Available via license: CC BY 4.0
Content may be subject to copyright.
ORIGINAL ARTICLE
Evolution and systematics of Green Bush-crickets (Orthoptera:
Tettigoniidae: Tettigonia) in the Western Palaearctic: testing
concordance between molecular, acoustic, and morphological data
Beata Grzywacz
1
&Klaus-Gerhard Heller
2
&Elżbieta Warchałowska-Śliwa
1
&
Tatyana V. Karamysheva
3
&Dragan P. Chobanov
4
Received: 14 June 2016 /Accepted: 16 November 2016
#The Author(s) 2016. This article is published with open access at Springerlink.com
Abstract The genus Te t t i g o n ia includes 26 species distribut-
ed in the Palaearctic region. Though the Green Bush-crickets
are widespread in Europe and common ina variety of habitats
throughout the Palaearctic ecozone, the genus is still in need
of scientific attention due to the presence of a multitude of
poorly explored taxa. In the present study, we sought to clarify
the evolutionary relationships of Green Bush-crickets and the
composition of taxa occurring in the Western Palaearctic.
Based on populations from 24 disjunct localities, the phylog-
eny of the group was estimated using sequences of the cyto-
chrome oxidase subunit I (COI) and the internal transcribed
spacers 1 and 2 (ITS1 and ITS2). Morphological and acoustic
variation documented for the examined populations and taxa
was interpreted in the context of phylogenetic relationships
inferred from our genetic analyses. The trees generated in
the present study supported the existence of three main line-
ages: BA^—composed of all sampled populations of
Tettigonia viridissima and the Tettigonia vaucheriana com-
plex, BB^—comprising Tettigonia caudata,Tettigonia
uvarovi, and the Tettigonia armeniaca complex, and BC^—
consisting of Tettigonia cantans. The present study provides
the first phylogenetic foundation for reviewing the systematics
of Tettig on i a (currently classified mostly according to mor-
phological characteristics), proposing seven new synonymies.
Keywords Tett ig o n i a .mtDNA .rDNA .Phylogeny .
Bioacoustics
Introduction
Genus Tet t igon i a Linnaeus, 1758 presently includes 26 recog-
nized species (Eades et al. 2016) distributed in the Palaearctic
ecozone and belongs to the long-horned orthopterans or the
bush-crickets (Ensifera, Tettigonioidea). Tettig o n i a ,popularly
known as the Green Bush-crickets, are generally large green
orthopterans with moderately slender body and legs and well-
developed wings that inhabit the plant cover searching for
their food (usually smaller insects or plant tissues).
Tettigon i a is one of the most notable Old World example with
two centers of diversity: one in the Mediterranean–Pontic re-
gion (see, e.g., Ramme 1951;Pinedo1985;Chobanovetal.
2014) and another in the Japanese archipelago (see Ichikawa
et al. 2006; Kim et al. 2016). Both regions are characterized by
a similar number of endemic taxa and insufficient knowledge
regarding the taxonomy and systematics of Green Bush-
crickets (Ichikawa et al. 2006; Chobanov et al. 2014; own
unpublished data).
Despite the fact that several species of Green Bush-crickets
are quite well known and have been the subject of detailed
neuro-ethological studies (e.g., Zhantiev and Korsunovskaya
1978; Schul 1998), others remain poorly known from single
specimens, and even nowadays, the discovery of new species
continues (Ogawa 2003;Ichikawaetal.2006;Chobanovetal.
2014; Storozhenko et al. 2015). Data on the systematics of this
genus involve piecemeal morpho-acoustic studies conducted
for geographically restricted areas or focused on
*Beata Grzywacz
grzywacz@isez.pan.krakow.pl
1
Institute of Systematics and Evolution of Animals, Polish Academy
of Sciences, Sławkowska 17, 31-016 Krakow, Poland
2
Grillenstieg 18, 39120 Magdeburg, Germany
3
Institute of Cytology and Genetics of the Siberian Branch of the
Russian Academy of Sciences, Novosibirsk, Russia
4
Institute of Biodiversity and Ecosystem Research, Bulgarian
Academy of Sciences, 1 Tsar Osvoboditel Boul, 1000 Sofia, Bulgaria
Org Divers Evol
DOI 10.1007/s13127-016-0313-3
morphological groups of species (e.g., Heller 1988;Rhee
2013;Chobanovetal.2014). Our recent morphological and
acoustic studies on Te t t igonia, concentrated on the Western
Palaearctic, revealed a number of conflicts within the pub-
lished data when trying to identify certain populations and
develop hypotheses about the systematics of the group (own
unpublished data). The latter further supports the need to use
new markers to test the systematic position of some taxa and
unravel the evolutionary history of this genus.
The evolution of acoustic communication systems in
orthopterans has led to high levels of acoustic specializa-
tion. As acoustic signals are important for intraspecific and
sex recognition as well as for interspecific isolation
(Paterson 1985; Hochkirch and Lemke 2011), they are of
great significance for studying the processes underlying
evolutionary radiation. Acoustic diversity within bush-
cricket genera varies from very low with a more or less
uniform pattern of the male calling song (cf. Heller 2006;
Çıplak et al. 2009)toveryhighwithagreatvarietyofsong
types, especially in sympatric taxa, even within groups of
closely related species (cf. Heller 1988,1990,2006;
Chobanov and Heller 2010,etc.).
In Tett i g o n ia, song differences between species (especially
well expressed in sympatric taxa) may express in different
syllable arrangement and repetition rate, echeme length, and
duty cycle. Some differences are also found in the carrier
frequency of the song. In some species (e.g., Tettigonia
cantans), females are not very sensitive to the conspecific
structure of the song and thus may respond to heterospecific
males (Schul et al. 1998), while in other species (i.e.,
Tettigonia caudata), females rely on the minimum duty cycle
of the echemes, thus neglecting the fine song structure (Schul
1998). In Tettigonia viridissima, song recognition based on
temporal clues has been shown to be more complicated.
Here, females evaluate the pause within disyllabic echemes
and respond only to the species-specific echeme structure
(Schul 1998).
In the present study, we aim to evaluate phylogenetic rela-
tionships within Tettigonia. We based our study on a genetic
dataset that was used as a basis for mapping acoustic and
morphological characters in an attempt to track the evolution-
ary paths of the acoustic communication in this genus. For
these purposes, sequences of the mitochondrial cytochrome
c oxidase subunit I (COI) gene and the nuclear internal tran-
scribed spacers 1 and 2 (ITS1 and ITS2) were used that have
previously been widely employed in phylogenetic studies of
grasshoppers (e.g., Cooper et al. 1995; Chapco and
Litzenberger 2002) and bush-crickets (Ullrich et al. 2010;
Allegrucci et al. 2011; Boztepe et al. 2013; Çiplak et al.
2015). The DNA sequences selected for the present study
have different modes of evolution and inheritance history,
and thus, they may reveal different aspects of the speciation
history of the examined lineages.
In bush-crickets, the songs of closely related species,
especially those that speciated in allopatry, usually have a
lineage-specific amplitude–temporal pattern that enables
recognition for systematic purposes and for drawing con-
clusions about paths of speciation (e.g., Heller 1990,2006;
Chobanov and Heller 2010). In Tettigonia, differences be-
tween species have been observed in the time and frequen-
cy domains, while particular song-recognizing mecha-
nisms may depend on the geographic and ecological pref-
erences of the species (Schul 1994; Schul et al. 1998).
Hence, we use the male calling song as an additional clue
for evolutionary assumptions as well as for testing the var-
iation of song types according to genetic or morphological
units. Thus, the present study indirectly vindicates the sig-
nificance of acoustic recognition systems and song special-
ization patterns in this genus.
Material and methods
Taxon sampling and morphological identification
The species used in this study and their sampling locali-
ties are presented in Table 1and Fig. 1. This dataset con-
tains 66 Tettigonia specimens from 33 disjunct localities/
populations and five outgroup taxa representing two
tettigoniid subfamilies (Tettigoniinae: Amphiestris Fieber,
1853 (Tettigoniini), Onconotus Fischer von Waldheim,
1839, Paratlanticus Ramme, 1939, Platycleis Fieber,
1853; Saginae: Saga pedo (Pallas, 1771)). Due to the
properties of the chosen DNA fragments (high amount
of interspecific variation providing good phylogenetic sig-
nal at a generic level but some risk of false results at a
higher systematic level due to convergencies and phenom-
ena like long branch attraction), we choose taxa that, ac-
cording to published data, are closely related and/or have
close ancestral position to Tettigonia (in the case of
Saginae) (e.g., Gorochov 1995;Songetal.2015).
Used samples of Tett i g o n i a have preliminary been identi-
fied using original descriptions and published reviews (e.g.,
Bolívar 1914; Chopard 1943; Ramme 1951;Harz1969;
Massa 1998;Chobanovetal.2014 and references therein).
