Available via license: CC BY 4.0
Content may be subject to copyright.
RESEARCH ARTICLE
Hyperglycemia Induces Skin Barrier
Dysfunctions with Impairment of Epidermal
Integrity in Non-Wounded Skin of Type 1
Diabetic Mice
Junko Okano
1
*, Hideto Kojima
2
, Miwako Katagi
2
, Takahiko Nakagawa
3
, Yuki Nakae
2
,
Tomoya Terashima
2
, Takeshi Kurakane
1
, Mamoru Kubota
1
, Hiroshi Maegawa
4
,
Jun Udagawa
1
1Department of Anatomy and Cell Biology, Shiga University of Medical Science, Shiga, Japan,
2Departments of Stem Cell Biology and Regenerative Medicine, Shiga University of Medical Science, Shiga,
Japan, 3Industry-Academia-Government Collaboration Center of Nara Medical University, Nara, Japan,
4Internal Medicine, Shiga University of Medical Science, Shiga, Japan
*jokano@belle.shiga-med.ac.jp
Abstract
Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated
by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are
required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia
induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyper-
glycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/with-
out insulin therapy. The results showed that dye leakages were prominent, and
transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data
indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of
the protein associated with the tight junction structure, tight junction protein-1 (ZO-1), was
characterized by diffuse and significantly wider expression in the diabetic mice compared to
that in the control mice. In turn, epidermal cell number was significantly reduced and basal
cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the
number of corneocytes, namely, denucleated and terminally differentiated keratinocytes sig-
nificantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic
mice. We found that cell proliferation was significantly decreased, while apoptotic cells were
comparable in the skin of diabetic mice, compared to those in the control mice. In the epider-
mis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were
ectopically induced in diabetic mice. These data suggest that hyperglycemia altered kerati-
nocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice
were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the
proliferation/differentiation process could be the underlying mechanisms for impaired skin
barrier functions in diabetic mice.
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 1 / 22
a11111
OPEN ACCESS
Citation: Okano J, Kojima H, Katagi M, Nakagawa
T, Nakae Y, Terashima T, et al. (2016)
Hyperglycemia Induces Skin Barrier Dysfunctions
with Impairment of Epidermal Integrity in Non-
Wounded Skin of Type 1 Diabetic Mice. PLoS ONE
11(11): e0166215. doi:10.1371/journal.
pone.0166215
Editor: Michel Simon, "INSERM", FRANCE
Received: June 20, 2016
Accepted: October 25, 2016
Published: November 15, 2016
Copyright: ©2016 Okano et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: Support was provided by Grant-in-aid
from the Japanese Ministry of Education, Culture,
Sports Science and Technology (26462730);
Grant-in-aid from the Cosmetology Research
Foundation; and Grant-in-aid from Astrazeneca.
Competing Interests: The authors have declared
that no competing interests exist.
Introduction
Skin complications are relatively common in diabetes. Xerosis (dry skin) is a skin disease char-
acterized by persistent itchiness and fissures in diabetic patients, and it often delays the process
of wound healing, resulting in reduction in the patients’ quality of life [1]. A foot ulcer is also a
common skin disorder in diabetic patients. This skin damage becomes more critical when
complicated by a bacterial infection [2]. In such a case, limb/toe amputation is often required
to prevent the development of sepsis [3,4].
Tragic outcomes from a limb/toe loss and higher possibilities of hospitalizations because of
skin infections in diabetes [5] have increased the attention on study of non-wounded diabetic
skin. However, the results are quite controversial. For instance, some researchers reported
thinner epidermis in non-wounded skin in diabetes, while others determined no altered thick-
ness of the epidermis in diabetes, compared with normal skin [6–10]. On the contrary, another
study showed thicker epidermis in diabetes compared with normal skin [11]. Likewise, with
respect to the molecular profile of non-wounded skin in diabetes, inconsistent results from
studies using even the same type 2 diabetic mouse model, db/db mice, have been reported on
commonly assessed skin proliferation/differentiation markers such as keratin 1 [8,12]. A pos-
sible explanation would be that the alteration of such proteins depends on the age of db/db
mice [13]. Probably, one of the reasons for such contradictory results could be attributed to
evidence obtained from various animal models (i.e., type 1 or type 2 diabetes, and mice or rats)
as well as from humans, because studies on non-wounded skin in diabetes are relatively fewer
compared with those on other complications such as kidney, retina, and peripheral nerves.
