
e
, Charles E. Griswold
f
, Gustavo Hormiga
d
, Lorenzo Prendini
a
,
Mart
ın J. Ram
ırez
g
, Petra Sierwald
h
, Lina Almeida-Silva
f,i
, Fernando Alvarez-Padilla
f,d,j
,
Miquel A. Arnedo
k
, Ligia R. Benavides Silva
d
, Suresh P. Benjamin
d,l
, Jason E. Bond
m
,
Cristian J. Grismado
g
, Emile Hasan
d
, Marshal Hedin
n
, Mat
ıas A. Izquierdo
g
,
Facundo M. Labarque
f,g,i
, Joel Ledford
f,o
, Lara Lopardo
d
, Wayne P. Maddison
p
,
Jeremy A. Miller
f,q
, Luis N. Piacentini
g
, Norman I. Platnick
a
, Daniele Polotow
f,i
,
Diana Silva-D
avila
f,r
, Nikolaj Scharff
s
, Tam
as Sz}
uts
f,t
, Darrell Ubick
f
, Cor J. Vink
n,u
,
Hannah M. Wood
f,b
and Junxia Zhang
p
a
Division of Invertebrate Zoology, American Museum of Natural History, Central Park West at 79th St., New York, NY 10024, USA;
b
Smithsonian
Institution, National Museum of Natural History, 10th and Constitution, NW Washington, DC 20560-0105, USA;
c
Natural History Museum,
University of Oslo, Oslo, Norway;
d
Department of Biological Sciences, The George Washington University, 2029 G St., NW Washington, DC
20052, USA;
e
Unidad Ejecutora Lillo, FML—CONICET, Miguel Lillo 251, 4000, SM. de Tucum
an, Argentina;
f
Department of Entomology,
California Academy of Sciences, 55 Music Concourse Drive, Golden State Park, San Francisco, CA 94118, USA;
g
Museo Argentino de Ciencias
Naturales ‘Bernardino Rivadavia’—CONICET, Av. Angel Gallardo 470, C1405DJR, Buenos Aires, Argentina;
h
The Field Museum of Natural
History, 1400 S Lake Shore Drive, Chicago, IL 60605, USA;
i
Laborat
orio Especial de Colec
ß
~
oes Zool
ogicas, Instituto Butantan, Av. Vital Brasil,
1500, 05503-900, S~
ao Paulo, S~
ao Paulo, Brazil;
j
Departamento de Biolog
ıa Comparada, Facultad de Ciencias, Laborat
orio de Acarolog
ıa,
Universidad Nacional Aut
onoma de M
exico, Distrito Federal Del. Coyoac
an, CP 04510, M
exico;
k
Departamento de Biolog
ıa Animal, Facultat de
Biolog
ıa, Institut de Recerca de la Bioversitat, Universitat de Barcelona, Av. Diagonal 643, 08028 Barcelona, Spain;
l
National Institute of
Fundamental Studies, Hantana Road, Kandy 20000, Sri Lanka;
m
Department of Biological Sciences, Auburn University Museum of Natural
History, Auburn University, Rouse Life Sciences Building, Auburn, AL 36849, USA;
n
Department of Biology, San Diego State University, 5500
Campanile Drive, San Diego, CA 92182, USA;
o
Department of Plant Biology, University of California, Davis, CA 95616, USA;
p
Department of
Zoology, University of British Columbia, 6270 University Boulevard, Vancouver, BC V6T 1Z4, Canada;
q
Department of Terrestrial Zoology,
Netherlands Centre for Biodiversity Naturalis, Postbus 9517 2300 RA, Leiden, The Netherlands;
r
Departamento de Entomologı´a, Museo de Historia
Natural, Universidad Nacional Mayor de San Marcos, Av. Arenales 1256, Apartado Postal 140434, Lima 14, Peru;
s
Biodiversity Section, Center for
Macroecology, Evolution and Climate, Natural History Museum of Denmark, University of Copenhagen, Universitetsparken 15, Copenhagen,
Denmark;
t
Department of Zoology, University of West Hungary, H9700, Szombathely, Hungary;
u
Canterbury Museum, Rolleston Avenue,
Christchurch, 8013, New Zealand
Accepted 24 October 2016
Abstract
We present a phylogenetic analysis of spiders using a dataset of 932 spider species, representing 115 families (only the family
Synaphridae is unrepresented), 700 known genera, and additional representatives of 26 unidentified or undescribed genera. Ele-
ven genera of the orders Amblypygi, Palpigradi, Schizomida and Uropygi are included as outgroups. The dataset includes six
markers from the mitochondrial (12S, 16S, COI) and nuclear (histone H3, 18S, 28S) genomes, and was analysed by multiple
methods, including constrained analyses using a highly supported backbone tree from transcriptomic data. We recover most of
the higher-level structure of the spider tree with good support, including Mesothelae, Opisthothelae, Mygalomorphae and Arane-
omorphae. Several of our analyses recover Hypochilidae and Filistatidae as sister groups, as suggested by previous transcrip-
tomic analyses. The Synspermiata are robustly supported, and the families Trogloraptoridae and Caponiidae are found as sister
to the Dysderoidea. Our results support the Lost Tracheae clade, including Pholcidae, Tetrablemmidae, Diguetidae,
Cladistics
Cladistics (2016) 1–43
10.1111/cla.12182
©The Willi Hennig Society 2016
Plectreuridae and the family Pacullidae (restored status) separate from Tetrablemmidae. The Scytodoidea include Ochyrocerati-
dae along with Sicariidae, Scytodidae, Drymusidae and Periegopidae; our results are inconclusive about the separation of these
last two families. We did not recover monophyletic Austrochiloidea and Leptonetidae, but our data suggest that both groups
are more closely related to the Cylindrical Gland Spigot clade rather than to Synspermiata. Palpimanoidea is not recovered by
our analyses, but also not strongly contradicted. We find support for Entelegynae and Oecobioidea (Oecobiidae plus Hersili-
idae), and ambiguous placement of cribellate orb-weavers, compatible with their non-monophyly. Nicodamoidea (Nicodamidae
plus Megadictynidae) and Araneoidea composition and relationships are consistent with recent analyses. We did not obtain reso-
lution for the titanoecoids (Titanoecidae and Phyxelididae), but the Retrolateral Tibial Apophysis clade is well supported. Pen-
estomidae, and probably Homalonychidae, are part of Zodarioidea, although the latter family was set apart by recent
transcriptomic analyses. Our data support a large group that we call the marronoid clade (including the families Amaurobiidae,
Desidae, Dictynidae, Hahniidae, Stiphidiidae, Agelenidae and Toxopidae). The circumscription of most marronoid families is
redefined here. Amaurobiidae include the Amaurobiinae and provisionally Macrobuninae. We transfer Malenellinae (Malenella,
from Anyphaenidae), Chummidae (Chumma)(new syn.) and Tasmarubriinae (Tasmarubrius,Tasmabrochus and Teeatta, from
Amphinectidae) to Macrobuninae. Cybaeidae are redefined to include Calymmaria,Cryphoeca,Ethobuella and Willisius (trans-
ferred from Hahniidae), and Blabomma and Yorima (transferred from Dictynidae). Cycloctenidae are redefined to include Ore-
pukia (transferred from Agelenidae) and Pakeha and Paravoca (transferred from Amaurobiidae). Desidae are redefined to
include five subfamilies: Amphinectinae, with Amphinecta,Mamoea,Maniho,Paramamoea and Rangitata (transferred from
Amphinectidae); Ischaleinae, with Bakala and Manjala (transferred from Amaurobiidae) and Ischalea (transferred from Stiphidi-
idae); Metaltellinae, with Austmusia,Buyina,Calacadia,Cunnawarra,Jalkaraburra,Keera,Magua,Metaltella,Penaoola and Que-
musia; Porteriinae (new rank), with Baiami,Cambridgea,Corasoides and Nanocambridgea (transferred from Stiphidiidae); and
Desinae, with Desis, and provisionally Poaka (transferred from Amaurobiidae) and Barahna (transferred from Stiphidiidae).
Argyroneta is transferred from Cybaeidae to Dictynidae. Cicurina is transferred from Dictynidae to Hahniidae. The genera Neo-
ramia (from Agelenidae) and Aorangia,Marplesia and Neolana (from Amphinectidae) are transferred to Stiphidiidae. The family
Toxopidae (restored status) includes two subfamilies: Myroinae, with Gasparia,Gohia,Hulua,Neomyro,Myro,Ommatauxesis
and Otagoa (transferred from Desidae); and Toxopinae, with Midgee and Jamara, formerly Midgeeinae, new syn. (transferred
from Amaurobiidae) and Hapona,Laestrygones,Lamina,Toxops and Toxopsoides (transferred from Desidae). We obtain a
monophyletic Oval Calamistrum clade and Dionycha; Sparassidae, however, are not dionychans, but probably the sister group
of those two clades. The composition of the Oval Calamistrum clade is confirmed (including Zoropsidae, Udubidae, Ctenidae,
Oxyopidae, Senoculidae, Pisauridae, Trechaleidae, Lycosidae, Psechridae and Thomisidae), affirming previous findings on the
uncertain relationships of the “ctenids” Ancylometes and Cupiennius, although a core group of Ctenidae are well supported. Our
data were ambiguous as to the monophyly of Oxyopidae. In Dionycha, we found a first split of core Prodidomidae, excluding
the Australian Molycriinae, which fall distantly from core prodidomids, among gnaphosoids. The rest of the dionychans form
two main groups, Dionycha part A and part B. The former includes much of the Oblique Median Tapetum clade (Trochanteri-
idae, Gnaphosidae, Gallieniellidae, Phrurolithidae, Trachelidae, Gnaphosidae, Ammoxenidae, Lamponidae and the Molycriinae),
and also Anyphaenidae and Clubionidae. Orthobula is transferred from Phrurolithidae to Trachelidae. Our data did not allow
for complete resolution for the gnaphosoid families. Dionycha part B includes the families Salticidae, Eutichuridae, Miturgidae,
Philodromidae, Viridasiidae, Selenopidae, Corinnidae and Xenoctenidae (new fam., including Xenoctenus,Paravulsor and Odo,
transferred from Miturgidae, as well as Incasoctenus from Ctenidae). We confirm the inclusion of Zora (formerly Zoridae) within
Miturgidae.
©The Willi Hennig Society 2016.
Introduction
Spiders (Araneae) are a distinctive and megadiverse
group of predators, abundant in virtually any terres-
trial ecosystem. With over 46 000 described species in
ca. 4000 genera (World Spider Catalog—WSC, 2016),
all Araneae retain the two synapomorphies of the
order: the spinnerets, appendages at the posterior end
of the body, used to spin silk through minute hair-like
outlets (spigots); and male copulatory organs that have
to be charged with sperm prior to copulation. Spin-
ning organs and genital systems represent two of the
main sources of characters in spider systematics (e.g.
Agnarsson, 2004; Griswold et al., 2005;
Alvarez-
Padilla and Hormiga, 2011; Ram
ırez, 2014; Lopardo
and Hormiga, 2015, among numerous others).
The silk-producing organs are thought to have
played a determinant role in the diversification of spi-
ders, following the diversification of their flying and
crawling insect prey, as well as the evolution and
increasing complexity of terrestrial habitats (Penney
et al., 2003; Dimitrov et al., 2012; Garrison et al.,
2016). The diversity of silk structures made by spiders,
e.g. lined burrows, trapdoors, aerial webs, cocoons,
silken cells and draglines, have an anatomical correlate
in their glands and spigots (up to seven types in a
given species; e.g. Coddington, 1989; Kovoor and
Peters, 1988), combined in a myriad of ways across
spider diversity. The resulting wealth of information
*Corresponding author:
E-mail address: wheeler@amnh.org
2Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
from spinnerets and web-building behaviour has been
at the centre of dispute in spider systematics since the
arrival of quantitative phylogenetic methods, underly-
ing the iconic debate on the monophyly of orb-weavers
(see Coddington, 1986; Dimitrov et al., 2016; and ref-
erences therein). While phenotypic data analyses have
relied on many characters from spigots and web-build-
ing behaviour to obtain orb-weavers as monophyletic
(e.g. Coddington, 1990), molecular analyses have had
difficulties obtaining supported resolution for the deep,
relevant branches of the phylogeny (Blackledge et al.,
2009; Dimitrov et al., 2012). The controversy has only
lurched to resolution recently through the production
of enlarged sequence data sets (Bond et al., 2014;
Fern
andez et al., 2014; Garrison et al., 2016) and
extensive taxon sampling for target genes (Dimitrov
et al., 2016). Both strategies suggest the non-mono-
phyly of orb-weavers, multiple losses of orb-webs and
continuing uncertainty about the placement of impor-
tant clades despite large quantities of data.
Genital characters are used in spider systematics at
every taxonomic level, from species to higher taxa.
Some of the largest clades of spiders have been charac-
terized precisely by these characters: the Haplogynae,
by a simplified male copulatory bulb with fused scle-
rites (Platnick et al., 1991); the Entelegynae, by a more
complex uni-directional flow of sperm in the female
genital system; and within entelegynes, the Retrolateral
Tibial Apophysis (RTA) clade, by a process on the
male palpal tibia (Griswold et al., 2005). While the
more distal groups within these clades are stable across
multiple analyses, the basal splits have seen radical
rearrangement recently. These changes include the
discovery of new taxa and the collection of new data
from previously known species. The discovery of
Trogloraptoridae, a new spider family allied to haplog-
ynes (Griswold et al., 2012), for example, provided
a possible morphological intermediate between
dysderoids and other haplogynes. Additionally, a
re-examination of Archoleptoneta, thought to be a
derived haplogyne, revealed a cribellum, a spinning
organ that was thought to be long lost in the group
(Ledford and Griswold, 2010). Finally, recent analyses
of phylogenomic data have revealed that the most
basal splits of entelegynes and former haplogynes
require profound remodelling (Bond et al., 2014; Gar-
rison et al., 2016; Hormiga et al., 2016). This reconfig-
uration has had significant impact on evolutionary
hypotheses in spiders, such as the origin and transfor-
mations of webs mentioned above, the timing and
mode of diversification (Garrison et al., 2016), and the
paths of simplification of circulatory and respiratory
systems (Huckstorf et al., 2015).
A growing number of multi-family target gene phy-
logenetic analyses are incrementally covering parts of
the spider tree of life. These studies have focused on
Mesothelae (Xu et al., 2015b), Mygalomorphae (Bond
et al., 2012; and references therein), Palpimanoidea
(Wood et al., 2012), many on orb-weavers (Blackledge
et al., 2009; Dimitrov et al., 2016; and references
therein), symphytognathoids (Rix et al., 2008;
Lopardo et al., 2011; Lopardo and Hormiga, 2015),
entelegynes (J. Miller et al., 2010; Spagna et al., 2010),
the Oval Calamistrum (OC) clade (Polotow et al.,
2015), psechrids (Agnarsson et al., 2012; Bayer and
Sch€
onhofer, 2013), eresids (Miller et al., 2012), phol-
cids (Dimitrov et al., 2013) and sparassids (Morad-
mand et al., 2014). These analyses show significant
agreement as well as important contradictions. A sum-
mary analysis compiling sequences from GenBank
(Agnarsson et al., 2013) has shown that new, unex-
pected results emerge when diverse data are combined
with broad taxon sampling. Several of these heretofore
unexpected results have been corroborated by recent
phylogenomic (Bond et al., 2014; Fern
andez et al.,
2014; Garrison et al., 2016) and high taxon sampling,
target gene analyses (Dimitrov et al., 2016).
Spider systematics is advancing along multiple
fronts: technological advances are making possible the
production of unprecedented quantites of sequence
data, repositories of morphology based on digital
images are documenting the anatomy of large groups,
and advances in computational techniques have
allowed the analysis of larger, more complex data sets.
In this study, we aim to establish the higher-level fea-
tures of spider history via unprecedentedly broad sam-
pling of spider diversity for multiple target genes.
Materials and methods
Taxonomic sampling
This dataset represents a nearly comprehensive sam-
pling of the arachnid order Araneae at the family rank.
The dataset comprised 932 spider species, representing
115 families (only the family Synaphridae is unrepre-
sented), 700 known genera and additional representa-
tives of 26 unidentified or undescribed genera. Eleven
outgroup genera of the orders Amblypygi, Palpigradi,
Schizomida and Uropygi were included, thus sampling
the three orders of the clade Pedipalpi, which is the well-
accepted sister group of spiders (Shultz, 1990, 2007;
Regier et al., 2010; Sharma et al., 2015). All trees were
rooted on the more distantly related order Palpigradi.
Several of the sequences generated for this study have
already been incorporated into published works on
more restricted taxonomic groups, including zodarioids
and other entelegynes (J. Miller et al., 2010), araneoids
(Lopardo et al., 2011; Lopardo and Hormiga, 2015),
palpimanoids (Wood et al., 2012) and Anyphaenidae
(Labarque et al., 2015). We also augmented our taxon
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 3
sampling by the incorporation of important representa-
tives from other studies prior to 2014 (Supporting Infor-
mation, Table S1).
Character sampling
Molecular data. Genes with differing degrees of
variability were chosen, and included both
mitochondrial and nuclear markers. DNA sequence
data from the mitochondrial genome were generated
from three regions and included 12S ribosomal RNA
(12S), 16S ribosomal RNA (16S) and cytochrome
coxidase subunit 1 (COI) genes. Three nuclear genes
were targeted for phylogenetic reconstruction and
included the protein-coding histone H3 (H3), as well
as the small and large subunits of ribosomal RNA
genes (18S and 28S, respectively).
The number of sequence data per terminal varied
from 752 bp (Calamoneta sp. MR661) to 6210 bp
(Antrodiaetus unicolor), with an average of 4186 bp per
taxon (Table S1). The newly generated sequences were
deposited in GenBank under accession numbers
KY015264–KY018569 (Table S1).
Laboratory protocols
DNA extraction and PCR amplification. Total
genomic DNA was extracted from leg tissue. In cases
where the specimen was small, the whole specimen was
used for DNA extraction. Sources for tissue samples
and locality information are provided in Table S1.
DNA extraction was achieved with a DNeasy animal
tissue extraction kit (Qiagen). DNA amplification was
carried out in a 25-lL volume reaction, using Illustra
PuReTaq Ready-To-Go PCR beads (GE Healthcare).
As a rule, 2 lL of genomic DNA, along with 1 lLof
both 10 lMforward and reverse primers were included
in each reaction. The primers (and their sources) used
in the amplification and sequencing of gene regions in
this study are given in Table 1. Molecular-grade
distilled water made up the remaining volume. PCRs
were executed on an Eppendorf Mastercycler ep
gradient thermocycler and subsequently visualized with
1.5% agarose gel electrophoresis.
The amplification profile and annealing temperatures
varied for the individual genes and across taxa for the
same gene. A number of different PCR profiles were
used in this study; initially, all amplifications pro-
ceeded with a standard protocol. This PCR profile
consisted of an initial denaturing step at 94 °C for
2 min, 30 amplification cycles [94 °C for 30 s, 50 °C
or optimal annealing temperature (T
m
°C) for 45 s,
72 °C for 45 s], followed by a final extension step at
72 °C for 5 min. The PCR profiles were adjusted for
the different primer pair and taxon combinations, until
such time that amplification and subsequent sequenc-
ing were successful. The annealing temperatures were
increased or decreased by 1–2°C to maximize
Table 1
Primers used for the amplification and sequencing of DNA in this study.
Gene Primer Primer sequence (50to 30) Source
12S 12S-ai AAACTAGGATTAGATACCCTATTAT K€
ocher et al. (1989)
12S-bi AAGAGCGACGGGCGATGTGT K€
ocher et al. (1989)
16S 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. (1991)
16S-B CTCCGGTTTGAACTCAGATCA Palumbi et al. (1991)
COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCOoutout GTAAATATATGRTGDGCTC Wheeler laboratory fide Schulmeister et al. (2002)
ExtA GAAGTTTATATTTTAATTTTACCTGG Wheeler laboratory fide Schulmeister et al. (2002)
ExtB CCTATTGAWARAACATARTGAAAATG Wheeler laboratory fide Schulmeister et al. (2002)
H3 aF ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998)
aR ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998)
18S 18S-1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. (1996)
18S-5R CTTGGCAAATGCTTTCGC Giribet et al. (1996)
18S-3F GTTCGATTCCGGAGAGGGA Giribet et al. (1996)
18S-bi GAGTCTCGTTCGTTATCGGA Whiting et al. (1997)
18S-a2.0 ATGGTTGCAAAGCTGAAA Whiting et al. (1997)
18S-9R GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996)
28S 28S-Rd1a CCCSCGTAAYTTAGGCATAT Crandall et al. (2000), modification of Van der Auwera et al. (1994):
primer 4
28S-Rd4b CCTTGGTCCGTGTTTCAAGAC Crandall et al. (2000), modification of Van der Auwera et al. (1994):
primer 10
28S-Rd3.2a AGTACGTGAAACCGTTCASGGGT Wheeler laboratory fide Whiting (2002)
28S-B TCGGAAGGAACCAGCTACTA Whiting et al. (1997)
28S-A GACCCGTCTTGAAGCACG Whiting et al. (1997), modification of Nunn et al. (1996)
28S-Bout CCCACAGCGCCAGTTCTGCTTACC Wheeler laboratory fide Hovm€
oller et al. (2002)
28S-Rd4.8a ACCTATTCTCAAACTTTAAATGG Wheeler laboratory fide Whiting (2002)
28S-Rd7b1 GACTTCCCTTACCTACAT Wheeler laboratory fide Whiting (2002)
4Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
specificity. For primer pairs that amplified longer frag-
ments, increasing the denaturation and extension time
by 30–60 s often yielded better results. Moreover,
increasing the number of amplification cycles to 35–40
often helped achieve the necessary results.
Sequences of 12S, ranging in length from 287 to
356 bp, were successfully obtained using the standard
primer combination, 12S-ai and 12S-bi. This region,
located in the 30end of the gene, corresponds to
approximately half of the entire 12S rRNA gene found
in this group. Primers developed by Palumbi et al.
(1991) were used to amplify approximately half of the
complete 16S rRNA gene. This fragment, ranging
from 421 to 552 bp, is located in the 30region of the
gene. Sequences for a large fragment of COI were
determined using the primers pairs LCO1490 and
HCOoutout, and ExtA and ExtB. These overlapping
primers amplified a region approximately 1100 bp in
size (the complete gene being ~1500 bp in length).
In addition to these mitochondrial genes, a single
nuclear protein-coding gene (H3) was also targeted. The
standard primer combination of Colgan et al. (1998)
successfully amplified a 328-bp fragment of this gene.
The complete 18S (approximately 1.7 kb) was amplified
in three overlapping fragments, using the primer pairs
18S-1F and 18S-5R, 18S-3F and 18S-bi, and 18S-a2.0
and 18S-9R. Multiple primers were employed in the
amplification of a large region of 28S (approximately
2.2 kb). These overlapping primers include the pairs
28S-Rd1a and 28S-Rd4b, 28S-Rd3.2A and 28S-B, 28S-
A and 28S-Bout, and 28S-4.8A and 28S-Rd7b1.
PCR clean up and sequencing. PCR products were
cleaned by use of a Beckman Coulter Laboratory
Automation Workstation using Agencourt magnetic
bead technology (AMPure). Double-stranded cycle-
sequencing of purified products was achieved using dye-
labelled terminators (BigDye Terminator v.3.1 Cycle
Sequencing Reaction Kit, Applied Biosystems) in a
thermocycler. The cycle-sequencing reactions consisted
of 0.5 lL BigDye, 2.0 lL BigDye Extender Buffer,
2.0 lL 3.2 lMprimer and 3.5 lL purified PCR product
(for a total of 8 lL). In all cases, the same primer used
in the amplification process was used for sequencing.
The cycle-sequencing programme consisted of 25
amplification cycles (96 °C for 15 s, 50 °C for 15 s and
60 °C for 4 min). Tagged products were subsequently
cleaned on the workstation using CleanSEQ
(Agencourt). Sequencing of the purified PCR products
was conducted by the dideoxy termination method
(Sanger et al., 1977) using an automated ABI Prism
3730xl DNA sequencer (Applied Biosystems).
Sequence editing and error checking. Sequence
chromatograms were assembled, visualized and edited
using Sequencher 4.1 (Gene Codes Corp.). Once
assembled, contigs were then queried against the online
NCBI BLAST database. The resulting BLAST hits were
checked to highlight possible contaminants (from
external sources). The sequences were subsequently
aligned using the CLUSTALW (Thompson et al., 1994)
package (under the default settings), as spawned
through BioEdit (Hall, 2007). The alignment was also
visualized in BioEdit. While a multiple sequence
alignment (MSA) is not necessary for the analysis of
sequences with dynamic homology, it is desirable for
two reasons. The first relates to quality control—an
MSA can highlight problems within a sequence (e.g.
extraneous nucleotides disrupting the reading frame in
protein coding sequences), as well as highlight aberrant
sequences (e.g. sequences that may have been
inadvertently reverse complemented during contig
assembly are clearly evident in an MSA). The second
concerns the partitioning of the sequence data into
smaller fragments for analysis under direct optimization
and is discussed below.
Phylogenetic analyses
Datasets and analyses. A number of analytical
methods of phylogenetic inference were explored in
this study and are discussed in turn below. These
methods were conducted using the dynamic homology
approach (POY analyses) or with the use of static
alignments (all other analyses).
Direct optimization (DO). The MSAs generated by
CLUSTALW were used to partition the data. The
procedure for partitioning the MSA is explained in
detail elsewhere (see Wheeler et al., 2014; : chapter 4).
The partitioning of sequences of unequal length (due
to incomplete sequencing) reduces the amount of
ambiguity (IUPAC X or N coding) in these regions.
Hence, these regions of the MSA are subsequently
treated as missing data in the analysis, and therefore
do not influence subsequent phylogenetic analysis.
Furthermore, partitioning allows more rapid and
efficient optimization of the sequences (see Giribet,
2002). These MSAs in no way constrained the
subsequent analysis of the data under DO, given that
gaps in the MSA are removed prior to analysis with
DO. This procedure is commonly used in the analysis
of molecular data under dynamic homology (e.g.
Arango and Wheeler, 2007; Lindgren and Daly, 2007;
Liu et al., 2009; Padial et al., 2014).
Analysis of these datasets was conducted on two
1024-GB RAM, AMD Opteron 6380 Series 2.5-GHz,
parallel 64-core computers at the AMNH using
dynamic homology (Wheeler, 2001), with the DO
method (Wheeler, 1996), as implemented in a parallel
version of POY 5 (Wheeler et al., 2015) version 5.1.1
(source code Wheeler et al., 2014).
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 5
Multiple datasets were analysed in this study—each
molecular partition, as well as a combined analysis of
all the molecular data. The separate analysis of these
data partitions facilitated the assessment of the pattern
of relationships from each. An exploration of different
parameter costs [gap opening, insertion/deletion (indel)
and transversion/transition (tv/ts)] was undertaken as
a sensitivity analysis (Wheeler, 1995). Three indel cost
ratios (1, 2, 4) and three tv/ts cost ratios (1, 2, 4) were
employed. Character congruence was measured using
the incongruence length difference index (ILD) (Farris,
1973). The parameter set that minimized the incongru-
ence among the partitions was considered optimal.
The analyses were performed in two stages. The initial
analyses consisted of random addition sequence Wagner
builds, followed by TBR branch swapping. Tree fusing
(Goloboff, 1999) followed. Each run held a maximum of
eight trees per replicate. A final round of TBR branch
swapping was performed, prior to reporting the resulting
trees [command line: build(8) swap() fuse(iterations:240)
select(best:8) swap() select()]. The first round of analyses
was performed for each of the nine parameter combina-
tions under investigation. All subsequent analyses
involved combining the trees from the previous analyses
and using them as input trees in the next round. The pro-
cess was repeated until such time that the results of all
the parameter combinations were stable (27 rounds). This
strategy (Simulated Annealing Tree Fusing, SATF) has
proven to be quite effective in identifying stable and
heuristically optimal results (D’Haese, 2003; Wheeler
et al., 2004; Boyer et al., 2005; Sørensen et al., 2006;
Giribet, 2007; Schuh et al., 2009) in other analyses.
Parsimony analysis ‘static’ (EW, IW). MSAs were
carried out with MUSCLE (Edgar, 2004) under default
options, and analysed with the parallel version of TNT
(Goloboff et al., 2008) running on 32 processors in the
cluster of the Fundaci
on Miguel Lillo—CONICET. For
the equal weights analysis (EW) each processor produced
ten replicates of RAS +TBR, followed by sectorial
searches and tree-drifting, and the trees from all
processors were combined by tree-fusing. The extended
implied weighting analysis (IW; Goloboff, 2014) used the
same search, computing average weighting against
homoplasy in blocks of 50 sites for the ribosomal
markers, and the average of 1st, 2nd and 3rd positions
for protein coding genes; in both cases the reference
constant of concavity for the weighting function was set
to 500. For each group of characters, this reference
concavity was decreased based on the proportion of
missing entries, so that the weight for the block decreases
more rapidly with homoplasy as there are more missing
entries, assuming missing entries have 0.75 of the
homoplasy in observed entries, and using a concavity
ratio within 5 [command line: xpiwe (*0.75 <5] (see
Goloboff, 2014: 264). Bootstrap proportions were
calculated with 100 pseudoreplicates, each of five
replicates of RAS +TBR, followed by sectorial searches
and tree drifting. The resulting trees from the five
replicates were subsequently subjected to tree-fusing.
Maximum-likelihood (ML). MSAs were carried out
with MAFFT v7.243 (Katoh and Standley, 2013).