All specimens listed in Table 1were morphologically related
to existing taxa based on available literature and museum
specimens.Apart from own material, the following specimens
from public collections that refer to the studied taxa were
studied:
Tettigonia acutipennis Ebner, 1946—male, holotype,
BKleinasien 1914 | Marasch, Tölg. | coll. R. Ebner^
(Naturhistorisches Museum Wien (NHMW)); male, Hakkari
(the Natural History Museum London (NHM)); two males,
BTurkey: | Gumusane, | Soganli Gecidi, 7-7500’. | 25. vii.
Grzywacz B. et al.
Tabl e 1 Locality data for the specimens sequenced and specimens used for bioacoustics evaluation
Voucher ID Species Location Geographical
position
GenBank accession nos.
COI ITS1 ITS2
out1 Saga pedo (Pallas, 1771) Bulgaria: E Stara Planina Mts, Zeravna
vill, 900 m
42.8427 N
26.4519 E
KT936310 KT823256 KT823233
out2 Platycleis (Squamiana) sp. Turkey: Zara-Susehri road, 1650 m 39.5556 N
37.9161 E
KT936311 KT358278 KT358337
out3 Onconotus servillei Fisher von
Waldheim, 1846
Bulgaria: Kapitan Dimitrovo vill. 43.95 N
27.7 E
KT936312 KT358279 KT358338
out4 Amphiestris baetica (Rambur,
1838)
Spain: Cultivo hija de otra de los Barrios,
Cadiz
36.32 N
6.17 W
KT936313 KT358280 KT358339
out5 Paratlanticus ussuriensis
(Uvarov, 1926)
Russia: Primorsky Krai, Lazovskii
Natural Reserve, Korpad
43.557 N
133.5726 E
KT936314 KT358336 KT358340
tam1a T. armeniaca complex Turkey: Horasan-Agri, Saclidag Pass,
2160 m
39.8747 N
42.3856 E
KT358223 KT358281 KT358341
tam1b T. armeniaca complex Turkey: Horasan-Agri, Saclidag Pass,
2160 m
39.8747 N
42.3856 E
KT358224 KT358282 KT358342
tam2a T. armeniaca complex Turkey: Horasan-Agri, Savsat-Ardahan
road, 1630 m
41.2312 N
42.4338 E
KT358225 KT358283 KT358343
–T. armeniaca complex Turkey: Pulumur, 1818 m 39.51934 N
39.87208 E
–––
–T. armeniaca complex Turkey: Ispir, 1900 m 40.583 N
40.883 E
–––
–T. armeniaca complex Armenia: above Djermuk, 2400 m 39.86365 N
45.69338 E
–––
–T. armeniaca complex Armenia: E Saravan, 2290 m 39. 68,531 N
45.70808 E
–––
–T. armeniaca complex Armenia: Shorja near Sevan Lake,
1965 m
40. 50,393 N
45.30347 E
–––
–T. armeniaca complex Armenia: Lermontovo vill., 1850 m 40.74874 N
44.66132 E
–––
–T. armeniaca complex Armenia: N of Vardaghbyur, 2015 m 40.99647 N
43.88796 E
–––
tca1 T. ca ntan s (Fuessly, 1775) Hungary: Borzsony Mts 47.55 N
19.00 E
KT358226 KT358284 KT358344
tca2a T. ca nt a n s (Fuessly, 1775) Poland: OPN, Dolina Sąpowska 50.1236 N
19.4845 E
KT358227 KT358285 KT358345
tca2b T. ca nt a n s (Fuessly, 1775) Poland: OPN, Dolina Sąpowska 50.1236 N
19.4845 E
KT358228 KT358286 KT358346
tca2c T. ca nt a n s (Fuessly, 1775) Poland: OPN, Dolina Sąpowska 50.1236 N
19.4845 E
KT358229 KT358287 KT358347
tca2d T. ca nt a n s (Fuessly, 1775) Poland: OPN, Dolina Sąpowska 50.1236 N
19.4845 E
KT358230 KT358288 KT358348
tca2e T. ca nt a n s (Fuessly, 1775) Poland: OPN, Dolina Sąpowska 50.1236 N
19.4845 E
KT358231 KT358289 KT358349
tca2f T. ca nt a n s (Fuessly, 1775) Poland: OPN, Dolina Sąpowska 50.1236 N
19.4845 E
KT358232 KT358290 KT358350
tca3a T. ca nt a n s (Fuessly, 1775) Romania: Lepsa 45.57 N
26.34 E
KT358244 KT358291 KT358351
tca3b T. ca nt a n s (Fuessly, 1775) Romania: Lepsa 45.57 N
26.34 E
KT358245 KT358292 KT358352
tca3c T. ca nt a n s (Fuessly, 1775) Romania: Lepsa 45.57 N
26.34 E
KT358247 KT358293 KT358353
tca3d T. ca nt a n s (Fuessly, 1775) Romania: Lepsa 45.57 N
26.34 E
KT358246 KT358294 KT358357
tct3 T. ca ntan s (Fuessly, 1775) China: Xinjiang, near Tianchi
(or Tienchi/Heaven Lake) in Tianshan
Mts. near mountain of Bogda Feng,
2000 m
43.9 N
88.117 E
KT358235 KT358297 KT358357
tct1 T. ca ntan s (Fuessly, 1775) Kyrgyzstan: Isik Ata 42.53 N
74.51 E
KT358233 KT358295 KT358355
–T. caudata (Charpentier, 1842) Turkey: Ispir, 1900 m 40.583 N
40.883 E
–––
Evolution and systematics of Green Bush-crickets
Tabl e 1 (continued)
Voucher ID Species Location Geographical
position
GenBank accession nos.
COI ITS1 ITS2
–T. caudata (Charpentier, 1842) Armenia: Gorhajk near Vorotan Dam,
2120 m
39.68521 N
45.78486 E
–––
tct2 T. caudata (Charpentier, 1842) Bulgaria: Byala 43.4717 N
25.7696 E
KT358234 KT358296 KT358356
tdm T. uvarovi Ebner, 1946 Russia: Primorsky Krai, Ussuri River,
Gornye Kluchi (Shamkovka)
45.20 N
134.40 E
KT358236 KT358298 KT358358
tmo1a T. cf. longealata Morocco: S Ajabo, 1360 m 33.0659 N
5.4086 W
KT358254 KT358299 KT358359
tmo1b T. cf. longealata Morocco: S Ajabo, 1360 m 33.0659 N
5.4086 W
KT358252 KT358300 KT358360
tmo1c T. cf. longealata Morocco: S Ajabo, 1360 m 33.0659 N
5.4086 W
KT358253 KT358301 KT358361
tmo2a T. cf. longealata Morocco: NW Khenifra, 1100 m 33.1377 N
5.9235 W
KT358261 KT358302 KT358362
tmo2b T. cf. longealata Morocco: NW Khenifra, 1100 m 33.1377 N
5.9235 W
KT358262 KT358303 KT358363
tmo2c T. cf. vaucheriana Morocco: NW Khenifra, 1100 m 33.1377 N
5.9235 W
KT358248 KT358304 KT358364
tmo3a T. cf. vaucheriana Morocco: near El Kebab, 966 m 32.7569 N
5.6451 W
KT358257 KT358305 KT358365
tmo3b T. cf. vaucheriana Morocco: near El Kebab, 966 m 32.7569 N
5.6451 W
KT358251 KT358306 KT358366
tmo3c T. cf. vaucheriana Morocco: near El Kebab, 966 m 32.7569 N
5.6451 W
KT358249 KT358307 KT358367
tmo3d T. cf. vaucheriana Morocco: near El Kebab, 966 m 32.7569 N
5.6451 W
KT358250 KT358308 KT358368
tmo3e T. cf. vaucheriana Morocco: near El Kebab, 966 m 32.7569 N
5.6451 W
KT358242 KT358309 KT358369
tmo4a T. cf. vaucheriana Morocco: SE Thar Es-Souk, 650 m 34.6585 N
4.2417 W
KT358258 KT358310 KT358370
tmo4b T. cf. vaucheriana Morocco: SE Thar Es-Souk, 650 m 34.6585 N
4.2417 W
KT358260 KT358311 KT358371
tmo5a T. cf. viridissima Morocco: S Aïn Zora, 835 m 34.5708 N
3.6657 W
KT358256 KT358312 KT358372
tmo5b T. cf. viridissima Morocco: S Aïn Zora, 835 m 34.5708 N
3.6657 W
KT358263 KT358313 KT358373
tmo5c T. cf. viridissima Morocco: S Aïn Zora, 835 m 34.5708 N
3.6657 W
KT358255 KT358314 KT358374
tmo5d T. cf. viridissima Morocco: S Aïn Zora, 835 m 34.5708 N
3.6657 W
KT358265 KT358315 KT358375
tmo5e T. cf. viridissima Morocco: S Aïn Zora, 835 m 34.5708 N
3.6657 W
KT358264 KT358316 KT358376
tmo6a T. cf. vaucheriana Morocco: Bouchfaa W Taza, 675 m 34.0830 N
4.2996 W
KT358239 KT358317 KT358377
tmo6b T. cf. vaucheriana Morocco: Bouchfaa W Taza, 675 m 34.0830 N
4.2996 W
KT358238 KT358318 KT358378
tmo7a T. sp. aff. viridissima Morocco: E Azrou, 1520 m 33.4259 N
5.1926 W
KT358268 KT358319 KT358379
tmo7b T. sp. aff. viridissima Morocco: E Azrou, 1520 m 33.4259 N
5.1926 W
KT358266 KT358320 KT358380
tmo7c T. sp. aff. viridissima Morocco: E Azrou, 1520 m 33.4259 N
5.1926 W
KT358267 KT358321 KT358381
tmo7d T. sp. aff. viridissima Morocco: E Azrou, 1520 m 33.4259 N
5.1926 W
KT358243 KT358322 KT358382
tmo8a T. cf. vaucheriana Morocco: Tilougguite Pass, 1570 m 32.0852 N
6.3003 W
KT358241 KT358323 KT358383
tmo8b T. cf. vaucheriana Morocco: Tilougguite Pass, 1570 m 32.0852 N
6.3003 W
KT358240 KT358324 KT358384
tmo9 T. cf. vaucheriana Morocco: SW Derdara, 400 m 35.0896 N
5.3074 W
KT358259 KT358325 KT358385
Grzywacz B. et al.