The pathogenesis of skin complications in diabetes remains unclear. It is reported that dia-
betic neuropathy and microangiopathy are likely involved in the development of skin diseases,
while a compromised immune system could account for increased susceptibility of the epider-
mis to infection [2]. Recently, Taylor et al found that the impaired function of gamma-delta
(γδ) T cells could be a cause for reduced keratinocyte number and altered epidermal histology
using two type 2 diabetes mouse models (db/db mice and high-fat diet-fed obese mice) [8].
While these mouse models are diabetic, the culprit for the keratinocyte abnormalities remains
unclear as these mouse models exhibit several other metabolic abnormalities in addition to
hyperglycemia, such as hyperlipidemia, obesity, and insulin resistance [8].
Here, we hypothesize that hyperglycemia per se induces the skin dysfunctions and disturbs
keratinocyte homeostasis in mice. To test our hypothesis, skin barrier functions, morphologi-
cal changes, and keratinocyte differentiation status were examined in the skin of streptozoto-
cin (STZ)-induced diabetic mice, in which the main pathogenesis of diabetes was due to
hyperglycemia. To dissect the effects of STZ toxicity, the effects of insulin were also assessed in
this model.
Materials and Methods
Mice
The Animal Care Committee of Shiga University of Medical Science approved all experimental
protocols (#2013-10-1H). Eight- to ten-week-old C57BL/6J mice were purchased from CLEA
Inc. (Osaka, Japan). Hyperglycemia was induced by a single intravenous injection of STZ (150
mg/kg) (Nacalai Tesque, Kyoto, Japan) to establish an insulin-deficient diabetic mouse model.
Mice injected with citrate buffer alone were used as control. For pellet implantation, mice were
anesthetized by inhalation of 1.5% isoflurane (NARCOBIT-E, Natsume seisakusho Co, Ltd.,
Tokyo, Japan). STZ-injected mice were randomly divided in two groups to establish the fol-
lowing three groups in total: STZ-injected mice (n = 10) in which insulin was administered in
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 2 / 22
the form of implanted microcrystallized palmitic acid pellets (LinBit, LinShin Canada, Inc.,
Canada), STZ-injected mice (n = 10) in which control pellets (Palmitic acid pellets, Innovative
Research of America, Sarasota, FL) were implanted, and citrate buffer-injected mice (n = 10)
in which control pellets were implanted. Both the insulin and control pellets were implanted
subcutaneously in the back, followed by 5–0 nylon adaptation sutures. The mice were warmed
up and monitored for several hours. All mice were checked twice a week and there was no
unexpected death due to surgery. They were housed in a specific pathogen-free barrier facility
and held under standard conditions in plastic cages (12 hours light: 12 hours dark photoperiod
cycle; temperature 23 ±2˚C). Food and tap water were available ad libitum. Blood glucose lev-
els were measured once a week in all experimental mice. The experiment was performed twice
and the representative data were shown. To determine serum insulin concentration, mice
were placed in a retainer to obtain 10 μl of blood by cutting tails. Serum was obtained after cen-
trifugation at 3700 rpm for 30 minutes at 4˚C the following day and kept at -80˚C until insulin
was measured. A Morinaga Ultra Sensitive Mouse/Rat Insulin ELISA kit (Morinaga Institute
of Biological Science, Inc., Yokohama, Japan) was used to measure serum insulin concentra-
tion. All efforts were made to minimize pain due to surgery and to obtain reliable data from
minimum number of experimental animals. Information on the number of animals used for
each experiment is described in each figure legend.
