No full-text available
To read the full-text of this research,
you can request a copy directly from the author.
Congenital Malformations Attributed to Prenatal Exposure to Cyclophosphamide
Abstract
Cyclophosphamide (CPA) remains one of the most widely prescribed anticancer drugs. It is also used in the treatment of rheumatoid arthritis, childhood nephrotic syndrome and systemic lupus erythematosus. It is a potent immunosuppressive agent. It is commonly used in blood and bone marrow transplantation. With the growing trend among women postponing childbearing, the number of women who are diagnosed with breast cancer is also increasing thus escalating the chances of exposure of the unborn child to antineoplastic drugs. A review of the literature provides strong evidence for the teratogenic effects on infants prenatally exposed to CPA. Both sporadic case reports and larger case series have demonstrated that babies with cyclophosphamide embryopathy are afflicted with intrauterine growth restriction, small for gestational age, and craniofacial malformations including eye anomalies, cleft/arched palate, hydrocephaly, micrognathia, low set microtia, hearing defects, craniosynostosis, and facial asymmetry. Also observed in these cases are limb defects such as radial, ulnar and tibial hypoplasia, club foot, digital defects of the hand and feet as well as vertebral fusion, brevicolis, and occasional Sprengel's deformity. These anomalies vary in consistency of occurrence and severity of the phenotype across cases and lack the specificity of thalidomide embryopathy or rubella embryopathy. However, that they do occur is no longer in doubt. First trimester of pregnancy seems to be particularly susceptible to fetal malformations, although CPA effects on fetuses of later stages of gestation (hearing defects, growth restriction for example) are also reported occasionally. One of the major concerns from a mechanistic point of view is our inability to dissect the teratogenic effects of CPA from those of other drugs administered together with CPA as combination therapy. Animal experiments have been of particular value in that they are able to circumvent the numerous extraneous variables inherent to human case reports. They have also revealed the detrimental effects of CPA on gametes, preimplantation embryos, organogenesis as well as their potential teratogenic mechanisms. Of particular importance are the role of genetic polymorphisms, male mediated teratogenesis, ovarian failure, preimplantation embryo loss, epigenetic modifications, proxidant-antioxidant imbalance, autophagy, apoptosis, microRNAs and postclosure neural tube defects induced by CPA -all of which are areas for further research in CPA teratogenesis. .
... Pregnancy associated with cancers and autoimmune disease can lead to adverse birth outcomes such as preterm birth, low birth weight, growth restrictions, and a wide range of birth defects affecting the central nervous system [13]. This highlights the necessity of aggressive anticancer treatments like nitrosoureas, antimetabolites, mitosis inhibitors, and alkylating agents like cyclophosphamide (Cp) [14]. ...
... This bioactivation process also generates acrolein (Acr), a toxic aldehyde associated with bladder damage and hemorrhagic cystitis [15]. Despite its beneficial biological properties, Cp causes adverse effects in pregnant women and fetuses; nausea, hair loss, bone marrow suppression, hepatotoxicity [19], cardiotoxicity, neurotoxicity, immunosuppression [20], and birth defects [13]. The latter is of particular interest to this study, although Cp-induced teratogenesis involves complex mechanisms such as caspases activation or NF-kappaB suppression, the main mechanisms responsible are associated with DNA damage by bioactivation of toxic metabolites and induction of oxidative stress. ...
... Although Am contains a wide variety of bioactive compounds and pigments, multiple studies have demonstrated that one of its most crucial components responsible for its biological effects are the PBP. These protein complexes, in Despite its beneficial biological properties, Cp causes adverse effects in pregnant women and fetuses; nausea, hair loss, bone marrow suppression, hepatotoxicity [19], cardiotoxicity, neurotoxicity, immunosuppression [20], and birth defects [13]. The latter is of particular interest to this study, although Cp-induced teratogenesis involves complex mechanisms such as caspases activation or NF-kappaB suppression, the main mechanisms responsible are associated with DNA damage by bioactivation of toxic metabolites and induction of oxidative stress. ...
Background/Objectives: In recent years the global incidence of cancer during pregnancy is rising, occurring in 1 out of every 1000 pregnancies. In this regard, the most used chemotherapy drugs to treat cancer are alkylating agents such as cyclophosphamide (Cp). Despite its great efficacy, has been associated with the production of oxidative stress and DNA damage, leading to embryotoxicity, genotoxicity, and teratogenicity in the developing conceptus. Therefore, this study aimed to investigate the protective role of phycobiliproteins (PBP) derived from Arthrospira maxima (spirulina) in reducing Cp-induced embryotoxicity and genotoxicity in pregnant CD1 mice. Methods: Pregnant CD1 mice were divided into five groups: control, Cp 20 mg/kg, and three doses of PBP (50, 100, and 200 mg/kg) + Cp co-treatment. PBP were administered orally from day 6 to 10.5 dpc, followed by a single intraperitoneal dose of Cp on 10.5 dpc. Embryos were collected at 12.5 dpc to assess morphological development and vascular alterations, while maternal DNA damage was evaluated using micronucleus assays and antioxidant enzyme activity in maternal plasma. Results: PBP exhibited a dose-dependent protective effect against Cp-induced damage. The 200 mg/kg PBP dose significantly reduced developmental abnormalities, micronucleated polychromatic erythrocytes, and oxidative stress, (as evidenced by increased SOD and GPx activity). Conclusions: Phycobiliproteins from Arthrospira maxima (spirulina) effectively reduced Cp-induced morphological and vascular alterations in embryos and genotoxicity in pregnant mice. These findings highlight their potential as a complementary therapy to mitigate teratogenic risks during chemotherapy. Further research is needed to optimize dosing and explore clinical applications.
... In a review of cases of women exposed to Cp, it has been pointed out that one of the reasons for the production of teratogenic effects is the prooxidant-antioxidant imbalance, which leads to intrauterine growth restriction and craniofacial malformations including ocular abnormalities, cleft palate, hydrocephalus, micrognathia, microtia, craniosynostosis, and facial asymmetry, in addition to limb defects such as radial, ulnar, and tibial hypoplasia, clubfoot, digital hand, and foot defects, as well as vertebral fusion. (6) Arthrospira maxima, better known by tradition and commercially as "spirulina", belongs to the phyllo Cyanobacteria, also formerly called green-blue microalgae, has a high nutritional value, so it has been recommended to fight hunger and malnutrition, (7) in addition to attributing different pharmacological activities in humans and laboratory animals, many of them based on its high antioxidant capacity. Such is the case of its antitoxic, (8) anti-inflammatory, (9) anticancer, chemopreventive and DNA repair, (10) antibacterial, (11) antifungal, (12) immunoregulatory, (13) antiallergic and antiviral, (14) antianemic, (15) antihypertensive and lipid-lowering, (16) hypoglycemic, (17) and hepatoprotective effect, (18) in addition to body weight reduction, (19) among others. ...
... (29) Regarding the effect of Cp on maternal weight, authors such as Miller et al., (4) do not report significant differences among the groups, while others find a significant reduction, even when administered concomitantly with oxidants such as vanadium (2) or green tea extract. (6) In this study, after starting the administration of Sp, pregnant mice began to decrease their weight compared with the control and Cp groups. However, at the end of pregnancy, there was recovery, with no difference among the groups. ...
... (34) Several authors have confirmed that the Cp administered by DG 10 produces malformations in mice without being embryo-lethal or causing apparent toxicity in pregnant females. (2,4,6) What was found in our study agrees with the above, in addition to not observing alterations in reproductive parameters, although there is an increasing trend in resorption and fetal deaths in the group treated with Cp and low doses of Sp. Cyclophosphamide, on the other hand, has been the subject of several toxicity studies reporting damage to different organs and systems, both in humans and animals. ...
We evaluated whether Arthrospira maxima, known as spirulina (Sp) counteracts the teratogenic effects induced by cyclophosphamide (Cp) in mice. Ninety pregnant CD-1 mice were divided into 6 groups: control, Cp 20 mg/kg, Sp 400 mg/kg and three with Sp at 100, 200 and 400 mg/kg with Cp. Sp was administered intragastrically from day of gestation (DG) 6 to 16 and Cp, intraperitoneally to DG 10. Females did not differ in weight, except for DG 10. In gravid parameters, Cp and Sp alone or in association did not show significant effects, except for umbilical cord length, placental diameter, weight and size of fetuses. At DG 17 the females were sacrificed to obtain pregnancy parameters. In the fetuses, macroscopic malformations such as anasarca, exencephaly, hydrocephalus, open eye, cleft palate, absence and deformations of upper and lower extremities and tail were evaluated, in skeletal anomalies absences, deformations, supernumerary bones and a delay in mineralization were observed, antioxidant enzymes were determined in the livers, as well as markers of damage due to oxidative stress. Sp 400 along with Cp counteracted the malformations significantly. Sp protects against Cp teratogenicity in mice by decreasing reactive oxygen species and increasing concentrations of superoxide dismutase and glutathione peroxidase, although not catalase.
... Sclerostin is also able to stimulate osteoblast apoptosis through the activation of caspases. 43 Therefore, when sclerostin action is suppressed, osteogenesis is indirectly stimulated. 44 Loss of sclerostin gene function is related to diseases characterised by a hyperostosis process. ...
... 44 Loss of sclerostin gene function is related to diseases characterised by a hyperostosis process. 43 Elevated serum sclerostin has also been associated with the presence of atherosclerosis and is a proposed marker of CVD, particularly in subjects with diabetes. 45 Kuiper et al. 46 showed that increased levels of sclerostin are associated with an augmented risk of having coronary artery calcifications. ...
... The importance of the status of the prescriber is echoed by the Chief Medical Officer, in guidelines produced by the Royal College of General Practitioners (RCGP), the BPNA, and the Royal College of Physicians (RCP). 24,42,43 The British Medical Association (BMA) has also produced a policy and research statement outlining the background to, and likely changes stemming from, increased prescribing of CBMP. 44 Although issued as a prelude to the NICE guidance, the advice to prescribers from these collective professional bodies is in broad alignment, with emphasis on specialist prescription only for the small number of patients with an unmet medical need. ...