1960. | K. M. Guichard | & D. H. Harvey. | B.M. 1960-364^
(NHM).
Tettigonia armeniaca stat. nov.—two females (not identi-
fied), BIsbisu (Gov. Eriwan)^(NHMW); female (not identi-
fied), BBakurian^[Georgia] (NHMW); male (not identified),
BKasikoparan^[Turkey] (NHMW); male (not identified),
BSoganli Gecidi^[Turkey] (NHMW)
T. cantans (Fuessly, 1775)—male, BKarnten 1927 |
Vellacher Toschna, 3. ix. | coll. R. Ebner^(NHMW)
T. caudata (Charpentier, 1842)—male, BJasenova,
Jugoslawien^(NHMW); male, BPirot^(NHMW); male,
BWalouiki, R. m. | Velitchkovsky^[Ukraine] (NHMW); male,
BGegend v. Wien | Von Hn. Turk | Coll. Br. v. W.^(NHMW);
male, BEriwan-Tiflis^(NHMW); male, BPoin-Shaval, Elbrus |
Funke leg.^(NHMW); male, BPersia s.- | Elburs | Rehne-
Demavend | ca. 2700–3600 m | 20–27. vii. 1936^(NHMW);
male, BSabzawaran | 12. v. 50 / Ö sterr. | Iran exped. 1950^
(NHMW); male, BAfghanistan | Chira | Hr. v. Pleson | Coll. Br.
v. W.^(NHMW)
Tettigonia lozanoi (Bolívar, 1914)—male, Aguelman
(NHM)
Tettigonia uvarovi Ebner, 1946—male, holotype, Siberia
(NHMW)
Tettigonia vaucheriana Pictet, 1888—male, BMorocco,
Azrou, 1200–1400 m, 28. v.-1. vi. 1930. Ebner^(NHMW); fe-
male, BAtlas, Asni | 1200 m, 23–30. vi.’30. | Ebner^(NHMW)
Tabl e 1 (continued)
Voucher ID Species Location Geographical
position
GenBank accession nos.
COI ITS1 ITS2
–T. cf. vaucheriana Morocco: N Fes, 20 m 34.47138 N
5.38195 W
–––
–T. cf. vaucheriana Morocco: Tilougguite Pass, 1570 m 32.08519 N
6.30028 W
–––
tvi1 T. viridissima (Linnaeus, 1758) Kyrgyzstan: Ata Arche 42.3842 N
74.2848 E
KT358273 KT358326 KT358386
tvi2 T. viridissima (Linnaeus, 1758) Spain: Isik Ata, Montes de Toledo 39.3045 N
04.4353 W
KT358237 KT358327 KT358387
tvi3a T. viridissima (Linnaeus, 1758) Ukraine: Donetsk Region 48.14 N
37.74 E
KT358274 KT358328 KT358388
tvi3b T. viridissima (Linnaeus, 1758) Ukraine: Donetsk Region 48.14 N
37.74 E
KT358275 KT358329 KT358389
tvi3c T. viridissima (Linnaeus, 1758) Ukraine: Donetsk Region 48.14 N
37.74 E
KT358276 KT358330 KT358390
tvi3d T. viridissima (Linnaeus, 1758) Ukraine: Donetsk Region 48.14 N
37.74 E
KT358277 KT358331 KT358391
tvi4 T. viridissima (Linnaeus, 1758) Turkey: Yanikcay, 1920 m 38.2547 N
42.8978 E
KT358269 KT358332 KT358392
tvi5a T. viridissima (Linnaeus, 1758) Bulgaria: Varna, Botanical Garden 43.2374 N
28.003 E
KT358272 KT358333 KT358393
tvi5b T. viridissima (Linnaeus, 1758) Bulgaria: Haskovo, Perperikon Ruins 41.715 N
25.4657 E
KT358270 KT358334 KT358394
tvi5c T. viridissima (Linnaeus, 1758) Bulgaria: Dobrich, Bolata Bay 43.3838 N
28.4715 E
KT358271 KT358335 KT358395
All sequences are submitted to the NCBI GenBank
Fig. 1 Map showing the sampling sites for Te ttigon i a
Evolution and systematics of Green Bush-crickets
According to the state of knowledge, taxonomic recogni-
tion and morphological similarities, we divided Tettigonia
taxa into three groups:
1. Commonly recognized taxa: well-studied T. viridissima
(Linnaeus, 1758), T. caudata (Charpentier, 1842) s. str.,
and T. cantans (Fuessly, 1775) of the Western Palaearctic.
2. Taxa that have been recently described and only partially
studied: Tettigonia dolichoptera maritima Storozhenko,
1994 = T. uvarovi Ebner, 1946 (see Storozhenko et al.
2015). Described from the Russian Far East, this subspe-
cies was thought to differ in the length of the pronotum
and tegmina from the nominotypical form from South
Korea. However, many South Korean specimens are sim-
ilar to T. uvarovi in their dimensions (Rhee 2013), and
only the most long-winged ones are now assumed to rep-
resent T. dolichoptera (Storozhenko et al. 2015). In any
case, this representative of the Eastern Palaearctic fauna
may provide clues as to the relationships and phylogeo-
graphic connections of the east and west Palaearctic line-
ages of Tettigonia.
3. Poorly known sibling species termed here as follows:
(a) The T. armeniaca complex. Upon sampling of a
specific shorter-winged Tettigonia, resembling
T. caudata in terms of many morphological fea-
tures, which occurs from Eastern Anatolia to
Southern Caucasus and possibly further to
Kyrgyzstan (own unpublished information), we
failed to definitely outline morpho-units that fit
each of the taxa T. caudata armeniaca Ta rbins ky,
1940 (presently a synonym of T. caudata s. str.),
T. acutipennis Ebner, 1946, and Tettigonia
turcica Ramme, 1951. This complex has been
previously defined by weak (but present) black
coloration at the base of ventral post-femoral
spines and more or less shortened wings.
(b) The T. vaucheriana complex. A multitude of forms
has been described from northwestern Africa, differ-
ing mostly in size, length of the forewings, and rel-
ative width of the scapus (front border of the vertex
bordering the frons) (T. vaucheriana Pictet,
1888 = Tettigonia maroccana Bolívar, 1893, syn.;
T. lo z a n o i (Bolívar, 1914); Tettigonia longealata
Chopard, 1937; Tettigonia krugeri Massa, 1998).
Some of them resemble T. viridissima, which has
been recorded from North Africa. Upon extensive
sampling in Morocco and comparison of museum
specimens, we observed a significant overlap be-
tween populations, with extreme examples ranging
from a slender body shape with long wings
(T. viridissima type) to a stout body with long wings
(T. longealata)orshortwings(T. vaucheriana,
T. lozanoi) as this has already been noted by
Pinedo (1985).
Genomic sampling
DNA extraction was performed using NucleoSpin® Tissue
Kits (Macherey-Nagel, Düren, Germany) according to the
standard protocol. DNA was used as a PCR template to am-
plify fourgenetic markers,including mitochondrial and nucle-
ar genes. These were (1) partial cytochrome c oxidase subunit
I (COI), (2) partial sequences of the first internal transcribed
spacer (ITS1) of the nuclear ribosomal gene cluster, and (3)
partial sequences of the second internal transcribed spacer
(ITS2) of the nuclear ribosomal gene cluster. The COI gene
was amplified with the primers LCO [5′GGT CAA CAA
ATC ATA AAG ATA TTG G 3′] and HCO [5′TAA ACT
TCAGGGTGACCAAAAAATCA3′] (Folmer et al.
1994). For nuclear DNA, ITS1 regions were PCR amplified
using the primers 18S-28S [5′TAG AGG AAG TAA AAG
TCG 3′](Weekersetal.2001) and ITS-R1 [5′CAT TGA CCC
ACGAGCC3′](Ullrichetal.2010), whereas ITS2 regions
were amplified using the primers ITS2-28S [5′GGA TCG
ATG AAG AAC G 3′] and 28S-18S [5′GCT TAA ATT
CAG CGG 3′](Weekersetal.2001).