Skin barrier function tests
The dye penetration assay was performed according to Bognar et al. with modifications [14].
Briefly, mice were anesthetized by intraperitoneal injection of ketamine/xylazine/aceproma-
zine (60 mg/kg, 10 mg/kg, and 2 mg/kg, respectively), followed by removing the hair of the ear
skin using Nair (Church & Dwight Co., Inc. Ewing, NJ). 1 μl of 1 mM lucifer yellow (Sigma,
St. Louis, MO) solution was applied onto the skin surface of the ears. After incubation for 3
minutes, the solution was removed and the ears were placed between a slide and a coverglass;
the ears were photographed at 2.5μm intervals with a range of 120 to 165 μm using a laser-
scanning confocal microscope to build Z-stack images (EZ-C1, Nikon, Tokyo, Japan). ImageJ
software (NIH, Bethesda, MD) was used to evaluate stained areas and measure the diameters
of leaked areas. Transepidermal water loss (TEWL) on the dorsal skin was measured using a
Vaposcan (Asahi Techno Lab. Ltd., Kanagawa, Japan). Mice were anesthetized by inhalation of
1.5% isoflurane and hairs on the dorsal region (20 mm x 20 mm) were shaved with an electric
clipper and then removed by Nair. On the following day, mice were anesthetized as in the pre-
vious day. After tape stripping four times using 3M Scotch mending tape (Sumitomo 3M Lim-
ited, Tokyo Japan), TEWL was measured five times in the same region per mouse and the
average values were calculated.
Histological examination
Mice were anesthetized with intraperitoneal injection as described in the previous section and
exsanguination and perfusion with 4% paraformaldehyde were performed. Pieces of the dorsal
skin were obtained and embedded in paraffin or Tissue-Tek OCT compound (Sakura Finetek
Japan Co., Ltd., Tokyo, Japan). Sections (10 μm) were obtained for hematoxylin and eosin
(H&E) staining and immunofluorescence. To perform immunofluorescence with epidermal
sheets, ear skin was taken before the perfusion with 4% paraformaldehyde, split into dorsal
and ventral halves, fixed with 95% ethanol on ice, and incubated in 3.8% ammonium thiocya-
nate for 30 minutes at 37˚C. The epidermis separated from the dermis and was permeabilized
in methanol at -20˚C and then washed in 0.2% Triton-X PBS several times. Blocking was per-
formed with 0.05% goat serum and 0.1% fetal bovine serum in 0.2% Triton-X PBS for 1 hour
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 3 / 22
at room temperature, followed by incubation with ZO-1 (1:20, Cell Signaling Technology,
Danvers, MA) for two consecutive nights at 4˚C. Alexa 488 anti-rabbit IgG (1:400, Life Tech-
nologies, Grand Island, NY) was used as the secondary antibody. Nuclei were stained with
TO-PRO-3iodide (Life Technologies). Epidermal sheets were photographed at 0.5 μm intervals
with a range of 15 to 20 μm using a laser-scanning confocal microscope to build Z-stack
images (EZ-C1). ImageJ software was used to evaluate stained areas and count epidermal cells.