Alignments of the protein-coding H3 and COI genes
were trivial due to the lack of gaps and were produced
using the L-INS-i method [command line: mafft—
thread 3—threadit 0—reorder—maxiterate 1000—
retree 1—localpair]. Due to the highly variable nature of
ribosomal genes, the E-INS-i method, which
incorporates affine gap costs, was used to generate
alignments of 12S, 16S, 28S and 18S [commands line:
mafft—thread 3—threadit 0—reorder—maxiterate 1000
—retree 1—genafpair]. A concatenated dataset of these
alignments was generated. An additional dataset was
constructed where ambiguously aligned regions in the
ribosomal genes were excluded. To detect and exclude
ambiguously aligned regions, alignments of the
ribosomal genes were processed with the program
trimAl v1.3 (Capella-Guti
errez et al., 2009) using the
heuristic automated1 method, except for the
hypervariable region of 28S. This region of 28S was
processed using the gappyout method, as the automated1
failed to provide a plausible solution (i.e. 99% of the
characters were removed).
ML analyses of the concatenated dataset were con-
ducted with the program RAxML (Stamatakis, 2014)
on the Abel Cluster at the University of Oslo or using
the CIPRES Science Gateway (M. Miller et al., 2010).
The concatenated gene matrix was partitioned by gene.
Bootstrap and optimal trees were computed in the
same run using the—fa option using 1000 bootstrap-
ping replicates. The GTRCAT model was used for the
fast bootstrap replicates and GTRGAMMA for opti-
mal topology searches. The raxmlHPC-HYBRID bina-
ries were employed and the job was run using 12 mpi
processors, each with four threads [command line:
raxmlHPC-HYBRID -T 4 -n result -s infile.txt -q
part.txt -p 12345 -x 12345 -N 1000 -c 25 -f a -m
GTRCAT -o Palpigradi sp. JA-2011].
The recent phylogenomic study of Garrison et al.
(2016) was used to construct a backbone constraint
tree for additional rounds of RAxML analyses. This
study, which included 50 spider families, and involved
extensive molecular sampling (3398 gene regions and
696 652 amino acid sites), was based on transcriptomic
data. Therein, many of the relationships in the result-
ing trees were well supported, albeit for a restricted
sample of families. The topology of the preferred tree
of Garrison et al. (2016) was modified, such that ter-
minals not included in our study were pruned from the
tree and nodes for the terminals that were not highly
supported (e.g. with bootstrap supports below 100)
6Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
were collapsed. The positions of all the remaining taxa
not included in this constrained topology were unre-
stricted as to placement. Constrained RAxML analy-
ses were run as described above with the addition of
the—gflag. In all cases, the bootstrap proportions
were calculated with 1000 pseudoreplicates of the rapid
bootstrap analysis.
Bayesian inference (BI). Bayesian analyses were
carried out in ExaBayes 1.4.1 (Aberer et al., 2014) using
the same dataset that was subjected to RAxML
analyses. All ExaBayes analyses were run using the Abel
cluster at the University of Oslo. Because the current
version of ExaBayes does not allow the use of
topological constraints, only unconstrained analyses,
using the same partitioning scheme and model settings
as in the RAxML analyses, were run. Two independent
analyses, each with four independent chains and using
Metropolis-Coupling (numCoupledChains was set to 2)
to speed up convergence, were run. Each run was
started using a parsimony starting tree. All model
parameters were unlinked among partitions except for
branch length. Results were checked for convergence
and effective sampling sizes of all parameters using the
tools distributed with the ExaBayes package. Support
values are expressed as posterior probabilities.
Taxonomic congruence and selection of working
tree. Results from the different phylogenetic analyses
are summarized in the form of a preferred working tree
(Figs 1–8). Selection of this tree, among all the trees
produced by the different optimality criteria, was
achieved by computing the correspondence of each
candidate tree with previously and herein established
families and infraorders of spiders (taxonomic
congruence). The tree with the greatest correspondence
with previous taxonomic hypotheses was reasoned to be
conservative by definition, and probably more robust, by
having a better fit to previous knowledge and
independent data, including morphology. We also
calculated how many of the groups most stable to all
optimality criteria were recovered by each individual
criterion. Furthermore, the quantity of shared groups
with the transcriptomic study of Garrison et al. (2016)
was also measured (transcriptomic congruence). For this
comparison, only those groups with high support values
and consistency across the different analyses (Garrison
et al., 2016: fig. 2; see next paragraph for groups and
mapping of terminals) were considered. The
correspondence with taxonomy was checked using the
[command line: taxonomy] command of TNT (Goloboff
and Catalano, 2012) and by custom scripts written in
TNT macro language. Congruence between the
taxonomic and skeleton transcriptomic trees was assessed
by the number of shared groups in a strict consensus, as
well as by a symmetric topological similarity coefficient
[command line: symcoeff]. To control for possible biases
in the taxonomic congruence measures, the taxonomic
congruence was calculated twice, for the families as here
relimited, or excluding the relimited families (conservative
taxonomic tree). Graphics of trees were obtained with
FigTree v. 1.4.2 (Rambaut, 2014), TNT and POY.
Constrained analyses using a highly supported backbone
tree from transcriptomic (TR) data. Results from the
Garrison et al. (2016) analysis of transcriptomic data
were used as a skeleton tree to produce additional,
constrained tree searches. Fifty-eight of the 74 terminals
of this phylogenomic study were mapped to our
representative taxa (Table S2). Of these mapped
individuals, 25 were the same species (thus mapping was
unproblematic), 28 were congeneric terminals and the
remaining five mapped individuals were representatives
of the same subfamily or family (three and two,
respectively). The latter five were added to recover the
monophyly of additional, important groups. This
strategy is justified on the basis that highly supported
groups (bootstrap 1) and groups that were robust to all
types of analyses in the transcriptomic analysis were
likely to remain well supported upon the addition of our
six target genes. Having removed all unmatched
terminals from the TR tree, nodes that were unstable
across analyses or with bootstrap values <1 were
collapsed. The resulting tree (Fig. S1) was then used as
a skeleton to constrain the analysis, only affecting the
58 mapped terminals; all the remaining terminals in our
dataset were left unconstrained, free to connect
anywhere as dictated by our data. To assess whether the
six molecular markers included in this study might
overturn the highly supported groups of the
transcriptomic dataset, an analysis of the smaller
dataset of Bond et al. (2014), consisting of 110 808
characters and 43 terminals, combined with our
sequence data, was performed. This dataset was too
large for full analysis (not shown; 122 001 characters by
1005 terminals, 89% missing entries), but, as expected,
superficial parsimony searches of this dataset did not
challenge the monophyly of any of the groups that were
highly supported in the original transcriptomic analysis.
Results
Phylogenetic analyses
The primary phylogenetic analyses of the concate-
nated markers are presented as Figs S6–S10. The sen-
sitivity analysis for the DO analysis (Table S3) found
minimum character incongruence at an indel cost ratio
of 1 and tv/ts cost ratio of 2, and thus we used that
tree for subsequent congruence comparisons with other
methods.
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 7
Congruence with taxonomy (TX) and transcriptomic
tree (TR)
A taxonomic classification of our spider terminals is
presented in Fig. S2. This reference tree (TX) contains
105 multi-sampled families (103 of spiders, two of out-
groups), and four higher groups (the order Araneae,
the suborder Opisthothelae, and the infraorders Myga-
lomorphae and Araneomorphae). This taxonomy is
based on the current classification of the WSC (2016),
with additional taxonomic changes as introduced by
Dimitrov et al. (2016) and herein (see Taxonomy sec-
tion below). A second calculation was made with the
groups that are not relimited, or whose rank is not
Uloboridae
Phyxelididae
Austrochilidae (part): Austrochilinae
Leptonetidae (part): Archoleptoneta
Mecysmaucheniidae
Liphistiidae
Sparassidae
Gradungulidae
Filistatidae
Titanoecidae
Zodarioidea: Homalonychidae
Deinopidae
Eresidae
0.3
Dionycha
Nicodamoidea
Stenochilidae + Archaeidae
Leptonetidae (part): Leptoneta infuscata
Araneoidea
Uropygi
Oecobioidea
Oval Calamistrum clade
Scytodoidea
Atypoidea
Zodarioidea: Zodariidae + Penestomidae
Austrochilidae (part): Hickmania troglodytes
Hypochilidae
Palpigradi
Dysderoidea + Trogloraptoridae + Caponiidae
Schizomida
Amblypygi
marronoid clade
Palpimanidae + Huttoniidae
Leptonetidae (part): Neoleptoneta + Calileptoneta
Lost Tracheae clade
Avicularioidea
RTA clade
Synspermiata
Mygalomorphae
Araneomorphae
Palpimanoidea
Pedipalpi
Araneae
Bootstrap
95–100%
75–94%
orp a
Otiothops birabeni
(Palpimanoidea, Palpimanidae)
Calathotarsus simoni
(Mygalomorphae, Migidae)
Periegops suteri
(Synspermiata, Periegopidae)
Agalenocosa pirity
(Oval Calamistrum clade, Lycosidae)
Entelegynae
Fig. 1. Summary phylogenetic tree from concatenated analysis of six markers obtained under maximum likelihood, constrained by highly
supported groups from transcriptomic analysis, four unstable terminals pruned (C-ML-P analysis).
8Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
changed here (see Table S4). This conservative refer-
ence tree (TX-C) has only 84 spider families (Fig. S3,
Table S4), and produced the same result as the full
taxonomic reference, but with slightly more marked
differences. This is expected, because the taxonomic
changes introduced here are robust to analytical strate-
gies. In the unconstrained analyses, the ML tree
(Fig. S6) recovered the most taxonomic groups (74%),
followed by BI (68%; Fig. S7), DO (60%; Fig. S8),
IW (52%; Fig. S10) and EW (50%; Fig. S9) (Table 2).
The second reference is the transcriptomic tree from
Garrison et al. (2016); after pruning taxa that did not
map to our terminals and collapsing groups not highly
supported (bootstrap below 100%, or variable across
analytical regimes), this tree has 45 groups (Fig. S1).
Of these, 36 of the 45 groups are recovered by the BI
tree, 34 by the ML and IW trees, 33 by the DO tree,
and 31 by the EW tree. A topological measure (a sym-
metric distortion coefficient modified after Farris,
1973; implemented in TNT, Goloboff et al., 2008) pro-
duced the same preferences for the BI and ML trees
when compared with the reference trees. The majority
rule consensus tree of the five optimality criteria (EW,
IW, DO, BI, ML) has 728 groups shared by at least
three criteria, and hence more stable (Fig. S12). We
calculated how many of those stable groups were
recovered by each criterion: ML and BI recovered the
most (90.2 and 89.8%, respectively), followed by IW,
DO and EW (85.6, 85.4 and 83.1%, respectively)
(Table 2). The ML criterion was subsequently used for
the constrained analysis; the BI criterion also per-
formed well in our taxonomic tests, but the current
version of ExaBayes does not allow constrained tree
searches.
Constrained analysis
The constrained ML tree (C-ML; Fig. S4), obtained
after constraining the backbone topology from the
transcriptomic analysis, is topologically very similar to
the unconstrained ML analysis, sharing 84% of the
recovered groups (788 out of 941 groups; see Table 2).
Support values are also similar, with slightly lower
overall group support (average bootstrap 0.71 in ML
vs. 0.69 in C-ML). It shows, however, a few important
differences in the resolution of some higher-level
0.3
Nemesiidae sp. South Africa MY546
Pseudotheraphosa apophysis
Calisoga longitarsis
Anidiops manstridgei
Acanthoscurria suina
Nemesiidae sp. South Africa MY551
Agastoschizomus lucifer
Paraembolides cannoni
Bymainiella terraereginae
Misgolas hubbardi
Neoapachella rothi
Antrodiaetus gertschi
Eukoenenia tetraplumata
Sphodros atlanticus
Eucteniza relata
Antrodiaetus unicolor
Draculoides julianneae
Harpactirella sp. LP293
Liphistius bicoloripes
Aphonopelma vorhiesi
Antrodiaetus riversi
Ixamatus sp. MY2102
Atypus affinis
Segregara abrahami
cf. Entychides sp. Mexico MY3548
Poecilomigas abrahami
Homogona pulleinei
Aliatypus isolatus
Heptathela kimurai
Cyclocosmia truncata
Migas variapalpus
Stenochrus sbordonii
Cethegus fugax
Conothele sp. MY2070
Microstigmatidae: Microstigmata longipes
Eucteniza cabowabo
Typopeltis crucifer
Entychides arizonicus
Mediothele cf. australis
Liphistius erawan
Palpigradi sp. JA-2011
Chenistonia tepperi
Atypus snetsingeri
Promyrmekiaphila clathrata
Harpactira sp. LP292
Poecilotheria metallica
Aptostichus atomarius
Ummidia sp. MY2042
Cataxia bolganupensis
Stanwellia hoggi
Ozicrypta sp. MY839
Aname sp. MY2121
Cyrtaucheniidae: Fufius atramentarius
Hebestatis theveneti
Ryuthela nishihirai
Moggridgea crudeni
Etienneus africanus
Myrmekiaphila fluviatilis
Australothele jamiesoni
Augacephalus junodi
Ancylotrypa sp. MY502
Phrynus longipes
Synothele arrakis
Bertmainius monachus
Paratropis sp. JB13
Mecicobothriidae: Hexura picea
Harpactirella sp. LP197
Migas sp. CG229
Scotinoecus cinereopilosus
Stenoterommata palmar
Mastigoproctus giganteus
Liphistius cf. murphyorum
Migas sp. CG247
Homostola pardalina
Hadronyche sp. MY2075
Allothele australis
Stasimopus mandelai
Atrax robustus
Missulena sp. MY2086
Cyclocosmia loricata
Bothriocyrtum californicum
Acanthogonatus campanae
Kiama lachrymoides
Ancylotrypa sp. MY500
Ummidia sp. MY2313
Damon diadema
Actinopus sp. MY2873
Apomastus kristenae
Heteromigas terraereginae
Charinus neocaledonicus
42
100
100
11
100 98
70
86
56
67
15
32
100
100
100
93
100
91
87
100
58
3
41
100
28
2
100
99
25
100
95
100
100
29
51
100
93
51
100
98
38
32
100
83
100
31
100
17
83
100
72
100
100
99
3
100
96
32
91
100
100
90
100
44
99
11
100
100
95
96
98
88
100
9
100
100
100
78
98
100
99
3
80
11
18
99
67
23
100
Idiopidae
Ctenizidae Part A
Migidae
(Hexathelidae, part) Actinopodidae +
Nemesiidae +
Theraphosidae
Barychelidae
Cyrtaucheniidae
Euctenizidae
Ctenizidae Part B
core Hexathelidae
Antrodiaetidae +
Atypidae
Liphistiidae
Uropygi
Schizomida
Amblypygi
Palpigradi
(Dipluridae)
Pedipalpi
Araneomorphae
Mygalomorphae
Araneae
Opisthothelae
Paratropididae
Mesothelae
Atypoidea
Avicularioidea
Tetrapulmonata
Mesothelae, Liphisthiidae
Aliatypus sp. (Mygalomorphae, Antrodiaetidae)
liat pus sp. M alomorphae, Antrodiaetidae
Cyclocosmia sp. (Mygalomorphae, Ctenizidae)
Fig. 2. Outgroups, Liphistiomorphae and Mygalomorphae. C-ML-P tree with bootstrap values on groups. Symbols +and denote groups that
are non-monophyletic by the addition or subtraction of few groups, respectively. Paraphyletic groups are in parentheses.
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 9
0.3
Colopea sp. NP6
Ariadna insidiatrix
Sarascelis cf. chaperi
Ischnothyreus sp. MR692
Sicarius hahni
Oonops procerus
Caponia sp. SP31
Archoleptoneta sp. JL-2011
Zaitunia beshkentica
Mecysmauchenius osorno
Opopaea sp. MR688
Segestrioides tofo
Scytodes thoracica
Pholcus kakum
Plectreurys deserta
Dysderocrates egregius
Calileptoneta helferi
Pholcidae sp. Dominican Republic GH2
Hygrocrates lycaoniae
cf. Psiloderces sp. Myanmar MA186
Indicoblemma monticola
Palpimanus sp. HMW-2012
Kibramoa madrona
Tetrablemma thamin
Pikelinia tambilloi
Neoleptoneta rainesi
Colopea sp. CG54
Huttonia sp. CG166
Ochyrocera sp. SP50
Zearchaea sp. HMW-2012
Perania nasuta
Harpactea hombergi
cf. Mallecolobus sp. Chile MA188
Pritha nana
Nyikoa limbe
cf. Lamania sp. Johor MR357
Sicarius sp. NP11
Kukulcania hibernalis
Huttonia sp. HMW-2012
Drymusa serrana
Harpactocrates globifer
Triaeris sp. MA176
Antilloides haitises
Dysdera crocata
Macrogradungula moonya
Austrochilus sp. SP9
Gradungula sorenseni
Ochyrocera sp. MA184
Diguetia catamarquensis
Filistata insidiatrix
Afrilobus sp. MA128
Orchestina sp. MA172
Austrarchaea sp. CG263
Pehrforsskalia conopyga
Periegops suteri
Carapoia genitalis
Afrarchaea godfreyi
Eriauchenius workmani
Loxosceles sp. SP30
Pholcus atrigularis
Modisimus sp. MA196
Leptopholcus gracilis
Chilarchaea quellon
Ariadna boesenbergi
Austrochilus franckei
Pholcus phalangioides
Scytodes sp. MR422
Eriauchenius sp. CG264
Holissus unciger
Scytodes globula
Archoleptoneta schusteri
Tasmanoonops sp. MR690
Palpimanus sp. SP25
Scytodes sp. SP46
Loxosceles spiniceps
Metagonia furcata
Segestria sp. LBB-2011
Austrarchaea nodosa
Dysdera erythrina
Lamania sp. MR45
Pholcophora americana
Palpimanus transvaalicus
Paculla sp. MR356
Smeringopus pallidus
Stenoops sp. MA177
Hypochilus pococki
Osornolobus sp. SP8
Mesabolivar sp. DNA100446398
Afrarchaea sp. HMW-2012
Misionella mendensis
Caponia sp. MA141
Tarlina woodwardi
Mesarchaea bellavista
Trogloraptor sp. CASENT
Otiothops birabeni
Drymusa sp. CG313
Loxosceles rufescens
Palpimanus gibbulus
Aotearoa magna
Hickmania troglodytes
Stedocys pagodas
Ibotyporanga naideae
Leptoneta infuscata
Ikuma sp. 11 06
Micropholcus fauroti
Prithinae sp. Costa Rica MR11
Mecysmauchenius segmentatus
Subantarctia sp. MA1
Scelidocteus sp. MR487
Notiothops sp. MR246
Cryptoparachtes sp. LBB-2011
Holocnemus pluchei
Trogloraptor marchingtoni
Nops sp. MR489
Orchestina sp. SP91
Diguetia canities
Thaida peculiaris
Artema atlanta
Archoleptoneta sp. MA9-CG323
Periegops keani
Orsolobidae sp. Western Australia GH56
Crossopriza lyoni
Rhode scutiventris
Nops sp. NP12
Austrochilus forsteri
Parachtes vernae
Psilochorus itaguyrussu
Drymusa rengan
Colopea cf. virgata
Shearella browni
Pholcus opilionoides
Loxosceles deserta
Quamtana sp. DNA100446427
Plectreurys tristis
Sicarius rupestris
Dasumia taeniifera
Diguetia mojavea
Orsolobus montt
Opopaea sp. MA140
Nita elsaff
Gradungula sp. CG185
Segestria senoculata
Scaphiella sp. MA179
49
100
97
61
98
100
100
100
71
35
100
57
100
100
100
98
98
53
66
100
77
98
21
94
100
99
58
100
99
98
98
92
38
39
100
62
20
40
57
84
11
73
98
48
100
67
39
60
55
84
95
97 98
98
34
100
60
60
70
100
88
99
24
100
100
99
73
100
29
75
65
79
35
99
100
100
99
83
85
74
31
100
100
52
18
16
24
42
79
96
98
100
45
100
93
81
100
100
100
35
100
64
99
69
85
73
94
41
100
48
74
74
99
98
93
99
52
30
100
71
10
99
96
99
99 76
62
70
99
12
96
95
82
92
96
100
100
76
100
58
100
36
91
Entelegynae
Filistatinae
Prithinae
Filistatidae
Trogloraptoridae
Caponiidae
Segestriidae
Oonopidae
higher gamasomorphines
Orsolobidae
Dysderidae Synspermiata
Dysderoidea
Sicariidae
Drymusidae
Periegopidae
Ochyroceratidae
Scytodidae
Tetrablemmidae
Plectreuridae
Diguetidae
Pacullidae
Pholcidae
Scytodoidea
Lost Tracheae clade
Hypochilidae
Austrochilidae (part): Hickmaniinae
Leptonetidae (part): Archoleptonetinae
Gradungulidae
Leptonetidae (part)
Austrochilidae (part): Austrochilinae
Mecysmaucheniidae
Huttoniidae
Palpimanidae
Otiothopinae
Chediminae
Palpimaninae
Stenochilidae
Archaeidae
Leptonetidae (part)
(Palpimanoidea)
CY Spigot clade
Ninetinae
Smeringopinae
Pikelinia sp.
(Filistatidae)
Caponina sp.
(Synspermiata, Caponiidae)
Loxosceles sp.
(Scytodoidea, Sicariidae)
Plectreurys tristis
(Lost Tracheae clade, Plectreuridae)
Gradungula sorenseni
(Gradungulidae)
Otiothops birabeni
(Palpimanoidea, Palpimanidae)
Fig. 3. Non-entelegyne Araneomorphae (same conventions as in Fig. 2).
10 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
0.3
Gnolus cordiformis
Mollemeta edwardsi
Parasteatoda tepidariorum
Ozarchaea platnicki
Nanometa sp. FAPDNA066
Neospintharus trigonum
Trogloneta sp. MYSM-025-CHILE
Novafroneta sp. GH40
Nephila pilipes
Frontinella sp. GH33
Allende sp. CG103
Physoglenes sp. SP41
Symphytognathidae sp. SYMP-005-AUST
Australolinyphia sp. GH45
Metleucauge yunohamensis
Leucauge venusta
Maymena mayana
Matilda sp. CG272
Pahoroides sp. CG244
Theridion differens
Mimetus sp. GH25
Pinkfloydia harveii
Cyrtognatha sp. GH12
Dubiaranea aysenensis
Diplostyla concolor
Meringa sp. CG142
Ostearius melanopygius
Thymoites unimaculatus
Opadometa sp. TL-2013
Tekelloides sp. CG101-CG102 CG242
Ulwembua sp. CG31
Micrathena gracilis
Megadictyna thilenii
Phoroncidia scutula
Pahora sp. CG155
Eustala sp. TAB-2009
Eriophora sp. GH7-GH21
Australomimetus sp. NS112
Meringa sp. CG193
Araneus diadematus
Gelanor latus
Pararchaea sp. SP3
Latrodectus hesperus
Mysmena leichhardti
Platnickina mneon
Episinus antipodianus
Neomaso patagonicus
Agyneta ramosa
Anapisona kethleyi
Scharffia chinja
Gaucelmus augustinus
Nephila clavipes
Gnolus angulifrons
Perilla teres
Tylorida striata
Eidmanella pallida
Anelosimus eximius
Patu sp. SYMP-001-DR
Oarces reticulatus
Microdipoena sp. GH3
Tidarren sisyphoides
Theridula opulenta
Pimoa sp. SP74
Trogloneta granulum
Epeirotypus chavarria
Orsonwelles polites
Tylorida sp. GH53
Haplinis diloris
Metellina segmentata
Thwaitesia sp.
Chrysso octomaculata
Azilia guatemalensis
Mysmenidae sp. Thailand MR83
Nephila fenestrata
Metellina merianae
Coddingtonia euryopoides
Labulinyphia tersa
Raveniella peckorum
Synotaxidae: Synotaxus sp. CG260
Elanapis aisen
Acrobleps hygrophilus
Mysmena sp. MYSM-013-THAI
Nephilengys cruentata
Maymena ambita
Ero spinipes
Epeirotypus brevipes
Malkara sp. MR205
Nanoa enana
Tekelloides sp. CG101-CG102
Parafroneta sp. CG168
Crassanapis cekalovici
Cyclosa conica
Pachygnatha sp. GH31
Taliniella vinki
Carathea parawea
Gonatium rubellum
Leucauge magnifica
Haplinis sp. CG162
Pimoa sp. CG73
Chrysometa alboguttata
Neoscona arabesca
Metepeira labyrinthea
Echinotheridion otlum
Hispanognatha guttata
Hylyphantes graminicola
Orsinome cf. vethi
Nephilengys dodo
Chileotaxus sans
Tasmanapis strahan
Pahora sp. CG241
Gongylidiellum vivum
Pimoa altioculata
Euryopis spinifera
Spirembolus erratus
Tetragnatha sp. GH19-GH27
Symphytognathidae sp. Madagascar MR87
Tekella sp. CG205
Gasteracantha cancriformis
Tetragnatha mandibulata
Nesticus holsingeri
Meta sp. GH47
Ambicodamus marae
Mangora maculata
Meringa sp. CG230
Mimetus banksi
Walckenaeria keikoae
Cyrtophora citricola
Laperousea sp. GH58
Pachygnatha sp. GH34
Frontinella communis
Tupua sp. CG299
Nephila clavata
Episinus affinis
Mecynogea lemniscata
Alaranea merina
Raveniella luteola
Pholcomma hirsutum
Larinioides cornutus
Latrodectus geometricus
Latrodectus mactans
Takayus lyricus
Neriene radiata
Solenysa sp. SL-2010
Malkara loricata
Micropholcomma sp. MR667
Dipoena cf. hortoni
Symphytognatha picta
Clitaetra episinoides
Zygiella x-notata
Oncodamus decipiens
Leucauge argyra
Bathyphantes gracilis
Mimetidae sp. New Zealand CG117
Argiope bruenicchi
Cyclosa bifurcata
Symphytognatha sp. SYMP-008-DR
Zealanapis armata
Deliochus sp.
Pahorinae sp. New Zealand CG226
Novodamus nodatus
Carpathonesticus hungaricus
Anapidae sp. New Zealand MR69
Tenuiphantes tenuis
Linyphia triangularis
Nephilengys malabarensis
Metabus ebanoverde
Leucauge sp. GH9
Symphytognathidae SYMP-004-THAI
Porrhomma montanum
Megadictyna sp. CG240
Chorizopes nipponicus
Spintharus flavidus
Nesticella brevipes
Pseudanapis cf. parocula
Nephilengys papuana
Mysmena tasmaniae
Microlinyphia sp. GH39
Microlinyphia dana
Crustulina sticta
Steatoda triangulosa
Tetragnatha versicolor
Cyatholipus sp. CG271
Argyrodes elevatus
Arkys cornutus
Herennia etruscilla
Symphytognathidae sp. SYMP-003-MAD
Maxanapis bartle
Herennia multipuncta
Forstera sp. CG273
Helvibis cf. longicauda
Zygiella atrica
Oedothorax apicatus
Stemonyphantes sp. GH32
Holarchaea sp. CG249
Chilenodes australis
Enoplognatha caricis
Pimoidae: Weintrauboa yele
Calcarsynotaxus sp. CG298
Linyphia sp. GH41
Phonognatha graeffei
Pimoa sp. CG81
Microdipoena guttata
Lepthyphantes minutus
Anapidae sp. Thailand MR88
Nephila senegalensis
Conculus sp. ANAP-001-THAI
Microneta viaria
Tekella sp. CG246
Dolichognatha sp. GH59
Nephilengys sp. GH36
19
100
85
100
94
100
99
100
100
57
83
100
99
71
70
100
100
100
99
97
66
22
97
99
100
100
100
100
79
24
92
87
90
48
77
11
51
100
100
100
89
99
49
100
3
15
99
42
41
72
98
27
10
49
43
90
70
100
100
100
100
77
97
37
32
100
17
99
100
90
100
50
80
92
64
47
13
44
50
30
50
36
30
100
100
28
60
92
96
100
22
94
45
12
55
72
100
99
35
86
78
100
98
100
16
72
87
100
100
97
100
100
22
5
87
100
100
32
13
98
97
13
44
75
62
18
26
55
97
100
40
100
100
51
39
45
100
100
100
43
89
40
100
93
82
52
50
100
33
88
37
56
16
28
87
100
63
98
99
100
26
84
99
100
97
15
91
100
88
54
31
63
64
44
1
98
75
100
26
37
69
100
99
88
99
35
34
100
94
99
100
100
100
55
83
100
33
37
19
98
62
100
47
59
100
40
100
95
98
53
Megadictynidae Nicodamoidea
Nicodamidae
Theridiidae
Theridiosomatidae
Mysmenidae
Symphytognathidae
Anapidae
Micropholcommatinae
Nephilinae
Araneidae
Malkaridae
Mimetidae
Tetragnathidae
Nesticidae +
Cyatholipidae
Physoglenidae
Pimoidae -
Linyphiidae +
Arkyidae
other
Entelegynae
Araneoidea
Megadictyna thilenii (Megadictynidae)
Mimetus syllepsicus (Mimetidae)
Stemonyphantes montanus (Linyphiidae)
Anelosimus pantanal (Theridiidae)
Alpaida bicornuta (Araneidae)
Fig. 4. Nicodamoidea and Araneoidea (same conventions as in Fig. 2).