PCR was performed in 30-μL reaction volumes, which
comprised 10 pmol of each primer, 10 mM of each dNTP,
25 mM MgCl
2,
2.5 μL 10× PCR buffer, 1 U Taq polymerase
(EURx, Gdańsk, Poland), and sterile H
2
O.
To amplify COI, we used the following PCR protocol:
35 cycles at 95 °C for 50 s, 50 °C for 1 min and 72 °C for
1 min, with the final extension at 72 °C for 6 min. PCR am-
plification of ITS1 and ITS2 consisted of 25 cycles at 95 °C
for 1 min, 52 °C for 1 min 50 s, and 72 °C for 2 min, with the
final extension at 72 °C for 10 min. PCR products were puri-
fied with the Gene MATRIX PCR/DNA Clean-Up
Purification Kit (EURx, Poland, following the standard proto-
col) and sequenced directly. Purified DNA was sequenced in
both directions using the same primers as for PCR and the Big
Dye Terminator 3.1 Cycle Sequencing Kit (Applied
Biosystems), according to the manufacturer’s instructions.
Phylogenetic analyses
DNA sequences were edited and compiled using Muscle
(Edgar 2004). To test for pseudogenes, coding sequences
(COI) were translated into protein with MEGA 6 (Tamura
et al. 2013) using the standard invertebrate mitochondrial ge-
netic code. No stop codons were observed. Nucleotide com-
position homogeneity within genes was tested with PAUP
*
4.0b10 (Swofford 2002). Mean net genetic distances among
clades were calculated using MEGA 6 (Tamura et al. 2013)
Grzywacz B. et al.
within the Kimura two-parameter model (K2P, standard errors
(SE) were obtained by bootstrapping with 1000 replicates).
Two different phylogenetic methods, maximum likelihood
(ML) and Bayesian inference (BI), were used to infer evolu-
tionary relationships. Following independent analysis for each
COI, ITS1, and ITS2 dataset, the COI and ITS1 + ITS2
datasets were concatenated and further analyses were per-
formed using the combined matrix. Evolutionary models for
each dataset and combined dataset were selected using
MrModeltest 2.3 (Nylander 2004) with the Akaike informa-
tion criterion (Akaike 1974). Support for nodes in ML analy-
sis was assessed with non-parametric bootstrapping (BP)
using Phyml (Guindon and Gascuel 2003) with 1000
pseduoreplicates and ten random BioNJ trees, and parameters
were estimated from each dataset within the model selected
for the original dataset. BI of phylogenetic relationships using
Metropolis-coupled Monte Carlo Markov chain (mcmc) sim-
ulation was performed with MrBayes 3.1 (Huelsenbeck and
Ronquist 2001; Huelsenbeck et al. 2001). Posterior probabil-
ities were based on two independent MCM runs, each com-
posed of four chains (three heated chains and one cold chain).
The mcmc simulations were run for 10,000,000 generations
with sampling every 100 generations. The convergence of
analyses was validated by monitoring likelihood values graph-
ically using Tracer (Rambaut and Drummond 2007), and trees
prior to stationarity were discarded as burn-in. A 50%
majority-rule consensus tree was constructed from the remain-
ing trees to estimate posterior probabilities (PPs).
Phylogenetic trees were produced using TreeView (Page
1996) and FigTree software (Rambaut 2008).
Bioacoustic evaluations
Male songs were recorded under different environmental con-
ditions using the following equipment: (1) Knowles BT-1759-
000 electret condenser microphone with a sensitivity of
−60 ± 3 dB re 1 V/μbar at 1 kHz and with a frequency re-
sponse roll-off of about 10 kHz and cutoff at over 45 kHz
(data combined from Irie 1995 and W. Schulze, Friedrich-
Alexander-Universität Erlangen-Nürnberg, personal commu-
nication), equipped with a custom-made preamplifier connect-
ed to a PC through an external soundcard (Transit USB, BM-
Audio^) (48/96-kHz sampling rate), used in the lab; (2)
Pettersson D500 external microphone with a frequency range
corresponding to that of the Pettersson D500x recorder, being
between 1 (−6dB)–2kHz(−3 dB) and 190 kHz (500-kHz
sampling rate) (Lars Pettersson, personal communication),
connected to a ZOOM H2 or ZOOM H4 handy recorder
(Zoom Corporation) (96-kHz sampling rate), used in captivity
and in nature; (3) UHER M645 microphone with a frequency
response flat up to 20 kHz connected to a UHER 4200 IC tape
recorder; and (4) Brüel and Kjaer 4135 microphone connected
to a RACAL store 4DS tape recorder.
The bioacoustic terminology used in this study is as fol-
lows (based on Ragge and Reynolds 1998, modified from
Chobanov et al. 2014): calling song—the song produced by
an isolated male; echeme—a first-order grouping of syllables;
echeme duration—the time measured from the beginning of
the first to the end of the last syllable; echeme period—the
span including an echeme and the following interval; sylla-
ble—the sound produced by one opening-and-closing move-
ment of the tegmina; syllable period—the span including a
syllable and the following interval, usually measured between
syllable peaks; syllable repetition rate—reciprocal of the syl-
lable period (unit Hz = 1/s); diplosyllables = disyllabic
echemes—two syllables separated from the neighboring
diplosyllables by longer silent intervals than those within each
diplosyllable; duty cycle—during singing activity, the propor-
tion of time spent actually singing: echeme duration divided
by the echeme period (in T. viridissima duration of echeme
sequences divided by duration of acoustic activity); and
chirp—an isolated acoustic event regardless of its structure.
Temperature during the recordings varied, but for evaluation,
we used only temperature-independent structures (duty cycle)
and relationships (relationship between temperature-
dependent chirp duration and temperature-dependent interval
duration). Differences between a daytime song consisting of
chirps and a continuous nighttime song as in T. cantans were
not observed in T. armeniaca complex nor in any other
Tettigon i a species.
We concentrate to the poorly studied groups of the here
named T. armeniaca complex and T. vaucheriana complex.
Altogether, nine continuous recordings under different condi-
tions (temperature, time of the day, different male individual)
from six remote localities of males, representing different
morphotypes of the T. vaucheriana complex, were studied (see
Fig. 2). From the T. armeniaca complex, we studied, respective-
ly, 34 recordings from ten localities (partly represented in Fig. 3).
Own data for the rest of the studied taxa were supplemented with
published recordings and song measurements. Recordings of
T. cantans and T. caudata caudata from Massa et al. (2012)
are used for comparative purposes in the figures (see BResults^
section).
The recordings used for duty cycle measurements included
those made by the present authors as well as recordings from
several published sound sources (Grein 1984; Bonnet 1995;
Kleukers et al. 1997; Ragge and Reynolds 1998;Nielsen
2000; Odé and Fontana 2002; Bellmann 2004; Barataud
2007; Roesti and Keist 2009; Massa et al. 2012; Kocarek
et al. 2013; Gomboc and Segula 2014) and from the Internet
(SYSTAX 2015; data provided by G. Schmidt).
Processing of sound files, measurements, and preparation
of oscillograms were performed with Audacity 2.0.3
(Audacity team 1999–2013), BatSound 4.1.4 (Pettersson
Electronics and Acoustics AB 1996–2010), and Amadeus II
(Martin Hairer; http://www.hairersoft.com).
Evolution and systematics of Green Bush-crickets
Results
Phylogenetic reconstruction
COI, ITS1, and ITS2 genes are standard markers used in
phylogenetic studies of insects, which in many cases have
proved informative on a specific and generic level. We
obtained the following fragments: 547 bp for COI,
400 bp for ITS1, and 420 bp for ITS2 (including gaps
and variable regions). No indels were observed in the
COI fragment.
The congruency of COI, ITS1, and ITS2 (p= 0.99) allowed
for these markers to be combined into a single matrix. The
resulting 1367 bp matrix was obtained after alignment and
trimming, containing 20% variable and 13% parsimony infor-
mative sites. MrModeltest identified the GTR + G model (gam-
ma distribution shape parameter G=0.94;−lnL = 12,691.23;
AIC = 25,400.47) as the best nucleotide substitution model for
ML and BI analyses.
Phylogenies reconstructed based on the combined data
using ML and Bayesian methods (Fig. 4) showed similar to-
pologies. The tree inferred from COI + ITS1 + ITS2 sequences
(Fig. 4) showed that Tettigonia taxa are grouped into three main
clades. Clade BA^includes all sampled populations of
T. vi r i d i s s i m a and all northwestern African specimens of the
taxon referred to in this paper as the T. vaucheriana complex.
Clade BB^is composed of T. caudata,T. uvarovi,andwhatis
here referred to as the T. armeniaca complex. Clade BC^is
composed of all the T. cantans samples in our dataset.
The genetic distances between and within clades for all
genes are presented in Tables 2and 3, respectively. Genetic
distances between major clades were similar for COI (1–4%)
and for ITS (1–3%). The genetic distances between ingroup
species were very low for COI (0–2%).