To evaluate epidermal cell density, epidermal sheets were prepared as in whole immunofluo-
rescence with ZO-1 antibody. Epidermal sheets were fixed in 4% paraformaldehyde, stained
with TO-PRO-3iodide and mounted with Vector Shield (Vector Laboratories, Burlingame,
CA). At least 10 images per sample were acquired with a confocal microscope for calculating
epidermal cell density. As for immunohistochemistry, paraffin or frozen sections were incu-
bated with primary antibodies overnight at 4˚C, followed by secondary antibodies for 2 hours
at room temperature. Primary antibodies used were the following: anti-caspase 3 (1: 100, Cell
Signaling Technology), anti-Ki67 (1:100, Abcam, Boston, MA), anti-keratin 5 (K5) (1:400,
Lifespan, Seattle, WA or 1:500, Covance, Princeton, NJ), anti-keratin 14 (K14) (1:1000, Cov-
ance), anti-keratin 10 (K10) (1:500, Covance), anti-Filaggrin (1:1000, Covance), anti-Loricrin
(1:500, Covance). Secondary antibodies used were ImmPRESS™HRP Anti-Rabbit IgG detec-
tion kit followed by Vectastain ABC HRP kit (Vector Shield), Alexa Fluor 488 or Alexa Fluor
555 goat anti-rabbit or guinea pig IgG (1:1000, Life Technologies). Sections for immunofluo-
rescence analyses were mounted with Vector Shield using 4´-6-diamidino-2-phenylindole
(DAPI) and photographed with a laser-scanning confocal microscope. The number of caspase
3- or Ki67-positive cells and epidermal cells were quantified in each 3
rd
section of the dorsal
skin in the control and diabetic mice, respectively. Eight sections per mouse were examined.
Cornified envelope (CE) isolation, quantitative analyses, and sonication
experiments
CEs were prepared from 20 mm x 25 mm of ventral skin as previously described [15]. Briefly,
CEs were isolated by boiling the extraction buffer (2% SDS, 100 mM Tris-HCl pH8.0, 5 mM
EDTA, 20 mM DTT, followed by 0.2% SDS, 100 mM Tris-HCl pH8.0, 5 mM EDTA, 20 mM
DTT) and by centrifuging (12, 000 x G) between each step, followed by resuspension in 1 ml of
100 mM Tris/EDTA. Next, 15 μl of CEs suspension was mounted and photographed using
Q-IMAGING (British Columbia, Canada). At least 20 images per sample were acquired for
counting CEs using ImageJ software. For the sonication experiments, CE concentration was
determined with a hemocytometer and 1.0 x 10
4
of CEs from the control, diabetic, and diabetic
mice receiving insulin therapy was suspended in 2% SDS and adjusted to 60 μl. It was soni-
cated using a sonicator (THU-80, AS ONE, Tokyo, Japan) at level 1 for 20 minutes on ice.
Then, 15 μl of CE suspension was mounted and photographed using Q-IMAGING. At least 6
images per sample were acquired in order to count destroyed and intact CEs using ImageJ
software.
Flow cytometry and Real-time PCR
The preparation of the epidermal cell suspension from ear skin and the cell sorting were per-
formed as previously described [16]. Briefly, split ventral and dorsal skin of the ear was incu-
bated in 0.5% dispase (Roche, Basle, Switzerland) for 45 minutes at 37˚C. After separation of
the epidermis from the dermis, epidermal sheets were incubated in 0.3% trypsin for 10 min-
utes at 37˚C, followed by addition of an equal volume of RPMI (Wako Pure Chemical Indus-
tries, Ltd. Tokyo, Japan) with 10% fetal bovine serum and 0.1% DNase (Sigma). After vigorous
shaking for 30 seconds, the cell suspension was filtered and collected after centrifugation at
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 4 / 22
1400 rpm for 10 minutes at 4˚C. Amine reactive dye (LIVE/DEAD Fixable Violet Dead Cell
Stain Kit (Life Technologies)) was added to exclude dead cells and then anti-mouse CD16/32
antibody (10 μg/ml) (clone 2.4G2, BD Pharmingen, Franklin Lakes, NJ) was used to block Fc-
gamma (Fcγ) receptors before staining. Antibodies used for sorting included anti-CD45
(30-F11, BD Pharmingen), anti-MHCII (clone M5/114.15.2, eBioscience, San Diego, CA),
anti-Sca-1 (D7, BD Pharmingen) and anti-Integrin α6 (GoH3, eBioscience). CD45
-
MHCII
-
Sca-1