A 30-year-old Asian male with a significant history of deep vein thrombosis and family history positive for pulmonary embolism presented with complaints of fever, nonradiating epigastric pain, and a sense of abdominal fullness. After the initial workup, ultrasonography of the whole abdomen was carried out which showed thrombus formation in the portal vein. A CT scan of the abdomen was performed, which showed findings suggestive of mesenteric panniculitis. Keeping the significant family history and imaging findings in mind, the clotting and thrombin profiles were analysed and came back positive for the factor V Leiden gene (homozygous). A CT angiogram was performed to demonstrate extensive thrombosis throughout the abdominal vasculature with cavernous transformation. It is asserted that the chronic thrombosis on a background of factor V mutation led towards chronic inflammation of the mesentery. To the authors knowledge it is the first reported case of mesenteric panniculitis in a patient with factor V homozygous gene mutation.
... Consequently, most guidelines discourage the administration of live attenuated vaccines until 6-12 months postpartum. This recommendation is applicable to the Measles-Mumps-Rubella vaccine and to the Bacillus Calmette-Guérin vaccine (when advisable according to the host country recommendations), which are both scheduled at 12 months of age [82]. Conversely, the vaccination against Rotavirus, typically performed at 6 months of age, cannot be delayed beyond 24 weeks due to the risk of intussusception. ...
... However, if the use of the drug is strictly necessary, fertility preservation strategies are strongly recommended, which can be obtained through the administration of gonadotropin-releasing hormone or by oocyte cryopreservation. Additionally, however, CYC may be considered in lifethreatening mother disease when other therapeutic options are not possible [5][6][7]82]. ...
Introduction:
Rheumatoid arthritis (RA), the most prevalent autoimmune disease in reproductive years, exhibits a higher incidence in females, suggesting involvement of estrogens, genetics and environmental factors in disease onset. Literature shows smaller families in RA patients, driving increased interest in Assisted Reproductive Techniques.
Areas covered:
This review elucidates how immunotolerance mechanisms contribute to favorable pregnancy outcomes in RA, emphasizing the need for a careful pregnancy planning to mitigate fetal complications and postnatal flares, which surpass those in the general population. A thorough medication evaluation, orchestrated by a multidisciplinary team, is imperative during pregnancy, weighing potential teratogenic effects against safer alternatives to balance medication safety with disease control. A systematic literature search on PubMed and MEDLINE, using specific terms, covered relevant academic journals up to the latest date.
Expert opinion:
This narrative review comprehensively addresses pregnancy-related considerations in RA patients, prioritizing meticulous disease management with pregnancy and breastfeeding-compatible drugs in line with the latest recommendations and registry data. The focus remains on evaluating glucocorticoids, conventional, and biological disease-modifying drugs for compatibility during pregnancy and breastfeeding. Additionally, the evolving landscape of targeted synthetic drugs during pregnancy is explored, providing insights into the latest developments in rheumatological care.
... Exposure to cyclophosphamide in the first trimester can cause spontaneous miscarriage and is associated with malformations of the palate and limbs. 3 Preterm birth, intrauterine growth restriction and abnormalities of the ears and eyes have been reported in infants with cyclophosphamide exposure in the second and third trimesters. 3 The aggressive nature of Anti-GBM disease, the fatal risk to maternal health and the lack of alternative immunosuppressive agents justified the use of cyclophosphamide despite the potential risks posed. ...
... 3 Preterm birth, intrauterine growth restriction and abnormalities of the ears and eyes have been reported in infants with cyclophosphamide exposure in the second and third trimesters. 3 The aggressive nature of Anti-GBM disease, the fatal risk to maternal health and the lack of alternative immunosuppressive agents justified the use of cyclophosphamide despite the potential risks posed. For this reason, we prescribed 1 g of cyclophosphamide at 18 weeks gestation and evaluated the patient's clinical course to determine further doses. ...
We present the case of a pregnant woman in her 20s who presented in her second trimester with severe pulmonary haemorrhage and dialysis-dependent acute kidney failure due to antiglomerular basement membrane (GBM) disease. Responding to therapy, she recovered kidney function and delivered a baby. During her pregnancy, she developed cytomegalovirus viraemia, gestational diabetes and pre-eclampsia. Here, we report the first combined use of cyclophosphamide, rituximab and intensified plasma exchange in anti-GBM disease in pregnancy, allowing minimal exposure to cytotoxic medication, resulting in live birth and dialysis independence.
... In young female patients, while SLE increases the risk of infertility due to decreased ovarian reserve, 3 the use of cyclophosphamide adds to the challenge due to known risk of premature ovarian insufficiency, 4-8 fetal loss and congenital malformations. 9 However, we have some recent studies including one from oncology where outcomes seem slightly better than previously noted. [10][11][12][13][14][15] and we are actively exploring and using modalities to preserve fertility. ...
... In addition to causing miscarriages and fetal growth retardation, it has also been associated with congenital malformations like the cleft palate, ear defects, hypoplastic thumbs and microcephaly. 9 These reported adverse effects inculcate some hesitancy while using this medication in the young female patients potentially planning a pregnancy in near future and we usually restrict its use for severe, organ threatening manifestations of lupus. ...
Systemic lupus erythematosus (SLE) often affects females of reproductive age and Cyclophosphamide, an alkylating agent leading to premature ovarian insufficiency (POF) and labelled category D for pregnancy is used as induction therapy for severe manifestations of lupus. There have been multiple case series reflecting variable outcomes of pregnancies after cyclophosphamide use for cancers and autoimmune diseases. With increasing maternal age, we have an increasing population of lupus patients who may wish to conceive after having received cyclophosphamide therapy. The objective of our study was to improve our understanding of the impact of cyclophosphamide exposure on fertility and pregnancy outcomes in patients with SLE.
We retrospectively reviewed the charts of all patients who had received intravenous cyclophosphamide at our academic institute in the time period from 2000–2018 and identified 440 patients which included 157 female patients of reproductive age. There were 37 documented pregnancies after the cyclophosphamide infusion, of which 23 patients had successful outcomes; 4 elective abortion and 10 miscarriages. There were 17 patients who developed POF, of which 7 also had end stage renal disease. The average cumulative dose of cyclophosphamide in the patients who had successful pregnancy was 4080.37 mg compared to 2806.25 mg in those who had a miscarriage (p 0.164) and 5526.47 mg in those who developed POF (p 0.046). Using multiple regressions to evaluate risk factors impacting pregnancy outcomes, when taken as a set, the predictors including race, serological profile, exposure to steroids and Mycophenolate mofetil, age at cyclophosphamide infusion, age at pregnancy, and cumulative cyclophosphamide dose accounted for 46.29% of the variance in outcome of pregnancy (p 0.23) and 39.58% of the variance in development of premature ovarian failure (p 0.008). We noted statistical significance in the impact of maternal age at time of pregnancy (p 0.04) and duration of time between the last infusions to subsequent pregnancy (p 0.02) to pregnancy outcome.
Our findings suggest that a longer time interval between the last cyclophosphamide infusion and subsequent pregnancy was favorable for a successful outcome and higher cumulative cyclophosphamide dose is more likely to be associated with premature ovarian failure.
... Although it is used in the treatment of plenty of diseases, liver, cardiac and gonadal toxicities, as well as haemorrhagic cystitis and haematopoietic suppression in higher doses, are limiting the benefits of this alkylating drug (Raza and Alghasham 2011;Ye et al. 2022). Under the results of the later clinical and experimental observations, it is demonstrated that CTX may have teratogenic and gamete-mutating chemical properties (Rengasamy 2017). Oxidative stress-mediated apoptotic signalling and immune toxicity are believed to be the major reasons for organ dysfunction in high doses of CTX exposure (Cengiz et al. 2020). ...
Background
Chemotherapy drugs may lead to hepatic injury, which is considered one of the limitations of these drugs.
Objectives
The aim of this study was to evaluate the effect of quercetin (QUE) on M1/M2 macrophage polarization and hepatoprotective effect in cyclophosphamide (CTX)‐induced liver toxicity.
Methods
Twenty‐four mice were divided into four groups (Control, QUE, CTX, CTX + QUE). The CTX and CTX + QUE groups received 200 mg/kg CTX. The animals in the QUE and CTX + QUE groups received 50 mg/kg QUE. All animals were sacrificed, and serum and liver samples were used for laboratory analyses.
Results
Examinations indicated that CTX exposure led to disruption of liver functions and morphological degenerations. Tissue pro‐apoptotic Bax and caspase 3, pro‐inflammatory TNF‐α and IL‐1β, transcription factor NF‐κB, and M1 macrophage polarization marker CD86 were upregulated significant (p < 0.05) in this group. In addition, CTX exposure led to significantly (p < 0.05) upregulation of the Bax/Bcl‐2 mRNA ratio and DNA fragmentations. The PCNA‐positive hepatic cell ratio and anti‐apoptotic Bcl‐2 expression are remarkably suppressed (p < 0.05). Immunohistochemical analyses are also indicated that M2 macrophage polarization marker CD163 is slightly but remarkably (p < 0.05) downregulated in the CTX group compared to the Control and QUE groups. The morphological and biochemical disruptions were alleviated in QUE‐treated animals in the CTX + QUE group. Liver function test results, apoptosis, inflammatory, transcription factor NF‐κB, regeneration/proliferation, and apoptotic index results in this group were similar (p > 0.05) to the control and QUE groups. The M1 cell surface marker expression of CD86 is significantly (p < 0.05) downregulated, and M2 macrophage polarization marker expression of CD163 is upregulated significantly (p < 0.05) compared to the CTX group.
Conclusions
This study indicates that QUE has the potential to downregulate CTX‐induced hepatic injury and regulate M1/M2 macrophage polarization to the M2 side, which indirectly demonstrates activation of anti‐inflammatory signalling and tissue repair.
... Our study conducted in China involved sampling 3,406 term infants aged 0 to 6 months, and we found that the incidence of head shape problems in this population was 56.5% (4). Head shape problems can stem from various causes, including genetic mutations, certain adverse embryonic environmental factors, certain drugs, craniosynostosis, and postural factors (5)(6)(7)(8)(9). Severe cephalic issues can have detrimental consequences that affect appearance, cognition, vision, hearing, and chewing ability (10,11). ...
Background
Head shape problems are common in infancy and early childhood, and thus their early identification and management can benefit the health of children. This study aimed to investigate pediatric healthcare professionals’ existing knowledge of children’s head shape abnormalities and their associated effects in China, providing guidelines for future clinical interventions, training, and interdisciplinary collaboration.