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 11
0.3
Habronestes raveni
Octonoba sinensis
Therlinya sp. CG297
Neolana sp. CG108
Calacadia sp. CG21
Dictyna sp. TAB-2009
Neoramia sp. CG239
Myro sp. CG160
Tegenaria domestica
Gandanameno spenceri
Anisacate tigrina
Textrix denticulata
Ypypuera crucifera
Adonea fimbriata
Cybaeus giganteus
Paramatachia sp. CG277
Cycloctenus sp. CG150
Hahnia nava
Mexitlia trivittata
Stiphidion sp. SP81
Dictyna major
Toxopidae: cf. Gasparia sp. New Zealand CG105
Porteria sp. MR284
Goeldia sp. MR17
Metaltella sp. SP19
Asceua sp. MR154
Nanocambridgea sp. CG203
Stiphidion facetum
Callobius bennetti
Badumna insignis
Tamgrinia palpator
Metaltella sp. CG23
Badumna sp. CG186
Saltonia incerta
Paramatachia sp. SP82
cf. Livius sp. Chile MR548
Nurscia albofasciata
Stiphidion sp. CG91
Dorceus fastuosus
Mallos pallidus
Hololena sp. CG18
Pimus ivei
Chresiona invalida
Hersilia sericea
Neoantistea agilis
cf. Capheris sp. Guinea Bissau MR467
Hetaerica scenica
Hermippus septemguttatus
Malaika longipes
Penestomus egazini
Rubrius antarcticus
Malenella nana
Lutica sp. MH12-MH13
Deinopis sp. GH4
Uroctea durandi
Leprolochus birabeni
Stegodyphus mimosarum
Pireneitega luniformis
Cybaeus mosanensis
Mamoea sp. CG177
Menneus capensis
Agelenopsis aperta
Dresserus kannemeyeri
Psammorygma sp. MR726-MR727
Cydrela sp. MR712
Orepukia sp. CG132
Aorangia sp. CG199
Amaurobius fenestralis
Chumma inquieta
Cybaeus morosus
Tenedos serrulatus
Naevius sp. MR423
Uloborus glomosus
Phyxelida bifoveata
Cambridgea sp. CG97
Cybaeolus cf. rastellus
Draconarius sp. CG82
Callevopsis striata
Caesetius bevisi
Eresus walckenaeri
cf. Titanoeca sp. Kazakhstan CG66
Neoramia sp. CG129
Asceua sp. MR378
Mallinella sp. MR207
Barronopsis barrowsi
Stegodyphus lineatus
Cicurina sp. MH10
Metaltella sp. CG61
Desis formidabilis
Dictyna latens
Neoramia sp. CG178
Corasoides sp. CG294
Argyroneta aquatica
Hersiliola macullulata
Eratigena atrica
Neolana sp. CG121
Hyptiotes cavatus
Dictyna sp. MH1
Oecobius cellariorum
Pakeha sp. CG169
Badumna longinqua
Rahavavy fanivelona
Marplesia sp. CG189
Goyenia sp. CG237
Goyenia sp. CG236
Platnickia elegans
Paradonea variegata
Goeldia sp. CG59
Chariobas cylindraceus
Tangaroa sp. JC5
Toxops sp. CG278
Barahna sp. CG293
Cycloctenus sp. CG98
Agelenopsis pennsylvanica
Ommatauxesis macrops
Cyrioctea spinifera
Iviraiva argentina
Diores femoralis
Metaltella sp. CG58
Calymmaria sp. CG231
Allagelena difficilis
Stiphidion sp. CG296
Pandava sarasvati
Miagrammopes sp. SP51
Paratheuma shirahamaensis
cf. Zodariellum sp. Guinea Bissau MR469
Amphinecta sp. CG187
Ambohima sublima
Xevioso orthomeles
Mallinella sp. MR207 MR374
Amaurobius similis
Ischaleinae: Ischalea sp. CG119
Cryptothele sp. MR663
cf. Rangitata sp. New Zealand CG224
Zanomys californica
Cycloctenus sp. CG133
Neoramia setosa
Aorangia sp. CG136
Baiami sp. CG291
Midgee thompsoni
Deinopis sp. SP68
Themacrys irrorata
Poaka graminicola
Agelena labyrinthica
Mamoea pilosa
Vidole capensis
Otagoa sp. CG235
Ambohima ranohira
Storena cyanea
Lathys alberta
Xevioso kulufa
Cybaeodamus ornatus
Oecobius sp. TAB-2009
Seothyra annettae
Psammoduon cf. deserticola
cf. Paramamoea sp. New Zealand CG114
Uroctea sp. CG285
Aorangia sp. CG197
Procambridgea sp. CG295
Tasmarubrius truncus
Hapona sp. CG113
Uloborus diversus
Draconarius sp. CG74
Cycloctenus sp. CG204
Metaltella sp. CG60
Naevius calilegua
Titanoeca sp. CG64
Hololena curta
Deinopis spinosa
Suffasia sp. GH54
Menneus camelus
Marplesia sp. CG238
Tenedos cf. persulcatus
Zodarion italicum
Lamina sp. CG145
Cycloctenus westlandicus
Waitkera waitakerensis
Phyxelida tanganensis
Lamina sp. CG118
Laestrygones sp. NP29
Cybaeolus pusillus
Amphinecta luta
Paravoca sp. CG222
Toxopsiella sp. CG134
Subasteron daviesae
72
54
86
23
15
44
100
100
28
100
54
100
100
96
84
100
80
100
100
36
100
100
44
65
4
100
100
38
91
53
51
21
99
94
100
79
58
41
100
26
96
99
100
100
100
50
42
100
100
94
78
100
29
100
100
2
99
53
100
94
100
78
98
100
83
97
84
100
67
11
48
76
67
6
34
100
94
51
34
84
58
100
55
99
100
45
58
49
100
57
100
100
100
100
100
57
100
99
80
29
100
78
100
35
99
37
100
100
63
100
10
12
100
64
100
100
40
100
67
77
35
100
34
100
57
92
96
48
68
11
100
86
8
29
100
100
15
100
43
32
97
34
100
82
100
61
33
84
100
66
100
55
39
100
100
88
98
7
97
100
100
100
99
42
13
100
38
59
92
100
100
100
70
53
100
100
100
100
62
100
81
78
22
100
35
100
Eresidae
Deinopidae
Hersiliidae
Oecobiidae
Uloboridae
Titanoecidae
Phyxelididae
Penestomidae
Zodariidae
Cryptothelinae
Amaurobiidae: Amaurobiinae
Coelotinae
Amaurobiidae: Macrobuninae
Agelenidae
Cybaeidae
Hahniidae
Toxopinae
Myroinae
Toxopidae
Dictynidae
Cycloctenidae
Stiphidiidae
Amphinectinae +
Metaltellinae
Porteriinae
Matachiinae
Desidae +
Oecobioidea
(Titanoecoidea)
Zodarioidea
marronoid clade
Oval Calamistrum clade + Dionycha + Sparassidae
Araneoidea + Nicodamoidea
Cybaeodamus meridionalis
(Zodarioidea, Zodariidae)
Calilena arizonica
(Agelenidae)
Austrohahnia sp.
(Hahniidae)
Stiphidion facetum
(Stiphidiidae)
Metaltella simoni
(Desidae, Metaltellinae)
ida
Cycloctenus sp.
(Cycloctenidae)
Otagoa sp CG235
Lamina sp. CG118
Ommatauxesis macrops
Myro sp. CG160
Lamina sp. CG145
cf. Gasparia sp. CG105
1
1
1
0,6749
0,956
Myroinae (BI)
tr h hni .
Hahniidae
RTA clade
Oecobius sp. (Oecobiidae)
Matachiinae sp. Queensland CG275
Fig. 5. The marronoid clade and other groups of Entelegynae: Eresidae, Deinopidae, Uloboridae, Oecobioidea, Titanoecoidea and Zodarioidea,
with alternative resolution for Myroinae from Bayesian analysis (BI) (same conventions as in Fig. 2).
12 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
0.3
Epicadus heterogaster
Delena cancerides
Xysticus sp. SP40
Coenypha sp. MR172
Varacosa gosiuta
Pseudopoda sp. MR532
Bradystichus crispatus
cf. Talaus sp. Malaysia MR385
Simorcus cf. asiaticus
Strophius sp. MR188
Psechrus senoculatus
Onocolus cf. pentagonus
Hippasa sp. PS8
Pardosa saxatilis
Psechrus sp. PS9
Zorocrates fuscus
Phanotea sathegyna
Polybetes pythagoricus
Strophius cf. albofasciatus
Ctenidae: Ancylometes bogotensis
Hamataliwa sp. SP20
Uduba sp. CG8
Pirata subpiraticus
Uliodon sp. CG182
Heteropoda venatoria
Epidius parvati
Eusparassus sp. MR103
Rabidosa rabida
Borboropactus sp. MR411
Oxyopidae sp. Myanmar PS6
Ctenus sp. CG78
Caayguara album
Dendrolycosa cruciata
Alcimochthes limbatus
Hogna cf. frondicola
Neostasina sp. MR351
cf. Tobias sp. Ecuador MR440
Hala sp. CG282
Pisaurina mira
Pardosa astrigera
Hippasa sp. PS7
Kilyana sp. CG306
cf. Sydimella sp. Ecuador MR444
cf. Misumena sp. Ecuador MR448
Synstrophius sp. MR454
Sidymella sp. CG211
Isopeda parnabyi
Eurychoera cf. banna
Homalonychus selenopoides
Anahita sp. CG25
Neostasina sp. MR164-MR350
Hala sp. CG281
Monaeses sp. SP29
Homalonychus theologus
Psechrus sp. CG75
Zorodictyna sp. CG47
Thomisidae sp. Malaysia MR392
Venonia cf. coruscans
Aphantochilus sp. MR186
Liocranoides archeri
Misumena sp. MR471
Oxyopes salticus
Quemedice enigmaticus
Zoropsis spinimana
Borboropactus bituberculatus
Bucranium sp. MR451-MR434
Ctenus sp. CG55-CG57
Uliodon sp. CG124
Stephanopoides sexmaculata
Boliscus cf. tuberculatus
Tmarus holmbergi
Trechaleoides biocellata
Thomisus onustus
Lysiteles coronatus
Tengella radiata
Zorodictyna sp. CG45
Ctenidae: Cupiennius cf. granadensis
Acentroscelus sp. MR453
Thomisops piger
Pardosa sp. GH46
Pardosa sp. GH52
Dolomedes sp. CG96
Arctosa kwangreungensis
Griswoldia transversa
Zorodictyna sp. CG300
Kilyana hendersoni
Alopecosa licenti
Stephanopis sp. SPB-2007
Phrynarachne katoi
Trochosa ruricola
cf. Synema sp. Ecuador MR437
Schizocosa ocreata
Pseudomicrommata longipes
Thomisidae sp. Malaysia MR395
Amyciaea sp. MR389
Tapinillus sp. PS202
Uliodon sp. CG127
Paracladycnis vis
Allocosa sp. PS114
Stiphropus cf. bisigillatus
Misumenops nepenthicola
Cebrenninus rugosus
Peucetia viridans
Hala sp. CG34
Pseudoporrhopis granum
Senoculidae: Senoculus cf. iricolor
Hala sp. CG9
Zorocrates sp. MR12
cf. Stephanopis sp. Queensland MR201
Titidius cf. galbanatus
Pirata minutus
Fecenia sp. MR409
Nilus esimoni
Uduba sp. CG301
Titidius cf. dubitatus
Austrotengella toddae
Dolomedes tenebrosus
Ctenus crulsi
Runcinia albostriata
Diaea subdola
Stephanopis ditissima
Tolma sp. CG283
Phoneutria fera
Raecius asper
Ciniflella sp. Iguazu MR699
Sinopoda sp. CG70
9
98
38
10
6
76
60
89
96
87
71
36
100
100
6
28
47
41
9
97
99
91
85
83
10
100
82
35
9
13
100
9
100
100
64
97
16
35
90
72
21
41
48
87
30
43
94
22
62
100
44
43
63
9
64
23
95
43
97
10
99
100
93
63
100
13
59
53
100
75
90
100
7
89
7
15
25
69
82
100
57
35
100
100
27
46
91
86
28
95
96
8
25
96
100
49
83
97
97
79
99
32
95
49
62
10
11
36
100
100
57
95
61
21
23
93
95
95
30
100
72
32
100
64
100
35
Sparianthinae
Heteropodinae
Deleninae
Sparassidae
Homalonychidae
Udubidae
Zoropsidae +
Uliodoninae
Tengellinae
Griswoldiinae
core Ctenidae
Oxyopidae +
Pisauridae
Dolomedinae
Halinae
Pisaurinae
Lycosidae
(Psechridae)
Borboropactinae
Thomisus group
Aphantochilinae
Thomisidae
Dionycha
Marronoid clade
Oval
Calamistrum
clade
Sydimella sp.
(Thomisidae)
ycos
Agalenocosa punctata
(Lycosidae)
Thaumasia velox
(Pisauridae)
sida
Polybetes punctulatus
(Sparassidae)
Trechaleidae
Zorocrates unicolor
(Zoropsidae, Tengellinae)
Fig. 6. Sparassidae, Homalonychidae and the Oval Calamistrum clade (same conventions as in Fig. 2).
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 13
0.3
Cithaeron jocqueorum
Clubiona huttoni
Neozimiris pubescens
Lygromma sp. MR540
Ferrieria echinata
Intruda signata
Trochanteriidae: Doliomalus sp. MR225
Legendrena sp. CG314
Camillina calel
Trachycosmus sculptilis
Thysanina absolvo
Orthobula sp. SP21
Gayenna americana
Gallieniella mygaloides
Paccius sp. SP52
Neato beerwah
Morebilus fumosus
Phydile punctipes
Austrodomus zuluensis
Drassodes lapidosus
Ammoxenidae: Ammoxenus amphalodes
Gallieniella betroka
Liocranidae sp. Dominican Republic MR160
Molycria broadwater
Vectius niger
Chilongius cf. palmas
Utivarachna cf. kinabaluensis
Monapia dilaticollis
Desognaphosa yabbra
Sesieutes cf. schwendingeri
Clubiona terrestris
Trachelas tranquillus
Gnaphosa lucifuga
Asemesthes cf. corticola
Lamponidae: Lampona murina
Clubiona consensa
Orthobula sp. MR362
Oxysoma saccatum
Teutamus sp. MR531
Lamponidae: Centrothele mutica
Amaurobioides maritima
Prodidomus rufus
Coptoprepes campanensis
Myandra bicincta
Liocranidae: Apostenus sp. MR20
Eilica cf. trilineata
Ammoxenidae: Rastellus florisbad
Negayan paduana
Xiruana gracilipes
Hemicloea sp. GH60
Aysha lagenifera
Trochanteriidae: Platyoides walteri
Rebilus bulburin
Prodidomus flavipes
Hatitia sp. MR428
Trochanteriidae: Tinytrema sandy
Hemicloea semiplumosa
Meedo broadwater
Zelanda sp. CG213
Philisca huapi
Utivarachna cf. phyllicola
Hemicloea sp. CG206
Elaver sp. MR163
Liocranidae: Apostenus californicus
Pteroneta cf. saltans
Anyphaena accentuata
Oxysoma punctatum
Josa lutea
Epicharitus sp. SP85
Trachelopachys sericeus
Paccius cf. scharffi
Tomopisthes varius
Lamponidae: Asadipus kunderang
cf. Tricongius sp. Argentina NP18-MR16
Otacilia sp. MR81
Scotinella sp. SP94
Sanogasta maculatipes
Platorish jimna
Micaria sp. NP17
Amaurobioides africana
Zelotes sp. MR525
Pristidia prima
Meriola barrosi
Ammoxenidae: Ammoxenus cf. daedalus
38
100
55
71
46
100
3
0
100
99
100
51
8
100
10
10
100
100
62
3
100
100
65
99
1
91
66
39
6
18
100
74
85
100
79
96
46
56
99
100
97
97
100
65
87
100
86
85
6
99
4
100
99
100
65
5
69
100
12
98
12
28
82
94
100
36
30
85
62
91
53
6
100
97
99
99
59
53
86
94
66
28
100
18
100
Theuminae
Prodidominae
Prodidomidae
Trochanteriidae (part)
Gallieniellidae (part)
(Clubionidae)
Anyphaeninae
Amaurobioidinae
Anyphaenidae
Gallieniellidae (core)
Teutamus group
Phrurolithidae
Trachelidae
Molycriinae
(Gnaphosidae)
Dionycha part B
Oval Calamistrum clade
Dionycha
part A
Molycria sp. MR670
Amaurobioides maritima
(Anyphaenidae,
Amaurobioidinae)
Meriola sp.
(Trachelidae)
Latonigena pampa
(Gnaphosidae)
Fig. 7. Prodidomidae and Dionycha part A (same conventions as in Fig. 2).
14 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
0.3
Corinna nitens
Freya decorata
Garcorops madagascariensis
Odo bruchi
Castianeira sp. MR527
Argoctenus sp. CG26
Eutichuridae: Eutichurus ravidus
Pronophaea nitida
Holcolaetis xerampelina
Massagris schisma
Idastrandia cf. orientalis
Sphecotypus sp. MR376
Paradiestus penicillatus
Vulsor sp. CG29
Eutichuridae sp. Madagascar MR4-MR90
Cocalodes macellus
Syspira cf. longipes
Hispo macfarlanei
Carrhotus sp. WM10
Falconina gracilis
Anyphops barbertonensis
Messapus natalis
Miturgidae sp. Queensland MR629
Philodromus aureolus
Lyssomaninae: Lyssomanes viridens
Zora spinimana
Cheiramiona mlawula
Tibellus oblongus
Titanebo mexicanus
“Pronophaea group”: Olbus jaguar
Teminius insularis
Viridasiidae sp. Madagascar CG269
Pedinopistha stigmatica
Xenoctenus sp. MR982
Corinnomma sp. MR402
Naphrys pulex
Viridasiidae sp. Madagascar CG28
Serendib volans
Mituliodon tarantulinus
Cambalida cf. fulvipes
Mahafalytenus sp. CG268
Graptartia tropicalis
Cheiracanthium sp. MR366
Hypaeus cf. miles
Castianeirinae sp. Guinea Bissau MR483
Asemoneinae: Asemonea tenuipes
Copa sp. MR46
Corinnomma cf. severum
Ligurra latidens
Cheiracanthium sp. SP22
Portia sp. SP32
cf. Mopsus sp. New Caledonia WM16
Thanatus formicinus
Yaginumanis wanlessi
Donuea sp. MR79
Hovops sp. MR47
Selenops cocheleti
Thanatus sp. MR481
Calamoneta sp. MR661
Echinax longespina
“Pronophaea group”: Carteronius sp. MR1007-MR1008
Pelegrina aeneola
Cotinusa sp. MRB024
Anyphops sp. SP44
Hurius vulpinus
Donuea sp. MR80
Pagiopalus nigriventris
Apochinomma formicaeforme
Cocalus murinus
Parapostenus sp. MR735
Plexippus paykulli
Bacelarella dracula
Eutichuridae sp. Queensland MR628
Selenops insularis
Leikung sp. WM11
Pronophaea proxima
cf. Myrmecotypus sp. Ecuador MR417
Aetius cf. nocturnus
Selenops nesophilus
Paravulsor sp. MR276
Galianora sacha
Salticus scenicus
Miturga lineata
Allomedmassa mae
Tibellus chamberlini
Petrichus sp. MR696
Castoponera ciliata
Thiania bhamoensis
Cheiracanthium cf. turiae
Bavia cf. aericeps
Phlegra sp. WM12
Sitticus rainieri
Carrhotus sp. MCH-2003
cf. Myrmecium sp. Ecuador MR433
Nuliodon fishburni
Nyssus cf. coloripes
Onomastinae: Onomastus nigrimaculatus
Cheiracanthium mildei
Spartaeus thailandicus
22
5
99
52
43
86
95
100
47
10
29
74
24
95
11
15
100
96
94
98
100
75
37
19
38
45
85
86
81
95
18
49
61
83
5
26
33
66
63
28
74
48
97
72
90
46
5
100
6
80
33
91
93
100
95
12
26
99
64
31
81
72
97
95
95
95
23
57
91
89
14
90
34
100
94
1
94
36
41
98
8
100
33
8
82
8
2
50
89
12
92
40
87
97
39
100
29
74
Xenoctenidae
Corinnidae
Corinninae
Castianeirinae
Viridasiidae
Selenopidae
Miturgidae +
Eutichuridae -
Philodromidae
Thanatini
Hawaiian endemics
Spartaeinae
Salticinae
“Pronophaea group” -
Salticidae
Dionycha part A
Mituliodon tarantulinus
Syspira cf. longipes
Miturga lineata
Argoctenus sp. CG26
Teminius insularis
Nuliodon fishburni
Zora spinimana
Miturgidae sp. Queensland MR629
1
0,9987
1
0,9987
0,9707
1
1
Miturgidae
(BI)
(Hisponinae)
Dionycha
part B
Eutichurus ravidus
Cheiramiona mlawula
Cheiracanthium sp. SP22
Eutichuridae sp. Madagascar MR4-MR90
Cheiracanthium sp. MR366
Calamoneta sp. MR661
Cheiracanthium cf. turiae
Eutichuridae sp. Queensland MR628
Cheiracanthium mildei
11
1
1
1
0.97
1
1Eutichuridae
(BI)
Tibellus sp.
(Philodromidae)
Breda bistriata
(Salticidae, Salticinae)
Corinna nitens
(Corinnidae, Corinninae)
Odo bruchi
(Xenoctenidae)
Fig. 8. Dionycha part B, with alternative resolutions from Bayesian analysis (BI) (same conventions as in Fig. 2).
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 15
groups in Araneomorphae: the structure within
Synspermiata; the clade Hypochilidae +Filistatidae; as
well as the relationships of the leptonetid Calileptoneta
and of Amaurobiidae. Recovery of taxonomic groups
by the C-ML tree is slightly lower (by five groups), as
compared to the unconstrained ML tree (Table 2).
The difference is limited to six families: the uncon-
strained ML analysis recovers the monophyly of six
more families (Actinopodidae, Ctenizidae, Dictynidae,
Drymusidae, Sicariidae, Zoropsidae), and the C-ML
tree only one more (Idiopidae). All these groups have
low support (see Relationships below), and the topo-
logical changes are still limited to a restricted neigh-
bourhood. We carried out an additional analytical
variant, a constrained analysis excluding ambiguously
aligned regions (C-ML-T; Fig. S5). This scheme recov-
ered fewer taxonomic or transcriptomic groups than
either the BI or the ML analyses (Table 2). As the C-
ML tree recovered many of the previously accepted
families, and incorporates the recent highly supported
groups, this analysis was used to summarize our
results and the sensitivity of selected groups to differ-
ent methodological approaches. Four terminals had
very long branches and were very unstable across anal-
yses: Caerostris sexcuspidata (Araneidae), Theotima sp.
MR15 (Ochyroceratidae), Usofila sp. MR71 (Telemi-
dae) and Theridiosoma gemmosum (Theridiosomatidae).
The removal of these four terminals from the dataset
and running a new ML analysis (C-ML-P) produced an
increment in bootstrap of several branches in the vicin-
ity where these species were formerly connected
(increasing average support from 0.69 to 0.71). Hence,
we present this analysis of 939 terminals as our working
hypothesis (C-ML-P tree, Figs 1–8).
Relationships
The results presented are based on molecular data
analysed using a diversity of optimality criteria
(Figs 1–8). Morphological characters, where discussed,
are used ad hoc and were not included in the phyloge-
netic analyses. To summarize the results and guide the
discussion, we use a tree that is based on ML analyses
of the concatenated dataset implementing a backbone
constraint based on the phylogenomic results from
Garrison et al. (2016), removing four unstable termi-
nals, the C-ML-P tree as discussed above. Based on
bootstrap support values (Figs 2–8), in the text we
refer to clade support as weak (<50), low (50–65),
moderate (66–79), good/well (80–94) or with high/
strong (95–100) support. We treat those groups mono-
phyletic in >70% of the different analyses as robust
(Fig. S11). Additional results from analyses under dif-
ferent analytical criteria and data treatments are given
in Table S4. Results from several unconstrained
Table 2
Congruence analysis between reference taxonomic (TX, TX-C) or transcriptomic (TR) trees, and the trees obtained in different phylogenetic analyses. Congruence is measured as
number and percentage of groups recovered, and as topological similarity coefficients. Groups of the C-ML tree recovered by the different analyses are also reported
Tree
Groups
in tree
TR
groups
recovered
TX groups
recovered
TXC
groups
recovered Sym. Coeff. vs. TR Sym. Coeff. vs. TX Sym. Coeff. vs. TXC
C-ML
groups
recovered
Stable groups
recovered
(TR) Transcriptomic skeleton 45 45 14 12 1 0.905 0.905
(TX) Taxonomy reference 109 14 109 94 0.905 1 1
(TXC) Taxonomy reference,
conservative
94 12 27% 94 86% 94 100% 0.913 1 1
(IW) Parsimony, implied weights 941 34 76% 57 52% 49 52% 0.996 0.722 0.722 542 58% 623 85.6%
(EW) Parsimony, equal weights 907 31 69% 54 50% 45 48% 0.995 0.736 0.736 528 58% 605 83.1%
(DO) Direct optimization 941 33 73% 65 60% 56 60% 0.995 0.753 0.753 566 60% 622 85.4%
(BI) Bayesian inference 940 36 80% 74 68% 62 66% 0.997 0.772 0.772 706 75% 654 89.8%
(ML) Maximum likelihood 941 34 76% 81 74% 70 74% 0.997 0.766 0.766 788 84% 657 90.2%
(C-ML-T) Trimmed alignments,
maximum likelihood constrained
by skeleton TR tree
941 44 98% 70 64% 61 65% 0.998 0.761 0.761 714 76% 618 84.9%
(C-ML) Maximum likelihood
constrained by skeleton TR tree
941 44 98% 76 70% 66 70% 0.999 0.779 0.779 941 100% 623 85.6%
16 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
analyses are reported in the supplementary materials
and discussed briefly below.
A number of taxonomic changes are suggested based
on these analyses, and are in general conservative. In a
few cases, we refer to the results of clade-specific total
evidence (DNA sequences and morphology) analyses
recently performed for Mygalomorphae (Bond et al.,
2012; with morphological characters for Euctenizidae),
Palpimanoidea (Wood et al., 2012, 2013) and Lycosoi-
dea (Polotow et al., 2015). Although our results here
differ in some ways from those studies, we rely on the
total evidence results to guide taxonomic suggestions
for Mygalomorphae, Palpimanoidea and Lycosoidea.
Outgroups
We recover a strongly supported Tetrapulmonata,
consisting of a monophyletic Pedipalpi, sister to Ara-
neae, following Shultz (1990) and others (Fig. 2).
Amblypygi is monophyletic, with Charinidae placing
basally in the order, following Weygoldt (1996). Pedi-
palpi comprise the monophyletic Schizomida plus Uro-
pygi, which follows Weygoldt and Paulus (1979), and
Amblypigi. Protoschizomidae place basally within
Schizomida, following Cokendolpher and Reddell
(1992).
Mesothelae versus Opisthothelae
The Mesothelae (family Liphistiidae, Liphistiomor-
phae) retain external abdominal segmentation; at least
vestiges of all four pairs of spinnerets and body
segments 12–18 are present, extending behind the
spinnerets such that these appear to be beneath the
middle of the abdomen, hence “meso-thele”. Four
book lungs and orthognath fangs are also retained in
this group. The Mesothelae sampling herein includes
three species of Liphistius, and one each of Ryuthela
and Heptathela. We find that Liphistius, Liphisti-
inae, Heptathelinae, Liphistiidae, Mesothelae and
Opisthothelae are all monophyletic with strong sup-
port (Fig. 2), in agreement with the recent analyses of
Xu et al. (2015a,b).
Opisthothelae
This group represents spiders in which the abdomi-
nal segments 12–18 are suppressed such that the spin-
nerets appear to be beneath the apex of the abdomen,
hence “opistho-thele”. We find a monophyletic
Opisthothelae with strong support (Fig. 2).
Mygalomorphae
These taxa retain the primitive four book lungs and
orthognath fangs but have reduced spinning organs.
None has a homologue of the anterior median spin-
nerets (AMS), and only a few retain anterior lateral
spinneret (ALS) homologues; most have only four pos-
terior spinnerets. A monophyletic Mygalomorphae is
recovered and strongly supported. Like previous
molecular studies that have included a broad sampling
of mygalomorph taxa (Hedin and Bond, 2006; Bond
et al., 2012, 2014; Garrison et al., 2016), we recover a
basal split between the Atypoidea and the Aviculari-
oidea (Fig. 2). The Atypoidea (Antrodiaetidae, Atypi-
dae and Mecicobothriidae) are a clade of
behaviourally disparate mygalomorphs that retain ves-
tiges of segmentation as dorsal abdominal tergites.
Holarctic Atypidae are monophyletic, whereas Holarc-
tic Antrodiaetidae are rendered paraphyletic, by the
inclusion of Mecicobothriidae. The latter show a bipo-
lar (North and southern South America), disjunct dis-
tribution. North America is a centre of diversity and
endemism for Atypoidea.
We recover a monophyletic Avicularioidea, compris-
ing all non-atypoidine mygalomorphs, which have lost
all vestige of external abdominal segmentation. Reso-
lution with Avicularioidea has similarities and differ-
ences with previous molecular studies of
Mygalomorphae (Hedin and Bond, 2006; Bond et al.,
2012, 2014; Garrison et al., 2016). When we compare
our results to the analyses recently performed by Bond
et al. (2012) (combining sequence data with morpho-
logical characters for Euctenizidae), we notice several
differences. Of the groupings found by Bond et al.
(2012), we recover Mygalomorphae, Atypoidea and
Avicularioidea, although arrangements within differ,
Theraphosoidina including Barychelidae and Thera-
phosidae, and the families Atypidae, Euctenizidae,
Migidae and Idiopidae (the latter with weak support).