+
Integrin α6
+
cells were sorted to collect basal cells, as previously reported [17]. To detect
apoptotic cells, anti-annexin V antibody (BD Pharmingen) was used, and 1.0 x 10
6
cells in epi-
dermal cell suspension from control or diabetic mice were sorted to compare the percentage of
amine reactive dye
+
annexin V
+
cells in CD45
-
MHCII
-
cells. For RNA isolation, sorted cells
were frozen in lysis buffer at -80˚C. RNA was isolated using an RNeasy Mini Kit (QIAGEN,
Valencia, CA). cDNA was synthesized using PrimeScript RT reagent kit (Takara, Kyoto,
Japan) and real-time PCR was performed in triplicate using Light Cycler 480 SYBR Green I
Master (Roche, Mannheim, Germany). To perform real-time PCR, the following primers were
used: Keratin 5-F, TGATGACCTACATGAACAAGG; Keratin 5-R, AGACGTGTGTCTGCATCTGG;
Keratin 14-F, CCTCTGGCTCTCAGTCATCC;Keratin 14-R, GAGCAGCATGTAGCAGCTTTAG;
RPLP0-F, ATCAATGGGTACAAGCGCGTC; RPLP0-R, CAGATGGATCAGCCAGGAAGG.Individ-
ual gene expression was normalized against the ribosomal protein, large, P0 (RPLP0) house-
keeping gene.
Transmission electron microscope
Under inhalation anesthesia of 1.5 to 3% isoflurane, dorsal skin was obtained and fixed with
2% paraformaldehyde and 2% glutaraldehyde in 0.1 M cacodylate buffer, followed by 2%
osmium tetroxide in 0.1 M cacodylate buffer. Samples embedded in polymerized resins were
sectioned at 70 nm, mounted on copper grids, and observed using a transmission microscope
(JEM-1400 Plus; JOEL Ltd., Tokyo, Japan) at an acceleration voltage of 80kV. Images were
captured with a CCD camera (VELETA; Olympus Soft Imaging Solutions GmbH, Munster,
Germany).
Primary keratinocyte culture and cell proliferation assay
Neonate skin was unwrapped from the body using forceps after CO
2
exposure and decapita-
tion [18]. The unwrapped neonate skin was incubated in 0.5% dispase overnight at 4˚C. On
the following day, the epidermis was separated from the dermis and incubated into TrypLE
(Invitrogen, Carlsbad, CA) for 10 minutes with shaking at 37˚C. Then, CnT-PR (CELLnTEC,
Bern, Switzerland) was added and pipetted 20 times to create the epidermal cell suspension.
After filtration and centrifugation at 200 g for 10 minutes, 4 x 10
4
cells were plated per well in
rat-tail collagen (Sigma) -coated 48 well plates. The following condition of medium was exam-
ined (5 wells per group): CnT-PR with 38 mM of glucose, CnT-PR with 7.5 mM of STZ, which
corresponded to the concentration in blood when 150 mg/kg of STZ was injected in a mouse,
CnT-PR with 4.0 ng/ml of insulin (Wako Pure Chemical Industries), which corresponded to
the average concentration of insulin in blood of the diabetic mice with insulin treatment
(Fig 1C), and CnT-PR (control). The setting of high glucose concentration (38 mM in this
study) followed the protocol in a previous study in which the physiological high glucose con-
centration was discussed and in vitro experiments performed [19]. To dissolve STZ or insulin,
saline was used and the same amount of saline was added to the control. 1% Antibiotic-Anti-
mycotic (Thermo Fisher Scientific, Waltham, MA) was routinely added in CnT-PR. Glucose
concentration in Cn-TR was 8 mM, which is thought to be the normal glucose level [20]. After
24 hours cultivation, WST-1 (Takara, Shiga, Japan) was added according to the instruction
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 5 / 22
Fig 1. Time course and physiological conditions of mice. (A) Schematic illustration of mouse models. (B)
Blood glucose levels (mmol/l) before STZ or buffer alone injection, at 1 week, 2 weeks, and 5 weeks after the
injection are shown for the three groups. Before STZ or buffer alone injection, there was no significant
difference in blood glucose levels among the three groups. (C) Serum insulin concentration (ng/ml) is shown
at 5 weeks after the injection in the three groups. The average values ±standard errors (S. E.) of 10 mice in
each group are shown. N.S., not significant; *P<0.01.