Methods
We conducted a survey among pediatric medical staff, encompassing various age groups, genders, hospitals, and professional levels. The electronic questionnaire queried respondents’ basic information, knowledge pertaining to head shape issues, diagnosis and treatment approaches, and the clinical development status of head shape problems. All surveys and data collection were conducted anonymously.
Results
A total of 214 valid questionnaires were collected. Differences in the level of understanding among medical staff regarding head shape issues were observed. Medical staff in tertiary care facilities showed the highest proficiency in diagnosing and treating positional plagiocephaly and cranial asymmetry (P<0.05), while those in primary care facilities exhibited the lowest competency in diagnosing head shape abnormalities (P<0.05). Most medical staff had a partial understanding of specific aspects of head shape issues, such as identifying high-risk individuals (n=144, 67.29%), making diagnoses (n=176, 82.24%), and understanding the consequences (n=151, 70.56%), with no significant differences across medical facilities of various levels. Additionally, 99.07% (n=212) of the medical staff believed that head shape measurements should be included as a routine component of pediatric physical examinations, and 75.23% (n=161) incorporate head shape assessment as part of their routine physical examination. Furthermore, 91.12% (n=195) of the medical staff received consultations on children’s head shape issues, with a higher prevalence in secondary and tertiary care facilities. Finally, 93.97% (n=201) of the participants expressed the need for further education and knowledge on pediatric head shape, with no significant differences across medical facilities of various levels.
Conclusions
There is a limited understanding among medical personnel in China regarding children’s head shape issues. Therefore, it is imperative to enhance training and educational initiatives for medical staff in China, with the goal of enhancing their awareness and knowledge regarding children’s head shape problems.
... Teratogenic effects of chemotherapy were reported as a result of testicular functions abnormality (Vassilakopoulou et al., 2015). It was noticed that CYP has the capability of inducing congenital malformations in the new generation (Rengasamy, 2017). ...
Chemotherapy is considered one of the crucial strategies for treating cancer. However, a variety of temporary and permanent side effects have been reported due to the use of these chemical compounds. The current study was designed to highlight the influence of cyclophosphamide (CYP) administration on reproductive development capability and fertility in male mice. Thirty premature male mice were divided into three groups; (1) control groups (2) one group injected interperitoneally with 150 mg CYP, and (3) one group with 250 mg CYP. Injections were administered for four weeks. The results indicate a significant reduction in body and organs weights in treated groups when compared with the control group. Similarly, the reproductive capabilities were also decreased in a increasing trend. Zoospermia was detected in treated groups with CYP, and this reduction was more noticable in the 150 CYP group. Luteinizing hormone levels increased significantly in both treated groups while testosterone levels declined considerably in the CYP-treated groups. These findings imply the risks of using this drug in cancer remediation during the maturation period of mice fertility. More investigations are required to detect whether these CYP-associated consequences are reversible or permanent after treatment discontinuation.
... Cyclophosphamide (CPM) is an alkylating agent that causes DNA-DNA crosslinking, enabling cell replication. According to literature, first-trimester exposure to CPM can frequently lead to MCMs in the context of the so-called "cyclophosphamide embryopathy" characterized by multiple malformations (i.e., growth restriction, ear and facial abnormalities, absence of digits, hypoplastic limbs) 76 . However, some reports claim the possible safe profile and absence of MCMs after exposition to CPM in the first trimester of pregnancy. ...
Several reports have described the autoimmune encephalitis’ (AE) possible onset during pregnancy. In this systematic review, we summarize the available data on the diagnostic and therapeutic approach to AE during pregnancy, highlighting the associated maternal and fetal clinical outcomes. A systematic search of the literature was performed. The following databases were used: Pubmed, Google Scholar, EMBASE, CrossRef. The revision was registered on the PROSPERO platform (CRD42022336357). Forty-nine patients were included. AE onset was mainly observed during the first and the second trimester of pregnancy with psychiatric manifestations and seizures as main onset symptoms. CSF analysis showed AE-specific autoantibody positivity in 33 patients (anti-NMDA receptor as the most frequent). EEG generally showed normal findings. MRI revealed pathological findings in less than half of patients. Tumor screening was positive findings in 14 cases. First line immunotherapy (single or combined) was generally employed while second line was administered in a minority of patients. Levetiracetam was the most used antiseizure medication. Cesarean section was performed in 18 women. Most of the women had an excellent early outcome after delivery but 22 showed persistent neurological deficits in long-term follow-up. Fetal outcome was positive in 33 cases whereas 12 cases of fetal death were reported. A logistic regression showed that no variable significantly influenced the odds of good/bad maternal and fetal clinical outcome. Diagnosis and treatment of AE during pregnancy is challenging. The rate of miscarriage in women with AE seems to be higher than the general population. In addition, mothers may show long-term neurological deficits.
... Nevertheless, retinal toxicity remains a worrying complication in patients treated with antimalarial drugs (Mukwikwi et al., 2020). Regarding prescribed immunosuppressants, a higher cumulative cyclophosphamide dose is associated with a greater possibility of premature ovarian failure and congenital malformations (Rengasamy, 2017;Sen et al., 2021). Despite their powerful capability to induce immunosuppression, corticosteroids are responsible for the majority of infections, permanent organ damage, and premature death in patients with lupus (Thamer et al., 2009;Apostolopoulos and Morand, 2016). ...
Background: Tripterygium glycosides have been used to treat systemic lupus erythematosus (SLE) for a long time, showing the effects of immune regulation. We aimed to evaluate the benefits and risks of Tripterygium Glycosides Tablets (TGT) for patients with SLE.
Methods: We searched electronic databases and clinical trial registries for relevant randomized controlled trials (RCTs). We identified eligible RCTs and assessed risk of bias. We conducted a meta-analysis to estimate the pooled effects. The Trial Sequential Analysis (TSA) 0.9.5.10 software was used to verify the reliability of the results.
Results: Eight RCTs encompassing 538 patients with SLE were included. TGT combined with conventional treatments (CTs) was superior to CTs alone in reducing lupus activity (MD = −1.66, 95% CI = −2.07 to −1.26, p < 0.00001, low-certainty evidence) and improving overall response rate (ORR) (RR = 1.21, 95% CI = 1.11 to 1.32, p < 0.0001, moderate-certainty evidence). The robustness of the results was confirmed by TSA. Regarding safety, there was no statistical difference in the overall incidence of adverse reactions between the two groups.
Conclusion: In patients with SLE, TGT might safely reduce disease activity. However, further high-quality studies are needed to firmly establish the clinical efficacy of TGT.
Systematic Review Registration: https://www.crd.york.ac.uk/prospero/display_record.php?ID=CRD42022300474; Identifier: CRD42022300474.
... Phosphoramide mustard-induced apoptosis plays an important role in CPA teratogenesis 7 . CPA is known to induce a variety of malformations in the brain, limbs, face, skeleton, and tail of many animal species, including mice, rats, rabbits, monkeys, humans, and chicks 8,9 . In addition, CPA is known to induce placental toxicity in rats and mice 1 0, 11 . ...
We examined the morphological effects of cyclophosphamide (CPA) on placental development in pregnant rats. CPA was administered as a single dose to pregnant rats intraperitoneally at 0 mg/kg (the control group), 25 mg/kg on gestation day (GD) 12 (the CPA GD 12-treated group), and 25 mg/kg on GD 14 (the CPA GD 14-treated group). The fetal and placental weight decreased in the CPA-treated groups, complete fetal resorption from GD 17 onwards in the CPA GD 12-treated group, and external malformations in the CPA GD 14-treated group. Histopathologically, CPA induced apoptosis and/or cell proliferation inhibition in each part of the placenta. In the labyrinth zone, syncytiotrophoblasts were selectively reduced, resulting in a small placenta. In the basal zone, the number of spongiotrophoblasts was reduced, resulting in hypoplasia of glycogen cell islands. In addition, a small number of interstitial trophoblasts invaded the metrial gland from the basal zone on GD 15. The severity of these lesions was higher in the CPA GD 12-treated group than in the CPA GD 14-treated group. In the metrial gland, although the number of uterine natural killer cells was reduced, metrial gland development was not affected.
... Cardonick et al. analyzed 110 pregnant women treated with multidrug regimens, containing cyclophosphamide and they found 1 intrauterine death (normal fetal autopsy), 1 neonatal death (due to autoimmune disorder), 1 IgA deficiency, 1 pyloric stenosis, 1 holoprosencephaly, 7 IUGR [25]. One of the major concerns is the inability to explore the teratogenic effects of cyclophosphamide from those of other drugs administered as combination therapy [96]. On the contrary, two other studies report no congenital malformation in neonates born after intrauterine exposure to chemotherapy containing cyclophosphamide during the second and third trimesters [97]. ...
The incidence of PAC is relatively infrequent among pregnant women. However, it has gradually increased in recent years, becoming a challenging area for clinicians that should take into account in the same way maternal benefits and fetal potential risks correlated to the antineoplastic treatment. None of the antineoplastic drugs is completely risk-free during the pregnancy, the timing of exposure and transplacental transfer properties influence the toxicity of the fetus. Despite the lack of guidelines about the management of PAC, several studies have described the use and the potential fetal and neonatal adverse events of antineoplastic drugs during pregnancy. We provide a review of the available literature about the transplacental passage and fetal effects of chemotherapy and targeted agents, to guide the clinicians in the most appropriate choices for the management of PAC.
... Immunosuppressive drugs as steroids, azathioprine, calcineurin inhibitors, can be used in pregnancy. Avoidance of nephrotoxic and teratogenic medications, as mycophenolate mofetil and cyclophosphamide, is necessary [26,27]. As far as anemia is concerned, erythropoietin, folic acid and intravenous saccharide ferric oxide are recommended [28]. ...