We obtained a monophyletic Actinopodidae in several
of our analyses (but not C-ML or BI); our results find
a close association of actinopodids with some
Hexathelidae, reproducing previous results by Bond
et al. (2012) and Opatova and Arnedo (2014). Nemesi-
idae are a large group paraphyletic with respect to
Microstigmatidae and at least Fufius of Cyrtaucheni-
idae. Our results differ from those of Bond et al.
(2012) in that our data do not recover any of the fol-
lowing taxa as monophyletic: Domiothelina, Crassi-
tarsae, Ctenizoidina, Euctenizoidina, Antrodiaetidae,
Dipluridae or Ctenizidae. Since these differences are
all weakly supported, we do not draw further conclu-
sions on this basis.
Ctenizidae, represented by eight taxa, are diphyletic.
The American Ummidia and Eurasian Conothele form
a strongly supported group (Ctenizidae part A), apart
from a weakly supported group of South African
(Stasimopus) and North American genera (Ctenizidae
part B). The three diplurid exemplars in this study are
not monophyletic, although the genera Australothele
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 17
and Cethegus are joined with high support. Cyr-
taucheniidae, with four exemplars, break into two
parts—Homostola plus Ancylotrypa are strongly
related and are supported as related to the Thera-
phosoidina, a result consistent with Bond et al. (2012),
while Fufius fell within Nemesiidae. We suspect that
the non-monophyly of Ctenizidae and Dipluridae may
be due to inadequacies in our data, and we defer to
the total evidence results of Bond et al. (2012), and
refrain from making any taxonomic changes for these
families. Only the unconstrained ML analysis retrieves
a monophyletic Ctenizidae, although with weak
support.
Araneomorphae
As with some mesotheles, the AMS are present in
some araneomorphs, but with many functional spig-
ots. The araneomorph AMS are unrecognizable as
spinnerets, as they are modified into a cribellum.
The cribellum is a synapomorphy for Araneomor-
phae, although in a majority of species it is reduced
to a non-functional colulus, or lost altogether.
Another synapomorphy for Araneomorphae are piri-
form silk glands, which produce a sticky glue that
bonds threads to each other or to the substrate,
making possible a much more varied and precise use
of silk than in mesotheles and mygalomorphs. The
basal branches of Araneomorphae are in a state of
flux. The most recent analysis from transcriptomes
(Garrison et al., 2016) finds strong support for some
basal clades, which we reflect in our backbone con-
straint. As expected, it is in the deeper nodes of
Araneomorphae where the transcriptomic data have
a stronger stabilizing effect, even with a limited
taxon sampling.
Hypochilidae and Filistatidae
This clade is one of the most exciting findings of the
recent transcriptomic analyses of Bond et al. (2014)
and Garrison et al. (2016). It not only refutes impor-
tant higher level groups (Paleo- and Neocribellatae,
Araneoclada, Haplogynae; see Taxonomy below), but
it begs for a substantial re-interpretation of the evolu-
tion of important characters, such as respiratory and
circulatory systems (see Huckstorf et al., 2015). This
clade is well supported after the addition of the TR
backbone tree, which contains Hypochilus and Filistata
(Fig. 3). We recover a monophyletic Filistatidae for
our eight exemplars. The unconstrained BI and IW
analyses also recover the group Hypochilidae +Filis-
tatidae (although in IW a representative of Filistati-
dae, Prithinae sp. Costa Rica MR11, goes to an odd
place, in Dysderidae, seemingly due to a misalignment
problem in the parsimony analyses).
Synspermiata
This group was recently named by Michalik and
Ram
ırez (2014) for all the ecribellate “haplogynes”,
after the unique fusion of several spermatids into one
synsperm (Alberti and Weinmann, 1985). Synspermi-
ata includes the superfamilies Dysderoidea, Scytodoi-
dea and the Lost Tracheae Clade. Synspermiata is
recovered with low support, but is obtained in all anal-
yses except for two unstable terminals (the telemid
Usofila and the filistatid Prithinae sp. Costa Rica
MR11 mentioned above) (Fig. 3).
Dysderoidea
The four dysderoid families (Dysderidae, Segestriidae,
Oonopidae and Orsolobidae) are recovered as mono-
phyletic in all analyses (Fig. 3), except for a few unsta-
ble representatives that may go, or come from,
elsewhere (the oonopid Stenoonops and the telemid Uso-
fila). The relationships among the families are homoge-
neous across analyses, including a new sister group
relationship between Orsolobidae and Dysderidae,
although weakly supported. This latter result agrees well
with the partly fused testes in dysderids, as an intermedi-
ate step towards total fusion that is distinctive of oono-
pids (Burger and Michalik, 2010; Michalik and
Ram
ırez, 2014). Within Oonopidae, the C-ML tree is
consistent with the progressive hardening of the body
from lower to higher gamasomorphines proposed by
Grismado et al. (2014: 7) (see also de Busschere et al.,
2014: 186), although not solving the orchestinines and
soft-bodied clades, which are undersampled in our
study. In Orsolobidae, we obtain a monophyletic group
of South American genera, represented by Orsolobus,
Osornolobus and cf. Mallecolobus sp. Chile MA188.
Trogloraptoridae and Caponiidae
Trogloraptoridae are the only entirely new spider
family described during this century. This taxon,
known only from Trogloraptor marchingtoni, was dis-
covered in caves and old growth forest in the Klamath-
Siskiyou region of Oregon and California. Their mor-
phology suggests a kinship with the Dysderoidea and
Caponiidae (Griswold et al., 2012). Most analyses
obtain Trogloraptoridae and Caponiidae as sister
groups (Fig. 3); C-ML and BI bring the unstable tele-
mid Usofila in between, but the removal of Usofila
increases the support of the group to moderate. This
latter clade is the sister group of Dysderoidea after the
TR backbone is enforced, and in the BI unconstrained
tree; in general, this is in good agreement with the mor-
phology, except that it implies homoplasy in the poste-
rior respiratory system of caponiids, remarkably similar
to that of dysderoids (Ram
ırez, 2000).
18 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Scytodoidea
The scytodoids are a group of Synspermiata with six
eyes grouped in three pairs. They include, among
others, the brown recluses (Loxosceles, Sicariidae) and
spitting spiders (Scytodidae). Scytodoids are recovered
in the BI tree, and their monophly is only weakly sup-
ported by the transcriptomic constraint, although only
Loxosceles and Scytodes are included in the skeleton
tree. According to this result, and also supported by
all the analyses, the tropical Ochyroceratidae are a
member of Scytodoidea (Fig. 3). This relationship had
previously been suggested by Lehtinen (1986), and we
have confirmed the presence of bipectinate proclaws
and a distal dorsal hood covering the claw bases in
Ochyrocera and Theotima (A. P
erez-Gonz
alez and M.
Ram
ırez, unpublished data); both are synapomorphies
of Scytodoidea (see Labarque and Ram
ırez, 2012).
Although Drymusidae are monophyletic in several of
our analyses (C-ML-T, ML, BI, DO), our results are
overall inconclusive about the separation or inclusion
of Periegopidae in Drymusidae.
Lost Tracheae Clade
This clade is a group of families of Synspermiata
that have lost their posterior respiratory system
(Ram
ırez, 2000). This clade is strongly supported after
the stabilization of the skeleton TR tree (which
includes Pholcus and Diguetia as the only representa-
tives of the clade) (Fig. 3), and also in the BI uncon-
strained tree. The resolution is novel, and implies the
separation of the armoured spiders Tetrablemminae
from Pacullidae, currently grouped in Tetrablemmidae,
but previously considered separate families (see Taxon-
omy below). Pholcidae are strongly supported, but
only the subfamilies Ninetinae and Smeringopinae are
recovered in our analysis; we refer to the densely sam-
pled analysis of Dimitrov et al. (2013) for intra-famil-
ial relationships.
Austrochiloidea and Leptonetidae
These two groups of spiders seem to be an endless
source of surprises. Austrochiloids comprise two aus-
tral families, Gradungulidae and Austrochilidae, which
include some of the largest araneomorphs (Forster
et al., 1987). Since Platnick (1977), these families have
been placed as an early branching lineage of the higher
spiders, as suggested by the retention of the primitive
arrangement of four book lungs. Within the last dec-
ade, field observations and careful scanning electron
microscopy examinations have revealed derived char-
acters in common with higher spiders, thereby chal-
lenging their grouping near the araneomorph base. At
least some austrochilids have cylindrical gland spigots
and card their cribellate silk in a supposedly derived
manner, using one leg IV braced against the other,
mobile leg IV (Lopardo et al., 2004; Griswold et al.,
2005). Leptonetids, tiny fragile spiders of caves and
other dark places, were traditionally placed within the
simple-genitalia haplogyne spiders. Again, detailed
scanning electron microscopy studies have changed
things: by discovering, first, a class of spigots that are
probably cylindrical gland spigots (Platnick et al.,
1991) and, second, a cribellum in Archoleptoneta (Led-
ford and Griswold, 2010). Morphology has suggested
a leptonetid affinity to entelegynes (Ledford and Gris-
wold, 2010) and phylogenomics added further support
(Garrison et al., 2016). Previous molecular studies
have suggested an Archoleptoneta–austrochiloid affin-
ity (Agnarsson et al., 2013). Herein, we continue to
expand novel interpretations of austrochiloid and lep-
tonetid placement (Fig. 3), underscoring the pivotal
importance of these obscure animals.
Gradungulidae
This bizarre family, known only from Australia and
New Zealand, is characterized by grotesquely asym-
metric tarsal claws and includes cribellate and ecribel-
late, four-lunged spiders. Gradungulidae are well
represented in our study, including the huge Australian
cribellate Macrogradungula moonya and the ecribellates
Gradungula sorenseni from New Zealand and Tarlina
woodwardi from Australia. Gradungulids unite with
high support, and appear related to the cribellate,
four-lunged sheet-web builder from Tasmania, Hick-
mania troglodytes (Austrochilidae). Gradungulids and
Hickmania appear also related to the cribellate lep-
tonetids Archoleptoneta in a clade of moderate sup-
port, although the precise relationships among them
are uncertain (Fig. 3).
Leptonetidae
The family Leptonetidae, exclusively Holarctic, had
long been placed among the haplogynes. The discovery
of a cribellum in Archoleptoneta, a relict leptonetid
from California (Ledford and Griswold, 2010), chan-
ged this scenario. Leptonetids had already been recog-
nized for having a category of spigots with sexual
dimorphism like cylindrical gland spigots, and Brignoli
(1979) had already remarked on the similarities to
Entelegynes. Ledford and Griswold (2010) suggested
that Archoleptoneta might be a proto-entelegyne, and
that the whole family might be misplaced in Synsper-
miata. Wunderlich (2015: 287) placed leptonetids as
part of his LAE clade (Leptonetoids, Archaeoids and
Entelegynes), based on cylindrical gland spigots, loss
of the posterior lungs and absence of eye triads.
Molecular data supported placement of Leptonetidae
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 19
outside of the Haplogynae (Agnarsson et al., 2013), as
did phylogenomic data (Garrison et al., 2016), proba-
bly as sister to Entelegynae, although the latter study
lacked some other strong candidates for leptonetid rel-
atives, e.g. austrochiloids and palpimanoids (see
below). Our study corroborates the placement of lep-
tonetids outside the Synspermiata and nearer the
Entelegynae; in addition, our data challenge leptonetid
monophyly (Fig. 3). In our study, the cribellate Arc-
holeptoneta, with a simple eye pattern, are separate
from the ecribellates, with posterior median eyes dis-
placed behind the lateral eyes. The ecribellate lep-
tonetids of our sample group are, however, diphyletic
in the optimal trees, and thus we prefer to defer taxo-
nomic changes in Leptonetidae (see comments below).
The CY Spigot clade, and the austrochiloids
Cylindrical gland spigots (CY), also known as
“tubuliform”, characterize a large clade of spiders
comprising all Araneomorphae except Hypochilidae,
Filistatidae and Synspermiata. These spigots appear
only in mature females and presumably take part in
making the eggsac, but the exact role is still unknown.
The aforementioned Leptonetidae join the austral fam-
ily Austrochilidae in having a category of spigots with
the same sexual dimorphism as CY. This last family
was long placed in Austrochiloidea near the base of
the Araneomorphae, because several (the austrochilid
Hickmania, together with Gradungulidae) retain four
book lungs. Our results place the two-lunged Aus-
trochilidae Austrochilus and Thaida as a monophyletic
group with high support, and ally these with the
ecribellate type genus of Leptonetidae, Leptoneta, but
with low support (Fig. 3). Austrochilids could be giant
austral counterparts of leptonetids; at least the peculiar
patella/tibia autospasy characteristic of leptonetids and
austrochilines supports this hypothesis. Leptonetidae
are not without problems though, in that the ecribel-
late leptonetines Neoleptoneta and Calileptoneta fall
far from Leptoneta, forming a group near the Enteleg-
ynae, and the cribellate Archoleptoneta joins with
Gradungulidae (see above). We suspect that this result,
especially the diphyletic Leptonetidae, is artefactual, as
there are numerous morphological synapomorphies
uniting the Leptonetinae, and the results are unstable
across analyses. Our data suggest, although with mod-
erate to low support, that the austrochiloids and lep-
tonetids are more closely related to palpimanoids and
entelegynes than to Synspermiata (Fig. 3).
Palpimanoidea
Assassin spiders are restricted to five living families,
Archaeidae, Huttoniidae, Mecysmaucheniidae, Palpi-
manidae and Stenochilidae. Palpimanoids were once
more widespread, with fossils dating back to the Juras-
sic in Northern Hemisphere deposits (Selden et al.,
2008; Wood et al., 2013). The fossil family
Lagonomegopidae was widespread in the Mesozoic
world, and 12 fossil genera of Northern Hemisphere
Archaeidae contrast to the only four known today
from Africa, Australia and Madagascar.
Wood et al. (2012, 2013), in total-evidence analyses
including fossil taxa, established the monophyly of a
Palpimanoidea comprising the above five families,
which we accept as the most robust solution. Molecu-
lar data alone repeatedly fail to recover Palpi-
manoidea. Each of the five palpimanoid families is
represented here by multiple exemplars and all of them
are recovered with strong support (Fig. 3). Huttoni-
idae and Palpimanidae unite with moderate support,
but the rest of the families, especially Archaeidae, are
unstable across analyses, clustering to other long-
branched regions of the tree; this situation improves
after the removal of Theridiosoma gemmosum and in
the BI tree. This instability might be the effect of long-
branch attraction or indicative of undetected paralogy
in some of the nuclear ribosomal genes (see comments
in Dimitrov et al., 2016). We prefer to retain the clas-
sification of Wood et al. (2012, 2013) and accept a
monophyletic Palpimanoidea; among other morpho-
logical characters, they have peg teeth on the pro-
margin of the chelicerae and a cheliceral gland mound.
All palpimanoids appear to be prey specialists often
feeding on other spiders, hence the broadly applied term
“assassin spiders”. Araneophagic palpimanids enter the
retreats of other spiders, seize them with scopulate ante-
rior legs and prey on them, at least pelican spiders
(Archaeidae) attack Araneoidea in the host’s webs, and
captive stenochilids and huttoniids seem to prefer spider
prey (see Wood et al., 2012). Huttoniidae, Palpi-
manidae and Stenochilidae have extensive, lateral scop-
ulae on their forelegs, which enable them to seize and
manipulate prey, and even the web-invading archaeids
retain a vestige of these scopulae. Mecysmaucheniidae
have a remarkable trap-jaw mechanism (Wood et al.,
2012, 2016). They hold the chelicerae widely open and
locked before a strike; when prey contacts one of the
long, forwardly directed setae (possibly triggers), the
chelicerae snap closed at remarkable speed, enabling
them to capture such speedy prey as springtails (Collem-
bola). Prey preferences of extinct Palpimanoidea are
unknown, but archaeids from amber have the same
prey-specialized morphologies as living forms. Within
Palpimanidae, our data support the monophyly of the
subfamilies Otiothopinae (represented by Notiothops
and Otiothops), Chediminae (by Scelidocteus and
Sarascelis) and Palpimaninae (with Palpimanus and
Ikuma); our Ikuma representative is nested in an African
group of Palpimanus species, suggesting that the generic
limits should be re-examined.
20 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Entelegynae
This large clade of spiders is characterized by a “flow-
thru” female genital system with separate ducts for cop-
ulation and fertilization. Entelegyne monophyly is sup-
ported, but with weak support (Figs 4–8). The
entelegyne condition and the sclerotized genital plate
near the copulatory openings (the epigynum) have long
been recognized as a synapomorphy for this clade, with
three reversals to a haplogyne organization in tetrag-
nathines, in the uloborids Waitkera and Tangaroa and
in the anapid Comaroma. A close examination of the
genital system of anapids revealed fertilization ducts in
all except Comaroma (Lopardo and Hormiga, 2015).
Nicodamoidea and Araneoidea
Araneoidea are a rich, successful clade characterized
by a triplet of one flagelliform gland and two aggre-
gate gland spigots on the posterior lateral spinnerets
(PLS; variations occur): the flagelliform glands each
produce an axial line and the aggregates coat these
with viscid glue. The superfamily Araneoidea is a clade
and its sister group is the superfamily Nicodamoidea,
but, unlike the results in Dimitrov et al. (2016), here
the Araneoidea and sister group association of Nico-
damoidea and Araneoidea have only low support
(Fig. 4). Each included nicodamoid family, represented
by two terminals of the same cribellate species (Mega-
dictynidae, New Zealand) and three ecribellate Nico-
damidae (Australia and New Guinea), and the
superfamily Nicodamoidea, are all strongly supported.
The Araneidae have received much attention in phy-
logenetic studies and have a checkered history (e.g.
Hormiga et al., 1995; Scharff and Coddington, 1997;
Kuntner, 2006; Kuntner et al., 2008, 2013;
Alvarez-
Padilla et al., 2009; Dimitrov and Hormiga, 2009,
2011; Gregori
c et al., 2015). Our coverage of these
taxa is good, with 13 nephilines and 24 non-nephiline
Araneidae including the contentious oarcines (Gnolus
and Oarces), Caerostris,Zygiella and Phonognatha,
plus Arkys, formerly an araneid but placed in its own
family, sister to the tetragnathids by Dimitrov et al.
(2016). We obtained good support for Araneidae
(excluding Arkys), with a strongly supported
Nephilinae sister to the rest of the family, as in
Dimitrov et al. (2016; but that study included many
more terminals). Caerostris sexcuspidata, one of the
species that we pruned from the analysis, fluctuated
across several clades and erased their support (com-
pare Figs 2 and S4).
A poorly supported but robust arrangement emerg-
ing from our study and mirroring Dimitrov et al.
(2016) is the relationship among Tetragnathidae,
Arkyidae and Mimetidae. Our Tetragnathidae com-
prise 27 exemplars, whose monophyly is strongly
supported. These are in turn sister group to the Aus-
tralian Arkyidae (Arkys), with good support. Finally,
our six exemplars of the worldwide pirate spiders
(Mimetidae) comprise a well-supported family.
The peculiar, poorly known Austral spiders formerly
placed in Holarchaeidae and Pararchaeidae long posed
classification mysteries, and were alternatively classi-
fied with orb builders (Araneoidea) and assassin spi-
ders (Palpimanoidea). Holarchaea is strongly allied to
the anapid Acrobleps and our two pararchaeid exem-
plars fit within the Malkaridae, compatible with the
synonymies proposed by Dimitrov et al. (2016), but
with weak support and unstable across analyses. We
include Australian and Chilean malkarid exemplars,
but none of the undescribed taxa from New Zealand
used in that study.
Of the families formerly placed in the symphytog-
nathoids (Griswold et al., 1998) or symphytognathi-
dans (Rix and Harvey, 2010), we only recover a
weakly supported group of Anapidae and Symphytog-
nathidae, but the families themselves are in general
well supported. Anapidae, comprising 16 exemplars
including Holarchaea and a variety of micropholcom-
matines, are well supported, as are Mysmenidae (ten
exemplars). Symphytognathidae (six exemplars) have
moderate support. We obtained low support for
Theridiosomatidae, even after pruning Theridiosoma
gemmosum due to its unstable placement near Titanoe-
cidae and Archaeidae (e.g. in ML), in a group seem-
ingly characterized only by long branches, suggesting
either an analytical artefact or a sequencing problem.
Synotaxus, the sole remaining genus in Synotaxidae,
allies strongly to the nesticid Gaucelmus. Diphyly of
the old Synotaxidae is well justified on molecular,
morphological and behavioural grounds: the Neotrop-
ical Synotaxus builds a unique, “chicken-wire” web
with modules of glue-sticky silk (Eberhard, 1995),
whereas the southern South American, Australian
and New Zealand physoglenids make ordinary sheet
or dome webs (Dimitrov et al., 2016; and references
therein). We obtain a strongly supported core Nestici-
dae of four genera (Nesticus,Nesticodes,Eidmannella
and Carpathonesticus) but Gaucelmus fluctuates
among analyses, always together with Synotaxus.
Separation of the cob-web building Nesticidae (five
exemplars) and Theridiidae (27 exemplars) is found
here, as it has been in previous molecular studies
(e.g. Dimitrov et al., 2012, 2016; Agnarsson et al.,
2013; Bond et al., 2014; Garrison et al., 2016). The
sticky-silk apparatus of these two families is strikingly
similar (Coddington, 1989), with enlarged aggregate
gland spigots on the PLS (also present in Arkyidae
and Synotaxus) and a ventral comb on the fourth
tarsus for throwing silk blobs (hence, “comb foot spi-
ders”), but nesticid and theridiid genitalia are very
different (Agnarsson, 2004). Males of the former have
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 21
a typical araneoid paracymbium (a process on the
cymbium of the palp), whereas theridiid males have a
distal locking mechanism within the alveolus. Theridi-
idae are well supported but only allied with low sup-
port to the remaining Araneoidea. The propinquity
between Theridiidae and some Mysmenidae and
Anapidae, as found in Dimitrov et al. (2016), is
excluded by the backbone constraint, but a liaison
with Mysmenidae is obtained in some of the uncon-
strained analyses (ML, BI).
We recover strongly supported groups for the 11
Physoglenidae exemplars, ten Cyatholipidae and a
clade of 39 exemplars comprising Linyphiidae plus
Pimoidae (the pimoid Weintrauboa clusters with the
linyphiid Stemonyphantes, otherwise these two families
are reciprocally monophyletic; see Dimitrov et al.,
2016 for a more detailed discussion).
Eresidae
Velvet spiders comprise an almost exclusively Old
World taxon (one species, possibly introduced, is
reported from Brazil) that has many species and genera
in the arid parts of Africa. Subsociality has evolved at
least three times within Stegodyphus, once in south Asia
(S.sarasinorum) and twice in Africa (S. dumicola and
S. mimosarum) (Johannesen et al., 2007). The phylogeny
of velvet spiders has recently been studied in detail
(Miller et al., 2012). Our nine eresid exemplars form a
robust monophyletic group arising near the base of the
Entelegynae, but more detailed placement is impossible,
as support for relations to other entelegynes is essen-
tially non-existent (Fig. 5). The concept of Eresoidea
(Eresidae plus Oecobiidae) was established based on
morphological data (Platnick et al., 1991; Griswold
et al., 1999, 2005) but molecular data have challenged
this (J. Miller et al., 2010) and the Eresoidea hypothesis
now seems definitively refuted. The transcriptomic stud-
ies are indecisive on the relationships of Eresoidea (only
two species of the three putative eresoid families have
been included), and hence we did not constrain their
placement.
Oecobioidea
These two families, Hersiliidae and Oecobiidae, have
modified, elongated PLS that spin sheets or curtains of
silk to tie down their prey, which is applied while the
spider whirls rapidly in circles around the prey. Tiny,
cribellate Oecobius include cosmopolitan and pantropi-
cal species that are common in houses; ecribellate her-
siliids have a worldwide distribution. We include four
exemplars of each family; Hersiliidae are strongly sup-
ported and the cribellate Oecobius and ecribellate
Uroctea form a moderately supported Oecobiidae
(Fig. 5). Grouping of Hersiliidae and Oecobiidae as
superfamily Oecobioidea is also well supported in the
ML and C-ML trees, while the remaining methods did
not recover Oecobius and Uroctea together.
Orb-web weaving spiders
Perhaps the most dramatic change in spider phy-
logeny in the last decade is the realization that the
complex suite of stereotypical behaviours used to con-
struct an orb-web do not define the corresponding
clade “Orbiculariae”, formerly comprising all cribellate
and ecribellate orb-building spiders (Bond et al., 2014;
Fern
andez et al., 2014; Hormiga and Griswold, 2014;
Dimitrov et al., 2016; Garrison et al., 2016). Instead,
these studies suggest that the orb-webs are most likely
an ancient development of a more inclusive group,
probably of all entelegynes, and that the orb-web was
subsequently modified or lost in several lineages.
Cribellate orb-weavers
The monophyly of Deinopoidea (Uloboridae and
Deinopidae) is disputed by molecular data, as revealed
in the molecules-only partitions of Blackledge et al.
(2009), as clearly shown by Dimitrov et al. (2012,
2016) and Agnarsson et al. (2013), and now solidly
refuted by transcriptomic analyses (Bond et al., 2014;
Fern
andez et al., 2014; Garrison et al., 2016) and
herein (Fig. 5).
Not surprisingly, the monophyly of Deinopidae, rep-
resented by five exemplars (two Menneus and three
Deinopis), is strongly supported by sequence data. The
Uloboridae representatives, seven exemplars, group
together with low support. Both families vary their
placement across analyses; other than the well-estab-
lished non-monophyly of Orbiculariae and Deinopoi-
dea, a clear understanding of the placement of
cribellate orb-weavers remains a future goal. Although
“Orbiculariae” now appears to be an artificial taxo-
nomic concept, recent analyses of character evolution
still show some support for a single origin of the orb
web, but with multiple losses (e.g. Dimitrov et al.,
2016; Garrison et al., 2016), either by modifying the
web into architectures no longer recognizable as orbs
(e.g. in Cyatholipidae) or by dispensing altogether with
foraging webs (e.g. the pirate spiders, Mimetidae).
Ecribellate orb-weavers
The phylogeny of Araneoidea has received extensive
recent attention (e.g. Blackledge et al., 2009; Sch€
utt,
2009; Lopardo et al., 2011; Dimitrov et al., 2012,
2016; Agnarsson et al., 2013; Hormiga and Griswold,
2014). The study of Dimitrov et al. (2016) includes
representatives of all valid araneoid families, including
Synaphridae, which are unrepresented in the present
22 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
study. Common results from this study and that of
Dimitrov et al. (2016) are the sister group relationship
of Nicodamoidea and Araneoidea, of Nephilinae and
the rest of Araneidae, close association among Mimeti-
dae, Arkyidae and Tetragnathidae, the inclusion of
former Pararchaeidae within Malkaridae, of Holar-
chaeidae and Micropholcommatidae within Anapidae,
isolation of Synotaxus from other former Synotaxidae
and the remarkable diphyly of the comb-footed
“theridioids” (Theridiidae and Nesticidae). Several of
those findings are strongly supported in our study as
well. Another similarity is the generally low support
for interfamilial relations. Disappointingly, the evolu-
tion and diversification of ecribellate orb-builders and
their kin as yet cannot be understood. Compared to
the results of Dimitrov et al. (2016), we do find simi-
larities and differences in family placement, which are
detailed in the previous section, Nicodamoidea and
Araneoidea.
Spiders with male palpal tibial apophyses
A process or set of processes on the male palpal
tibia occurs widely within the Entelegynae. Occurrence
of as many as four lateral processes, e.g. in Amaurobi-
idae, suggests that there may be up to four homologies
(Griswold et al., 2005). The retrolateral tibial apoph-
ysis (RTA) characterizes a large clade of spiders (see
below). The dorsal tibial apophysis (DTA) of Nico-
damoidea and some Linyphiidae, Titanoecidae and
Phyxelididae is not homologous to the RTA; some
phyxelidids (Vytfutia) and phrurolithids (Phonotimpus)
and most Amaurobiidae have both RTA and DTA.
Titanoecidae
Titanoecids lack tarsal trichobothria, a primitive
condition, and have a complex DTA but lack an RTA
on the male palp. In our dataset, Titanoecidae are well
represented by six exemplars and form a robust,
strongly supported monophyletic family (Fig. 5).
Phyxelididae
These spiders occur in Africa, Madagascar and Asia,
and have been suggested as the sister group of Tita-
noecidae (Griswold et al., 1999, 2005). We include ten
representatives including African Vidoliini and also
Phyxelidini from both Africa and Madagascar, but
unfortunately the enigmatic Asian Vytfutiini are
absent from our analysis. Phyxelididae are strongly
supported and robustly allied to the RTA clade,
although with low support (Fig. 5). Phyxelididae and
Titanoecidae fall apart, provisionally refuting the clade
Titanoecoidea (Griswold et al., 1999). A broader rep-
resentation of phyxelidids, including Vytfutiini, plus
enhanced molecular, as well as morphological data,
will be necessary to better test the monophyly and the
limits of Titanoecoidea.
The RTA clade
These taxa have an RTA on the male palp and also
one to many trichobothria on the tarsi and metatarsi,
representing advances in mating stabilization and
vibration sensitivity, respectively. Spiders with dorsal
but not retrolateral male palpal tibial apophyses, i.e.
Nicodamoidea, Phyxelididae and Titanoecidae, are his-
torically excluded from the RTA clade (Griswold
et al., 1999, 2005). Herein, we recover the RTA clade,
albeit with low support (Fig. 5).
Zodarioidea
A gestalt of morphological data long associated the
Zodariidae and Homalonychidae, to which the pecu-
liar African Penestomidae were added by J. Miller et al.