doi:10.1371/journal.pone.0166215.g001
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 6 / 22
manual and the absorbance at 440 nm was measured using a multi-well plate reader (Infinite
F200, TACAN, Kawasaki, Japan). The absorbance at 650 nm was used as the reference wave-
length. Experiments were performed twice and representative data are shown.
Statistical analysis
One-way ANOVA followed by Bonferroni correction was used to assess the significance of the
data. P<0.01 was considered statistically significant.
Results
Diabetic mouse models with/without insulin pellets
Diabetes was induced in C57Bl/6 mice by intravenous administration of STZ. Either control
or insulin pellets were subcutaneously placed under the mid dorsal skin in half of the diabetic
mice (Fig 1A). Compared to age-matched control mice in which control pellets were
implanted (Fig 1A), the diabetic mice showed significantly higher blood glucose concentration
at 1 week, 2 weeks, and 5 weeks (Fig 1B). In turn, insulin therapy significantly increased serum
insulin levels and lowered blood glucose concentrations in the diabetic mice (Fig 1B and 1C).
Hyperglycemia disturbs skin barrier function in the diabetic mice
Skin functions as a barrier to prevent the invasion of external assaults such as chemical materi-
als and microorganisms from the outside (outside-in skin barrier). Lucifer yellow (LY) dye
with 0.95 nm in diameter cannot penetrate into the epidermis [21], therefore it was utilized to
examine the epidermal barrier functions against external assaults. In particular, the outside-in
barrier function in the stratum corneum would be an important target to evaluate [15,22];
therefore, the recently developed in vivo dye penetration assay [14] was used in this study.
Consistent with previous studies [15,22], we found that positive signals were confined to hair
follicles and to the outer surface of the stratum corneum in the control mice (Fig 2A). By con-
trast, LY signals were sporadically observed in the stratum corneum of the diabetic mice (Fig
2A). Quantification of LY positive signals showed that total LY stained area significantly
increased by 2.7 ±0.4-fold (mean ±standard errors) in the diabetic mice, compared to the
control mice (Fig 2B). These data indicate that the outside-in barrier was impaired in the dia-
betic mice. Importantly, controlling the blood glucose with insulin in the diabetic mice
returned the total LY stained area to a similar amount as that of the control (Fig 2B). Thus, the
impaired outside-in barrier would be caused by hyperglycemia, but not by STZ toxicity.
Another barrier function of the skin is to regulate water evaporation from the epidermis
(inside-out skin barrier). TEWL is thought to be a marker for water evaporation from inside
the body to the outside via the epidermis [23]. TEWL is also associated with water diffusion in
intercellular spaces [24]. In this study, a tape stripping technique was applied prior to TEWL
measurements because this technique adequately removes corneocytes to evaluate the function
of the epidermis [25]. It was found that TEWL significantly increased in the diabetic mice
compared to the control mice (Fig 2C). Importantly, insulin treatment prevented a TEWL ele-
vation observed in the diabetic mice (Fig 2C).