Fig. 2 Oscillograms of the song
of the Tettigonia viridissima
group (1–9)andT. cantans (10)
recorded at two speeds: 1T.cf.
longealata (MO: Ajabo,
T= 20 °C), 2T.cf. vaucheriana
(MO: N Fes, T= 20 °C), 3T.cf.
vaucheriana (MO: Bouchfaa W
of Taza, T= 21 °C), 4T.cf.
vaucheriana (MO: Tilougguite
Pass, T= 23 °C), 5T.cf.
vaucheriana and cf. longealata
(MO: El Kebab, T= 25 °C), 6T.
cf. vaucheriana (MO: El Kebab,
T=28–30 °C), 7T.cf. viridissima
(MO: S Aïn Zora, T= 22 °C), 8T.
cf. viridissima (MO: S Aïn Zora,
T= 25 °C), 9 T. viridissima (BG:
Sofia, T=27°C),and10 T.
cantans (IT: Val Malene; from
Massa et al. 2012,T=15°C)).
Scale bar for Ais 10 s and for B
2s
Grzywacz B. et al.
Bioacoustic evaluation and morphological characters
The three bioacoustically well-distinguished species (see
BIntroduction^section) belong to three well-outlined clusters
in our study. In addition to the previously known acoustic
diversity in Central Europe, we found striking examples of
variation among populations with uniform morphology, as
well as uniform song patterns among morphologically distinct
populations hitherto classified as different species.
Clade A (Figs. 4and 5j–m) comprises haplotypes with low
(COI) to very low (ITS) ingroup genetic distances. This clade
includes populations from a large portion of the range of
Fig. 3 Oscillograms of songs of
the Tettigonia armeniaca
complex (1–11 ), T. caudata (12),
and T. uvarovi (13) recorded at
two or three speeds: 1T.
armeniaca (AM: Djermuk,
T= 19 °C), 2 T. armeniaca (TR:
Saclidag Pass, T=21.5°C),3T.
armeniaca (TR: Ispir, T=17°C)
(monosyllabic type), 4T.
armeniaca (TR: Ispir, T=17°C)
(disyllabic type), 5T.armeniaca
(AM: Saravan, T=20–25 °C)
(outdoor recording), 6T.
armeniaca (AM: Lermontovo
vill., T=20°C),7 T. armeniaca
(TR: Savsat–Ardahan, T= 26 °C),
8 T. armeniaca (TR: Savsat–
Ardahan, T= 26 °C) (variable
echeme length), 9T.armeniaca
(TR: Ispir, T=17°C)
(polysyllabic type of variable
length), 10 T. armeniaca (TR:
Pulumur, T=20–22 °C) (shorter
echemes), 11 T. armeniaca (TR:
Pulumur, T=20–22 °C) (the same
specimen as in 10 longer
echemes), 12 T. caudata (GR:
Drama; from Massa et al. 2012,
T=25°C),and13 T. uvarovi
(South Korea; from Kim 2009 as
T. dolichoptera;see Rhee 2013).
Scale bar for Ais 10 s; for B,2s;
and for C, 200 ms
Evolution and systematics of Green Bush-crickets
T. viridissima as well as all populations sampled in
Northwestern Africa that may be identified as one of
T. vaucheriana,T. lozanoi,T. longealata,T. krugeri,and
T. viridissima. All these taxa were described in terms of
Fig. 4 Phylogenetic tree of the genus Tett i g o n i a based on BI analysis of
concatenated COI-ITS1-ITS2 sequences. BI posterior probability (PP)
values are shown near resolved branches (only support values above
0.50). Species groups, as defined by genetic and morpho-acoustic data,
are distinctly shaded, and the respective branches are marked with an
open circle and a capital letter as follows: BA^—T. viridissima group,
BB^—T. caudata group, and BC^—T. cantans group. Haplotype codes
correspond to Table 1in the Supplement, followed by morphological
identification. Squares on the right side of names correspond to relative
wing length: filled squares short wings and open squares long wings;
circles for the T. viridissima group correspond to relative body shape:
filled circles larger and stouter body and open circles smaller and more
slender body. A partial oscillogram with the main song types is presented
for each group: MO Moroccan populations of the T. viridissima group; VI
T. viridissima (specimen from Bulgaria); A1,A2,andA3 three song types
of different specimens of the T. ar m eni a c a complex from the Erzurum
region (Ispir); CT T. caudata (Greece, Drama; from Massa et al. 2012);
DM T. uvarovi (S Korea; from Kim et al. 2009); CA T. cantans (Italy, Val
Malene; from Massa et al. 2012). Scale bar corresponds to 1 s of record-
ing (for temperature during recordings, see Figs. 2and 3)
Grzywacz B. et al.
differences in body size, relative length of the tegmina (see
open and closed symbols designating each specimen in
Fig. 4), and some additional features, such as the width of the
fastigium of the vertex (according to our observations in this
group, a wide fastigium corresponds to large, stout body and
vice versa). Despite these Bstrict^differences, we failed to clearly
outline taxa as wide variation was observed between populations,
and animals with both long and short wings occurred together in
some areas. All sampled populations and studied museum spec-
imens were compared (also with descriptions), and we did not
find differences in the shape of male cerci and genitalia
(titillators), female subgenital plate, or other species-specific
characters.
All studied individuals from the sampled populations of clade
A showed the same song pattern—sequences of disyllabic
echemes of variable length separated by short intervals (see
Fig. 2). Large intraindividual variation in the echeme sequence
length was also observed. The fine structure of the song fully
corresponded to that of T. viridissima though the latter species
usually produced longer echeme sequences. Yet, a large overlap
was detected between the song duty cycles (calculated using
echemes and echeme intervals) of the northwestern African pop-
ulations and T. viridissima (Fig. 6). The genetic data, showing
low genetic diversification, support the phenotypic similarities.
Clade B (Fig. 4)isformedbyT. uvarovi (Fig. 5c, d),
T. caudata (Fig. 5e), and the T. armeniaca complex (Fig. 5f–
i). T. uvarovi is a well-characterized species, morphologically
resembling T. viridissima, with a song more similar to that of
T. cantans (Rhee 2013). T. caudata is also a well-studied spe-
cies, though this only applies to its nominotypical form, while
its relationships with subspecific taxa are vague. Its typical
song, consisting of long echemes (1–10 s), was recorded from
Switzerland in the west (Roesti and Keist 2009), through
Europe and Anatolia, to China (Xinjiang) in the east (Fan
et al. 2013). The T. armeniaca complex as here regarded con-
cerns populations sampled in the Transcaucasus and Eastern
Anatolia (see Table 1) with specimens fitting either T. caudata
armeniaca,T. acutipennis,orT. turcica. All of the latter indi-
viduals were characterized in comparison with T. caudata s.
str. by more or less shortened wings, as well as shorter hind
femora, smaller body size, and weaker development of black
dots at the base of the ventral spines of the hind femora.
Interestingly, although we could not discriminate between
populations morphologically, specimens from different local-
ities exhibited a wide variety of song types. The latter caused
confusion not only for the fact that specimens with different
songs looked the same, but due to the lack of a geographic
structuring of the songs. Song types varied from long se-
quences of isolated syllables to sequences of disyllabic or
polysyllabic echemes. However, all songs exhibited approxi-
mately the same relationship between chirp duration and chirp
interval. Compared with the songs of T. caudata,the latter has
higher absolute values in both aspects, still preserving the ratio
between chirp duration and interval (Fig. 7). Part of the vari-
ation is certainly due to different temperatures during record-
ing, but the groups did not overlap despite similar temperature
ranges (T. armeniaca:13–27.5 °C; T. caudata:14–27 °C). The
duty cycle of the armeniaca song (Fig. 6) varied significantly
and partly overlapped with that of T. caudata.
After observation of dense populations of the
T. armeniaca complex, we found that the songs of differ-
ent individuals within the same population may vary to
almost the same extent as in general (see Figs. 3and 7).
Rarely, single individuals may also produce a different
song by alternating monosyllabic, disyllabic, or polysyl-
labic echemes within one performance (see Fig. 3(5Ba,
Bb, 9A, 9B)). The genetic structure also showed very low
Tabl e 2 Net mean genetic distances (%) between Tettigon ia clades for
mitochondrial (COI) and nuclear (ITS1 + ITS2) genes
T1 T2 T3 T4
COI clades
T. viridissima +T vaucheriana complex T1
T. uvarovi T2 0.02
T. armeniaca complex + T. caudata s.
str.
T3 0.03 0.02
T. caudata s. str. T4 0.04 0.03 0.02
T. cantans T5 0.01 0.03 0.03 0.04
ITS1 + ITS2 clades
T. viridissima +T vaucheriana complex T1 - -
T. uvarovi T2 0.01 -
T. armeniaca complex + T. caudata s.
str.