(2010) based on molecular evidence. One morphological
synapomorphy for these three families is that the ALS
have the major ampullate gland spigots placed deep
within the piriform spinning field (J. Miller et al., 2010;
Ram
ırez et al., 2014), thus providing independent cor-
roboration of the molecular results. We find a robust
and well-supported Zodariidae comprising 27 exemplars
(Fig. 5). Zodariids are easily distinguished by a combi-
nation of characters (see Jocqu
e, 1991) —an unambigu-
ous synapomorphy for the family was recently
discovered by Jocqu
e and Henrard (2015)—the distal
dorsal rim of the leg tibia has a ball-shaped projection,
fitting in a cavity of the metatarsus. Within zodariids,
we corroborate the kinship of Cryptothele with former
cydrelines, and thus Cryptothelinae, as indicated by
morphological data (Ram
ırez et al., 2014). Our only
representative of Lachesaninae (Lutica) is deeply nested
among zodariines, although most internal nodes have
weak support. Penestomidae (Penestomus) are moder-
ately supported as the sister group of Zodariidae.
Homalonychidae are placed with zodarioids in our DO,
BI and ML analyses, with weak support, but are driven
elsewhere in the tree by the backbone constraint of Gar-
rison et al. (2016), close to the OC Clade and Dionycha,
but with weak support. Considering the congruence in
morphology and the molecular data found here, we sus-
pect that the breakup of Zodarioidea forced by the tran-
scriptomic analysis backbone tree may be artefactual.
The marronoid families
Our informal name marronoid (marr
on, brown in
Spanish) comes from grouping together several spider
families lacking striking characters and formerly classi-
fied together in such “tailor’s drawer” families as
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 23
Agelenidae, Desidae, Dictynidae and Amaurobiidae.
Most are brown, grey or mottled but also have complex,
distinctive genitalia with an elaborate RTA and several
bulbal sclerites, all retain three claws, and most families
have both cribellate and ecribellate species. The globally
representative taxon sample in Griswold et al. (1999,
2005) suggested a dichotomy roughly between the spi-
ders placed in Amaurobioidea and Dictynoidea, but not
equivalent to the tracheae-based groups Amaurobioidea
and Dictynoidea as defined by Forster and Wilton
(1973). Instead, their results hinted at a basic dichotomy
between Holarctic (Amaurobiidae, Dictynidae) and
Austral (Desidae, Stiphidiidae) spiders, the latter infor-
mally referred to as the “Fused Paracribellar clade”
(FPC) after a peculiarity of their spinning organs. A ser-
ies of molecular phylogenetic studies beginning with
Spagna and Gillespie (2008) and continued through J.
Miller et al. (2010), Spagna et al. (2010), Agnarsson
et al. (2013) down to the current study have divided and
reassembled these taxonomic concepts, hence requiring
the reclassification of Forster and Wilton’s concepts of
Amaurobioidea and Dictynoidea. Our study comprises
by far the densest and broadest taxon sampling for tar-
get genes. This convinces us to formalize the taxonomic
reorganization presaged by the works cited above and
corroborated and extended here. The families Age-
lenidae, Amaurobiidae, Amphinectidae, Cybaeidae,
Desidae, Dictynidae, Hahniidae, Neolanidae and
Stiphidiidae all require radical reclassification due to
our analysis, and below we provide the transfers and in
some cases new synonymies necessary for a phylogeneti-
cally robust classification. The “marronoid” group is
recovered by all our analyses albeit with weak support,
only differing in the inclusion of Sparassidae as a mem-
ber in the unconstrained analyses (sister to Amaurobi-
idae, with weak support), or exclusion after the
constraint skeleton from Garrison et al. (2016), which
did not have sparassids in their sample (Fig. 5).
Amaurobiidae
This family is strongly supported only if drastically
redelimited (Fig. 5). Of the 15 taxa in our dataset for-
merly classified as amaurobiids, only four species in
three genera, Amaurobius (two species), Callobius and
Pimus, remain to comprise the core of Amaurobiidae,
i.e. subfamily Amaurobiinae. Others are distributed to
Agelenidae (Paracoelotes), Cycloctenidae (Pakeha and
Paravoca) and Toxopidae (Midgee). This classical fam-
ily has been picked apart so that of the nine subfami-
lies recognized by Lehtinen (1967), only the Holarctic
Amaurobiinae, the principly austral Macrobuninae
and the mysterious Neotropical Altellopsinae remain.
The subfamily Macrobuninae was proposed by Lehti-
nen (1967) within Amaurobiidae, but clear synapomor-
phies were discovered in recent years, in the male
palps: a peculiar gland discharging in the retrolateral
tibial apophysis (Compagnucci and Ram
ırez, 2000),
and a stridulatory area on the cymbium (Griswold
et al., 2005). The molecular study of J. Miller et al.
(2010) indicated that the African and North American
macrobunines Chresiona and Zanomys allied with the
monogeneric South African Chummidae, falling far
from the core Amaurobiidae. We link here these taxa
with the core South American macrobunines, confirm-
ing that they are not amaurobiids, although their
nomenclatorial status is still unsolved (under study by
Almeida-Silva, pers. comm., Almeida-Silva, 2013;
unpublished thesis). Macrobunines generally occur in
temperate and subantarctic habitats in Africa, Australia
and South America, where they predominate in collec-
tions of undetermined “amaurobiids”. This group
received good support in our analysis. Our constellation
of Macrobuninae includes genera listed in Amaurobi-
idae (Anisacate,Callevopsis,Chresiona,Livius,Naevius,
Rubrius and Zanomys), Chummidae (Chumma),
Amphinectidae (Tasmarubrius) and most surprisingly,
Anyphaenidae (Malenella). Malenella nana exhibits one
of the many striking convergences into a dionychan-like
morphology. This Chilean species has the extensive tra-
cheal system and expanded claw tuft setae typical of
Anyphaenidae, where it was originally described
(Ram
ırez, 1995). The morphological analysis of
Ram
ırez (2014) obtained Malenella in the vicinity of
anyphaenids, but still uncovered several convergences
in tracheal systems and claw tuft setae strikingly similar
to those of anyphaenids (e.g. in some Eutichuridae and
in Hortipes). The present analysis strongly supports the
placement of Malenella among macrobunines, indepen-
dently supported by each molecular marker; we
sequenced several specimens with identical results, so
the possibility of contamination is discounted.
Agelenidae
This is a large Holarctic family, only native to Africa,
south of the Equator. This family received high support
in our analysis. As noted above, austral “agelenids”, e.g.
Neoramia, were misclassified and belong elsewhere.
Invasive Tegenaria occurs in South America, New Zeal-
and and Australia; otherwise agelenids comprise numer-
ous genera and myriad species in North America and
temperate Eurasia, extending to South Africa. There is
a single cribellate agelenid genus, Tamgrinia (J. Miller
et al., 2010), a little known taxon from central Asia.
Most are ecribellate funnel or sheet web builders with
lengthened PLS and a characteristic divided colulus; in
tropical Africa there are even subsocial species. Of our
agelenid representatives, two genera are moved to other
families: Orepukia, from New Zealand, allies with
Cycloctenidae and Neoramia is placed in Stiphidiidae.
Among the Agelenidae, Coelotinae and a core
24 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Ageleninae are each robust and strongly supported, but
we obtain Textrix and Tegenaria outside these subfami-
lies, grouped with moderate support; the cribellate Tam-
grinia is sister to the rest of the family (Fig. 5). All these
results were first suggested by J. Miller et al. (2010).
Bolzern et al. (2013) obtained a different composition
for agelenines, including Textrix and Tegenaria.
The “Dictynidae”, a polyphyletic group
The current catalogue of spiders lists 52 genera and
578 species in the family Dictynidae, and includes cribel-
late and ecribellate spiders (WSC, 2016). Whereas mor-
phological data are adequate to group the cribellates
together (Griswold et al., 2005), the family falls apart in
molecular analyses that include cribellate and ecribellate
members (Spagna and Gillespie, 2008; J. Miller et al.,
2010; Spagna et al., 2010). Dictynidae are clearly in
need of a major overhaul, which was begun by Spagna
et al. (2010) and Zamani et al. (2016). In our analysis,
former dictynids are scattered among at least three
clades, including the newly circumscribed families
Cybaeidae, Hahniidae and Dictynidae (Fig. 5).
Cybaeidae
In our analysis, Cybaeidae receive strong support
(Fig. 5), but differ from tradition by including Calym-
maria (formerly Hahniidae) but excluding Argyroneta
(moved to Dictynidae, see below). The genus Cybaeus
was subject to a revision (Bennett, 1991; unpublished
thesis), revealing several new genera and many new
species. Calymmaria has been revised (Heiss and Dra-
ney, 2004). Like Calymmaria, little-known genera with
patella/tibia autospasy probably belong here as well.
The ecribellate Cryphoeca,Blabomma, Willisus and
Yorima have been associated with Cybaeus and Calym-
maria by Roth and Brame (1972) and Spagna et al.
(2010) and we follow the latter study in classifying
these ecribellate genera in our redefined Cybaeidae.
Hahniidae
This family contains the clearly monophyletic Hah-
niinae with a strongly modified arrangement of spin-
nerets in a single transverse row, here represented by
Hahnia and Neoantistea (Fig. 5).These group with the
austral Cybaeolinae (Cybaeolus), forming a strongly
supported core Hahniidae. In our analysis, the mono-
phyly of the Holarctic Cicurina group with our core
Hahniidae is only moderately supported.
Dictynidae
This group represents a dumping ground for a
diverse array of cribellate and ecribellate three-clawed
Entelegynae. Of the several genera representing Dic-
tynidae in our analysis, Cicurina departs to Hahniidae,
leaving Dictyna,Mallos,Mexitlia and Saltonia in Dic-
tynidae (Fig. 5). We add to these the ecribellate Argy-
roneta (formerly Cybaeidae). Corroborating Zamani
et al. (2016), the intertidal genus Paratheuma also falls
here. All these together form a strongly supported Dic-
tynidae. The cribellate residue of Dictynidae contains
Dictyna, of course, and similar genera such as Mex-
itlia, and Mallos, but the cribellate Lathys is not
clearly placed in any of the above families (Spagna
et al., 2010), but is provisionally kept in Dictynidae.
Toxopidae
We resurrect the family Toxopidae to accommodate
an array of small spiders, typically with strongly
curved eye rows, from Australia and New Zealand. In
addition to the Tasmanian Toxops, a small, flattened
spider with large eyes, typically found running on for-
est vegetation, Toxopidae include the genera Hapona
and Laestrygones from New Zealand, which are simi-
lar in morphology and lifestyle. Also circumscribed in
this family is the tropical Australian genus Midgee,
formerly Amaurobiidae; these together as the subfam-
ily Toxopinae are strongly supported. A second group
of toxopids comprises Lamina,Ommatauxesis,Otagoa
and Myro. The first three are restricted to Australia
and New Zealand but Myro is scattered across sub-
Antarctic islands south of New Zealand and in the
southern Indian Ocean (e.g. Kerguelen, Marion and
the Crozets). Toxopidae might be an austral analogue
of the Dictynidae. Like dictynids, toxopines, e.g. Tox-
ops,Hapona and Midgee, are small hunters on foliage
or in soil, whereas myroines, e.g. Otagoa,Myro and
Ommatauxesis, are largely intertidal. Myroines are
monophyletic in several of our analyses, only varying
in the placement of cf. Gasparia sp. New Zealand
CG105 (occasionally with Desidae, Amphinectinae).
Relationships among the above six families generally
receive extremely weak support and are unstable
across analyses, as is typical in target gene analyses. A
relationship of at least Hahniidae plus Cybaeidae
receives support from phylogenomics; Garrison et al.
(2016) associate Cicurina and Calymmaria, and were
placed by them in Dictynidae and Hahniidae, respec-
tively. In the context of our revised classification, this
is equivalent to uniting Hahniidae and Cybaeidae.
“Austral Cribellates” or the “Fused Paracribellar clade”
Many species of this group are characterized by unu-
sual arrangements of the paracribellar spigots within
the posterior median spinneret (PMS) spinning field,
typically with two to many shafts arising from common
bases—the function of these multi-shaft spigot
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 25
arrangements, as opposed to the more widely encoun-
tered single shaft spigot, is unknown. The “Fused
Paracribellar Clade” was named by Griswold et al.
(1999) and corroborated by Spagna and Gillespie
(2008) (“Austral Cribellates”); this is now known to be
one of the dominant spider clades in the southern
hemisphere, but is represented by only a few invasives
in North America. Of the families previously associated
with the FPC, Agelenidae are here excluded: cribellate
agelenids, e.g. Neoramia, are not related to true Age-
lenidae and phylogenies relying on Neoramia for age-
lenid placement (e.g. Griswold et al., 2005; Blackledge
et al., 2009) are erroneous. We find a weakly supported
group fairly coincident with the FPC clade (Desidae,
Stiphidiidae, newly joined by Cycloctenidae), although
the composition of these families will differ radically
from former classifications (see Taxonomy) (Fig. 5).
Cycloctenidae
In our dataset, the genera Cycloctenus and Toxop-
siella, traditionally placed in Cycloctenidae, group with
high support (Fig. 5). The family may be expanded to
a group with lower support to include Paravoca (for-
merly Amaurobiidae) and Orepukia (formerly Age-
lenidae) plus Pakeha (formerly Amaurobiidae), which
we circumscribe as Cycloctenidae sensu lato. The New
Zealand genera Pakeha and Orepukia are closely
related, and all the cycloctenids in our analysis are
restricted to Australia and New Zealand.
Stiphidiidae
Twelve taxa in our dataset formerly assigned to
Stiphidiidae are distributed among a few families,
rejecting the monophyly of traditional Stiphidiidae.
The newly circumscribed Stiphidiidae recover a well-
supported core Stiphidiidae, comprising the type genus
Stiphidion, together with Therlyna and Procambridgea.
The former Neolanidae Marplesia and Neolana (incor-
rectly synonymized with Amphinectidae; Jocqu
e and
Dippenaar-Schoeman, 2006) group with the former
agelenid Neoramia; these also refer to the core
Stiphidiidae (Neolanidae =Stiphidiidae, new syn-
onymy). Aorangia, a New Zealand genus formerly
attributed to Amphinectidae, is related to core
Stiphidiidae with moderate support (Fig. 5).
Desidae
We recognize a broadly circumscribed Desidae with
weak support (Fig. 5). Classification of the “Austral
Cribellates” or “FPC” remains one of the largest
unsolved family-level problems in spiders, in spite of
30 years of effort, and we leave most uncertainty
within our broad Desidae.
Desis is quite distinct from other genera placed in
this family, and other genera unstably associated near
Desis, i.e. Poaka and Barahna, do so with weak sup-
port. Forster and Wilton (1973) assigned many pre-
existing and new genera to families first recognized
from the northern hemisphere, e.g. Agelenidae or
Amaurobiidae, but the presence of any true Age-
lenidae or Amaurobiidae native to the Australia–New
Zealand region is doubtful. Davies took the most care-
ful approach to classifying her new Australian genera,
placing them with quantitative analyses (Davies, 1990,
1997, 1998), but the shortage of outgroups in most of
her analyses renders the conclusions uncertain. We are
also unable to test another of her discoveries, e.g. the
Kababinae, for which no material was available.
Within our loosely conceived Desidae, we identify at
least five subgroups with stronger support. One could
recognize as families the taxon clusters around Desis,
Amphinecta,Porteria,Metaltella and Paramatachia,
but this risks stranding many genera, particularly
those not treated in our phylogeny, without family
assignment. Instead, we retain the broad Desidae and
treat subgroups as subfamilies.
Subfamily Amphinectinae
We have six exemplars representing four genera,
including Amphinecta, which cluster within Desidae as
Amphinectinae with weak support. All of our exem-
plars, Amphinecta,Mamoea,Paramamoea and Rangi-
tata, are from New Zealand. We obtained the species
cf. Gasparia sp. New Zealand CG105 within
Amphinectinae in the preferred tree, but it falls among
myroines (where Gasparia is currently listed) in the
EW, IW, BI and DO analyses.
Subfamily Metaltellinae
The South American and Australian metaltellines,
formerly attributed to Amphinectidae, but distant
from amphinectines here, are easily recognized by a
unique male palpal conformation. Calacadia and
Metaltella group with high support. The enigmatic for-
mer stiphidiid Ischalea from New Zealand groups near
these, representing Davies’ (1990) Ischaleinae.
Subfamily Matachiinae
Matachia and Paramatachia (our exemplar) are
elongate spiders with large chelicerae sometimes
likened to cribellate Desis. Their genitalia and spin-
ning organs differ greatly from Desis, however. Bad-
umna exhibit genitalia strikingly similar to
Paramatachia, and the other genera that fall here are
also similar. Matachiinae as a whole and all sub-
groups are strongly supported.
26 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Subfamily Porteriinae
Five genera include some striking genital, somatic
and behavioural similarities, regardless of their dis-
parate distribution among families. Porteria (South
America) runs atop its sheet web and the abdomen is
boldly marked with guanine; Corasoides (Australia)
could be a giant version of Porteria, with which they
group with good support. Cambridgea and Nanocam-
bridgea are closely allied, long-legged spiders from
New Zealand that hang beneath their sheet webs. All
four genera mentioned above have a unique configura-
tion of the piriform gland spigot field on the anterior
lateral spigots. Baiami (Australia) also hangs beneath
sheet webs, and shares genital similarities with the
above. The Porteriinae have strong support; Porteria
remains in the Desidae; the other four genera are
transferred here from Stiphidiidae.
Evidence for combining the subfamilies and main
groups of Desidae is weak and unstable across analy-
ses. Scores of genera attributed to Desidae and
Amphinectidae are not included in our dataset, so it
would be premature to suggest finer familial subdivi-
sions. In the Taxonomy section below, we reclassify
several genera, but others we leave where they are
because knowledge of their characters and phyloge-
netic placement remains poor.
Sparassidae
Huntsman spiders are difficult to place even though
they have many synapomorphies (e.g. the fleshy, trilo-
bate metatarsal dorsal tip) and are indisputably mono-
phyletic (Moradmand et al., 2014); except for the
sparianthines (first split in the family), all the rest have
a unique tapetum for acute night vision, as a shiny,
regularly perforated plate (Nørgaard et al., 2008). Phy-
logeny within the family has been investigated using
DNA sequences (Agnarsson and Rayor, 2013; Morad-
mand et al., 2014) and morphology (Rheims, 2007;
unpublished thesis); although our sample of 12 repre-
sentatives is not very extensive, we recover the
Heteropodinae and Deleninae with strong support
(Fig. 6). Morphology places Sparassidae among the
Dionycha (Ram
ırez, 2014) but molecular data are
ambiguous and to date there is no clear association
with other families, Dionycha or not; Moradmand
et al. (2014) found sparassids near the base of the
RTA clade, far from other Dionycha, a result mir-
rored by Agnarsson et al. (2013). Sparassidae, com-
prising 12 exemplars in our analysis, are recovered
with high support. Unconstrained versions of our
analyses occasionally grouped Sparassidae with Amau-
robiinae (Amaurobiidae), but with weak support. In
our constrained analysis, Sparassidae are possibly
related to the combined OC clade and Dionycha,
although this has very weak support as well. Sparassid
placement remains a goal for future studies.
Oval Calamistrum clade and Dionycha
Molecular, morphological and total evidence analy-
ses agree on associating the venerable Dionycha, or
two-clawed spiders, with a more recently discovered
clade (Griswold, 1993) characterized by a calamistrum
with several rows of setae, typically forming a patch,
hence the Oval Calamistrum clade. These spiders have
numerous tarsal and metatarsal trichobothria, sharp-
ening their vibration detection, most have extensive
scopulae at least on the forelegs and usually claw tufts
for feet adherence; and several clades have remarkable
specializations of the eyes as befits fast moving, visu-
ally aware predators. Each clade has good support, i.e.
the OC Clade and the Dionycha, and their sister group
status is strongly supported (Fig. 6); these higher
groups are also obtained in the transcriptomic analysis
of Garrison et al. (2016), but we obtain higher support
values with our target genes without applying a con-
strained skeleton tree (see Figs S6 and S7). This may
be related to the position of Homalonychidae, which
we believe is an artefact of the TR analysis (see
above).
The OC clade
Phylogenetic studies (e.g. Griswold, 1993) have asso-
ciated two remarkable morphologies: a cribellum com-
prising several lines or a patch of modified setae and
an autospasy joint through the bases of the tibia of
males (“male tibial crack”). A series of studies based
on morphology grouped the Lycosoidea, including
Lycosidae, Pisauridae, Oxyopidae and Ctenidae, with
the less known Trechaleidae, Senoculidae and even the
cribellate Psechridae, Tengellidae, Zorocratidae and
Zoropsidae (see Raven and Stumkat, 2005; Piacentini
et al., 2013). A recent total evidence phylogeny (Polo-
tow et al., 2015) differs in some details from our tree:
the findings of Polotow et al. (2015) are used as the
basis for our classification here.
The Udubidae are well supported (Fig. 6); our
exemplars comprise Raecius from Africa and two spe-
cies of Uduba and three of Zorodictyna, all from
Madagascar. For the Zoropsidae, we found good sup-
port for several of the subfamilies as found in Polotow
et al. (2015), but the family as a whole fluctuates
across analyses (Fig. 6). The ecribellate Griswoldiinae,
Griswoldia and Phanotea, from South Africa ally with
strong support. Tengella,Zorocrates and Liocranoides
unite as Tengellinae with strong support; Kilyana and
Uliodon unite as Uliodoninae, again with high support,
to which are allied Austrotengella, forming a moder-
ately supported Australia and New Zealand clade. The
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 27
analyses are unstable for the relationships among these
three subfamilies, the South American Ciniflella and
Zoropsis, and in some of them Udubidae are nested
within Zoropsidae, although with negligible support.
This extends to all the branches near the base of the
OC clade.
Ctenidae are a large, mainly tropical family that has
been persistently hard to circumscribe. Griswold
(1993) made the first quantitative attempt using a few
exemplars, and the first extensive phylogeny was pro-
duced by Silva-D
avila (2003). Polotow et al. (2015)
provided the first analysis including sequence data and
morphology. We find a core Ctenidae of Anahita,Cte-
nus and Phoneutria grouped with high support
(Fig. 6). Ctenidae continues to be a problematic taxon.
Polotow et al. (2015) solved some problems by reveal-
ing that Vulsor,Viridasius and some other genera from
Madagascar are not ctenids at all but belong among
the Dionycha as family Viridasiidae, a result corrobo-
rated here (see below). Other genera traditionally
placed in Ctenidae also fall outside this family. The
model genus Cupiennius here allies with Trechaleidae
with good support, and these together ally with the
Lycosidae, again with strong support. This is similar
to the result from Polotow et al. (2015), with Cupien-
nius allied to Lycosidae and a paraphyletic Pisauridae.
Ancyclometes bogotensis sits alone as sister to the
higher Lycosoidea, but with low support; Ancylometes
placement is unsolved here, except as Lycosoidea, and
its affinities remain another goal for future studies.
The wolf spiders (Lycosidae), fishing and nursery
web spiders (Pisauridae) and lynx spiders (Oxyopidae)
are well known Lycosoidea. Most are cursorial hunters
relying on their excellent eyesight to find prey, but at
least some members of each family construct sheet
webs, which may have evolved in parallel (e.g. Murphy
et al., 2006). Lycosidae, represented by 17 exemplars,
are recovered with good support and in turn are
related with the clade Trechaleoides (Trechaleidae) plus
Cupiennius (“Ctenidae”) (Fig. 6). Sister group to this
clade, with high support, we have Pisauridae, with low
support, which may be divided into three subfamilies,
each with high to good support: Halinae, comprising
Hala and Tolma; Dolomedinae, comprising Bradys-
tichus and Dolomedes; and Pisaurinae, represented here
by Dendrolycosa,Eurychora,Paracladycnis,Pisaura
and Nilus.
The East Asian Psechridae are monophyletic only in
some of our analyses, although with weak support,
and usually ally with Thomisidae (Fig. 6). A grate-
shaped tapetum and oval calamistrum place them in
the OC Clade (Homann, 1971; Griswold, 1993; Gris-
wold et al., 1999, 2005; Agnarsson et al., 2012), but
psechrids possess a bizarre combination of characters:
true claw tufts in addition to a third tarsal claw at all
life stages. All psechrids hang from cribellate sheet
webs (Robinson and Lubin, 1979; Griswold et al.,
2005: fig. 208A, B, D, E). Psechridae monophyly and
placement deserve further study. Male genitalia and
adult web types differ greatly. Psechrid placement was
also dubious for Polotow et al. (2015), with their
exemplar Psechrus placed within a paraphyletic Cteni-
dae, far from the Thomisidae. The more detailed anal-
ysis of Bayer and Sch€
onhofer (2013) also obtained low
support, if any, for the monophyly of psechrids.
Crab spiders (Thomisidae) are well represented in
our analysis with 44 terminals (Fig. 6). All thomisids,
except Borboropactus, group with good support; our
two Borboropactus join these with weaker support, and
then only in the BI, ML and C-ML analyses, resem-
bling the results of Benjamin et al. (2008). We prefer
to keep the more traditional Thomisidae sensu lato
with weak support, but our results are also compatible
with the split of a robust Thomisidae sensu stricto and
a separate Borboropactidae as proposed by Wunder-
lich (2004). We also obtain a strongly supported and
robust Thomisus group, including all genera with few
or no cheliceral teeth, also including the bird-dropping
genus Phrynarachne and the ant-specialists Aphan-
tochilinae as obtained by Benjamin (2011). Our resolu-
tion inside Aphantochilinae is slightly different from
the one obtained by Teixeira et al. (2013) using mor-
phological data, but the conflicting clades are not
strongly supported in either analysis. Of the thomisids
retaining several cheliceral teeth (“stephanopines”), we
obtain a lengthy multinode grade separated by
branches with weak support. Homann (1971) sug-
gested thomisid affinity to Lycosoidea based on their
eye structure (a grate-shaped tapetum as in lycosoids),
but Griswold (1993) discounted Homann’s opinion.
Sequence data settled the placement of crab spiders
among lycosoids (Bayer and Sch€
onhofer, 2013;
Polotow et al., 2015), while the morphological data
were slightly in favour of dionychans (Ram
ırez, 2014).
Here, our data place Thomisidae firmly among the
Lycosoidea.
In addition to the above stated problems with ctenid
circumscription, the families Senoculidae and Oxyopi-
dae are also problematic (Fig. 6). Polotow et al. (2015)
found a monophyletic Oxyopidae, not surprising given
the distinctive eye pattern and spinose legs of the lynx
spiders. Senoculidae (the sole genus Senoculus)
emerged from a long branch within Zoropsidae in
Polotow et al. (2015), a dubious result and one differ-
ent from our current analysis. Here, Senoculus is allied
to some Oxyopidae, a result that harkens back at least
to Griswold (1993). Several of our analyses find Oxy-
opidae diphyletic. Each clade (Tapinillus plus Peucetia
and Oxyopes plus Hamataliwa) is recovered with high
support, but these and Senoculus combine in different
ways and with other lycosoid branches, always with
weak support. It is possible that the long branch of
28 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Senoculus is responsible for instability in the higher
lycosoids.
Dionycha
We obtained a relatively robust Dionycha with mod-
erate support, without the use of the backbone con-
straint (Figs 7 and 8). Some of the larger clades within
dionychans are quite unexpected, and we are cautious
in their interpretation. Three main clades compose
dionychans in our tree: (A) Prodidomidae sensu stricto
(see below) (Fig. 7); (B) a well-supported clade of
Gnaphosoidea sensu lato (herein referred to as Diony-
cha part A), for lack of a better name, roughly equiva-
lent to the morphology-based groupings of
gnaphosoids delineated by Platnick (2002) or the
Claw-Tuft Clasper and the Oblique Median Tapetum
clades (proposed by Ram
ırez, 2014) (Fig. 7); and (C) a
strongly supported large clade (herein referred to as
Dionycha part B) that includes corinnids, jumping spi-
ders and miturgids, among others (Fig. 8). The latter
two clades are united with good support.
Prodidomidae
The first and surprising split of dionychans is the Pro-
didomidae sensu stricto, containing three genera of Pro-
didominae (Prodidomus, Austrodomus and Neozimiris)
and three of Theuminae (cf. Tricongius sp. Argentina
NP18-MR16, Lygromma and Chilongius), all with high
support. The bizarre Australian Molycriinae, here rep-
resented by three species of Molycria and Myandra, fall
distantly from other prodidomids, among other gna-
phosoid-like taxa separated from Prodidomidae sensu
stricto by several branches with high support; molycri-
ines have extremely long ALS placed anteriorly, far
removed from the other spinnerets (Platnick, 1990;
Platnick and Baehr, 2006) (Fig. 7). We defer taxonomic
action until other prodidomids are more adequately
studied, especially Zimiris, which has an intermediate
morphology between prodidomines and molycriines
(Platnick and Penney, 2004), and is also bearer of a
family-level group name.
Dionycha part A
This large clade includes the gnaphosoids, Tracheli-
dae, Phrurolithidae, members of the poorly defined
“Liocranidae” and, most surprisingly, Anyphaenidae
plus Clubionidae (Fig. 7). The linking of these last two
families in a group confirms Platnick’s (1990) suspi-
cions due to their common absence of cylindrical
gland spigots, but their inclusion among “gnapho-
soids” is unexpected. The North American liocranid
Apostenus serves as a link between these two families
and the rest, in a well-supported clade.
Clubionidae
We obtain a strongly supported core Clubionidae
except for the American Elaver, which group with
Anyphaeninae with low support (Fig. 7); we believe
that this is an artefactual result, as the DO analysis
obtains a monophyletic Clubionidae, and Elaver have
many morphological characters in common with clu-
bionines (Ram
ırez, 2014), but a basal placement in the
family seems plausible, as it is the only genus of clu-
bionids that retains a median apophysis on the male
palp (Saturnino and Bonaldo, 2015).