Hyperglycemia changes the distribution of tight junction protein-1 (ZO-1)
Cell-to-cell junction in the granular layers of the skin is sealed by tight junctions, which
enables the regulation of water evaporation from the body as well as block external assaults
[26,27]. Since both the outside-in and the inside-out skin barrier did not function normally in
the diabetic mice, we next investigated whether hyperglycemia could alter the expressions of
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 7 / 22
Fig 2. Skin barrier dysfunction in diabetic mice and its mitigation by insulin treatment. (A) In vivo lucifer yellow
(LY) penetration assay reveals dye leakages in the stratum corneum of the diabetic mice. Arrowheads indicate large
leakages, while arrows indicate small leakages. Hf, hair follicles. Top panels (LY + bright filed (BF)) show the merged
images of dark (middle panels) and BF in the epidermis. Bottom panels (“Z-stack”) are the magnified images of a 90˚
rotation of the white boxes in middle panels. Scale bars = 50 μm. Four mice per group were examined. (B) LY stained
areas are shown in the skin from the control (white bar), diabetic mice (black bar) and insulin-treated diabetic mice
(gray bar). Values are relative to control (set as 1) ±S.E. Four mice per group were examined. (C) Transepidermal
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 8 / 22
tight junction proteins between keratinocytes. It was found that tight junction protein-1
(ZO-1) was more widely and diffusely expressed among the epidermal cells in the diabetic
mice than in the control mice (Fig 3A). A quantitative analysis confirmed that ZO-1 positive
area per keratinocyte was significantly greater in the diabetic mice compared with that in the
control mice (Fig 3B). Importantly, such enhancements were mitigated by insulin treatment in
the diabetic mice (Fig 3A and 3B). Given these facts, the altered distribution pattern of the pro-
tein associated with the tight junction among keratinocytes might account for the impairment
of the skin barrier function in the diabetic mice.
water loss (TEWL) after tape stripping is shown for the control mice (white bar), the diabetic mice (black bar), and
insulin-treated diabetic mice (gray bar). The average values ±S. E. of 10 mice in each group were shown.
Experiments shown in (A), (B), and (C) were repeated twice. *P<0.01.
doi:10.1371/journal.pone.0166215.g002
Fig 3. Different distribution of tight junction protein expression in the diabetic mice and the effect of insulin
treatment. (A) ZO-1 (green) expresses widely and diffusely in the skin of diabetic mice among epidermal cells. The
nuclei of epidermal cells are indicated in white color. Arrowheads indicate significantly widened area with ZO-1
positive in the diabetic mice. Scale bars = 10 μm. (B) ZO-1 stained area per epidermal cell (mean ±S.E.) is shown in
three groups. Four mice per each group were examined and experiments were repeated twice. *P<0.01.
doi:10.1371/journal.pone.0166215.g003
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 9 / 22
Diabetes alters epidermis histology in the mice
Histological analyses revealed that basal cells were regularly aligned in the basal layer of the
control mice, while their alignment appeared irregular in the diabetic mice (Fig 4A). In addi-
tion, increased layers of the stratum corneum were also found in the diabetic mice (Fig 4A).
The former finding seemed to be accompanied by decreased number of keratinocytes. Thus,
to address the question whether keratinocytes were reduced in non-wounded skin of diabetic
mice, nuclear staining was performed on the epidermal sheets obtained from ear skin. Conse-
quently, the epidermal cell number was significantly reduced in the diabetic mice compared to
that in the control mice (Fig 4B and 4C), which is consistent with the results from a recent
report on the skin phenotype of type 2 diabetes [8].
In order to identify a mechanism for the decreased number of keratinocytes, we examined
if keratinocytes underwent apoptosis in diabetic mice. By sorting for CD45
-
MHCII
-
cells, we
were able to isolate the population which was mostly composed of keratinocytes from the epi-
dermis [17,28]. Then, we examined if isolated epidermal cells contained apoptotic cells by
labeling them with Annexin V and amine-reactive dye. It was found that the number of apo-
ptotic cells in the diabetic mice were not different from that in the control mice (30.2% in dia-
betic mice vs. 26.2% in control mice, P = non-significant.) (Fig 4D and 4E). Simultaneously,
immunohistochemical analysis using anti-caspase 3 antibody to detect apoptotic cells revealed
that there was no significant difference of the percentage of apoptotic cells in the epidermis
between the control and the diabetic mice (8.23% in diabetic mice vs. 10.1% in control mice,
P = non-significant.) (Fig 4F and 4G).