Background. Renal chronic disease can be categorized as an uncommon pathology associated with pregnancy, with a real incidence difficult to estimate. The significant risk for adverse outcomes can be translated into a high degree of occurrence of preeclampsia, fetal growth restriction, preterm delivery, and, also, progression of underlying renal dysfunction. The purpose of the article is to review the data from specialty literature, regarding the correlation between renal function and the pregnancy’s prognosis, so the best management can be implemented to improve the outcomes. Material and methods. We performed a research project conducted in Emergency University Hospital in Bucharest, regarding the impact of chronic renal disease on maternal and fetal outcome. The retrospective and prospective study extends over a period of over 4 years, between 2017 and 2021 and it is currently ongoing with the involvement of the Nephrology Department, the Dialysis Department and the Medical Laboratory. Results. We enrolled 12 pregnant women diagnosed with chronic renal disease. In all cases included in this research the mean 1-minute Apgar Index was 7. The rate of cesarian section was 95%, due to severe preeclampsia in 58% cases, fetal bradycardia in 33.33% cases and placentae abruption in 8.66%. In our study the most frequent risk factor was systemic lupus erythematosus (25%). The risk factors associated with the progression of renal disease in pregnancy were age < 24 years, nephrotic syndrome, hypertension, hematocrit <= 26%, serum creatinine > 1.4 mg/dl, prednisone monotherapy. The blood urea nitrogen had an average of 57 mg/dl, ranging between 26 and 173 mg/dl. Conclusions. The prognosis of pregnancy-associated with renal chronic disease is burdened by the appearance of serious fetal and maternal complications. Thus, special regard should be given to the management of this pathology during pregnancy, so that therapeutic criteria can be easily adopted, taking into consideration that, nowadays, the diagnosis is still a challenge due to the overlapping psychological changes.
... Studies have found that the epigenetic modification of sperms can be passed to the early embryo and can regulate the development of the early embryos [7,8]. Sperm chromatin is highly concentrated, containing 90%-99% protamine and 1%-10% histones. ...
Background:
New Wenshen Shengjing Decoction (NWSSJD), a traditional Chinese compound medicine, has significant effect on spermatogenesis disorder and can significantly improve sperm quality. Many components in NWSSJD can induce epigenetic modifications of different types of cells. It is not yet known whether they can cause epigenetic modifications in sperm or early embryos.
Objective:
This study investigated the effect of NWSSJD on mouse early embryonic development and its regulation of H3K4me3 in mouse sperm and early embryos.
Methods:
Spermatogenesis disorder was induced in male mice with CPA (cyclophosphamide). NWSSJD was administrated for 30 days. Then, the male mice were mated with the female mice with superovulation, and the embryo degeneration rate of each stage was calculated. Immunofluorescence staining was used to detect the expression of H3K4me3 in sperm and embryos at various stages. Western blotting was performed to detect methyltransferase SETD1B expression. The expressions of development-related genes (OCT-4, NANOG, and CDX2) and apoptosis-related genes (BCL-2 and p53) were measured with qRT-PCR.
Results:
Compared with the CPA group, NWSSJD significantly reduced the H3K4me3 level in sperms, significantly increased the number of normal early embryos (2-cell embryos, 3-4-cell embryos, 8-16-cell embryos, and blastocysts) per mouse, and reduced the degeneration rate of the embryos. The expression levels of H3K4me3 and methyltransferase SETD1B in early embryos were significantly elevated by NWSSJD. Additionally, NWSSJD significantly promoted BCL-2 expression, while reducing p53 expression, thus inhibiting embryonic cell apoptosis. Moreover, the expressions of development-related genes OCT-4 and CDX2 were significantly increased by NWSSJD, but NANOG expression had no significant difference.
Conclusion:
NWSSJD may promote early embryonic development possibly by maintaining low H3K4me3 levels in sperms and normal H3K4me3 modification in early embryos and by inhibiting embryonic cell apoptosis.
... Adverse effects include growth retardation, developmental delay, craniofacial defects and limb abnormalities, among others. 43 Dapsone Dapsone can be used for its anti-inflammatory effect. It is used as an adjuvant to corticosteroids in patients with severe, persistent PG with various results. ...
Pemphigoid gestationis (PG) is important to diagnose and treat because it carries considerable morbidity for the pregnant woman and can also constitute a risk to the fetus. Herein, the treatment options for PG and a proposed treatment algorithm for PG during pregnancy, breastfeeding, and late postpartum are reviewed.
... The risk seems to increase among the fetuses exposed during the first trimester. 48 For this reason, during pregnancy planning, CYC should be discontinued before conception and switched to pregnancy-compatible medications to avoid fetal exposure to medication. Considering the risk of ovarian failure, other immunosuppressive agents should be preferred as first-line therapy for young females instead of CYC. ...
The advances in treatments, including disease-modifying anti-rheumatic drugs and biologic agents, have significantly improved the management of inflammatory rheumatic diseases, allowing females with severe disease to become pregnant and lactate, previously considered as prohibited. Maintaining low disease activity with medications known to be safe from pre-conception to post-partum is a key point in reducing adverse pregnancy outcomes. Numerous observational and case studies have provided a growing amount of evidence on the use of safe anti-rheumatic medications in patients during pregnancy and lactation. Based on this information, this review discusses the safety of medications for patients with inflammatory rheumatic diseases during pregnancy and lactation. Among these, hydroxychloroquine, sulfasalazine, azathioprine, low-dose glucocorticoids, and low-dose aspirin are considered compatible with pregnancy, while methotrexate, cyclophosphamide, mycophenolate mofetil, and leflunomide are contraindicated. Non-steroidal anti-inflammatory drugs are only recommended for use early in pregnancy, as they are reported to cause rare but serious kidney problems in the fetus after 20 weeks or later. Cyclosporin, tacrolimus, and anti-TNF agents can be continued throughout pregnancy if the benefit is greater than the potential risk for the individual patient. Physicians should carefully weigh the risks and benefits of medications in patients with inflammatory rheumatic diseases considering pregnancy.
... Low-dose Chlordecone insecticide can significantly increase the modification level of H3K27me3 in fetal oocytes, change the epigenetic modification characteristics of oocytes, and lead to the delay of estrus, the reduction of the number of primordial follicles, and the increase of the atretic follicle in adult female mice [28]. Cyclophosphamide (CPA) is an alkylating agent that is widely used in antitumor and immunosuppression after organ transplantation [29][30][31][32]. It has been reported that the use of CPA in males significantly increased the rate of embryo loss, malformation, and the incidence of behavioral defects in offspring, and these abnormalities could be passed on to offspring [29]. ...
Many ingredients in Wenshen Shengjing Decoction (WSSJD) can cause epigenetic changes in the development of different types of cells. It is not yet known whether they can cause epigenetic changes in sperms or early embryos. Here, we investigated the role of WSSJD in epigenetic modifications of sperms or early embryos and early embryo development. A mouse model with spermatogenesis disorders was established with cyclophosphamide (CPA). WSSJD was administrated for 30 days. The male model mice after the treatment were mated with the female mice treated with superovulation. The embryo development rate of each stage was calculated. Immunofluorescence staining was used to detect the expression of H3K27me3 in sperm, pronuclear embryos, and 2-cell embryos. Western blotting was used to detect the expression of histone demethylase KDM6A and methyltransferase EZH2 in 2-cell embryos with developmental arrest. The expressions of zygotic genome activation genes (ZSCAN4, E1F1AX, HSPA1A, ERV4-2, and MYC) in 2-cell embryos with developmental arrest were analyzed with qRT-PCR. Comparing with the control group, CPA destroyed the development of seminiferous epithelium, significantly increased the expression level of H3K27me3 in sperm, reduced the expression ratio of H3K27me3 in female and male pronuclei, delayed the development of 2-cell embryos, and increased the developmental arrest rate and degeneration rate of 2-cell embryos. Moreover, the expressions of EZH2 and H3K27me3 were significantly increased in the 2-cell embryos with developmental arrest, and the expression of zygotic genome activation genes (ZSCAN4, E1F1AX, HSPA1A, ERV4-2, and MYC) was significantly decreased. Compared with the CPA group, WSSJD promoted the development of seminiferous epithelium, maintained a low level of H3K27me3 modification in sperm and male pronucleus, significantly increased the development rate of 2-cell embryos and 3-4 cell embryos, and reduced the developmental arrest rate and degeneration rate of 2-cell embryos. WSSJD may promote early embryonic development by maintaining a low level of H3K27me3 modification in sperm and male pronucleus and regulating the zygotic genome activation in mice with spermatogenesis disorders induced by CPA.
1. Introduction
Wenshen Shengjing Decoction (WSSJD) is a traditional Chinese compound medicine, which is widely used to treat male spermatogenesis disorders [1–5]. WSSJD is composed of 15 kinds of Chinese herbs, mainly including Ginseng, velvet antler, Cynomorium, Astragalus, Epimedium, and Angelica [1]. It can maintain high androgen concentration in testicular tissue, promote the development of spermatogenic cells [1], inhibit the apoptosis of spermatogenic cells [5], and increase the production and maturity rate of sperms [2]. An important criterion for the efficacy of drugs for male spermatogenesis disorders is normal fertility. Therefore, the efficacy of WSSJD depends on its effect on early embryonic development.
Epigenetic modification is an important method of gene expression regulation, which can regulate DNA replication, transcription, and repair [6], and plays an important regulatory role in the development of sperms and early embryos. It has been found that many effective ingredients in WSSDJ can participate in the regulation of cell epigenetic modification, such as ginsenosides, astragalus polysaccharides, and limoxine [7–10]. Ginsenoside Rg3 can regulate the acetylation modification of H3K14/K9 and H4 K12/K5/K16 in ovarian cancer cells [7]. Astragalus polysaccharide can regulate the methylation status of DNA in the colonic epithelium [8]. Tetramethylpyrazine can cause histone H3 and H4 acetylation modification in neural stem cells [9], which are closely related to the changes in the modification pattern of H3K27me3 in mouse cardiomyocytes [10]. Our previous research found that WSSJD regulated the modification level of K3K9me2 in spermatocytes and inhibited spermatocyte apoptosis [5]. Therefore, it is speculated that WSSJD may also be involved in the regulation of epigenetic modification of sperm or early embryos.