Anyphaenidae
We obtain the family as strongly supported mirroring
the results of Labarque et al. (2015), with a well-sup-
ported Anyphaeninae and Amaurobioidinae, and Josa
as a basal split in Amaurobioidinae (Fig. 7). Our larger
sample of outgroups allowed the detection of a remark-
able morphological convergence in the Chilean Male-
nella nana, the sole representative of Malenellinae,
hereby transferred to Macrobuninae (Amaurobiidae).
Trachelidae
We obtain trachelids together but with weak support,
probably due to two terminals floating nearby through
the different analyses; one of them is Cithaeron, the only
representative of Cithaeronidae, and the other is an
unidentified Liocranidae from the Dominican Republic
(Fig. 7). We obtain the minute soil dweller Orthobula
deep inside Trachelidae, a possibility considered by
Ram
ırez (2014) as suboptimal but still plausible; a re-
examination of the foot morphology of Orthobula cal-
ceata revealed that they have the claw lever file projec-
tions interlocking with the claw tuft bases, uniquely
found in some trachelids (Ram
ırez, 2014: character 171
and fig. 76D). With this evidence, we thus transfer the
genus Orthobula from Phrurolithidae to Trachelidae.
Phrurolithidae
We obtained strong support for the family after the
removal of Orthobula to Trachelidae, although our sam-
pling is limited to two genera from North America and
South East Asia (Scotinella and Otacilia, respectively).
We confirm also that the Teutamus group, here repre-
sented by Teutamus and Sesieutes and joined with high
support, are not phrurolithids, although its family associ-
ation remains to be solved with a better sampling (Fig. 7).
Liocranidae
We were unable to get suitable samples of the South
European Liocranum. Of our five representatives, one
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 29
is very unstable (Liocranidae sp. Dominican Republic
MR160), two are species of the North American Apos-
tenus, linked with good support to Anyphaenidae plus
Clubionidae, and two are species of the Malagasy
Donuea, which remain mysterious and only loosely
associated to a few rogue terminals in Dionycha part
B. Liocranids are poorly defined and are a target for
future research (Fig. 7).
Gallieniellidae, Trochanteriidae and Lamponidae
We obtain a core group of the Malagasy Gallieniella
and Legendrena with strong support (Fig. 7), but the
Australian gallieniellids Neato and Meedo are grouped,
also with high support, with five Australian
trochanteriids (Trachycosmus,Desognaphosa,Rebilus,
Platorish and Morebilus). These trochanteriids are in
turn isolated from other Australian (Tinytrema),
American (Doliomalus) and South African (Platyoides)
genera placed in Trochanteriidae. Most trochanteriids
are extremely flat bark-dwellers, but this is a syndrome
that has occurred many times in spider phylogeny pro-
ducing remarkable convergences, including the gna-
phosid Hemicloea (see below). Ram
ırez (2014) already
detected at least two unrelated groups of “trochanteri-
ids” using morphological data. Our results are in par-
tial agreement with this, in having the Australian
trochanteriids in a basal split, and the African and
South American genera more closely associated to
Gnaphosidae, but otherwise gnaphosoids are quite
mixed up. This is another target of future research,
especially after the name-bearer genus Trochanteria is
better studied. Our three lamponid representatives
(Lampona,Centrothele and Asadipus) fall nearby but
not together.
Ammoxenidae
We did not retrieve the South African ammoxenids
Rastellus and Ammoxenus in a monophyletic group
[Ram
ırez (2014) did not find morphological support
for ammoxenid monophyly either], but obtain them
nested within gnaphosids, together with Eilica and
Asemesthes although with weak support (Fig. 7). This
is biologically interesting; Asemesthes are sand-dwell-
ing spiders, as are Rastellus and Ammoxenus, and Eil-
ica are specialized feeders on ants, while Rastellus and
Ammoxenus specialize on termites.
Gnaphosidae
We included 14 genera placed in Gnaphosidae, with
a wide geographical and morphological breadth
(Fig. 7). Our results are daunting, as they are all
involved in weakly supported, unstable groups, mixed
with other gnaphosoid families. The three Hemicloea
species, all flat bark dwellers from Australia, are joined
with moderate support with Intruda, a typical gnapho-
sid from Australasia, thus confirming the placement
suggested by their gland spigot morphology (Platnick,
1990). It seems that Gnaphosidae will have to be pro-
foundly reorganized, but this will have to wait for a
better taxon and character sampling. A comprehensive
morphological phylogenetic assessment of gnaphosids
and their kin is underway (G. Azevedo, pers. comm.).
Dionycha part B
This clade includes the Salticidae, Philodromidae,
Eutichuridae, Miturgidae, Corinnidae, Selenopidae,
Viridasiidae and the new family Xenoctenidae. The
group is strongly supported and robust, even if not
constrained by the transcriptomic backbone (only rep-
resented by the salticid Habronattus in the study of
Garrison et al., 2016). The internal relationships
among families have, however, weak support and are
unstable (Fig. 8).
Salticidae
Jumping spiders are well supported and robust
(Fig. 8). Our results agree in general with those of
Maddison and collaborators for the family (see
Maddison et al., 2014, 2016; Maddison, 2015), using
a larger taxon sampling and more markers. The
three subfamilies Lyssomaninae, Onomastinae and
Asemoninae are joined in an unstable group with
low support. The Spartaeinae and a clade of
Hisponinae plus Salticinae are strongly supported,
although we did not recover the Hisponinae, proba-
bly because of shallow taxon sampling (Hispo joins
the Salticinae, leaving Massagris behind). The sister
group to salticids is, unfortunately, not solved by
our analyses and will remain a subject of future
studies.
Philodromidae
The family is strongly supported and robust (Fig. 8).
We recover the tribe Thanatini with good support,
represented by Tibellus and Thanatus, sister to a group
of all other philodromids with moderate support, but
this is unstable and does not agree well with the mor-
phological analysis of Muster (2009). The two Hawai-
ian endemics Pedinopistha and Pagiopalpus are
together with good support, thus suggesting a single
colonization event to the islands.
Eutichuridae
A core Eutichuridae is retrieved with strong support
and robustness; the entire family including Eutichurus,
30 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
however, is only retrieved in the BI analysis and the
MUSCLE alignments (EW, IW), with very low sup-
port; in DO and ML Eutichurus floats around a few
rogue terminals of unclear affiliation (see the Prono-
phaea group). Four species of Cheiracanthium group
with strong support (Fig. 8).
Xenoctenidae
We reproduce previous morphological results of Silva-
D
avila (2003) and Ram
ırez (2014) by obtaining a strongly
supported clade of three lycosoid-looking genera with a
distal division in the tegulum of the male copulatory bulb
(Xenoctenus,Odo,Paravulsor). These were previously
assigned to Zoridae and Miturgidae for lack of a better
affiliation (see the Xenoctenus group in Ram
ırez, 2014).
This analysis has a wide taxonomic coverage allowing us
to formalize the new family here (Fig. 8).
Viridasiidae
A core Viridasiidae is obtained with strong support,
and resting among the Dionycha, confirming the
results of Polotow et al. (2015) for this recently
established Malagasy family (Fig. 8). We included an
undescribed genus from Madagascar (Viridasiidae
sp. Madagascar CG28) that is probably allied to the
family as well.
Selenopidae
The flatties, or Selenopidae, are well supported, with
two to three successive basal splits from Africa and
Madagascar (Anyphops,Hovops,Garcorops); the remain-
ing terminals in our analysis are three American Selenops
species (Fig. 8). This is in agreement with the much more
detailed findings of Crews and Gillespie (2010).
Miturgidae
The family is retrieved with weak support, probably
because of several rogue terminals of unclear associa-
tion (see below). Two genera of former zorids (Zora,
Argoctenus) plus a zorid-like undescribed genus
(Miturgidae sp. Queensland MR629) are grouped as
sister to three Australian miturgines (Miturga,Mit-
uliodon,Nuliodon). The American miturgines Teminius
and Syspira are on a basal split. According to our
results, the enigmatic African genus Parapostenus
could be a miturgid or a viridasiid (ML and BI analy-
ses, respectively) (Fig. 8).
Corinnidae
We included a good breadth of Corinnidae (21 rep-
resentatives of 20 genera), and recovered the family as
a group, confirming its separation from the Tracheli-
dae and Phrurolithidae as proposed by Ram
ırez
(2014). Corinnidae are obtained with weak support;
the subfamily Castianeirinae, well known from the
many ant-mimicking genera, is moderately supported,
and the recently described genus Allomedmassa is sug-
gested as its sister group. Although the details differ,
we confirm the findings of Haddad (2013) that the
non-ant-mimicking castianeirines (Copa sp. MR46 and
Echinax, in our dataset) have derived from an ant-
mimicking ancestor through loss of myrmecomorphy
(Fig. 8).
The “Pronophaea” group
A few corinnid-looking genera retaining a median
apophysis on the male copulatory bulb were loosely
grouped in the Pronophaea group by Ram
ırez (2014),
although it is not clear that they are all closely related
to each other. In that study, it was rejected that they
were basal corinnids, as proposed before by Bonaldo
(1997) and Ram
ırez et al. (2001). We include here two
species of Pronophaea,twoofDonuea, and one each
of Olbus and Carteronius. The congeners grouped with
high support, but besides a weak but consistent group-
ing of Donuea with Pronophaea (all analyses except
EW) and sometimes also Olbus (BI), our study only
indicates that they belong to the Dionycha part B
(Fig. 8); solving their affiliation remains a future goal.
Taxonomy
Family Agelenidae C. L. Koch, 1837
Type genus Agelena Walckenaer, 1805 (type species
Araneus labyrinthicus Clerck 1757).
Diagnosis. RTA clade spiders with a divided
colulus, i.e. with two separate patches of hairs, and, in
most species, PLS with the apical segment pointed and
greater than or equal to the length of the basal; the
cribellate genus Tamgrinia may be recognized by
details of the genitalia, as presented by Wang (2000).
Composition. The WSC (2016) lists 73 genera and
1195 species in this family. As discussed below, it is
unlikely that 13 genera and nearly 100 species endemic
to Australia and New Zealand truly belong here, but
even discounting these, the more than 1000 species
distributed across Africa and the Holarctic region
make this one of the largest families of spiders.
Remarks. Lehtinen (1967) noted that the presence of
a divided colulus, i.e. with two separate patches of
hairs, allows recognition of the family. This bifid
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 31
colulus serves as an agelenid synapomorphy (Lehtinen,
1967; Spagna and Gillespie, 2008; J. Miller et al.,
2010) for the taxa represented in this study and
include Ageleninae, Textricinae, Tegenariinae and
Coelotinae. As pointed out by J. Miller et al. (2010)
and in this study, at least the New Zealand Neoramia,
a cribellate “agelenid” exemplar (Griswold et al., 2005;
Blackledge et al., 2009), is not an agelenid; other
austral agelenid genera may also be misplaced. At
least 13 genera, most described by Forster and Wilton
(1973), are recorded as endemic to New Zealand
(WSC, 2016). These authors note that “the ecribellates
... do not possess a divided colulus. The colulus is
then a more or less triangular structure, and the hairs
are not separated into two bunches” (Forster and
Wilton, 1973: 11). Absence of the agelenid
synapomorphy, plus placement elsewhere by our study
for some of the New Zealand genera, e.g. Neoramia to
Stiphidiidae, Orepukia to Cycloctenidae, suggests that
none of the New Zealand genera may belong in true
Agelenidae. We defer transfer of these genera to other
families until they can be studied in more detail, and
preferably with molecular data.
Family Amaurobiidae Thorell, 1870 (new
circumscription)
Type genus Amaurobius C. L. Koch, 1837 (type spe-
cies Aranea fenestralis Str€
om 1768).
Diagnosis. This diverse and probably non-
monophyletic taxon is difficult to diagnose. All are
entelegyne Araneomorphae in the RTA clade, and
most have male palpal tibial processes in addition to
the RTA (Griswold et al., 2005). Amaurobiinae have a
“pseudocalamistrum”, a row of prominent setae
adjacent and parallel to the calamistrum (Lehtinen,
1967; Jocqu
e and Dippenaar-Schoeman, 2006: fig. 8f).
Macrobuninae have several teeth on the retromargin
of the cheliceral fang furrow, reduced anterior median
eyes in most species, and many have enlarged male
palpal tibiae, some with an internal gland and/or a
tibia/cymbium stridulation mechanism. The monotypic
subfamilies Arctobiinae and Ovtchinnikoviinae may be
diagnosed by characters of the included genus of each.
Altellopsinae might be recognized by characters of the
female genitalia (Lehtinen, 1967: 334), although this
group remains poorly known.
Composition. Five subfamilies remain in
Amaurobiidae: Altellopsinae (South America),
Amaurobiinae (Holarctic), Arctobiinae (Holarctic),
Macrobuninae (Africa, Australia, South America and
Western North America) and Ovtchinnikoviinae
(western Palearctic).
Remarks. Amaurobiidae remain problematic in spite
of continuing phylogenetic and taxonomic progress.
Of the nine subfamilies (Altellopsinae, Amaurobiinae,
Desinae, Macrobuninae, Matachiinae, Metaltellinae,
Phyxelidinae, Rhoicininae and Stiphidiinae) listed by
Lehtinen (1967: 321), only three remain: Altellopsinae,
Amaurobiinae and Macrobuninae. To these have
subsequently been added Arctobiinae, Midgeeinae and
Ovtchinnikoviinae. The enigmatic Altellopsinae
Lehtinen, 1967 is too poorly known to diagnose or
even confirm as an amaurobiid, whereas affinities of
the Arctobiinae and Ovtchinnikoviinae remain to be
tested: we provisionally leave them here for lack of a
better alternative. The Macrobuninae are discussed in
detail below. Our results suggest that some of Forster
and Wilton’s (1973) austral amaurobiid genera are
misplaced: we move Pakeha and Paravoca to
Cycloctenidae and Poaka to the Desidae. Ischalea
(from Stiphidiidae) is transferred to Desidae
Ischaleinae: our phylogeny places Ischalea within
Desidae near Metaltellinae. Davies (1990: 102)
suggested that Ischalea,Bakala and Manjala form the
Ischaleinae. Although the latter genera are listed in
Amaurobiidae (WSC, 2016) we transfer all to Desidae
Ischaleinae. Midgee and Jamara [placed in
Amaurobiidae, Midgeeinae by Davies (1995: 93)] are
here transferred to Toxopidae Toxopinae. Pending
resolution of the taxonomic situation for
Macrobuninae, there may be no true amaurobiids
native to the southern hemisphere. See below for a
discussion of Macrobuninae, including the new
synonyms Tasmarubriinae (Amphinectidae),
Malenellidae (Anyphaenidae) and Chummidae.
Subfamily Macrobuninae Lehtinen, 1967
Type genus Macrobunus Tullgren, 1901 (type species
Myro backhauseni Simon, 1896).
Malenellinae Ram
ırez, 1995. Type genus Malenella
Ram
ırez, 1995 (Type species Malenella nana Ram
ırez,
1995). New synonymy.
Chummidae Jocqu
e, 2001. Type genus Chumma
Jocqu
e, 2001 (type species Chumma inquieta Jocqu
e,
2001). New synonymy.
Tasmarubriinae Davies, 2002. Type genus Tas-
marubrius Davies, 1998 (type species Rubrius milvinus
Simon, 1903). New synonymy.
Diagnosis. Entelegyne RTA clade spiders with a
single row of tarsal trichobothria distinguished by the
presence of denticles on the cheliceral retromargin
(Almeida-Silva et al., 2015: fig. 2E), an oblique
cheliceral groove (e.g. Griswold et al., 2005: 231;
fig. 130G, I) and reduced anterior median eyes
(Almeida-Silva et al., 2015: figs 1A, 2A–B).
32 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Composition. Macrobuninae comprise taxa from
Australia, western North America, South Africa and
South America. Currently included are Anisacate,
Auximella,Callevopsis,Cavernocymbium,Chresiona,
Chumma,Emmenomma,Hicanodon,Livius,Macrobunus,
Malenella,Naevius,Neoporteria,Obatala,Parazanomys,
Pseudauximus,Retiro,Rubrius,Tasmarubrius,Tas-
mabrochus,Teeatta,Urepus,Yupanquia and Zanomys.
Remarks. Lehtinen (1967: 333) recognized the
distinctness of a group of genera related to Macrobunus.
Compagnuci and Ram
ırez (2000) discovered a gland in
the male palpal tibia of Anisacate,Emmenomma and
Naevius, and Griswold et al. (2005) noted a stridulatory
area on the retrobasal area of the cymbium of
Anisacate,Emmenomma,Macrobunus and Rubrius,
comprising characters that may be useful in outlining
the phylogeny of the group. J. Miller et al. (2010)
treated the macrobunine Chresiona in a molecular
phylogeny and found Chresiona to fall far from the core
amaurobiids, represented by Amaurobius,Callobius and
Pimus, and also found the South African Chumma and
North American Cavernocymbium and Zanomys closely
allied to Chresiona. Although noting the distinctness
from the core Amaurobiidae, no taxonomic changes
were made. Malenella, formerly Anyphaenidae, and
Tasmarubrius, formerly Amphinectidae, are newly
transferred here. Macrobunine placement and
taxonomy are currently under study by Almeida-Silva
(pers. comm.), who has provided diagnostic characters
and putative synapomorphies (Almeida-Silva, 2013;
unpublished thesis; Almeida-Silva et al., 2014, 2015).
Macrobuninae is provisionally kept in Amaurobiidae.
Family Cybaeidae Banks, 1892 (new circumscription)
Type genus Cybaeus L. Koch, 1868 (type species
Amaurobius tetricus C. L. Koch, 1839).
Cryphoecinae Lehtinen, 1967. Type genus Cryphoeca
Thorell, 1870 (type species Tegenaria silvicola C. L.
Koch, 1834). New synonymy.
Diagnosis. Araneomorphs with three claws and
branched tracheae; most have an apophysis on the
male palpal patella in addition to the RTA.
Composition. This family comprises several genera
from the Holarctic, and especially genera endemic to
North America. The family Cybaeidae has been
revised in North America (Bennett, 1991; unpublished
thesis; Bennett et al., 2016).
Remarks. Our exemplars include Cybaeus and
Calymmaria, the latter transferred here from
Hahniidae. Closely related to Cybaeus are Cybaeina,
Cybaeota and Cybaeozyga (Lehtinen, 1967; Bennett,
1991; unpublished thesis). Calymmaria has a peculiar
form of autospasy, with a break through the leg
patellae: this was recognized by Roth and Brame
(1972), who considered this a synapomorphy for a
group of several poorly known genera. Following their
suggestion, we include other genera with patellar
autospasy: Cryphoeca,Ethobuella and Willisius (from
Hahniidae) and Blabomma and Yorima (from
Dictynidae) are here transferred to Cybaeidae. Based
on our results and those of J. Miller et al. (2010) and
Spagna et al. (2010), we transfer Argyroneta from
Cybaeidae to Dictynidae.
Family Cycloctenidae Simon, 1898 (new
circumscription)
Type genus Cycloctenus L. Koch, 1878 (type species
Cycloctenus flaviceps L. Koch, 1878).
Diagnosis. Araneomorphae with three claws, simple
posterior tracheae, a complex RTA and a hyaline
conductor on the male palp. At least Cycloctenus and
Toxopsiella have a strongly recurved anterior eye row,
and Cycloctenus a laterigrade habitus, resembling
Ctenidae.
Composition. All the classic and newly assigned
genera occur in New Zealand and Australia.
Remarks. Our exemplars comprise the classic
(Lehtinen, 1967; Forster and Wilton, 1973) cycloctends
Cycloctenus and Toxopsiella. To these we add
Orepukia (from Agelenidae) and Pakeha and Paravoca
(from Amaurobiidae). There may be other taxa
currently placed in Agelenidae and Amaurobiidae that
more appropriately conform to Cycloctenidae.
Family Desidae Pocock, 1895 (new circumscription)
Type genus Desis Walckenaer, 1837 (type species
Aranea maxillosa Fabricius 1793).
Amphinectidae Forster and Wilton, 1973. Type
genus Amphinecta Simon, 1898 (type species Amphi-
necta decemmaculata Simon, 1898). New synonymy.
Diagnosis. Araneomorphae with three claws, tarsal
trichobothria, cribellate or ecribellate. Our
phylogenetic concept brings together a diverse set of
spiders, including some with simple and some with
complex, branched posterior tracheae. The male
palpal tibia of most included taxa has a complex
RTA, with several separate processes (Matachiinae)
or separate distal and proximal processes
(Metaltellinae and many Amphinectinae). The
included subfamilies have strong diagnostic
characters, e.g. the peculiar palpal bulbs of
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 33
metaltellinaes and matachiines and narrowed piriform
gland spigot field on the ALS of Porteriinae.
Composition. In addition to Desis, which occur
worldwide on tropical seacoasts, our Desidae occur in
Australia and New Zealand and nearby parts of Asia
and in southern South America. We recognize Desis
and the subfamilies Metaltellinae, Matachiinae,
Amphinectinae, Ischaleinae and Porteriinae (new rank).
Remarks. Our dataset includes numerous exemplars
that we group together in our enlarged Desidae. In
addition, we follow the suggestions of authors to include
presumed close relatives of our exemplars. Desis,which
branches basally in our enlarged Desidae, is the most
divergent genus: we could establish it as a monotypic
family and retain (Amphinectidae) or establish family
rank for the several related subfamilies, e.g.
“Metaltellidae” and “Porteriidae”, but the low support
values for the basal branches and numerous additional
taxa not treated give us pause, and we feel the most
cautious and conservative approach is to recognize a
large, polythetic Desidae. On our tree, Desis is close to
Poaka, which is transferred from Amaurobiidae to
Desidae. Our exemplars include the former amphinectids
Amphinecta,Mamoea,Maniho,Paramamoea and
Rangitata;alongwithManiho, as suggested by Forster
and Wilton (1973), these are placed in Desidae
Amphinectinae. Our phylogeny also places Barahna in
Desidae Amphinectinae, transferred from Stiphidiidae.
Our exemplars of Amphinectidae Metaltellinae
(Calacadia and Metaltella) form a group transferred to
Desidae Metaltellinae; to these we add Austmusia,
Buyina,Cunnawarra,Jalkaraburra,Keera,Magua,
Penaoola and Quemusia, following the classification of
Davies (1998). Ischalea falls near the metaltellines: we
transfer this genus from Stiphidiidae, along with Bakala
and Manjala from Amaurobiidae, to comprise Desidae
Ischaleinae (Davies, 1990: 102). Our exemplars Goyenia,
Badumna, Matachiinae sp. Queensland CG275 and
Paramatachia form a group; to these we add Matachia,
Notomatachia and Nuisiana, following Forster (1970) and
Griswold et al. (1999, 2005), to comprise the Desidae
Matachiinae. Finally, to the Chilean desid genus
Porteria,weaddBaiami,Cambridgea,Corasoides and
Nanocambridgea from Stiphidiidae to comprise Desidae
Porteriinae, a group first recognized by Lehtinen (1967,
as Porteriini) and that is currently under study (Morrill,
2014; unpublished thesis).
Family Dictynidae O. Pickard-Cambridge, 1871 (new
circumscription)
Type genus Dictyna Sundevall, 1833 (type species
Aranea arundinacea Linnaeus 1758).
Diagnosis. Araneomorphae with three claws and
branched median tracheae; cribellate or ecribellate. All
have a characteristic male palpus: the conductor is
fleshy, and embraces the embolus, and the conductor
apex extends proximally along the retrolateral side of
the cymbium.
Composition. A worldwide taxon of cribellate web
builders; ecribellates appear to be associated with
water or former wet places, i.e. Argyroneta,Saltonia
and Paratheuma.
Remarks. The family Dictynidae has long been a
receptacle for a miscellany of cribellate and ecribellate
RTA clade spiders. Cribellate Dictynidae are easy to
recognize and seem to be a natural group: all have the
characteristic male palp, and many males have
chelicerae that are concave medially. With our transfer
of many ecribellates to other families, e.g. of
Blabomma and Yorima to Cybaeidae, Dictynidae
become more consistent and the remaining ecribellate
genera also have the characteristic male palp. Spagna
and Gillespie (2008), J. Miller et al. (2010) and Spagna
et al. (2010) have explored the molecular phylogenetics
of the RTA clade and our results corroborate many of
theirs. We find support for inclusion of Saltonia and
Paratheuma, and based on our results and those of J.
Miller et al. (2010) and Spagna et al. (2010),
Argyroneta is transferred from Cybaeidae to
Dictynidae. The cribellates Mexitlia,Dictyna and
Mallos fall in the Dictynidae; Lathys also groups here
but with little support.
Family Hahniidae Bertkau, 1878 (new circumscription)
Hahniidae Bertkau, 1878. Type genus Hahnia C. L.
Koch, 1841 (type species Hahnia pusilla C. L. Koch,
1841).
Diagnosis. Araneomorphae with three claws, an
RTA and in many species a process on the patella as
well; typical Hahniinae have the spinnerets in one
transverse row.
Composition. Hahniinae are worldwide; Cybaeolinae
(Cybaeolus) are endemic to southern South America;
Cicurina is Holarctic.
Remarks. Our dataset includes the hahniid
exemplars Hahnia and Neoantistea (Hahniinae),
Cybaeolus (Cybaeolinae) and Calymmaria
(Cryphoecinae). We find that the Hahniinae and
Cybaeolinae are valid members of Hahniidae, but
that Calymmaria, along with Cryphoeca,Ethobuella
and Willisius, must be transferred to Cybaeidae (see
34 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
above and J. Miller et al., 2010). Cicurina, also in
our dataset, is transferred from Dictynidae to
Hahniidae.
Family Pacullidae Simon, 1893 (restored status)
Type genus Paculla Simon, 1887 (type species
Phaedima granulosa Thorell, 1881).
Pacullinae, Lehtinen, 1981.
Diagnosis. Ecribellate, three-clawed Synspermiata
with six eyes, similar to Tetrablemmidae by the
abdomen with dorsal and ventral scuta and laterally
with thin, sclerotized strips or lines of platelets,
distinguished from those by the much larger size
(greater than 5 mm length), heavily rugose cuticle
and by lacking a pair of large membranous
receptacles in the female genitalia (Shear, 1978;
Lehtinen, 1981).
Composition. Four genera, all from Southeast Asia:
Paculla,Perania,Lamania and Sabahya (Lehtinen,
1981; WSC, 2016).
Remarks. Our matrix includes the paculline
exemplars Paculla sp., Lamania sp. and Perania
nasuta, which form a family group distinct from the
tetrablemmines and sister to the Diguetidae within the
“lost tracheae clade” (Diguetidae, Pacullidae,
Plectreuridae and Tetrablemmidae).
Family Stiphidiidae Dalmas, 1917 (new circumscription)
Type genus Stiphidion Simon, 1902 (type species
Stiphidion facetum Simon, 1902).
Neolanidae Forster and Wilton, 1973. Type genus
Neolana Forster and Wilton, 1973 (type species Ixeuti-
cus dalmasi Marples, 1959). New synonymy.
Diagnosis. Three-clawed RTA clade araneomorphs
with a simple posterior respiratory system of four
tubes that may be cribellate or ecribellate; cribellates
have PMS paracribellars with multiple shafts arising
from single, enlarged bases. A comprehensive
diagnosis is not yet possible, but potential diagnoses
are made in the original descriptions of the subfamilies
Borralinae, Kababinae and Neolaninae and by the
characters of included genera.
Composition. Stiphidiidae incertae sedis comprise
Aorangia,Neoramia,Procambridgea and Stiphidion;
Neolaninae comprise Marplesia and Neolana;
Borralinae comprise Borrala,Couranga,Elleguna,
Jamberoo,Karriella,Pillara and Therlinya;
Kababinae comprise Carbinea,Kababina,Malarina
and Wabua.
Remarks. Lehtinen (1967: 331) placed the group as a
subfamily of Amaurobiidae; Forster and Wilton (1973:
128) raised them to family. Our phylogeny suggests
several changes in stiphidiid composition: Neoramia
(from Agelenidae) and Aorangia,Marplesia and Neolana
(from Amphinectidae) transferred to Stiphidiidae;
Baiami,Cambridgea,Corasoides and Nanocambridgea
transferred to Desidae Porteriinae, where they are closely
related to Porteria (Morrill, 2014; unpublished thesis);
Ischalea is transferred to Desidae Ischaleinae. Our matrix
includes the incertae sedis genera Aorangia,Neoramia,
Procambridgea,Stiphidion;Marplesia and Neolana from
the Neolaninae; and Therlinya from the Borralinae. We
use the discussion of Gray and Smith (2008) to place the
other borraline genera, and also to associate Kababinae
with Borralinae.
Family Tetrablemmidae O. Pickard-Cambridge, 1873
(new circumscription)
Type genus Tetrablemma O. Pickard-Cambridge,
1873 (type species Tetrablemma medioculatum O. Pick-
ard-Cambridge, 1873).
Diagnosis. Ecribellate, three-clawed Synspermiata
with six to no eyes, similar to Pacullidae by the
abdomen with dorsal and ventral scuta and laterally
with thin, sclerotized strips or lines of platelets,
distinguished from those by the much smaller size (less
than 3 mm length), smooth cuticle and by having a
pair of large membranous receptacles in the female
genitalia (Shear, 1978; Lehtinen, 1981).