T3 0.01 0.02
T. caudata s. str. T4 0.02 0.02 0.01
T. cantans T5 0.02 0.03 0.01 0.01
Tabl e 3 Net mean genetic
distances (%) within Tettigonia
clades for mitochondrial (COI)
and nuclear (ITS1 + ITS2) genes
COI clades ITS1 + ITS2 clades
T. viridissima +T vaucheriana complex 0.02 0.01
T. uvarovi ––
T. armeniaca complex + T. caudata s. str. 0.01 0.05
T. caudata s. str. 0 0.01
T. ca n tan s 00.07
Evolution and systematics of Green Bush-crickets
Fig. 5 Appearance of some taxa
of Western Palaearctic Tettigonia
(relative size proportions between
photos not retained). aT. ca ntan s ,
male, Germany, Gunzenhausen; b
T. ca n tan s , female, Germany,
Gunzenhausen; cT. uvarovi
Ebner, 1946—male, holotype,
Siberia (NHMW), lateral view; d
same, dorsal view; eT. caudata,
male, Bulgaria, Russe district,
Byala; fT. acutipennis Ebner,
1946—male, holotype,
BKleinasien 1914 | Marasch,
Tölg. | coll. R. Ebner^(NHMW),
dorsal view; gsame, lateral view;
hT. armeniaca, male, Armenia,
Djermuk; iT. arm e niac a , male,
Turkey, Ispir; jT. viridissima
morphotype of longealata,male,
Morocco, El Kebab; k
T. viridissima morphotype of
longealata,female,Morocco,El
Kebab; lT. viridissima
morphotype of vaucheriana,
male, Morocco, El Kebab; and m
T. viridissima, male and female in
copula, Bulgaria, Haskovo
district, Kostilkovo village
Grzywacz B. et al.
(almost zero) differentiation for the COI fragment within
the T. armeniaca complex, while distances within the
clade consisting of the T. armeniaca complex and
T. ca u d a t a were from very low (COI) to moderate (ITS)
(Table 3).
Clade C (Fig. 4) is here represented by a single taxon,
T. cantans (Fig. 5a, b). Its basal position in the tree supports
the suggestion that its song corresponds to an ancestral state
for Tettig o n i a due to its simple structure and low female pref-
erence towards temporal song parameters (Schul 1998).
Discussion
The genus Tettigonia is one of the ecologically most successful
Palaearctic groups of bush-crickets, distributed throughout the
Palaearctic ecozone. The Green Bush-crickets occur in a wide
variety of habitats—from the semideserts of North Africa and
Central Asia to Eurasian taiga and the lush meadows of the
treeless mountain zone. The low mitochondrial genetic
differentiation found in this study suggests relatively recent
diversification and fast expansion throughout the Palaearctic
and the occasional presence of hybrids, even between members
of different clades (Schul 1995), are in support of the latter
suggestion. The occurrence of the most basal branching
resulting in the topology clade C (T. cantans)+(cladesA,B)
supports the ancestral state of the temporal song structure and
the low female preference filter of T. ca ntan s (Schul 1998).
Furthermore, this type of song (although female acoustic pref-
erence is not known) occurs in T. uvarovi, the basal taxon in
clade B. Interestingly, T. uvarovi has relatively short wings but
is similar in overall habitus to T. viridissima, which is another
piece of evidence suggesting a closer relationship between
clades A and B. While both T. cantans and T. uvarovi are
typically found in humid habitats with a moderate to cool cli-
mate and occupy the northernmost areas of the range of this
genus, T. caudata and the T. armeniaca complex occur mostly
in mountainous and steppe areas from southeastern Europe,
through Anatolia and Iran, to Central Asia. Thus, song elabo-
ration by changes in syllable length and the development of
echemes may have been connected with the southwestern ex-
pansion from the Eastern Palaearctic towards drier open habi-
tats in the mountains of Central Asia and/or Irano-Anatolia.
The uniform morphology, intraindividual and intrapopula-
tion song variability, and low genetic distances suggest that all
studied members of the T. armeniaca complex represent a
single taxonomic unit. The variable song pattern within the
complex is a unique phenomenon in bush-crickets. The incor-
poration of either long monosyllables or short disyllabic or
polysyllabic echemes in communication indicates an unusual
mechanism of song recognition. The recognition mechanism
of females of the related T. caudata requires mainly echemes
that do not contain long intervals, i.e., echemes composed of a
fast sequence of syllables (high syllable repetition rate; Schul
1998). Those females accept even continuous songs without
intervals (Schul 1998). Yet, the minimum acceptable duration
of an echeme has not been tested. Females of the T. armeniaca
complex may use the same criterion, possibly accepting
shorter echeme durations than T. caudata and rejecting longer
ones. In this case, the internal structure of a chirp can vary as
long as there are no long intervals within a chirp. Populations
of the T. armeniaca complex occur sympatrically with
T. caudata (their suspected syntopic occurrence may be mar-
ginal or accidental), and thus, low selectivity could provoke
hybridization. Yet, we found neither significant differences in
the song frequency (unpublished data) and duty cycle (Fig. 6),
nor evidence for hybrids between these groups. Thus, to elu-
cidate the mechanisms of recognition and sexual selection in
this group, it is necessary to conduct large-scale population
genetic research combined with a behavioral study of female
acoustic preferences.
Clade A is composed of a group of populations with rela-
tively uniform song patterns, more or less typical of
Fig. 6 Comparison of the duty cycle in the songs of the T. armeniaca
complex and T. caudata (left panel) and the Tettigonia viridissima group
(right panel)
Fig. 7 Relationship between the duration of chirps and inter-chirp inter-
vals in T. caudata and the Tettigonia armeniaca complex. Green triangles
mark recordings from Ispir, Turkey, where monosyllabic, disyllabic, and
polysyllabic songs of T. armeniaca were recorded, as well as a song of
T. caudata (Color figure online)
Evolution and systematics of Green Bush-crickets
T. viridissima. In contrast to the T. armeniaca complex
discussed previously, here, a uniform song pattern was present
within a rather wide range of morphotypes. However, varia-
tion concerned only body size and wing length, while the
shape of the female external genitalia and the male internal
and external genitalia did not differ across the morphotypes.
Although the song pattern showed moderate geographical
structuring (shorter echemes in North African populations),
genetic data revealed a mixed pattern of all sampled popula-
tions. The duty cycle distribution (Fig. 6) largely overlapped
between Eurasian and North African samples. The previous
data suggest a recent expansion of T. viridissima populations
to the African continent (possibly during the glacial maxima
connected with the ocean level decreasing since the
Pleistocene). Thus, isolated micropopulations may have spe-
cialized in certain microclimates prior to subsequent secondary
contact and gene exchange. Similar morphological changes in-
volving shorter wings have been observed in T. viridissima
populations occurring in Great Britain (Cooper et al. 2012).
Taxonomic reconsiderations
Following the interdisciplinary study presented previously, we
suggest the following taxonomic reconsiderations:
T. viridissima (Linnaeus, 1758)
T. vaucheriana Pictet, 1888, syn.n.
T. maroccana Bolívar, 1893, syn.n. (upon synonymy with
T. vaucheriana)
T. lozanoi (Bolívar, 1914), syn.n.
T. longealata Chopard, 1937, syn.n.
T. krugeri Massa, 1998, syn.n.
Notes, diagnosis, and distribution In Northern Africa, two
morphological groups of species occur. The Tettigonia savignyi
group contains T. savignyi (Lucas, 1849) and Tettigonia
macroxipha (Bolívar, 1914) (including also Tettigonia
longispina Ingrisch, 1983, described from Sardinia) that char-
acterizes with male cercus with a very big internal spine (longer
than the width of cercus), titillators with short stout apical arms
with a very small second apical hook and apically attenuated
female subgenital plate with a narrow incision. This group has
not been considered in the present study.
The second group involves species related to T. viridissima
and here assigned to as T. vaucheriana complex (among the
listed in Eades et al. 2016, valid taxa are T. vaucheriana,
T. lozanoi,T. longealata,andT. krugeri). The latter character-
izes with malecercus with a short internal spine (much shorter
than the width of cercus), titillators with long gracile apical
arms with two equal apical hooks, and apically widened fe-
male subgenital plate with a wide incision. Formerly, the latter
taxa were considered distinct species on account of differ-
ences in the length of tegmina, body size, and width of scapus
in relation to the first antennal segment and subtle differences
in the female subgenital plate (based on dry specimens in
which its shape may differ after deformation due to desicca-
tion). With the present study, we found all these characters
highly variable between and within populations. For example,
width of scapus is in direct relation to the body size (the
stouter the body is, the wider the scapus is in relation to the
first antennal segment). Considering the low genetic distances,
uniform male and female genitalia, and the uniform song of
the studied populations subjectively referred to at least three of
the mentioned taxa, we consider all members of the
T. vaucheriana complex synonymous with T. viridissima.
Thus, the species distribution, known to be mostly restricted
north of the Mediterranean, is now proved to cover all Western
Palaearctic including the southern Mediterranean on the terri-
tories of northern Morocco, Algeria, and partly Libya (thus,
without any doubt, also Tunisia).