H3K27me3 plays an important regulatory role in the development of sperm and early embryos [11–16], and it is involved in the regulation of gene transcription inhibition [10]. H3K27me3 is widely present in testicular tissues [11]. Polycomb protein SCML2 promotes the modification of spermatogonia H3K27me3 by binding to the promoter region of undifferentiated spermatogonia [12]. H3K27me3 regulates the expression of meiosis-related genes and involves the meiosis of spermatocytes [13]. Moreover, H3K27me3 is still retained in mature sperm of mice, humans, and zebrafish [14–16]. H3K27me3 is genetically inherited in mammals [14–16], and the inhibitory histone marker H3K27me3 in drosophila embryos could be passed to their offspring [17]. H3K27me3 in early embryos can accumulate in the regulatory region of H3K27ac to prevent premature activation of zygotic genome activation genes [17].
Cyclophosphamide (CPA) is a commonly used antitumor and immunosuppressive drug. Its metabolites can bind to DNA and proteins in cells, activate enzymes, and cause cell death [18]. The testis containing the dividing spermatogenic cells at various levels is particularly sensitive to CPA. It is reported that CPA had a high toxic effect on male reproduction and could cause oligospermia and azoospermia [19]. CPA is often used for the establishment of animal models with spermatogenesis disorders [20, 21].
Considering that WSSJD may be involved in the epigenetic regulation of sperms and embryos and that H3K27me3 is a marker involved in the regulation of sperms and early embryo development [11–16], therefore, we aim to investigate the possible effect of WSSJD on the modification of H3K27me3 in sperms or early embryos and early embryo development. The mouse model with spermatogenesis disorders was induced with CPA. The effects of WSSJD on early embryo development and H3K27me3 modification were analyzed. Our findings may provide experimental evidence for demonstrating the therapeutic mechanism of WSSJD on spermatogenesis disorders.
2. Materials and Methods
2.1. Animals
A total of 180 male Kunming mice (10-weeks-old; 35–40 g) and 80 female Kunming mice (8-weeks-old; 25–30 g) were provided by the Changchun Institute of Biological Products Co., Ltd. (Changchun, China). The present study was conducted with approval from the Ethics Committee of Jilin Medical University (Jilin, China). Mice were housed at 23 ± 3°C room temperature, with 55–65% relative humidity, and under a 12 h dark-light cycle. Mice were given free access to a standard laboratory mouse diet and sterile water.
2.2. Preparation of WSSJD
The 15 Chinese herbs of WSSJD, including Panax ginseng, 6 g; Cynomorium songaricum, 9 g; Radix Astragali, 12 g; Epimedium brevicornum, 6 g; Cornu Cervi Nippon Parvum, 1 g; Cistanche deserticola, 9 g; Angelica sinensis, 6 g; Flatstem Milkvetch Seed, 9 g; Rhizoma Dioscoreae, 15 g; Largehead Atractylodes Rhizome, 6 g; Ligusticum wallichii, 3 g; Radix Paeoniae Alba, 6 g; Cinnamomum cassia, 1 g; Costustoot, 1.5 g, and Fructus Foeniculi, 3 g. [1], were purchased from Tongrentang (Beijing, China). These herbs were decocted according to the traditional method of Chinese medicinal decoction [22]. The decoction was subsequently heated at 80°C in a water bath for 6-7 h until the concentration reached 2 g crude drug/ml, and the decoction was stored at 4°C prior to use.
2.3. Animal Model and Treatment
All 180 mice were randomly divided into 3 groups (60 mice per group) of Control, CPA, and WSSJD groups. Mice in the CPA and WSSJD groups were intraperitoneally (i.p.) injected with 80 mg/kg/day CPA (Shanxi Powerdone Pharmaceutics Co., Ltd., Datong, China) for 5 days [23]. Then, mice in the WSSJD group were administered with 12 g crude drug/kg/day of WSSJD by gavage for 30 days. Mice in the control and CPA groups underwent a daily gavage with an equal volume of normal saline throughout the 30-day experimental period. At the end of the experimental period (at day 31), one-half amount of male mice were sacrificed by cervical dislocation. The testes were quickly removed. The epididymis was also quickly removed, punctured with a 26-gauge needle, and incubated at 37°C for 10 min to fully release the sperm from the epididymal tail. The other half of male mice were used to mate with the female mice with superovulation to test their fertility.
2.4. Hematoxylin and Eosin Staining
The testes were fixed with 4% paraformaldehyde, dehydrated by gradient ethanol, transparent in xylene, embedded in paraffin, made into 5 μm sections, and stained with Hematoxylin and Eosin according to routine procedure. The histopathological changes in the seminiferous tubules were observed under a light microscope.
2.5. Immunofluorescence Staining of Sperms
Sperm suspensions from 5 mice of each group were diluted in distilled water, smeared on a cover glass, and dehydrated at room temperature for 2 h. Sperm deagglutination solution (25 mM DTT, 0.2% Triton X-100 and 200 IU/mL heparin) was added dropwise to the smear and incubated in a 37°C incubator for 15 min. The sperm deagglutination solution was discarded, and the 3.7% paraformaldehyde solution was used for fixation for 20 min. After washing with PBS and blocking with 5% BSA for 2 h at room temperature, the sample was incubated with rabbit-derived anti-H3K27me3 (A2363, ABclonal) primary antibody for 2 h. After washing three times with PBS, the goat anti-rabbit FITC-labeled secondary antibody (AS011, ABclonal) was added and incubated for 1 h. Hoechst 33342 (14533, Sigma) was used to stain the sperm nucleus. Finally, the sample was mounted with antifluorescence quenching mounting fluid (AR1109, BOSTER) and observed under the oil microscope of Olympus IX-53 with the microscopic image acquisition system (CellSens Dimension) (Olympus, Tokyo, Japan). Five sections were obtained from each mouse. Five high-power fields (×1000) were randomly selected, and ImageJ software (NIH) was used to analyze the average fluorescence intensity value of H3K27me3 in sperm.
2.6. Embryo Collection and Immunofluorescence Staining
Through observation of vaginal changes and vaginal cytology as described by Byers et al. [24], the estrous cycle of mice was determined. Proestrus mice were selected for follicular stimulation and mating process. Then, female mice were subjected to superovulation treatment of 10IU pregnant mare serum gonadotropin (i.p.) (cat# 200803; Ningbo Second Hormone Factory Co. Ltd., Ningbo, China), and 10IU human chorionic gonadotropin (HCG) (cat# 190703; Ningbo Second Hormone Factory Co. Ltd., Ningbo, China) injection 48 h later. After that, the female mice were caged with male mice at 1 : 1 ratio. The mouse oviducts were obtained at 21 h, 41-42 h, 43-44 h, 45-46 h, and 52 h after HCG injection. The pronuclear embryos, 2-cell embryos, and 3-4 cell embryos were collected from the ampulla of the oviducts. The 0.1% hyaluronidase (H3506, Sigma) was used to remove cumulus cells from the pronuclear embryos. The development rate of embryos at a specific stage was calculated as the number of embryos at that stage divided by the total number of embryos obtained from the oviducts.
The obtained pronuclear embryos and 2-cell embryos were fixed in 3.7% paraformaldehyde solution for 20 min and in 0.1% Trion X-100 in PBS solution for 15 min. After blocking with 5% BSA blocking solution for 1 h, the embryos were incubated with rabbit-derived anti-H3K27me3 (A2363, ABclonal) primary antibody for 2 h. After washing three times with PBS, the embryos were incubated with a goat anti-rabbit FITC-labeled secondary antibody (AS011, ABclonal) for 1 h. After staining with Hoechst 33342 (14533, Sigma), the embryos were mounted and observed by a laser scanning confocal microscope (Olympus, FV1000). ImageJ software was used to analyze the average fluorescence intensity of H3K27me3 on 10 embryos in each group.
2.7. Western Blotting
The 2-cell embryos (n = 60 each group) were subjected to protein lysis (950 μL Laemmli sample buffer + 50 μL β-mercaptoethanol + 0.5 μL protease inhibitor). The proteins were collected after full lysis at room temperature. After separation by SDS-PAGE, the proteins were transferred to the PVDF membrane. The membrane was blocked with 5% skimmed milk for 1 h and then incubated with rabbit polyclonal antibody KDM6A (lysine-specific demethylase 6A) (A8159, Abclonal), rabbit polyclonal antibody EZH2 (Enhancer of zeste homolog2) (A16846, Abclonal), and rabbit polyclonal antibody Lamin A/C (A0249, Abclonal) at 4°C overnight. After washing with PBST, the membrane was incubated with goat anti-rabbit HRP-labeled secondary antibody (AS041, Abclonal) for 2 h at room temperature. Then, the enhanced chemiluminescence color development was performed. The membrane was scanned using ChemiDOC XRS + imaging systems (Bio-Rad Laboratories, Hercules, CA, USA). ImageJ image analysis software was used to analyze the relative expression levels of KDM6A and EZH2.
2.8. Quantitative Real-Time PCR (qRT-PCR)
RNAs were extracted from embryos (n = 60 each group) using Rneasy Micro Kit (Qiagen, Hilden, Germany) and transcribed into cDNA. Reverse transcription was performed in a 20 μL reverse transcription system (1 μL random primers, 1 μL Oligo dT Primer, 4 μL Reverse Transcription buffer, and 1 IU/mL PrimeScriptTEMRT Enzyme Mix I (TaKaRa, Dalian, China)). The mRNA levels of HSPA1A (recombinant heat shock 70 kDa protein 1A) , MYC (myelocytomatosis oncogene homolog), EIF1AX (eukaryotic translation initiation factor 1AX), ERV4 (endogenous retroviral sequence 4), and ZSCAN4 (zinc finger and SCAN domain containing 4) were measured with SYBR Premix Ex Taq (Takara, Dalian, China) on the iQ5 Multicolor Real-time PCR Detection System (Bio-RAD). The specific primers used are shown in Table 1. Real-time PCR reaction system included Premix Ex TaqTM II, forward/reverse primers and cDNA template. PCR reaction conditions were 95°C predenaturation for 30 seconds, 40 cycles of 95°C denaturation for 5 seconds, 60–62°C annealing for 20 seconds, and 72°C extension for 30 seconds. The housekeeping gene GAPDH was used as an internal reference. The 2−△△Ct method was used to calculate the relative expression level of the target gene.