Composition. Twenty-seven genera scattered across
the tropical parts of the world: Ablemma,Afroblemma,
Anansia,Bacillemma,Borneomma,Brignoliella,
Caraimatta,Choiroblemma,Cuangoblemma,
Fallablemma,Gunasekara,Hexablemma,Indicoblemma,
Lehtinenia,Maijana,Mariblemma,Matta,Micromatta,
Monoblemma,Pahanga,Rhinoblemma,Shearella,
Sinamma,Singalangia,Singaporemma,Sulaimania,
Tetrablemma (Lehtinen, 1981; WSC, 2016).
Remarks. Our matrix includes the tetrablemmine
exemplars Indicoblemma monticola,Tetrablemma
thamin and Shearella browni, which form a family
group distinct from the pacullines and sister to the
remaining families of the “lost tracheae clade”
(Plectreuridae, Diguetidae and Pacullidae).
Family Toxopidae Hickman, 1940 (restored status)
Type genus Toxops Hickman, 1940 (type species
Toxops montanus Hickman, 1940).
Toxopidae Hickman, 1940 (included in Desidae by
Forster and Wilton, 1973).
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 35
Midgeeinae Davies, 1995 (included in Amauro-
bioidea). Type genus Midgee Davies, 1995 (type spe-
cies Midgee binnaburra Davies, 1995). New synonymy.
Diagnosis. Three-clawed RTA clade cribellate
(Jamara) or ecribellate Araneomorphae with highly
branched posterior median tracheae. Toxopines are
small spiders, many laterigrade, that have a T-shaped
conductor on the male palp. Many have strongly
recurved or procurved eye rows; at least Midgee,
Jamara and Laestrygones have a stout seta on the
anterior face of the paturon; Laestrygones and Toxops
have a patch of scales anterior to the posterior
tracheal spiracle. Myroines may have strongly
procurved eye rows (Myro and Ommatauxesis);
all have vulvae with slender, convoluted copulatory
ducts.
Composition. Two subfamilies, Toxopinae (Hapona,
Jamara,Laestrygones,Lamina,Midgee,Toxops and
Toxopsoides) and Myroinae (Gasparia,Gohia,Hulua,
Neomyro,Myro,Ommatauxesis and Otagoa), occur in
Australia and New Zealand. Myro also occurs on
subantarctic islands around the Southern Ocean.
Remarks. Myro,Ommatauxesis and Otagoa (all from
Desidae) group together in our phylogeny, far from the
taxa that we place in Desidae. Gasparia groups among
the Desidae in the ML trees, but with myroines in most
other analyses. Forster (1970) associated Gasparia with
Myro, and we follow his suggestion. Forster (1970) also
placed Gohia,Hulua and Neomyro near Myro (in
Myroninae, sic.). Gasparia,Gohia,Hulua,Neomyro,
Myro,Ommatauxesis and Otagoa (all from Desidae) are
transferred to Toxopidae Myroinae. Our exemplars
include Toxops,Hapona,Laestrygones and Lamina,
which fall together in a group with the Australian
amaurobiid Midgee. We transfer Midgeeinae (Midgee
plus Jamara) from Amaurobiidae and Hapona,
Laestrygones,Lamina,Toxops and Toxopsoides, all
from Desidae, to Toxopidae Toxopinae.
Family Trachelidae Simon, 1897 (new circumscription)
Diagnosis. Trachelids are similar to prurolithids in
having claw tufts arising from a non-articulated area
of the distal tarsi, made of heavily folded setae, tarsal
claws with a claw tuft clasper and reduced leg
spination especially on posterior legs and dorsally on
all femora, and lacking a median apophysis on the
male copulatory bulb. Most trachelids (except
Orthobula) can be distinguished by lacking a ventral
distal hook on the male palpal femur. Most trachelids
have also uniquely shaped bases of the claw tuft setae,
in the form of rectangular blocks, and frequently the
claw lever file projections interlock with the claw tuft
bases. With a few exceptions such as Orthobula and
Spinotrachelas, most of the trachelid species lack
macrosetae altogether, and the males have leg cusples.
Composition. Afroceto,Cetonana,Fuchiba,Fuchi-
botulus,Meriola,Metatrachelas,Orthobula,Paccius,
Paratrachelas,Patelloceto,Planochelas,Poachelas,
Spinotrachelas,Thysanina,Trachelas,Trachelopachys
and Utivarachna.
Remarks. Orthobula is transferred from
Phrurolithidae to Trachelidae.
Family Phrurolithidae Banks, 1892 (new
circumscription)
Diagnosis. Phrurolithids are similar to trachelids in
having claw tufts arising from a non-articulated area
of the distal tarsi, made of heavily folded setae, tarsal
claws with a claw tuft clasper and reduced leg
spination especially on posterior legs and dorsally on
all femora, and lacking a median apophysis on the
male copulatory bulb. They can be distinguished by
having ventral modifications on the male palpal femur,
especially a ventral median apophysis and usually a
ventral apical hook. Phrurolithids (except Drasinella)
have a globose, often flexible receptacle on the female
internal genitalia, in addition to the primary and
secondary spermathecae (this receptacle is also present
in the trachelid Orthobula). Phrurolithids differ from
most trachelids by having several pairs of ventral
macrosetae on the anterior tibiae, and by lacking
characters unique to trachelids (projections of the claw
lever file interlocking with claw tuft bases, expanded
bases of the claw tuft setae).
Composition. Abdosetae,Dorymetaecus,Drassinella,
Liophrurillus,Otacilia,Phonotimpus,Phrurolinillus,
Phrurolithus,Phruronellus,Phrurotimpus,Piabuna,
Plynnon and Scotinella.
Remarks. Orthobula is transferred from
Phrurolithidae to Trachelidae.
Family Xenoctenidae Ram
ırez and Silva-D
avila, new
family
Type genus Xenoctenus Mello-Leit~
ao, 1938 (type
species Xenoctenus unguiculatus Mello-Leit~
ao, 1938) by
present designation.
Xenoctenus group, Ram
ırez, 2014.
Diagnosis. Xenoctenids are similar to viridasiids and
some miturgids by having the eyes in two recurved
rows and with grate-shaped tapetum in the indirect
eyes, two claws and well-developed scopulae and
36 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
sometimes claw tufts, but can be distinguished by
having a distal division in the tegulum of the male
copulatory bulb, in the region where the embolus
arises.
Composition. Xenoctenus,Odo,Paravulsor and
Incasoctenus, all South and Central American.
Remarks. The group was already distinguished as
deserving family-level status by Silva-D
avila (2003), and
later confirmed by Ram
ırez (2014) as the ‘Xenoctenus
group’; both authors identified the tegular distal division
at the embolar base as a synapomorphy (see Ram
ırez,
2014: character 343). This analysis confirmed with high
support that Xenoctenidae are members of Dionycha.
The closer relatives to xenoctenids are, however,
uncertain in this and previous analyses, but their
monophyly is well supported by all these analyses.
Summary
The present paper is the culmination of years of
intensive research on spider systematics and, although
mainly based on the findings of the spider AToL pro-
ject, also summarizes relevant findings from the last
decade of systematic studies of that group. Our results
reach far into the spider evolutionary tree and many
branches are reorganized or newly discovered. We
hope that these new insights on spider relationships
will stimulate a plethora of follow-up studies on spider
evolution and systematics, especially for the areas of
the spider tree where we still have too little informa-
tion to gain insight on taxonomic relationships. We
also show the relevance of target gene approaches in
the phylogenomics era and how both can be used to
build on each other’s findings. In our study, the
unprecedented taxon sampling would have been very
challenging in a phylogenomic framework whilst recent
phylogenomic studies have been invaluable assets in
improving our results.
Acknowledgements
This work was primarily supported by a grant from
the United States National Science Foundation (NSF)
(EAR-0228699—’Assembling the Tree of Life: Phy-
logeny of Spiders’) awarded to W. C. Wheeler (P.I.)
and J. Coddington (JC), G. Hormiga (GH), L. Pren-
dini (LP) and P. Sierwald (PS) (co-P.I.s). JC acknowl-
edges support from the NMNH Neotropical Lowlands
Program, Small Grants Program and Biodiversity of
the Guyanas Program, as well as the NSF grants
DEB-9712353 (GH, P.I.; JC, co-P.I.) and DBI-
0956426 (N. Davies, P.I.; G. Roderick, C. Meyer, JC
and T. Orrell, co-P.I.s). Various aspects of this
research in the GH Lab at GWU were supported by
NSF awards DEB-0328644, DEB-1144492 and DEB-
1457300 (to GH and Gonzalo Giribet), by NSF award
DEB-0613928 (to N. I. Platnick (P.I.), R. Gillespie,
CEG, GH, and PS (co-P.I.s)) and by three NSF REU
supplementary grants. GH’s stay at the Scharff’s lab
in the Zoological Museum (University of Copenhagen)
was supported by a Villum Kann Rasmussen Fund,
VELUX Visiting Professorship. Further support to
GH for this project was provided by several awards
from GWU. LL acknowledges the Cosmos Club
Foundation Program of Grants-in-Aid to Young
Scholars and a Weintraub Fellowship from The
George Washington University. The participation in
this project of F.
Alvarez-Padilla, L. Benavides, S.
Benjamin, D. Dimitrov and E. Hasan was made possi-
ble in part by support of The George Washington
University and the aforementioned NSF awards to
GH. F.
Alvarez-Padilla acknowledges support from a
scholarship from the Consejo Nacional de Ciencia y
Tecnolog
ıa of Mexico (CONACYT).
Aspects of this research conducted in the LP lab at
the AMNH, including field collections that contributed
material to the project, were supported by NSF
awards DEB-0413453 (to LP and W. D. Sissom) and
DEB-0640219 (to LP and P. E. Cushing), by a grant
from the Richard Lounsbery Foundation (to R.
DeSalle, LP and M. E. Siddall), and a Constantine
Niarchos Expedition Grant (to LP). PS’s fieldwork in
South Africa and Myanmar was supported by Field
Museum’s Marshal Field Fund.
C. E. Griswold (CEG) and the CAS Arachnology
Lab (L. Almeida-Silva, F.
Alvarez-Padilla, J. Ledford,
D. Silva-Davila, D. Polotow, F. Labarque, D. Ubick
and H. Wood) acknowledge financial support from the
CAS Exline-Frizzell Fund for Arachnological Research
and CAS Lindsay Expedition Fund and by The Sch-
linger Foundation; D. Polotow is grateful for CNPq,
Conselho Nacional de Desenvolvimento Cient
ıfico e
Tecnol
ogico (PDE programme), D. Polotow and L.
Almeida-Silva both acknowledge Bill and Maria Peck
Fellowships (CAS); and J. Ledford, D. Silva-Davila,
F.
Alvarez-Padilla, F. Labarque and L. Almeida-Silva
acknowledge Schlinger Chair of Arachnology Postdoc-
toral Fellowships from CAS. T. Sz}
uts’ participation
was funded by a Marie Curie Intra European Fellow-
ships (Life Sciences Panel, No. 025850) and he
acknowledges support from the OTKA/NKFI 106241.
Aspects of this research were supported by NSF
grants: DEB-0072713 (to CEG and B. Fisher), DEB-
9296271 (to CEG), DEB-0613775 (to NIP, CEG, GH,
MJR) and BSI-0103795 (to Jablonski and Fritsch,
P.I.s). Participation by undergraduate students (Robin
Carlson, Joel Ledford, Hillary Guttman, Nibia Soto-
Rol
on, Christopher Vo, Vanessa Knutson, Jasper
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 37
Bash, Erika Garcia and Rachel Gibbs) in the CAS
Arachnology lab was made possible by NSF BIR-
9531307 (to R. Mooi, T. Gosliner and D. Kavanaugh,
P.I.s). CEG also thanks Sarah Weigold and Meghan
Culpepper for documenting morphology of selected
taxa. M. J. Ram
ırez (MJR) and the MACN lab (C.
Grismado, M. Izquierdo, F. Labarque, L. Piacentini)
acknowledge financial support from CONICET and
grants from FONCyT PICT 2011-1007, PICT-2007-
01393, PICT 2003-14092, CONICET PIP 6502, PIP
2008-03209 and PEI 6558.
Aspects of this research in the Scharff lab (NS) at
the Zoological Museum, University of Copenhagen,
were supported by a grant from the Danish National
Science Research Council (SNF21-02-0502). NS
acknowledges travel grants for fieldwork in Thailand
from DANIDA (Danish development cooperation), as
well as from the Carlsberg Foundation (grant no.
0537/60) for fieldwork in Australia. Participation by
undergraduate student Jesper Birkedal Schmidt in the
NS lab was made possible by the above-mentioned
grants.
Fieldwork was made possible thanks to the support
of Andr
es A. Ojanguren-Affilastro, Luis Compagnucci,
Gonzalo Rubio and Ana Quaglino (Argentina); Bar-
bara Baehr, Lisa Boutin, Mark S. Harvey, Robert
Raven and Michael Rix (Australia); Valerio Vignoli
(Benin); Joseph Koh and Natalia Chousou-Polydouri
(Brunei Darussalem); Elizabeth Arias, Juan Enrique
Barriga Tu~
n
on, Camilo I. Mattoni, Peter Michalik and
Jose A. Ochoa (Chile); Brian D. Farrell, Kelvin Guer-
rero, Jeremy Huff and Erich S. Volschenk (Dominican
Republic); Jeremy Huff (French Guiana); Jeremy Huff
and Valerio Vignoli (Guinea Bissau and Senegal);
Alexander Gromov, Alex and Elena Kreuzberg (Kaza-
khstan and Uzbekistan); Oscar Francke, Andrew
Gluesenkamp, Edmundo Gonz
alez-Santill
an, Randy
Mercurio, Hector Monta~
no, Ricardo Paredes, Javier
Ponce-Saavedra, Charles Savvas and Peter Sprouse
(Mexico); Da Aye Aye Cho, Dong Lin, U Kin Mawng
Zaw, U Tin Mya Soe and Joe Slowinski (Myanmar);
Tharina and Chris Bird, Quinton and Nicole Martins
and Elizabeth Scott (Namibia); Ray Forster, Lyn For-
ster and Steven King (New Zealand); Pedro Cardoso
(Portugal); Lauren Esposito (Puerto Rico); Ansie Dip-
peaar-Schoeman, Ian Engelbrecht, Charles Haddad,
Norman Larsen, Robin Lyle, Randy Mercurio,
Audrey Ndaba, Elizabeth Scott and Esther van der
Westhuizen (South Africa); and Weerachai Nanakorn,
Suyanee Vessabutr and Chaweewan Hutacharern
(Thailand).
Specimens for this project were provided by Andr
es
A. Ojanguren-Affilastro, Ingi Agnarsson, Elizabeth
Arias, Barbara Baehr, Domir De Bakker, Jorge Bar-
neche, Jesper Birkedal Schmidt, Marius Burger, Tom
as
Cekalovic, Fred Coyle, Sara Crews, Michael Driessen,
Ian Engelbrecht, Mike Fitzgerald, Charles Haddad,
Mark S. Harvey, Bernhard Huber, Jeremy Huff,
Joseph Joh, Matzaj Kuntner, James Lazell, Steven
Lew, Camilo Mattoni, Jos
e Ochoa, Vladimir Ovt-
sharenko, Pierre Paquin, Robert Raven, Carles Ribera,
Michael Rix, Sergio Rodr
ıguez Gil, Cristina Scioscia,
Carlos Viquez and Peter Weygoldt.
DNA sequence data were generated at the AMNH
by Rebecca B. Dikow, Torsten Dikow, Jeni Kuszak,
Diana Pietri and Dana Price. We thank Bryce McQuil-
lan for providing a photograph of Megadictyna
thilenii.
Author contributions
Led the project: WCW. Directed the study: WCW,
JAC, GH, LP, PS. Directed a lab/group: WCW, JAC,
CEG, GH, LP, MJR, PS, JEB, MH, WPM, NS. Par-
ticipated in taxon selection, collected, identified speci-
mens, processed samples: JAC, CEG, GH, LP, MJR,
PS, LAS, FAP, MA, LBS, SB, JEB, CJG, EH, MH,
MAI, FML, JL, LL, WPM, JM, LNP, NIP, DP,
DSD, NS, TS, DU, CV, HMW, JZ. Managed tissue
sample and voucher flow among project participants
and AMNH: LP. Directed molecular lab: WCW. Edi-
ted sequences and generated data files: LMC. Provided
additional sequences: DD, CEG, GH, LP, MJR, PS,
JEB, MH, FML, JL, LL, WPM, JM, DP, NS, HMW,
JZ. Curated and maintained tissue samples and vou-
cher the data: LMC, LP.
Examined preliminary analyses, detected contamina-
tions: LMC, DD, CEG, GH, MJR. Performed phylo-
genetic analyses: WCW (direct optimization), DD
(maximum-likelihood and Bayesian), PAG (parsi-
mony). Performed congruence analyses: MJR.
Drafted manuscript sections: LMC (Methods); MJR
(Results); CEG, MJR (Relationships, Taxonomy).
Made illustrations: MJR. Made tables: LMC, MJR.
Submitted sequences to GenBank: LMC. All
authors approved the final text.
References
Aberer, A.J., Kobert, K., Stamatakis, A., 2014. ExaBayes: massively
parallel Bayesian tree inference for the whole-genome era. Mol.
Biol. Evol. 31, 2553–2556.
Agnarsson, I., 2004. Morphological phylogeny of cobweb spiders
and their relatives (Araneae, Araneoidea, Theridiidae). Zool. J.
Linn. Soc. 141, 447–626.
Agnarsson, I., Rayor, L.S., 2013. A molecular phylogeny of the
Australian huntsman spiders (Sparassidae, Deleninae):
implications for taxonomy and social behaviour. Mol.
Phylogenet. Evol. 69, 895–905.
Agnarsson, I., Gregoric, M., Blackledge, T.A., Kuntner, M., 2012.
The phylogenetic placement of Psechridae within Entelegynae
and the convergent origin of orb-like spider webs. J. Zool. Syst.
Evol. Res. 51, 100–106.
38 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Agnarsson, I., Coddington, J.A., Kuntner, M., 2013. Systematics:
progress in the study of spider diversity and evolution. In:
Penney, D. (Ed.), Spider Research in the 21st Century: Trends
and Perspectives. Siri Scientific Press, Rochdale, UK, pp. 58–111.
Alberti, G., Weinmann, C., 1985. Fine structure of spermatozoa of
some labidognath spiders (Filistatidae, Segestriidae, Dysderidae,
Oonopidae, Scytodidae, Pholcidae; Araneae; Arachnida) with
remarks on spermiogenesis. J. Morph. 185, 1–35.
Almeida-Silva, L., 2013. An
alise clad
ıstica de Macrobunidae
Petrunkevitch 1928 stat. nov. e revis~
ao de Macrobuninae
(Araneae). Cladistic analysis of Macrobunidae Petrunkevitch,
1928 new rank and revision of Macrobuninae (Araneae).
Universidade de S~
ao Paulo 2013, unpublished thesis.
Almeida-Silva, L., Griswold, C., Brescovit, A., 2014. An
alise
clad
ıstica de Macrobunidae Petrunkevitch 1928 stat. nov. e
revis~
ao de Macrobuninae (Arachnida: Araneae). 2014. IV
Congreso Latinamericano de Aracnolog
ıa, Morelia, Mexico.
Almeida-Silva, L., Griswold, C.E., Brescovit, A.D., 2015. Revision
of Emmenomma Simon, (Amaurobiidae, Macrobuninae). Zootaxa
3931, 387–400.
Alvarez-Padilla, F., Hormiga, G., 2011. Morphological and
phylogenetic atlas of the orb-weaving spider family
Tetragnathidae (Araneae: Araneoidea). Zool. J. Linn. Soc. 162,
713–879.
Alvarez-Padilla, F., Dimitrov, D., Giribet, G., Hormiga, G., 2009.
Phylogenetic relationships of the spider family Tetragnathidae
(Araneae, Araneoidea) based on morphological and DNA
sequence data. Cladistics 25, 109–146.
Arango, C.P., Wheeler, W.C., 2007. Phylogeny of the sea spiders
(Arthropoda, Pycnogonida) based on direct optimization of six
loci and morphology. Cladistics 23, 255–293.
Bayer, S., Sch€
onhofer, A.L., 2013. Phylogenetic relationships of the
spider family Psechridae inferred from molecular data, with
comments on the Lycosoidea (Arachnida: Araneae). Invertebr.
Syst. 27, 53–80.
Benjamin, S.P., 2011. Phylogenetics and comparative morphology of
crab spiders (Araneae: Dionycha, Thomisidae). Zootaxa 3080,
1–108.
Benjamin, S.P., Dimitrov, D., Gillespie, R.G., Hormiga, G., 2008.
Family ties: molecular phylogeny of crab spiders (Araneae:
Thomisidae). Cladistics 24, 708–722.
Bennett, R., 1991. The systematics of the North American cybaeid
spiders (Araneoidea, Dictynoidea, Cybaeidae). University of
Guelph, unpublished thesis.
Bennett, R., Copley, C., Copley, C., 2016. Cybaeus (Araneae:
Cybaeidae): the Nearctic species of the Holarctic clade. Zootaxa
4164, 1–67.
Blackledge, T.A., Scharff, N., Coddington, J.A., Sz€
uts, T., Wenzel,
J.W., Hayashi, C.Y., Agnarsson, I., 2009. Reconstructing web
evolution and spider diversification in the molecular era. Proc.
Natl Acad. Sci. USA 106, 5229–5234.
Bolzern, A., Burckhardt, D., H€
anggi, A., 2013. Phylogeny and
taxonomy of European funnel-web spiders of the Tegenaria-
Malthonica complex (Araneae: Agelenidae) based upon
morphological and molecular data. Zool. J. Linn. Soc. 168, 723–
848.
Bonaldo, A.B., 1997. On the new Neotropical spider genus Ianduba
(Araneae, Corinnidae). Iheringia S
er. Zool. 83, 165–180.
Bond, J.E., Hendrixson, B.E., Hamilton, C.A., Hedin, M., 2012. A
reconsideration of the classification of the spider infraorder
Mygalomorphae (Arachnida: Araneae) based on three nuclear
genes and morphology. PLoS ONE 7, e38753.
Bond, J.E., Garrison, N.L., Hamilton, C.A., Godwin, R.L., Hedin,
M., Agnarsson, I., 2014. Phylogenomics resolves a spider
backbone phylogeny and rejects a prevailing paradigm for orb
web evolution. Curr. Biol. 24, 1765–1771.
Boyer, S.L., Karaman, I., Giribet, G., 2005. The genus
Cyphophthalmus (Arachnida, Opiliones, Cyphophthalmi) in
Europe: a phylogenetic approach to Balkan Peninsula
biogeography. Mol. Phylogenet. Evol. 36, 554–567.
Brignoli, P.M., 1979. The morphology and relationships of the
Leptonetidae (Arachnida, Araneae). J. Arachnol. 7, 231–236.
Burger, M., Michalik, P., 2010. The male genital system of goblin
spiders: evidence for the monophyly of Oonopidae (Arachnida:
Araneae). Am. Mus. Novit. 3675, 1–13.
de Busschere, C., Fannes, W., Henrard, A., Gaublomme, E., Jocqu
e,
R., Baert, L., 2014. Unravelling the goblin spiders puzzle: rDNA
phylogeny of the family Oonopidae (Araneae). Arthropod Syst.
Phyl. 72, 177–192.
Capella-Guti
errez, S., Silla-Mart
ınez, J.M., Gabald
on, T., 2009.
TrimAl: a tool for automated alignment trimming in large-scale
phylogenetic analyses. Bioinformatics 25, 1972–1973.
Coddington, J.A., 1986. The monophyletic origin of the orb web. In:
Shear, W.A. (Ed.), Spiders: Webs, Behavior and Evolution.
Stanford University Press, Stanford, CA, pp. 319–363.
Coddington, J.A., 1989. Spinneret silk spigot morphology: evidence
for the monophyly of orbweaving spiders, Cyrtophorinae
(Araneidae), and the group Theridiidae plus Nesticidae. J.
Arachnol. 17, 71–95.
Coddington, J.A., 1990. Cladistics and spider classification:
araneomorph phylogeny and the monophyly of orbweavers
(Araneae: Araneomorphae; Orbiculariae). Acta Zool. Fenn. 190,
75–87.
Cokendolpher, J.C., Reddell, J.R., 1992. Revision of the
Protoschizomidae (Arachnida: Schizomida) with notes on the
phylogeny of the order. Texas Mem. Mus., Speleol. Monogr. 3,
31–74.
Colgan, D.J., McLauchlan, A., Wilson, G.D.F., Livingston, S.P.,
Edgecombe, G.D., Macaranas, J., Cassis, G., Gray, M.R., 1998.
Histone H3 and U2 snRNA DNA sequences and arthropod
molecular evolution. Aust. J. Zool. 46, 419–437.
Compagnucci, L.A., Ram
ırez, M.J., 2000. A new species of the
spider genus Naevius Roth (Araneae, Amaurobiidae,
Macrobuninae). Stud. Neotrop. Fauna Environ. 35, 203–207.
Crandall, K.A., Harris, D.J., Fetzner Jr., J.W., 2000. The
monophyletic origin of freshwater crayfish estimated from
nuclear and mitochondrial DNA sequences. Proc. R. Soc. Lond.
B 267, 1679–1686.
Crews, S.C., Gillespie, R.G., 2010. Molecular systematics of Selenops
spiders (Araneae: Selenopidae) from North and Central America:
implications for Caribbean biogeography. Biol. J. Linn. Soc. 101,
288–322.
Davies, V.T., 1990. Two new spider genera (Araneae: Amaurobiidae)
from rainforests of Australia. Acta Zool. Fenn. 190, 95–102.
Davies, V.T., 1995. A tiny cribellate spider, Jamara gen. nov.
(Araneae: Amaurobioidea: Midgeeinae) from northern
Queensland. Mem. Queensl. Mus. 38, 93–96.
Davies, V.T., 1997. A redescription and renaming of the Tasmanian
spider Amphinecta milvina (Simon, 1903) with descriptions of
four new species (Araneae: Amaurobioidea: Amaurobiidae). In:
Shelden, P.A. (Ed.), Proceedings of the 17th European
Colloquium of Arachnology, Edinburgh, pp. 67–82.
Davies, V.T., 1998. A revision of the Australian metaltellines
(Araneae: Amaurobioidea: Amphinectidae: Metaltellinae).
Invertebr. Taxon. 12, 211–243.
D’Haese, C.A., 2003. Sensitivity analysis and tree-fusing: faster,
better. Cladistics 19, 150–151.
Dimitrov, D., Hormiga, G., 2009. Revision and cladistic analysis of
the orbweaving spider genus Cyrtognatha Keyserling, 1881
(Araneae, Tetragnathidae). Bull. Am. Mus. Nat. Hist. 317, 1–
140.
Dimitrov, D., Hormiga, G., 2011. An extraordinary new genus of
spiders from Western Australia with an expanded hypothesis on
the phylogeny of Tetragnathidae (Araneae). Zool. J. Linn. Soc.
161, 735–768.
Dimitrov, D., Lopardo, L., Giribet, G., Arnedo, M.A.,
Alvarez-
Padilla, F., Hormiga, G., 2012. Tangled in a sparse spider web:
single origin of orb weavers and their spinning work unraveled
by denser taxonomic sampling. Proc. R. Soc. Lond. B 279, 1341–
1350.
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 39
Dimitrov, D., Astrin, J.J., Huber, B.A., 2013. Pholcid spider molecular
systematics revisited, with new insights into the biogeography and
the evolution of the group. Cladistics 29, 132–146.
Dimitrov, D., Benavides, L.R., Arnedo, M.A., Giribet, G.,
Griswold, C.E., Scharff, N., Hormiga, G., 2016. Rounding up
the usual suspects: a standard target-gene approach for resolving
the interfamilial phylogenetic relationships of ecribellate orb-
weaving spiders with a new family-rank classification (Araneae,
Araneoidea). Cladistics 1–30. doi: 10.1111/cla.12165.
Eberhard, W.G., 1995. The web and building behavior of Synotaxus
ecuadorensis (Araneae, Synotaxidae). J. Arachnol. 23, 25–30.
Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high
accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797.
Farris, J.S., 1973. On comparing the shapes of taxonomic trees. Syst.
Zool. 22, 50–54.
Fern
andez, R., Hormiga, G., Giribet, G., 2014. Phylogenomic
analysis of spiders reveals nonmonophyly of orb weavers. Curr.
Biol. 24, 1772–1777.
Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994.
DNA primers for amplification of mitochondrial cytochrome c
oxidase subunit I from diverse metazoan invertebrates. Mol.
Mar. Biol. Biotech. 3, 294–299.
Forster, R.R., 1970. The spiders of New Zealand. Part III. Otago
Mus. Bull. 3, 1–184.
Forster, R.R., Wilton, C.L., 1973. The spiders of New Zealand. Part
IV. Otago Mus. Bull. 4, 1–309.
Forster, R.R., Platnick, N.I., Gray, M.R., 1987. A review of the spider
superfamilies Hypochiloidea and Austrochiloidea (Araneae,
Araneomorphae). Bull. Am. Mus. Nat. Hist. 185, 1–116.
Garrison, N.L., Rodriguez, J., Agnarsson, I., Coddington, J.A.,
Griswold, C.E., Hamilton, C.A., Hedin, M., Kocot, K.M.,
Ledford, J.M., Bond, J.E., 2016. Spider phylogenomics:
untangling the spider tree of life. PeerJ 4, e1719.
Giribet, G., 2002. Relationships among metazoan phyla as inferred
from 18S rRNA sequence data: a methodological approach. In:
DeSalle, R., Giribet, G., Wheeler, W.C. (Eds.), Molecular
Systematics and Evolution: Theory and Practice. Birkhauser
Verlag, Basel, pp. 85–101.