T. armeniaca Tarbinsky, 1940, stat. nov.
T. acutipennis Ebner, 1946, syn.n.
T. turcica Ramme, 1951, syn.n.
Notes, diagnosis, and distribution Two species related to
T. caudata and usually recognized by their shorter wings are
known to occur in Anatolia (T. acutipennis and T. turcica)
(Ebner 1946; Ramme 1951). Similarly to T. caudata, these taxa
are characterized by well-visible black dots in the base of the
ventral spines of the femora (most visible in the apical half of
hind femora), strongly apically attenuated stridulatory file, long
ovipositor (as long as or longer than body, while shorter in most
other Tettigonia), short and apically outcurved male cerci, and
male titillators with comparatively stout apical arms ending with
two short hooks. T. acutipennis and T. turcica differ from
T. caudata by the shorter (usually less than 33 mm, while over
33 in T. caudata) and apically tapering tegmina, shorter hind
femora (usually less than 25 mm, while over 25 in T. caudata),
and less expressed black dots ventrally on the femora. From the
Caucasus area, the subspecies T. caudata armeniaca has been
described by Tarbinsky (1940) and later synonymized with
T. caudata caudata by Stolyarov (1983). Our samples showed
that the morphotype of T. armeniaca complex is widely distrib-
uted in the Transcaucasus area. Summarizing the results of the
current study, we prove that T. armeniaca complex repre-
sents a single well-outlined species, T. armeniaca, stat.
nov., with two newly established synonyms,
T. acutipennis, syn.n., and T. turcica,syn.n.T. armeniaca
characterizes with the previously mentioned features, as
well as by its unique variable song and low genetic dis-
tances between its populations. Acoustically, it differs from
T. caudata by the shorter chirps (echemes) and chirp inter-
vals, both being less than a second, while over 1 s in
T. caudata.
T. armeniaca occurs in moderately humid grass and shrub
associations in the high plateaus and mountains of Eastern
Grzywacz B. et al.
Anatolia and whole Transcaucasia (Georgia, Armenia, and
Azerbaijan), as well as in the Northern Iran (at least in the
Elburs range) (this study and own unpublished data). Its occur-
rence further east in the mountains of Central Asia is not
excluded.
Conclusions
The taxonomy of Tettigonia was hitherto based only on morpho-
logical descriptions that frequently led to difficulties in outlining
its systematics and relationships between taxa (see references in
the BIntroduction^section). In the present study, we partially
revealed the phylogeny and relationships of the genus
Tettigonia, with a focus on the major groups in the Continental
Palaearctic. Three main lineages were outlined representing three
distinct clades with unique morpho-acoustic evolution. The com-
bination of variable morphology and uniform song in the
T. viridi s s i m a lineage, and of variable song and uniform mor-
phology in the T. caudata/armeniaca lineage, addressed a mul-
titude of evolutionary and behavioral questions. This paper pro-
vides a foundation for future investigations into the evolution of
the recognition mechanisms and female choice in Tettigonia,
which led to this diversity of forms, being the cause or result
of the ecological success of Green Bush-crickets.
Acknowledgements We kindly acknowledge the collectors who donat-
ed material for this study, namely, Roman Babko, Pedro J. Cordero,
Tomasz Postawa, Gellért Puskas, Sergey Storozhenko, and Bogdan
Wiśniowski. We are grateful to the late Fer Willemse, who provided
copies of his sound recordings. This study was supported by grant
2011/01/B/NZ8/01467 from the National Science Centre, Poland (B.
Grzywacz). T. Karamysheva was partially supported by The Russian
Foundation for Basic Research, research project no. 14-04-00086a. The
morphological studies on additional historic material of Tettigonia
(Naturhistorisches Museum, Vienna; the Natural History Museum,
London; the Hungarian Natural History Museum, Budapest) were possi-
ble by the financial support of the SYNTHESYS (European
Commission’s Research Infrastructures Network funded under FP7)
grants AT-TAF-546, GB-TAF-1320, and HU-TAF-2202 to D. Chobanov.
Open Access This article is distributed under the terms of the Creative
Commons Attribution 4.0 International License (http://
creativecommons.org/licenses/by/4.0/), which permits unrestricted use,
distribution, and reproduction in any medium, provided you give appro-
priate credit to the original author(s) and the source, provide a link to the
Creative Commons license, and indicate if changes were made.
References
Akaike, H. (1974). A new look at the statistical model identification.
IEEE Transactions on Automatic Control, 19(6), 716–723.
Allegrucci, G., Trucchi, E., & Sbordoni, V. (2011). Tempo and mode of
species diversification in Dolichopoda cave crickets (Orthoptera,
Rhaphidophoridae). Molecular Phylogenetics and Evolution, 60,
108–121.
Audacity team (1999-2013). Audacity 2.0.3. Audacity 2.0.3, http://web.
audacityteam.org/.
Barataud, M. (2007). Sauterelles de France. Edition Sitelle. Compact
Disc.
Bellmann, H. (2004). Heuschrecken. Edition Ample, Germering.
Compact Disc.
Bolívar, I. (1914). Dermapteros y Ortopteros de Marruecos. Memorias de
la Real Sociedad Española de Historia Natural, 8,157–239.
Bonnet, F. R. (1995). Guide sonore des sauturelles, grillons et criquets
d’Europe occidentale. Compact Disc. Lausanne and Paris:
Delachaux and Niestle.
Boztepe, Z., Kaya, S., & Çıplak, B. (2013). Integrated systematics of the
Poecilimon luschani species group (Orthoptera, Tettigoniidae): ra-
diation as a chain of populations in a small heterogeneous area.
Zoological Journal of the Linnean Society, 169,43–69.
Chapco, W., & Litzenberger, G. (2002). A molecular phylogenetic anal-
ysis of the grasshopper genus Melanoplus Stal (Orthoptera:
Acrididae). An update. Journal of Orthoptera Research, 11,1–9.
Chobanov, D. P., & Heller, K.-G. (2010). Revision of the Poecilimon
ornatus group (Orthoptera: Phaneropteridae) with focus on
Bulgaria and Macedonia. European Journal of Entomology, 107,
647–672.
Chobanov, D. P., Lemonnier-Darcemont, M., Darcemont, C., Puskás, G.,
& Heller, K.-G. (2014). Tettigonia balcanica, a new species from the
Balkan Peninsula (Orthoptera, Tettigoniidae). Entomologia, 2(2),
209, 95–209,106.
Chopard, L. (1943). Orthoptèroïdes de l’Afrique du Nord. Faune de
l’Empire Français. Librairie Larose II, Paris (p. 447).
Çıplak, B., Heller, K.-G., & Willemse, F. (2009). Review of the genus
Eupholidoptera (Orthoptera, Tettigoniidae): different genitalia, uni-
form song. Zootaxa, 2156,1–77.
Çiplak, B., Kaya, S., Boztepe, Z., & Gunduz, I. (2015). Mountainous
genus Anterastes (Orthoptera, Tettigoniidae): autochthonous surviv-
al in refugial habitats across several glacial ages via vertical range
shifts. Zoologica Scripta, 44,534–549.
Cooper, E. M., Lunt, P. H., Ellis, J. S., & Knight, M. E. (2012).
Biogeographical patterns of variation in Western European popula-
tions of the great green bush-cricket (Tettigonia viridissima;
Orthoptera Tettigoniidae). Journal of Insect Conservation, 17(3),
431–440.
Cooper, S. J., Ibrahim, K. M., & Hewitt, G. M. (1995). Postglacial ex-
pansion and genome subdivision in the European grasshopper
Chorthippus parallelus.Molecular Ecology, 4,49–60.
Eades, D. C., Otte, D., Cigliano, M. M., & Braun, H. (2016). Orthoptera
Species File Online. Version 5.0/5.0. (24/5/2016) http://Orthoptera.
SpeciesFile.org.
Ebner, R. (1946). Einige seltenere paläarktische Tettigoniidae und
Gryllidae (Orthoptera). Eos–Revista Española de Entomologia, 22,
17–30.
Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high
accuracy and high throughput. Nucleic Acids Research, 32(5),
1792–1797.
Fan, B.-F., Wang, J., & Lu, R.-S. (2013). Comparative study on male
songs of four species of Tettigoniidae in Xinjiang. Acta
Zootaxonomica Sinica, 38(2), 239–245.
Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994).
DNA primers for amplification of mitochondrial cytochrome c ox-
idase subunit I from diverse metazoan invertebrates. Molecular
Marine Biology and Biotechnology, 3(5), 294–299.
Gomboc, S., & Segula, B. (2014). Pojoce kobilice Slovenije/Singing
Orthoptera of Slovenia. EGEA, Zavod za naravo, Ljubljana: 1–
240. + Compact Disc.
Gorochov, A. V. (1995). System and evolution of the suborder Ensifera
(Orthoptera). II. Proceedings of the Zoological Institute, Russian
Academy of Sciences, 260, 212 (in Russian, English summary)
Evolution and systematics of Green Bush-crickets
Grein, G. (ed) (1984). Gesänge der einheimischen Heuschrecken.