Gene
Primer sequences (5′ to 3′)
Forward
Reverse
HSPA1A
TGGTGCAGTCCGACATGAAG
GCTGAGAGTCGTTGAAGTAGGC
MYC
ATGCCCCTCAACGTGAACTTC
CGCAACATAGGATGGAGAGCA
EIF1AX
GGAGACTACTGTTCTGGGTAGC
GTTACCGAGAGATCAAACACCG
ERV4
GGAGACTACTGTTCTGGGTAGC
GTTACCGAGAGATCAAACACCG
ZSCAN4
CCATGAGATCATACACATGCCAG
CAGTCAGATCTGTGGTAATTCCTC
GAPDH
ATTTGGCCGTATTGGGCG
TCTCGCTCCTGGAAGATGGT
Note: HSPA1A, recombinant heat shock 70 kDa protein 1A; MYC, myelocytomatosis oncogene homolog; EIF1AX, eukaryotic translation initiation factor 1AX; ERV4, endogenous retroviral sequence 4; and ZSCAN4, zinc finger and SCAN domain containing 4.
... Cases of malformation have been described in newborns of mothers who received cyclophosphamide in the first months of pregnancy. The drug is contraindicated in pregnancy, particularly in the first trimester [125,126]. ...
Pregnancy is not contraindicated in kidney transplant women but entails risks of maternal and fetal complications. Three main conditions can influence the outcome of pregnancy in transplant women: preconception counseling, maternal medical management, and correct use of drugs to prevent fetal toxicity. Preconception counseling is needed to prevent the risks of an unplanned untimely pregnancy. Pregnancy should be planned ≥2 years after transplantation. The candidate for pregnancy should have normal blood pressure, stable serum creatinine <1.5 mg/dL, and proteinuria <500 mg/24 h. Maternal medical management is critical for early detection and treatment of complications such as hypertension, preeclampsia, thrombotic microangiopathy, graft dysfunction, gestational diabetes, and infection. These adverse outcomes are strongly related to the degree of kidney dysfunction. A major issue is represented by the potential fetotoxicity of drugs. Moderate doses of glucocorticoids, azathioprine, and mTOR inhibitors are relatively safe. Calcineurin inhibitors (CNIs) are not associated with teratogenicity but may increase the risk of low birth weight. Rituximab and eculizumab should be used in pregnancy only if the benefits outweigh the risk for the fetus. Renin–angiotensin system inhibitors, mycophenolate, bortezomib, and cyclophosphamide can lead to fetal toxicity and should not be prescribed to pregnant women.
... MMF exposure especially after the first trimester increases the risk of miscarriage and congenital malformation [109], and practically should be stopped at least 3-6 months prior to conception to ensure disease control is maintained with the new agent(s) [47]. CYC is also teratogenic, associated with premature ovarian failure and increases miscarriage rate [110]. ...
Lupus is a heterogenous multisystem autoimmune disease whereby nephritis is one of its most common cause of overall morbidity and mortality. Accurate, timely diagnosis and effective treatment in lupus nephritis (LN) remains a challenge to many clinicians including those who are directly involved in the daily care of these patients. Despite significant improvement in patients’ survival rate in recent years, in this era of precision medicine, there is pressing need to further improve our understanding and management of this disease. Our chapter would shed light on the key issues in LN including recent advances in our scientific understanding of its’ pathophysiology, major challenges and treatment strategies.
... However, in cases where ERS becomes prolonged or too severe for UPR-based mitigation, apoptosis is triggered (Lin et al. 2019); it is also becoming evident that ERS signals can lead to an increase in general autophagy (Smith and Wilkinson 2017). In recent years, it has well identified that excessive cell apoptosis can be a principle cause of embryo malformation (Rengasamy 2017), and autophagy has also been confirmed to be involved in it . In addition, cyclins (Ccns) play an important role in embryo development and teratogenic processes (Nemer and Horb 2007;Polański et al. 2012). ...
Intrauterine exposure to flutamide not only causes abnormal development of the reproductive organs in male offspring, but also damages ovaries and uteri. The unfolded protein response (UPR) is believed to play an important role in embryo development and teratogenic processes. In the present study, pregnant mice were administered either flutamide (300 mg kg⁻¹ day⁻¹, p.o.) on an equivalent volume of soybean oil (control) on Days 12–18 of gestation. Eight weeks after birth, female offspring in the flutamide-treated group had a lower bodyweight and lower ovarian and uterine weights, but there was no significant difference in uterine and ovarian weights normalised by bodyweight between the flutamide-treated and control groups. Furthermore, histopathological changes were observed in all uteri and ovaries in the flutamide-treated group, with fewer and less-developed follicles in the ovaries. In both the uteri and ovaries, flutamide increased the expression of UPR members, although the expression of cell cycle-related genes remained unchanged compared with the control group. Flutamide increased the expression of all autophagy- and apoptosis-related genes evaluated in the uterus, as well as some in the ovary. The results suggest that the in utero exposure of mice to flutamide may contribute to uterine and ovarian damage in the offspring, with endoplasmic reticulum stress possibly triggered by the UPR leading to the induction of excessive autophagy and apoptosis.
... It was not surprising that prenatal alcohol exposure was associated with congenital anomalies, despite being adjusted for by other risk factors including older maternal age, low socioeconomic status, abnormal BMI, and gestational diabetes/hypertension. Congenital anomalies such as ventricular septal defects, cleft lips with cleft palates, low-set ears, hydrocephalies, and Down syndrome, have been associated with a number of predictors including prenatal exposure to alcohol [22], chemotherapy [23], cannabis [24], and methadone [25]. While first trimester alcohol exposure was not associated with any adverse birth outcomes in our study population, previous studies have emphasized that first trimester drinking alters placental perfusion and fetal oxygen availability, which affects fetal growth and development [26]. ...
A few studies to date have examined the association between prenatal exposure to alcohol, tobacco, and coffee, and congenital complications/adverse birth outcomes among South Korean populations. Thus, this study analyzed the data of 1675 Korean women with birth experience within the last 3 years for pregnancy-related health and nutritional behaviors and relative outcomes. During their pregnancies, 11.58% of the study population consumed alcohol at least once, 1.43% drank throughout all three trimesters, 1.13% smoked, 25.43% were exposed to secondhand smoking, and 28.18% consumed 3 coffees or more every day. Prenatal alcohol exposure was associated with 11.24 times increased risk of birth defects/disabilities [Odds Ratio (OR): 11.24, 95% Confidence Interval (CI) 1.07–117.86] and 10.66 times increased risk of inherited metabolic diseases (OR: 10.66, 95% CI: 1.08–104.82). Prenatal secondhand smoke exposure (OR: 1.62, 95% CI: 1.01–2.62) and coffee consumption (OR: 1.92, 95% CI: 1.22–3.03) was associated with increased risk of low birth weight. Such results were in alignment with that of previous studies and confirmed that prenatal alcohol, tobacco, and coffee exposure can have detrimental neonatal and maternal consequences.
... Consequences of prenatal exposure to cyclophosphamide were reviewed in a recent study [111]. Side effects after second or third trimester exposure involved intrauterine growth restriction; this was confirmed in a cohort of 24 fetuses exposed to cyclophosphamide [105]. ...
Simple Summary
The use of anti-cancer treatments in pregnant women is an increasingly common situation given the increasing age at first pregnancy. The aim of this study is to review data concerning the transplacental transfer of drugs that can be used in the management of the most common pregnancy-associated cancers. This work is intended to guide clinicians in the choice of the treatments that offer the best benefit–risk ratio for the mother and the fetus and to deliver balanced information to pregnant patients.
Abstract
The occurrence of cancer during pregnancy is observed in 1 in 1000 pregnancies and is expected to increase given the trend of delaying childbearing. While breast cancer is the most common, the incidence of other cancers, such as cervical, ovarian, and lung cancers as well as hemopathies and melanomas, is also increasing. Thus, cancer occurrence in pregnant women raises questions of management during pregnancy and, especially, assessment of the treatment benefit–risk ratio to ensure optimal management for the mother while ensuring the safety of the fetus. Chemotherapy remains a cornerstone of cancer management. If the use of anticancer agents appears possible during pregnancy, while avoiding the first trimester, the extent of placental transfer of different anticancer agents varies considerably thereafter. Furthermore, the significant physiological pharmacokinetic variations observed in pregnant women may have an impact on the placental transfer of anticancer agents. Given the complexity of predicting placental transfer of anticancer agents, preclinical studies are therefore mandatory. The aim of this review was to provide updated data on in vivo and ex vivo transplacental transfer of anticancer agents used in the management of the most common pregnancy-associated cancers to better manage these highly complex cases.
... [8] Some of these environmental factors include maternal exposure to thalidomide, alcohol, cyclophosphamide and rubella, particularly in the first trimester of pregnancy. [11,12] Congenital hand anomalies could occur as isolated defects, in combination with anomalies in other regions of the body or as a component of syndromes, for example, Poland syndrome and Holt-Oram syndrome. [4,13,14] Swanson classified congenital hand anomalies into seven broad types as failure of formation of parts (arrest of development), failure of differentiation (separation) of parts, duplication, overgrowth, undergrowth, constriction band syndrome and generalised skeletal abnormalities. ...
Context:
Although congenital hand anomalies are among the more common musculoskeletal anomalies worldwide, we do not know its prevalence in our practice.
Aims:
The aim of the study was to determine the pattern of congenital hand anomalies presenting to our tertiary plastic surgery outpatient service in South-Western Nigeria.
Materials and methods:
This is a cross-sectional retrospective analysis of outpatient cases of congenital hand anomalies presenting over a 10-year period. Descriptive and inferential statistics were performed using frequencies, Student's t-test and Chi-square as appropriate. The data were analysed using IBM SPSS Statistics 23.0. The statistical significance value was set at P < 0.05.
Results:
One hundred and twenty-two cases were identified. The highest number of cases was seen in the year 2012, 23 patients (19.3%). There was a male preponderance of 66 patients (55.1%). Thirty-two patients (26.2%) presented as neonates and 36 (29.5%) as infants. Bilateral anomalies were seen in 67 patients (54.9%). The most common anomaly was failure of differentiation, 88 patients (72.1%) followed by duplication, 26 patients (21.3%). Syndactyly with 43 patients (35.2%) was the most common anomaly under failure of differentiation. No significant associations were found between the type of anomaly and gender or laterality.
Conclusions:
Syndactyly was the most common congenital hand anomaly in this study. There was a preponderance of bilateral involvement in both syndactyly and polydactyly.