Giribet, G., 2007. Efficient tree searches with available algorithms.
Evol. Bioinform. Online 3, 341–356.
Giribet, G., Carranza, S., Bagu~
na, J., Riutort, M., Ribera, C., 1996.
First molecular evidence for the existence of a
Tardigrada +Arthropoda clade. Mol. Biol. Evol. 13, 76–84.
Goloboff, P.A., 1999. Analyzing large data sets in reasonable times:
solutions for composite optima. Cladistics 15, 415–428.
Goloboff, P.A., 2014. Extended implied weighting. Cladistics 30,
260–272.
Goloboff, P.A., Catalano, S., 2012. GB-to-TNT: facilitating creation
of matrices from GenBank and diagnosis of results in TNT.
Cladistics 28, 503–513.
Goloboff, P.A., Farris, J.S., Nixon, K.C., 2008. TNT, a free
program for phylogenetic analysis. Cladistics 24, 774–786.
Gray, M.R., Smith, H.M., 2008. A new subfamily of spiders
with grate-shaped tapeta from Australia and Papua New
Guinea (Araneae: Stiphidiidae: Borralinae). Rec. Aust. Mus.
60, 13–44.
Gregori
c, M., Agnarsson, I., Blackledge, T.A., Kuntner, M., 2015.
Phylogenetic position and composition of Zygiellinae and
Caerostris, with new insight into orb-web evolution and
gigantism. Zool. J. Linn. Soc. 175, 225–243.
Grismado, C.J., Deeleman, C., Piacentini, L.N., Izquierdo, M.A.,
Ram
ırez, M.J., 2014. Taxonomic review of the goblin spiders of
the genus Dysderoides Fage and their Himalayan relatives of the
genera Trilacuna Tong and Li and Himalayana, new genus
(Araneae: Oonopidae). Bull. Am. Mus. Nat. Hist. 387, 1–108.
Griswold, C.E., 1993. Investigations into the phylogeny of the
lycosoid spiders and their kin (Arachnida: Araneae: Lycosoidea).
Smithson. Contrib. Zool. 539, 1–39.
Griswold, C.E., Coddington, J.A., Hormiga, G., Scharff, N., 1998.
Phylogeny of the orb-web building spiders (Araneae, Orbiculariae:
Deinopoidea, Araneoidea). Zool. J. Linn. Soc. 123, 1–99.
Griswold, C.E., Coddington, J.A., Platnick, N.I., Forster, R.R.,
1999. Towards a phylogeny of entelegyne spiders (Araneae,
Araneomorphae, Entelegynae). J. Arachnol. 27, 53–63.
Griswold, C.E., Ram
ırez, M.J., Coddington, J.A., Platnick, N.I.,
2005. Atlas of phylogenetic data for entelegyne spiders (Araneae:
Araneomorphae: Entelegynae) with comments on their
phylogeny. Proc. Calif. Acad. Sci. 56, 1–324.
Griswold, C.E., Audisio, T., Ledford, J.M., 2012. An extraordinary
new family of spiders from caves in the Pacific Northwest
(Araneae, Trogloraptoridae, new family). ZooKeys 215, 77–102.
Haddad, C.R., 2013. Taxonomic notes on the spider genus Messapus
Simon, 1898 (Araneae, Corinnidae), with the description of the
new genera Copuetta and Wasaka and the first cladistic analysis
of Afrotropical Castianeirinae. Zootaxa 3688, 1–79.
Hall, T.A., 2007. BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symp. Ser. 41, 95–98.
Hedin, M., Bond, J.E., 2006. Molecular phylogenetics of the spider
infraorder Mygalomorphae using nuclear rRNA genes (18S and
28S): conflict and agreement with the current system of
classification. Mol. Phylogenet. Evol. 41, 454–471.
Heiss, J.S., Draney, M.L., 2004. Revision of the Nearctic spider
genus Calymmaria (Araneae, Hahniidae). J. Arachnol. 32, 457–
525.
Homann, H., 1971. Die Augen der Araneae: Anatomie, Ontogenie
und Bedeutung f€
ur die Systematik (Chelicerata, Arachnida). Z.
Morphol. Tiere 69, 201–272.
Hormiga, G., Griswold, C.E., 2014. Systematics, phylogeny and
evolution of orb weaving spiders. Ann. Rev. Entomol. 59, 487–
512.
Hormiga, G., Eberhard, W.G., Coddington, J.A., 1995. Web-
construction behaviour in Australian Phonognatha and the
phylogeny of nephiline and tetragnathid spiders (Araneae,
Tetragnathidae). Aust. J. Zool. 43, 313–364.
Hormiga, G., Fern
andez, R., Kallal, R., Ballesteros, J.A., Arnedo,
M., Dimitrov, D., Giribet, G., 2016. A phylogenomic approach
to resolve the relationships among the main lineages of araneoid
spiders. Denver Mus. Nat. Sci. Rep. 3, 109–110.
Hovm€
oller, R., Pape, T., K€
allersj€
o, M., 2002. The Palaeoptera
problem: basal pterygote phylogeny inferred from 18S and 28S
rDNA sequences. Cladistics 18, 313–323.
Huckstorf, K., Michalik, P., Ram
ırez, M., Wirkner, C.S., 2015.
Evolutionary morphology of the hemolymph vascular system of
basal araneomorph spiders (Araneae: Araneomorphae).
Arthropod Struct. Dev. 44, 609–621.
Jocqu
e, R., 1991. A generic revision of the spider family Zodariidae
(Araneae). Bull. Am. Mus. Nat. Hist., 201, 1–160.
Jocqu
e, R., Dippenaar-Schoeman, A.S., 2006. Spider Families of the
World. Mus
ee Royal de l’Afrique Central, Tervuren, Belgium.
Jocqu
e, R., Henrard, A., 2015. The new spider genus Palindroma,
featuring a novel synapomorphy for the Zodariidae (Araneae).
Eur. J. Taxon. 152, 1–33.
Johannesen, J., Lubin, Y., Smith, D.R., Bilde, T., Schneider, J.M.,
2007. The age and evolution of sociality in Stegodyphus spiders:
a molecular phylogenetic perspective. Proc. R. Soc. Lond. B 274,
231–237.
Katoh, K., Standley, D.M., 2013. MAFFT. Multiple sequence
alignment software version 7: improvements in performance and
usability. Mol. Phylogenet. Evol. 30, 772–780.
K€
ocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S.,
Villablanca, F., Wilson, A.C., 1989. Dynamics of mitochondrial
DNA evolution in animals: amplification and sequencing with
conserved primers. Proc. Natl Acad. Sci. USA 86, 6196–6200.
Kovoor, J., Peters, H.M., 1988. The spinning apparatus of Polenecia
producta (Araneae, Uloboridae): structure and histochemistry.
Zoomorphology 108, 47–59.
Kuntner, M., 2006. Phylogenetic systematics of the Gondwanan
nephilid spider lineage Clitaetrinae (Araneae, Nephilidae). Zool.
Scripta 35, 19–62.
Kuntner, M., Coddington, J.A., Hormiga, G., 2008. Phylogeny of
extant nephilid orb-weaving spiders (Araneae, Nephilidae):
40 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
testing morphological and ethological homologies. Cladistics 24,
147–217.
Kuntner, M., Arnedo, M.A., Trontelj, P., Lokov
sek, T., Agnarsson,
I., 2013. A molecular phylogeny of nephilid spiders: evolutionary
history of a model lineage. Mol. Phylogenet. Evol. 69, 961–979.
Labarque, F.M., Ram
ırez, M.J., 2012. The placement of the spider
genus Periegops and the phylogeny of Scytodoidea (Araneae:
Araneomorphae). Zootaxa 3312, 1–44.
Labarque, F.M., Soto, E.M., Ram
ırez, M.J., Arnedo, M.A., 2015.
Chasing ghosts: the phylogeny of Amaurobioidinae ghost spiders
(Araneae, Anyphaenidae). Zool. Scripta 44, 550–561.
Ledford, J.M., Griswold, C.E., 2010. A study of the subfamily
Archoleptonetinae (Araneae, Leptonetidae) with a review of the
morphology and relationships for the Leptonetidae. Zootaxa
2391, 1–32.
Lehtinen, P.T., 1967. Classification of the cribellate spiders and some
allied families, with notes on the evolution of the suborder
Araneomorpha. Ann. Zool. Fenn. 4, 199–468.
Lehtinen, P.T., 1981. Spiders of the Oriental-Australian region. III.
Tetrablemmidae, with a world revision. Acta Zool. Fenn. 162, 1–
151.
Lehtinen, P.T., 1986. Evolution of the Scytodoidea. Proceedings of
the Ninth International Congress of Arachnology, Panama 1983.
University of Panama, Smithsonian Tropical Research Institute,
and Centre International de Documentation Arachnologique
Panama City, Panama, 1–8 August 1983. Smithsonian Institution
Press, Washington, D.C., pp. 149–157.
Lindgren, A.R., Daly, M., 2007. The impact of length-variable data
and alignment criterion on the phylogeny of Decapodiformes
(Mollusca: Cephalopoda). Cladistics 23, 464–476.
Liu, K., Nelesen, S., Raghavan, S., Linder, C.R., Warnow, T., 2009.
Barking up the wrong treelength: the impact of gap penalty on
alignment and tree accuracy. IEEE/ACM Trans. Comput. Biol.
Bioinf. 6, 7–21.
Lopardo, L., Hormiga, G., 2015. Out of the twilight zone:
phylogeny and evolutionary morphology of the orb-weaving
spider family Mysmenidae, with a focus on spinneret spigot
morphology in symphytognathoids (Araneae, Araneoidea). Zool.
J. Linn. Soc. 173, 527–786.
Lopardo, L., Ram
ırez, M.J., Grismado, C., Compagnucci, L.A.,
2004. Web building behavior and the phylogeny of austrochiline
spiders. J. Arachnol. 32, 42–54.
Lopardo, L., Giribet, G., Hormiga, G., 2011. Morphology to the
rescue: molecular data and the signal of morphological
characters in combined phylogenetic analyses—a case study from
mysmenid spiders (Araneae, Mysmenidae), with comments on the
evolution of web architecture. Cladistics 27, 278–330.
Maddison, W.P., 2015. A phylogenetic classification of jumping
spiders (Araneae: Salticidae). J. Arachnol. 43, 231–292.
Maddison, W.P., Li, D., Bodner, M., Zhang, J., Xu, X., Liu, Q.,
Liu, F., 2014. The deep phylogeny of jumping spiders (Araneae,
Salticidae). ZooKeys 440, 1–57.
Maddison, W.P., Maddison, D.R., Zhang, J., Szuts, T., 2016.
Phylogenetic placement of the unusual jumping spider Depreissia
Lessert, and a new synapomorphy uniting Hisponinae and
Salticinae (Araneae, Salticidae). ZooKeys 549, 1–12.
Michalik, P., Ram
ırez, M.J., 2014. Evolutionary morphology of the
male reproductive system, spermatozoa and seminal fluid of
spiders (Araneae, Arachnida) –Current knowledge and future
directions. Arthropod Struct. Dev. 43, 291–322.
Miller, M.A., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES
Science Gateway for inference of large phylogenetic trees.
Proceedings of the Gateway Computing Workshop (GCE), 14
November 2010, New Orleans, LA, pp. 1–8.
Miller, J.A., Carmichael, A., Ram
ırez, M.J., Spagna, J.C., Haddad,
C.R., Rezac, M., Johannesen, J., Kral, J., Wang, X., Griswold,
C.E., 2010. Phylogeny of entelegyne spiders: affinities of the family
Penestomidae (new rank), generic phylogeny of Eresidae, and
asymmetric rates of change in spinning organ evolution (Araneae,
Araneoidea, Entelegynae). Mol. Phylogenet. Evol. 55, 786–804.
Miller, J.A., Griswold, C.E., Scharff, N., Rezac, M., Szuts, T.,
Marharbai, M., 2012. The velvet spiders: an atlas of the Eresidae
(Arachnida, Araneae). ZooKeys 195, 1–144.
Moradmand, M., Sch€
onhofer, A.L., J€
ager, P., 2014. Molecular
phylogeny of the spider family Sparassidae with focus on the
genus Eusparassus and notes on the RTA-clade and
‘Laterigradae’. Mol. Phylogenet. Evol. 74, 48–65.
Morrill, L., 2014. Revision and phylogenetic analysis of the spider
genus Porteria (Araneae, Desidae). San Francisco State
University, unpublished thesis.
Murphy, N.P., Framenau, V.W., Donnellan, S.C., Harvey, M.S.,
Park, Y.-C., Austin, A.D., 2006. Phylogenetic reconstruction of
the wolf spiders (Araneae: Lycosidae) using sequences from the
12S rRNA, 28S rRNA, and NADH1 genes: implications for
classification, biogeography, and the evolution of web building
behavior. Mol. Phylogenet. Evol. 38, 583–602.
Muster, C., 2009. Phylogenetic relationships within Philodromidae,
with a taxonomic revision of Philodromus subgenus Artanes in the
western Palearctic (Arachnida: Araneae). Invertebr. Syst. 23, 135–
169.
Nørgaard, T., Nilsson, D.E., Henschel, J.R., Garm, A., Wehner, R.,
2008. Vision in the nocturnal wandering spider Leucorchestris
arenicola (Araneae: Sparassidae). J. Exp. Biol. 211, 816–823.
Nunn, G.B., Theisen, B.F., Christensen, B., Arctander, P., 1996.
Simplicity-correlated size growth of the nuclear 28S ribosomal
RNA D3 expansion segment in the crustacean order Isopoda. J.
Mol. Evol. 42, 211–223.
Opatova, V., Arnedo, M.A., 2014. From Gondwana to Europe:
inferring the origins of Mediterranean Macrothele spiders
(Araneae: Hexathelidae) and the limits of the family
Hexathelidae. Invertebr. Syst. 28, 361–374.
Padial, J.M., Grant, T., Frost, D.R., 2014. Molecular systematics of
terraranas (Anura: Brachycephaloidea) with an assessment of the
effects of alignment and optimality criteria. Zootaxa 3825, 001–
132.
Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L.,
Grabowski, G., 1991. The simple fool’s guide to PCR, Version
2.0. University of Hawaii, Honolulu. Privately published,
compiled by S. Palumbi.
Penney, D., Wheater, C.P., Selden, P.A., 2003. Resistance of spiders to
Cretaceous-Tertiary extinction events. Evolution 57, 2599–2607.
Piacentini, L.N., Ram
ırez, M.J., Silva-D
avila, D., 2013. Systematics
of Cauquenia (Araneae: Zoropsidae), with comments on the
patterns of evolution of cribellum and male tibial crack on
Lycosoidea. Invertebr. Syst. 27, 567–577.
Platnick, N.I., 1977. The hypochiloid spiders: a cladistic analysis,
with notes on the Atypoidea (Arachnida, Araneae). Am. Mus.
Novit. 2627, 1–23.
Platnick, N.I., 1990. Spinneret morphology and the phylogeny of
ground spiders (Araneae, Gnaphosoidea). Am. Mus. Novit. 2978,
42 pp.
Platnick, N.I., 2002. A revision of the Australasian ground spiders
of the families Ammoxenidae, Cithaeronidae, Gallieniellidae, and
Trochanteriidae (Araneae: Gnaphosoidea). Bull. Am. Mus. Nat.
Hist. 271, 1–244.
Platnick, N.I., Baehr, B., 2006. A revision of the Australasian
ground spiders of the family Prodidomidae (Araneae:
Gnaphosoidea). Bull. Am. Mus. Nat. Hist. 298, 1–287.
Platnick, N.I., Penney, D., 2004. A revision of the widespread spider
genus Zimiris (Araneae, Prodidomidae). Am. Mus. Novit. 3450,
1–12.
Platnick, N.I., Coddington, J.A., Forster, R.F., Griswold, C.E.,
1991. Spinneret morphology and the higher classification of the
haplogyne spiders (Araneae, Araneomorphae). Am. Mus. Novit.
3016, 1–73.
Polotow, D., Carmichael, A., Griswold, C.E., 2015. Total evidence
analysis of the phylogenetic relationships of Lycosoidea spiders
(Araneae, Entelegynae). Invertebr. Syst. 29, 124–163.
Rambaut, A., 2014. FigTree, tree figure drawing tool. v. 1.4.2.
Institute of Evolutionary Biology, University of Edinburgh,
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 41
Edinburgh. http://tree.bio.ed.ac.uk/software/figtree/ [accessed 5
June 2016].
Ram
ırez, M.J., 1995. A phylogenetic analysis of the subfamilies of
Anyphaenidae (Arachnida, Araneae). Entomol. Scand. 26, 361–384.
Ram
ırez, M.J., 2000. Respiratory system morphology and the
phylogeny of haplogyne spiders (Araneae, Araneomorphae). J.
Arachnol. 28, 149–157.
Ram
ırez, M.J., 2014. The morphology and phylogeny of dionychan
spiders (Araneae: Araneomorphae). Bull. Am. Mus. Nat. Hist.
390, 1–374.
Ram
ırez, M.J., Lopardo, L., Bonaldo, A.B., 2001. A review of the
Chilean spider genus Olbus, with notes on the relationships of
the Corinnidae (Arachnida, Araneae). Insect. Syst. Evol. 31, 441–
462.
Ram
ırez, M.J., Grismado, C.J., Labarque, F.M., Izquierdo, M.A.,
Ledford, J.M., Miller, J.A., Haddad, C.R., Griswold, C.E., 2014.
The morphology and relationships of the walking mud spiders of
the genus Cryptothele (Araneae: Zodariidae). Zool. Anz. 253,
382–393.
Raven, R.J., Stumkat, K.S., 2005. Revisions of Australian ground-
hunting spiders: II. Zoropsidae (Lycosoidea: Araneae). Mem.
Queensl. Mus. 50, 347–423.
Regier, J.C., Shultz, J.W., Zwick, A., Hussey, A., Ball, B., Wetzer,
R., Martin, J.W., Cunningham, C.W., 2010. Arthropod
relationships revealed by phylogenomic analysis of nuclear
protein-coding sequences. Nature 463, 1079–1083.
Rheims, C.A., 2007. An
alise clad
ıstica dos g^
eneros de Sparassidae
Bertkau (Arachnida, Araneae). Instituto de Bioci^
encias da
Universidade de S~
ao Paulo, unpublished PhD thesis.
Rix, M.G., Harvey, M.S., 2010. The spider family
Micropholcommatidae (Arachnida: Araneae: Araneoidea): a
relimitation and revision at the generic level. ZooKeys 36, 1–321.
Rix, M.G., Harvey, M., Roberts, J., 2008. Molecular phylogenetics
of the spider family Micropholcommatidae (Araneae: Araneae)
using nuclear rRNA genes (18S and 28S). Mol. Phylogenet. Evol.
46, 1031–1048.
Robinson, M.H., Lubin, Y.D., 1979. Specialists and generalists: the
ecology and behavior of some web-building spiders from Papua
New Guinea. II. Psechrus argentatus and Fecenia sp. (Araneae:
Psechridae). Pac. Insects 21, 133–164.
Roth, V.D., Brame, P.L., 1972. Nearctic genera of the spider
family Agelenidae (Arachnida, Araneida). Am. Mus. Novit.
2505, 1–52.
Sanger, F., Nicklen, S., Chase, A.R., 1977. Sequencing with chain
terminating inhibitors. Proc. Natl Acad. Sci. USA 74, 5463–
5468.
Saturnino, R., Bonaldo, A.B., 2015. Taxonomic review of the New
World spider genus Elaver O. Pickard-Cambridge, 1898
(Araneae, Clubionidae). Zootaxa 4045, 1–119.
Scharff, N., Coddington, J.A., 1997. A phylogenetic analysis of the
orb-weaving spider family Araneidae (Arachnida, Araneae).
Zool. J. Linn. Soc. 120, 355–434.
Schuh, R.T., Weirauch, C., Wheeler, W.C., 2009. Phylogenetic
relationships within the Cimicomorpha (Hemiptera: Heteroptera):
a total-evidence analysis. Syst. Entomol. 34, 15–48.
Schulmeister, S., Wheeler, W.C., Carpenter, J.M., 2002.
Simultaneous analysis of the basal lineages of Hymenoptera
(Insecta) using sensitivity analysis. Cladistics 18, 455–484.
Sch€
utt, K., 2009. The limits of the Araneoidea (Arachnida:
Araneae). Aust. J. Zool. 48, 135–153.
Selden, P.A., Huang, D.Y., Ren, D., 2008. Palpimanoid spiders from
the Jurassic of China. J. Arachnol. 36, 306–321.
Sharma, P.P., Fern
andez, R., Esposito, L.A., Gonz
alez-Santill
an, E.,
Monod, L., 2015. Phylogenomic resolution of scorpions reveals
multilevel discordance with morphological phylogenetic signal.
Proc. R. Soc. Lond. B 282, 20142953.
Shear, W.A., 1978. Taxonomic notes on the armored spiders of the
families Tetrablemmidae and Pacullidae. Am. Mus. Novit. 2650,
1–46.
Shultz, J.W., 1990. Evolutionary morphology and phylogeny of
Arachnida. Cladistics 6, 1–38.
Shultz, J.W., 2007. A phylogenetic analysis of the arachnid orders
based on morphological characters. Zool. J. Linn. Soc. 150, 221–
265.
Silva-D
avila, D., 2003. Higher-level relationships of the spider family
Ctenidae (Araneae: Ctenoidea). Bull. Am. Mus. Nat. Hist. 274, 1–86.
Sørensen, M.V., Sterrer, W., Giribet, G., 2006. Gnathostomulid
phylogeny inferred from a combined approach of four molecular
loci and morphology. Cladistics 22, 32–58.
Spagna, J.C., Gillespie, R.G., 2008. More data, fewer shifts:
molecular insights into the evolution of the spinning apparatus in
non-orb-weaving spiders. Mol. Phylogenet. Evol. 46, 347–368.
Spagna, J.C., Crews, S.C., Gillespie, R.G., 2010. Patterns of habitat
affinity and Austral/Holarctic parallelism in dictynoid spiders
(Araneae: Entelegynae). Invertebr. Syst. 24, 238–257.
Stamatakis, A., 2014. RAxML Version 8: a tool for phylogenetic
analysis and post-analysis of large phylogenies. Bioinformatics
30, 1312–1313.
Teixeira, R.A., Campos, L.A., Lise, A.A., 2013. Phylogeny of
Aphantochilinae and Strophiinae sensu Simon (Araneae;
Thomisidae). Zool. Scripta 43, 65–78.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties and
weight matric choice. Nucleic Acids Res. 22, 4673–4680.
Van der Auwera, G., Chapelle, S., De Wachter, R., 1994. Structure
of the large ribosomal subunit RNA of Phytophthora
megasperma, and phylogeny of the oomycetes. FEBS Lett. 338,
133–136.
Wang, X.P., 2000. A revision of the genus Tamgrinia (Araneae:
Amaurobiidae), with notes on amaurobiid spinnerets, tracheae
and trichobothria. Invertebr. Taxon. 14, 449–464.
Weygoldt, P., 1996. Evolutionary morphology of whip spiders:
towards a phylogenetic system (Chelicerata: Arachnida:
Amblypygi). J. Zool. Syst. Evol. Res. 34, 185–202.
Weygoldt, P., Paulus, H.F., 1979. Untersuchungen zur morphologie,
taxonomie und phylogenie der Chelicerata. II. Cladogramme und
die entfaltung der Chelicerata. J. Zool. Syst. Evol. Res. 17, 177–
200.
Wheeler, W.C., 1995. Sequence alignment, parameter sensitivity, and
the phylogenetic analysis of molecular data. Syst. Biol. 44, 321–
331.
Wheeler, W.C., 1996. Optimization alignment: the end of multiple
sequence alignment in phylogenetics? Cladistics 12, 1–9.
Wheeler, W.C., 2001. Homology and the optimization of DNA
sequence data. Cladistics 17, S3–S11.
Wheeler, W.C., Giribet, G., Edgecombe, G.D., 2004. Arthropod
systematics: the comparative study of genomic, anatomical, and
paleontological information. In: Cracraft, J., Donoghue, M.J.
(Eds), Assembling the Tree of Life. Oxford University Press,
Oxford, pp. 281–295.
Wheeler, W.C., Lucaroni, N., Hong, L., Crowley, L.M., Var
on, A.,
2014. POY 5.1.1. American Museum of Natural History. http://
research.amnh.org/scicomp/projects/poy.php
Wheeler, W.C., Lucaroni, N., Hong, L., Crowley, L.M., Var
on, A.,
2015. POY version 5: phylogenetic analysis using dynamic
homologies under multiple optimality criteria. Cladistics 31, 189–
196.
Whiting, M.F., 2002. Phylogeny of the holometabolous insect
orders: molecular evidence. Zool. Scripta 31, 3–15.
Whiting, M.F., Carpenter, J.C., Wheeler, Q.D., Wheeler, W.C.,
1997. The Strepsiptera problem: phylogeny of the
holometabolous insect orders inferred from 18S and 28S
ribosomal DNA sequences and morphology. Syst. Biol. 46, 1–68.
Wood, H.M., Griswold, C.E., Gillespie, R., 2012. Phylogenetic
placement of pelican spiders (Archaeidae, Araneae), with insight
into evolution of the “neck” and predatory behaviors of the
superfamily Palpimanoidea. Cladistics 28, 598–626.
Wood, H.M., Matzke, N., Gillespie, R., Griswold, C.E., 2013.
Treating fossils as terminal taxa in divergence time estimation
reveals ancient vicariance patterns in the palpimanoid spiders.
Syst. Biol. 62, 264–284.
42 Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43
Wood, H.M., Parkinson, D.Y., Griswold, C.E., Gillespie, R.G.,
Elias, D.O., 2016. Repeated evolution of power-amplified
predatory strikes in trap-jaw spiders (Araneae,
Mecysmaucheniidae). Curr. Biol. 26, 1057–1061.
World Spider Catalog, 2016. Natural History Museum Bern. http://
wsc.nmbe.ch, version 17.0 [accessed 24 May 2016].
Wunderlich, J., 2004. The new spider (Araneae) family
Borboropactidae from the tropics and fossil in Baltic amber.
Beitr. Araneol. 3, 1737–1746.
Wunderlich, J., 2015. Mesozoic spiders and other fossil arachnids.
Beitr. Araneol. 9, 1–512.
Xu, X., Liu, F., Chen, J., Ono, H., Li, D., Kuntner, M., 2015a. A
genus-level taxonomic review of primitively segmented spiders
(Mesothelae, Liphistiidae). ZooKeys 488, 1–121.
Xu, X., Liu, F., Cheng, R.C., Chen, J., Xu, X., Zhang, Z., Ono, H.,
Pham, D.S., Norma-Rashid, Y., Arnedo, M.A., Kuntner, M., Li,
D., 2015b. Extant primitively segmented spiders have recently
diversified from an ancient lineage. Proc. R. Soc. Lond. B 282,
2014–2486.
Zamani, A., Marusik, M., James, W.B., 2016. A new species of
Paratheuma (Araneae: Dictynidae) from Southwestern Asia and
transfer of the genus. Zool. Middle East 62, 177–183.
Supporting Information
Additional Supporting Information may be found in
the online version of this article:
Fig. S1. Transcriptomic skeleton tree (TR). Skeleton
tree obtained from the transcriptomic analysis of Gar-
rison et al. (2016), with terminals mapped to our data-
set. All clades have bootstrap values of 100% and are
robust to analytical methods.
Fig. S2. Taxonomic reference tree (TX). Includes
multi-sampled families of spiders and outgroups.
Fig. S3. Taxonomic reference tree, conservative
(TX-C). Same as TX, but excluding the families that
are relimited here.
Fig. S4. Maximum-likelihood tree constrained by
TR skeleton tree (C-ML). With bootstrap values.
Fig. S5. Maximum-likelihood tree constrained by
TR skeleton tree based on the dataset excluding areas
of ambiguously aligned position in non-coding genes
(C-ML-T). With bootstrap values.
Fig. S6. Unconstrained maximum-likelihood tree
(ML). With bootstrap values.
Fig. S7. Unconstrained Bayesian inference tree (BI).
With posterior probabilities.
Fig. S8. Direct optimization tree (DO). Tree
obtained for InDel cost ratio of 1 and tv/ts cost ratio
of 2.
Fig. S9. Parsimony equal weights tree (EW). With
bootstrap values.
Fig. S10. Parsimony extended weighting tree (IW).
With bootstrap values.
Fig. S11. ree with robust groups. Majority rule con-
sensus tree from all analyses in Figs S4–S10.
Fig. S12. Tree with groups stable to optimality crite-
ria. Majority rule consensus tree from the five optimal-
ity criteria (EW, IW, DO, BI, ML), complete
alignments without constraints.
Table S1. Voucher and DNA locus information.
Specimen and locus information is provided below.
The identification code (Voucher Codes) of the tissue
or DNA sample from which newly generated
sequences were obtained is given. Institution codes
(Museum Voucher Code) are also provided. Locality
data are also supplied, with localities for conspecific
tissues separated by a semicolon. All newly generated
sequences, as well as those attributable to the NSF
grant EAR-0228699, are highlighted in bold type; all
others refer to sequences that were previously depos-
ited in GenBank by other authors.
Table S2. Mapping of our terminals to those of
Garrison et al.’s (2016) analysis of transcriptomic
data.
Table S3. Combined and partial tree costs and
incongruence length difference (ILD) for different
schemas of InDel and tv/ts cost ratios.
Table S4. Monophyly of selected taxonomic groups
and multi-sampled families as found in the different
analyses, and list of taxa used for the taxonomic con-
gruence analyses.
Ward C. Wheeler et al. / Cladistics 0 (2016) 1–43 43