Deutscher Jugendbund für Naturbeobachtung and
Niedersächsisches Landesverwaltungamt, Hannover. Long-playing
record and booklet (2001 on Compact Disc).
Guindon, S., & Gascuel, O. (2003). A simple, fast and accurate algorithm
to estimate large phylogenies by maximum likelihood. Systematic
Biology, 52,696–704.
Harz, K. (1969). Die Orthopteren Europas/the Orthoptera of Europe. Vol .
I. Series Entomologica, 5,749.
Heller, K.-G. (1988). Bioakustik der Europäischen Laubheuschrecken.
Ökologie in Forschung und Anwendung 1. Josef Margraf (p. 358).
Heller, K.-G. (1990). Evolution of song pattern in east Mediterranean
Phaneropterinae: constraints by the communication system. In W.
J. Bailey & D. C. F. Rentz (Eds.), The Tettigoniidae: biology, sys-
tematics and evolution (pp. 130–151). Berlin: Crawford House
Press, Bathurst and Springer.
Heller, K.-G. (2006). Song evolution and speciation in bushcrickets. In S.
Drosopoulos & M. F. Claridge (Eds.), Insect sounds and communi-
cation, physiology, behaviour, ecology and evolution (pp. 207–219).
Boca Raton: CRC Press.
Hochkirch, A., & Lemke, I. (2011). Asymmetric mate choice, hybridiza-
tion, and hybrid fitness in two sympatric grasshopper species.
Behavioral Ecology and Sociobiology, 65,1637–1645.
Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian infer-
ence of phylogeny. Bioinformatics, 17,754–755.
Huelsenbeck, J. P., Ronquist, F., Nielsen, R., & Bollback, J. P. (2001).
Bayesian inference of phylogeny and its impact on evolutionary
biology. Science, 294,2310–2314.
Ichikawa, A., Kano, Y., Kawai, M., Tominago, O., & Murai, T. (2006).
Orthoptera of the Japanese Archipelago in Color (pp. 687 + CD).
Japan, Hokkaido: Hokkaido University (Orthopterological Society
of Japan), (in Japanese).
Kim, T. W. (2009). Taxonomy and acoustic signals of Korean
Tettigonioidea (Orthoptera: Ensifera) (II). Incheon: NIBR (National
Institute Biological Resources), (pp. 140 +CD) (in Korean).
Kim, T.-K., Han, T., Kim, T.-W., Park, I. G., Kim, S., & Park, H. (2016).
A molecular phylogenetic study on South Korean Tettigonia species
(Orthoptera: Tettigoniidae) using five genetic loci: the possibility of
multiple allopatric speciation. Zootaxa, 4092(2), 219–230.
Kleukers, R. M. J. C., van Nieukerken, E., Odé, B., Willemse, L., & van
Wingerden, W. (1997). [The grasshoppers and crickets of the
Netherlands (Orthoptera).] De sprinkhanen en krekels van
Nederland (Orthoptera). Knnv Uitgeverij, Utrecht. Nederlandse
Fauna, Deel 1. + Compact Disc by Odé B.
Kocarek, P., Holusa, J., Vlk, R., & Marhoul, P. (2013). Rovnokridli Ceske
republiky (Insecta: Orthoptera) (pp. 1–285. + Compact Disc).
Czech Republic: Academia, Praha.
Massa, B. (1998). Attuali conoscenze sugli Ortotteri della Libia (Insecta
Orthoptera). Il Naturalisto Siciliano, 4(22), 235–320.
Massa, B., Fontana, P., Buzetti, F. M., Kleukers, R., & Odé, B. (2012).
Orthoptera. In: Fauna d’Italia 48 (p. 563). Calderini, Milano.
Nielsen, F. O. (2000). De Danske Graeshopper. Stenstrup: Apollo Books
(pp. 1–192. + Compact Disc).
Nylander, J. A. A. (2004). MrModeltest v2. Program distributed by the author.
Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden.
Odé, B., & Fontana, P. (2002). Grasshoppers and crickets of the Veneto
region. Sound guide. Museo Naturalistico Archaeologico Di
Vicenza, Vicenza. Compact Disc.
Ogawa, J. (2003). A new species of the genus Tettigonia from Tsushima
Is. of Japan (Orthoptera, Tettigoniidae). Japanese Journal of
Systematic Entomology, 9(2), 291–295.
Page, R. D. M. (1996). TreeView: an application to display phylogenetic
trees on personal computers. Computer Applications in the
Biosciences, 12,357–358.
Paterson, H. E. H. (1985). The recognition concept of species. In E. S. Vrba
(Ed.), Species and speciation (pp. 21–29). Pretoria: Transvaal Museum.
Pettersson Electronics and Acoustics AB (1996-2010). BatSound 4.1.4.
http://www.batsound.com/?p=15.
Pinedo, C. (1985). Los Tettigoniidae de la Peninsula Ibérica, España
insular y norte de Africa. Eos, 61,241–263.
Ragge, D. R., & Reynolds, W. J. (1998). The songs of the grasshoppers
and crickets of western Europe. Harley Books, Colchester, Essex.
1998: I-X, 1–591. + Compact Disc.
Rambaut, A. (2008). FigTree v1.1.1: tree figure drawing tool. Available:
http://tree.bio.ed.ac.uk/software/figtree/.Accessed20June2008.
Rambaut, A., & Drummond, A. J. (2007). Tracer v1.4: MCMC trace
analyses tool. Available: http://beast.bio.ed.ac.uk/Tracer.
Ramme, W. (1951). Zur Systematik, Faunistik und Biologie der
Orthopteren von Südost-Europa und Vorderasien. Mitteilungen aus
dem Zoologischen Museum in Berlin, 27,1–432.
Rhee, H. (2013). Disentangling the distribution of Tettigonia viridissima
(Linnaeus, 1758) in the eastern part of Eurasia using acoustical and
morphological data. Articulata, 28(1/2), 103–114.
Roesti, C., & Keist, B. (2009). Die Stimmen der Heuschrecken. Haupt
Verlag; Bern, Stuttgart, Wien. 1–144. + DVD.
Schul, J. (1994). Untersuchungen zur akustischen Kommunikation bei
drei Arten der Gattung Tettigonia (Orthoptera, Tettigoniidae). PhD
Thesis, Marburg.
Schul, J. (1995). A case of interspecific hybridization in the genus
Tettigonia (Saltatoria: Ensifera). Entomologia Generalis, 19(3),
185–190.
Schul, J. (1998). Song recognition by temporal cues in a group of closely
related bushcricket species (genus Tettigonia). Journal of
Comparative Physiology A, 183,401–410.
Schul, J., von Helversen, D., & Weber, T. (1998). Selective phonotaxis in
Tettigonia cantans and T. viridissima in song definition and discrim-
ination. Journal of Comparative Physiology A, 182,687–694.
Swofford, D. L. (2002). PAUP*. Phylogenetic Analysis Using Parsimony
(*and other methods). Version 4.0b10a. Sinauer Associates,
Sunderland, Massachusetts.
Song, H., Amédégnato, C., Cigliano, M. M., Desutter-Grandcolas, L.,
Heads, S. W., Huang, Y., Otte, D., & Whiting, M. F. (2015). 300
million years of diversification: elucidating the patterns of orthop-
teran evolution based on comprehensive taxon and gene sampling.
Cladistics,pp.1–31.
Stolyarov, M. V. (1983). Taxonomic remarks on some Orthoptera of the
Caucasus. Vestnik Zoologii, 3,15–21 (in Russian, English abstract).
Storozhenko, S. Yu., Kim, T.-W., & Jeon, M. J. (2015). Monograph of
Korean Orthoptera. Incheon: National Institute of Biological Resources.
SYSTAX (2015). SysTax—a database system for systematics and taxonomy
http://www.biologie.uni-ulm.de/systax/daten/index.html (May 01, 2015).
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013).
MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.
Molecular Biology and Evolution, 30,2725–2729.
Tarbinsky, S. P. (1940). [The saltatorian orthopterous insects of the
Azerbaidzhan SSR] (p. 245). Moscow–Leningrad: Acad. Sci.
Azyerbaidjandkoi S.S.R. (in Russian).
Ullrich, B., Reinhold, K., Niehuis, O., & Misof, B. (2010). Secondary
structure and phylogenetic analysis of the internal transcribed
spacers 1 and 2 of bush crickets (Orthoptera: Tettigoniidae:
Barbitistini). Journal of Zoological Systematics and Evolutionary
Research, 48(3), 219–228.
Weekers, P. H. H., De Jonckheere, J. F., & Dumont, H. J. (2001).
Phylogenetic relationships inferred from ribosomal ITS sequences and
biogeographic patterns in representatives of the genus Calopteryx
(Insecta: Odonata) of the West Mediterranean and adjacent West
European zone. Molecular Phylogenetics and Evolution, 20,89–99.
Zhantiev, R. D., & Korsunovskaya, O. S. (1978). Morphofunctional or-
ganization of tympanal organs in Tettigonia cantans.Zoologiceskij
Zhurnal, 57, 1012–1016 (in Russian).
Grzywacz B. et al.