... The reproductive effects of PM exposure have been well characterized by our group and others, which include loss of primordial and primary follicles in mice [24][25][26][27], antral follicles in rats [28], and amenorrhea, premature ovarian failure, and infertility in women and young girls [29]. In addition to fertility issues, CPA exposure has been associated with congenital malformations in offspring exposed to CPA in utero as well as pregestational germ cell exposures [30]. Increasing cancer survival rates present the need to identify the mechanisms by which cancer therapies or other chemical exposures cause ovarian damage. ...
Ataxia telangiectasia mutated (ATM) protein recognizes and repairs DNA double strand breaks (DSB) through activation of cell cycle checkpoints and DNA repair proteins. Atm gene mutations increase female reproductive cancer risk. Phosphoramide mustard (PM) induces ovarian DNA damage and destroys primordial follicles, and pharmacological ATM inhibition prevents PM-induced follicular depletion. Wild-type (WT) C57BL/6 or Atm+/- mice were dosed once intraperitoneally with sesame oil (95%) or PM (25 mg/kg) in the proestrus phase of the estrous cycle and ovaries harvested 3 days thereafter. Atm+/- mice spent ~ 25% more time in diestrus phase than WT. LC-MS/MS on ovarian protein was performed and bioinformatically analyzed. Relative to WT, Atm+/- mice had 64 and 243 proteins increased or decreased in abundance, respectively. In WT mice, PM increased 162 and decreased 20 proteins. In Atm+/- mice, 173 and 37 proteins were increased and decreased, respectively, by PM. Exportin-2 (XPO2) was localized to granulosa cells of all follicle stages and was 7.2-fold greater in Atm+/- than WT mice. Cytoplasmic FMR1-interacting protein 1 (CYFIP1) was 6.8-fold lower in Atm+/- mice and was located in the surface epithelium with apparent translocation to the ovarian medulla post-PM exposure. PM induced γH2AX, but fewer γH2AX positive foci were identified in Atm+/- ovaries. Similarly, cleaved caspase-3 was lower in the Atm+/- PM-treated, relative to WT mice. These findings support ATM involvement in ovarian DNA repair and suggest that ATM functions to regulate ovarian atresia.
... Use during second and third trimester is associated intrauterine growth retardation, small for gestational age, hearing defects, neonatal pancytopenia, and craniofacial deformities. [23] Malignancies ...
Cyclophosphamide (CYC) is one of the most potent antineoplastic and immunosuppressant agents. It is used as a drug of choice in many organ-threatening manifestations of systemic autoimmune rheumatic diseases (AIRDs) such as lupus nephritis, antineutrophil cytoplasmic antibody-associated vasculitis, classical polyarteritis nodosa, and myositis. It is also used in connective tissue disease-related interstitial lung disease and Behcet's disease. However, its use may be limited by the toxicities including its adverse effects on gonads in the childbearing age group, severe infections, hemorrhagic cystitis, and malignancies associated with prolonged usage. As a result, mycophenolate, azathioprine, and rituximab have gained popularity over CYC as an induction and maintenance agent in many AIRDs. However, in the event of failure of aforementioned agents in aggressive rheumatic diseases or in a resource-limited setting, the usage of CYC continues to be a useful therapeutic strategy. In this review, we have appraised the adverse effects of CYC therapy in AIRDs which would help clinicians in taking informed decisions regarding CYC usage.
... Systemic lupus erythematosus (SLE) is an autoimmune chronic inflammatory disease more prevalent among women at reproductive age [1]. Due to the period of disease exacerbation, clinical control is achieved with the use of antimalarials, glucocorticosteroids and immunosuppressants, some of which have teratogenic effects if administered during pregnancy [2][3][4]. It is recommended that pregnancy occur during the disease remission periods, and it is important that women with SLE at the reproductive age receive counselling about the use of highly effective contraception. ...
Purpose
The disease status and thromboembolic events in women with systemic lupus erythematosus (SLE), with and without anti-phospholipid syndrome (APS), were evaluated before and after placement of the 52-mg levonorgestrel-releasing intrauterine system (LNG-IUS).
Methods
A retrospective cohort study, with review of medical records of SLE women, who received an LNG-IUS placement between January 2007 and December 2016, carried out at the University of Campinas Medical School, Brazil. The outcomes included the disease activity (SLEDAI-2K) and damage index scores (SLICC/ACR-DI) presented for each year of device use, as well as venous/arterial thrombotic events, insertion up to a median of 5 years. The author’s used χ², Fisher’s exact and the Mann–Whitney tests for analysis and generalized estimating equations for score comparison.
Results
The study evaluated 46 women with SLE, 18 with and 28 without APS; the mean age (± standard deviation [SD]) was 31.8 (SD ± 8.3) years old. The length of follow-up after LNG-IUS placement was 5.6 (SD ± 2.7) and 4.1 (SD ± 2.3) years for the groups with and without APS, respectively. Comparison of the groups found that the SLEDAI and SLICC mean scores were low for both at baseline, without variations through the follow-up. After LNG-IUS placement, two women presented three thrombotic arterial events, and one of them died from causes unrelated to LNG-IUS use.
Conclusions
Our results, although restricted, provide information to policymakers and health professionals that the use of a 52 mg LNG-IUS over a 5-year median did not increase disease activity or damage index scores among women with SLE, with and without APS.
... Teratogenicity of cyclophosphamide is well demonstrated in animals. Cases of malformation have been described in newborns of mothers who received cyclophosphamide in the first months of pregnancy [55][56][57][58]. The drug is contraindicated in pregnancy (FDA Class D). ...
Women affected by autoimmune diseases, organ transplantation, or neoplasia need to continue immunosuppressive treatment during pregnancy. In this setting, not only a careful planning of pregnancy, but also the choice of drugs is critical to preventing maternal complications and minimizing the fetal risks. Some immunosuppressive drugs are teratogenic and should be replaced even before the pregnancy, while other drugs need to be managed with caution to prevent fetal risks, including miscarriage, intrauterine growth restriction, prematurity, and low birth weight. In particular, the increasing use of biologic agents raises the question of their compatibility with reproduction. In this review we present data on the indication and safety in pregnancy of the most frequently used immunosuppressive drugs.
... 14 To the best of our knowledge, only cyclophosphamide has been identified as a possible prenatal inductor of synostosis. 15 Vincristine or Actinomycin (main drugs in SIOP Wilm's 2001 protocol) have not been reported in the literature as possible causative so we cannot relate them as etiopathogenic agents in our patient. ...
Background:
The polymalformative syndromes and craniofacial anomalies association is a well-known phenomenon in patients with Crouzon's, Pfeiffer, Apert or Muenke disease. Recently, other less frequent pathologies, such as Alagille syndrome, are showing an association with alterations in the development of cranial sutures resulting in serious cosmetic defects and neurological disorders.
Case description:
The authors report an exceptional case of a 30-month-old girl, nephroblastoma survivor, diagnosed with Alagille syndrome who is referred to our department with progressive anterior plagiocephaly and premature left coronal suture closure associated with a large compensating right bossing. Despite the age of the patient, we offered aggressive surgical treatment performing a new forehead harvested from skull vertex with orbital rim reconstruction.
Conclusions:
Alagille syndrome is a complex multisystem pathology with a poor craniosynostosis association and only three cases have been described in the literature.
... It was once assumed that the maternal environment had little effect on the embryo prior to embryonic implantation (when the embryo adheres to the uterine wall to receive oxygen and nutrients from the mother); however, many studies have since shown that this maternal environment can influence proper development, as the pre-implantation embryo is in direct contact with the cells of the mother's reproductive tract. For instance, in animal models, exposing pre-implantation embryos to chemotherapy drugs such as cyclophosphamide can induce various congenital malformations (Rengasamy 2017). However, most studies on the impacts of pre-implantation exposure have been done in in-vitro models. ...
Exposure to alcohol during in-utero development can permanently change the developmental programming of physiological responses, thereby increasing the risk of neurological illnesses during childhood and later adverse health outcomes associated with fetal alcohol spectrum disorder (FASD). There is an increasing body of evidence indicating that exposure to alcohol during gestation triggers lasting epigenetic alterations in offspring, long after the initial insult; together, these studies support the role of epigenetics in FASD etiology. However, we still have little information about how ethanol interferes with the fundamental epigenetic reprogramming wave (e.g., erasure and re-establishment of DNA methylation marks) that characterizes pre-implantation embryo development. This review examines key epigenetic processes that occur during pre-implantation development and especially focus on the current knowledge regarding how prenatal exposure to alcohol during this period could affect the developmental programming of the early stage pre-implantation embryo. We will also outline the current limitations of studies examining the in-vivo and in-vitro effects of alcohol exposure on embryos and underline the next critical steps to be taken if we want to better understand the implicated mechanisms to strengthen the translational potential for epigenetic markers for non-invasive early detection, and the treatment of newborns that have higher risk of developing FASD.
Globally, almost nine million women are diagnosed with cancer each year. Nearly every type of cancer affects the female reproductive system. This book is a comprehensive reference for the gynecologic care of women who have been directly impacted by cancer. Providing streamline management approaches to common clinical problems, the text is split into two sections. The first addresses common gynecologic concerns for all cancer patients, with chapters covering topics such as fertility assessment and preservation options, managing sexual health, and cancer and pregnancy. The second section addresses gynecologic considerations based on specific cancer sites including breast cancer, head and neck cancers and leukemias. Representative patient vignettes are included at the end of each chapter to reinforce clinical guidance, along with bulleted 'take home points' for rapid information access.
Aims:
Azithromycin is widely used in clinical practice for treating maternal infections during pregnancy. Meanwhile, azithromycin, as an "emerging pollutant", is increasingly polluting the environment due to the rapidly increasing usage (especially after the COVID-19). Previous studies have suggested a possible teratogenic risk of prenatal azithromycin exposure (PAzE), but its effects on fetal multi-organ development are still unclear. This study aimed to explore the potential impacts of PAzE.
Materials and methods:
We focused on pregnancy outcomes, maternal/fetal serum phenotypes, and fetal multiple organ development in mice at different doses (50/200 mg/kg·d) during late pregnancy or at 200 mg/kg·d during different stages (mid-/late-pregnancy) and courses (single-/multi-course).
Key findings:
The results showed PAzE increased the rate of the absorbed fetus during mid-pregnancy and increased the intrauterine growth retardation rate (IUGR) during late pregnancy. PAzE caused multiple blood phenotypic changes in maternal and fetal mice, among which the number and degree of changes in fetal blood indicators were more significant. Moreover, PAzE inhibited long bone/cartilage development and adrenal steroid synthesis, promoting hepatic lipid production and ovarian steroid synthesis in varying degrees. The order of severity might be bone/cartilage > liver > gonads > other organs. PAzE-induced multi-organ alterations differed in stages, courses doses and fetal sex. The most apparent changes might be in high-dose, mid-pregnancy, multi-course, and female, while there was no typical rule for a dose-response relationship.
Significance:
This study confirmed PAzE could cause fetal developmental abnormalities and multi-organ functional alterations, which deepens the comprehensive understanding of azithromycin's fetal developmental toxicity.
Medication during pregnancy is widespread, but there are few reports on its fetal safety. Recent studies suggest that medication during pregnancy can affect fetal morphological and functional development through multiple pathways, multiple organs, and multiple targets. Its mechanisms involve direct ways such as oxidative stress, epigenetic modification, and metabolic activation, and it may also be indirectly caused by placental dysfunction. Further studies have found that medication during pregnancy may also indirectly lead to multi-organ developmental programming, functional homeostasis changes, and susceptibility to related diseases in offspring by inducing fetal intrauterine exposure to too high or too low levels of maternal-derived glucocorticoids. The organ developmental toxicity and programming alterations caused by medication during pregnancy may also have gender differences and multi-generational genetic effects mediated by abnormal epigenetic modification. Combined with the latest research results of our laboratory, this paper reviews the latest research progress on the developmental toxicity and functional programming alterations of multiple organs in offspring induced by medication during pregnancy, which can provide a theoretical and experimental basis for rational medication during pregnancy and effective prevention and treatment of drug-related multiple fetal-originated diseases.
Congenital disorders of the eye are amongst the major causes of vision reduction in children and they are often part of a syndrome. Recent advances in sequencing technology and molecular pathology, have significantly increased our understanding of genetic basis of ocular diseases and molecular control of eye development. Molecular tests based on targeted or expanded analysis of gene panels are available and have become important tools for diagnostic confirmation, prognostication, molecular targeted therapy, and genetic counseling of many ophthalmic diseases, such as cataract, retinoblastoma and retinal dystrophies. Abnormalities of the periorbital tissues, nose, and ear can also point to pathology elsewhere or be syndromic. Congenital hearing loss is one of the most frequent birth defects; and genetic causes account for a significant proportion of these, many being syndromic. There is a growing body of evidence that ciliopathies are responsible for some sensory defects or developmental abnormalities in the eye, ear or olfaction.
Rheumatic diseases affect women during their reproductive years. Many women with rheumatic diseases become pregnant; some undergo pregnancy termination. However, there are no official guidelines on pregnancy termination in patients with rheumatic diseases. This work provides an overview of factors that health care professionals must consider. We highlight areas that require further studies and the importance of pregnancy planning and contraception counseling. Patients with rheumatic diseases need to be informed of adverse maternal and fetal outcomes of pregnancy to make informed reproductive decisions and reduce the need for pregnancy terminations.
This authoritative textbook provides a much-needed guide for postgraduate trainees preparing for the European Board and College of Obstetrics and Gynaecology (EBCOG) Fellowship examination. Published in association with EBCOG, it fully addresses the competencies defined by the EBCOG curriculum and builds the clinical practice related to these competencies upon the basic science foundations. Volume 1 covers the depth and breadth of obstetrics, and draws on the specialist knowledge of four highly experienced Editors and over 100 contributors from across Europe, reflecting the high-quality training needed to ensure the safety and quality of healthcare for women and their babies. It incorporates key international guidelines throughout, along with colour diagrams and photographs for easy understanding. This is an invaluable resource, not only for postgraduate trainees planning to sit the EFOG examination, but also for practising specialists looking to update their knowledge and skills to meet the ever-evolving complexity of clinical practice.
Dr Susan Hou began her illustrious nephrology career at a time when pregnancy in women with chronic kidney disease (CKD) was hazardous and actively discouraged. Her pioneering research in women’s health provided much of the early outcome data that shaped our current understanding of CKD and pregnancy. Although many uncertainties regarding optimal management of this vulnerable patient group remain, recent decades have witnessed important advances and renewed interest in improving care for pregnant women with CKD. Many nephrologists have been inspired by Dr Hou’s lifetime of work and are grateful for her generous collaborations. In this In Practice Review, we honor her legacy by providing an update of current literature and clinical management guidance in the context of a clinical case vignette that challenges us to consider the many complex aspects to the counseling and care of women with CKD who desire a pregnancy.
Pregnancy requires several physiological adaptations from the maternal organism, including modifications in the glomerular filtration rate and renal excretion of several products. Chronic kidney disease (CKD) can negatively affect these modifications and consequently is associated with several adverse maternal and fetal adverse outcomes (gestational hypertension, progression of renal disease, pre-eclampsia, fetal growth restriction, and preterm delivery). A multidisciplinary vigilance of these pregnancies is essential in order to avoid and/or control the harmful effects associated with this pathology. Dialysis and transplantation can decrease the risks of maternal and fetal complications, nonetheless, the rates of complications remain high comparing with a normal pregnancy. Several recent developments in this area have improved quality and efficacy of treatment of pregnant women with CKD. This article summarizes the most recent literature about CKD and pregnancy.
Cancer during pregnancy is relatively rare but is increasing in frequency in countries in which the maternal child-bearing age continues to rise. The complexities of medical decision making are underscored by the need to weigh the potential benefits of any intervention for the mother against the risks to the fetus. A majority of diagnostic evaluations can be performed safely in the setting of pregnancy and should not be delayed. Noninvasive prenatal testing that shows discordance with fetal karyotype can be a clue to an underlying maternal malignancy. After diagnosis, a multidisciplinary team should formulate a care plan for both the mother and the fetus. Key topics for discussion should include the mother's prognosis, standard treatment plan, and predictions of how modifications for a continuing pregnancy will affect the treatment plan and overall prognosis. In the context of this knowledge, frank discussions about pregnancy termination should be addressed with the patient, if appropriate. Selection of a plan for oncologic management in the case of a pregnant woman is based on the type of cancer, the tumor biology, and the tumor stage. Additional complexities for pregnant patients are typically related to the gestational age of the fetus, the dynamic physiologic changes of pregnancy, and the limited safety data for administration of most anticancer therapies during pregnancy. In this article, we summarize data related to different classes of anticancer therapies as well as considerations for the management of selected cancers. Finally, we provide some key principles that should be considered in the management of patients with cancer during pregnancy.
Conception, pregnancy and childbirth are a biological necessity, a unique privilege and birthright and yet something that mothers suffering with vasculitis cannot take for granted. Takayasu arteritis and Behcet’s disease mainly, but also ANCA associated vasculitis and IgA vasculitis are of relevance in this population. A diagnosis of systemic vasculitis has meant a lower chance of stable relationships, lower fertility, lower conception rates and worse foetal outcomes. Systemic vasculitis or it’s treatment may affect fertility by direct involvement of the reproductive organs, teratogenicity, induced infertility, or by producing a state inducing an inability of the maternal body to carry a foetus to term. Unfortunately, there is sometimes the need for medical termination. Pregnancy outcomes are poorer in women with a diagnosis of vasculitis, but this may be truer for women with Takayasu arteritis than Behcet’s disease. In spite of the many challenges in looking after expectant mothers with systemic vasculitis, we suggest some basic principles in this chapter to improve maternal and foetal outcomes. This is largely an evidence-free zone and this stream of medicine involving motherhood, babies and life-threatening rare diseases will remain emotive and therefore difficult, calling for the best that clinicians can offer.
This book is intended as a guide to help the clinician determine where a visual problem is a drug-induced ocular side effect. We continually review spontaneous case reports from the National Registry of Drug-Induced Ocular Side Effects, the World Health Organization, the US Food and Drug Administration, and the world literature. We have attempted to classify a suspected adverse event with our impression to causality (i.e. certain, probable, unlikely, conditional/unclassified). This chapter discusses oncolytic drugs including antineoplastic drugs.
To study the influence of distraction osteogenesis (DO) on the maxillary growth as first-stage treatment of palatal defect. The uniform palate defect experimental animal models (21 miniature pigs) were established surgically. Then animals were randomly divided into negative control group (A, n = 6), conventional surgery group (B, n = 6), and distraction osteogenesis group (C, n = 9) respectively. The group A underwent none treatment as control group, the group B were undergoing a conventional defect repair surgery, and the group C were undergoing a distraction osteogenesis treatment. Cone beam computed tomography examination was performed monthly to analyze the growth of maxilla for 6 months. One pig of group C was randomly sacrificed at 2, 4, and 8 weeks after the completion of DO and the tissue of distraction gap was stained with hematoxylin-eosin and Masson staining. At the end of 6th months, all pigs were sacrificed and tissues of the surgical area were stained as previous described. The palate defect was repaired by the distraction osteogenesis with the successful bone formation on the distraction gap. Group A and group C kept a similar growth rate, but that of group B was relatively slow. Distraction osteogenesis is efficient and successful for closing the defect of palate and there is no significant disturbance on the subsequent growth of the maxilla.
Autoimmune bullous diseases (AIBD), including pemphigus, bullous pemphigoid, epidermolysis bullosa acquisita, mucous membrane pemphigoid, and pemphigoid gestationis, pose significant therapeutic challenges, especially in pregnant and post-partum breastfeeding patients or those planning to conceive. Data on the safety and efficacy of therapeutic interventions during the perinatal period are lacking because randomized controlled trials are typically not performed in this setting. However, many of the treatments for AIBD are also used in other diseases, so data can be extrapolated from studies or case reports in these other patient populations. It appears that many of the treatments for AIBD can adversely affect the fetus or neonate, and alterations in immune status caused by pregnancy-associated hormonal changes can negatively impact disease control. This article summarizes and weighs the risks and benefits of the various agents used to treat AIBD during pregnancy. We also present the available information on lactation as well as effects on male fertility.
ResearchGate has not been able to resolve any references for this publication.