In turn, we asked whether hyperglycemia affected proliferation of epidermal cells.
Ki67-positive cells was significantly decreased in the epidermis of diabetic mice, compared
with that of control mice (Fig 5A and 5B), which was consistent with a different approach by
other group [6].
Corneocytes are denucleated and terminally-differentiated keratinocytes located in the stra-
tum corneum. These cells use CEs as scaffold instead of plasma membrane [29]. Here, we
found an unbalanced association between the number of epidermal nucleated cells and CEs.
In fact, while the number of epidermal cells decreased (Fig 4B and 4C), the number of CEs was
rather higher in the diabetic mice than in the control mice (Fig 6A and 6B). Importantly, these
changes observed in the diabetic mice were prevented by insulin treatment (Figs 4A–4C,6A
and 6B). Next, we addressed whether these increased CEs would be more vulnerable against
mechanical stress by sonication in diabetic mice [30]. It was found that sonication destroyed
82.4 ±1.94% (mean ±standard errors) of CEs derived from diabetes whereas 52.4 ±6.08% of
CEs of control mice were destroyed (Fig 6C and 6D). Again, insulin treatment was able to sig-
nificantly reduce the number of fragile CEs in diabetic mice, because the destroyed CEs by
sonication were 59.5 ±5.25% in diabetic mice treated by insulin (Fig 6C and 6D). These results
suggest that the integrity of CEs would be impaired despite of the significant increase of CE
numbers in diabetic mice. Considering that basal cells physiologically move up to the supraba-
sal layers to finally differentiate into corneocytes, hyperglycemia would disrupt the differentia-
tion process in the skin of the diabetic mice.
Diabetes alters the ultrastructure in basal cells
We next investigated the skin histology in more detail at the ultrastructural level. Transmission
electron microscopy revealed that the skin of diabetic mice exhibited unclear and shorter
hemidesmosomes in basal cells (Fig 7A, 7B, 7C and 7D). Some suprabasal cells exhibited
abnormal parakeratotic nuclei in the stratum corneum in the diabetic mice (Fig 7C and 7E).
Since it was reported that epidermal parakeratotic nuclei were associated with impaired barrier
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 10 / 22
Fig 4. Altered skin morphology but no significant induction of apoptotic cellsin the epidermis of the
diabetic mice. (A) The H&E staining showed the alignment of basal cells in the dorsal skin of the control and
insulin-treated diabetic mice, but the alignment was lost in the diabetic mice. A black box in diabetes is
magnified in the bottom panel and dot circles indicate nuclei of basal cells. Dot lines indicate the epidermis-
dermis junction, on which basal cells are located. Arrows indicate the widened stratum corneum in the diabetic
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 11 / 22
mice. (B) The nuclei staining in the epidermal sheets prepared from the ear skin are shown. (C) Epidermal cell
numbers per 1 mm
2
in the control (white bar), the diabetic mice (black bar) and insulin-treated diabetic mice
(gray bar) were quantified. (D) Representative flow cytometry plots show that 93.1% and 91.8% of cells
isolated from the enzymatically digested epidermal sheets of the control mice and diabetic mice, respectively,
are CD45
-
MHCII
-
cells. Next, 26.2% and 30.2% of epidermal cells turn positive for Annexin V and amine-
reactive dye, which corresponds to apoptotic cells. Values adjacent to the red boxes or circles are the percent
cells in each area. (E) Annexin V
+
amine-reactive dye
+
population in the epidermal cells (mean ±S.E.)
between control (white bar) and diabetic mice (black bar). (F) Apoptotic cells in the epidermis were examined
using anti-caspase 3 antibody by immunohistochemistry. Arrowheads indicate caspase 3-positive cells. Dot
lines indicate the epidermis-dermis junction. (G) Caspase 3
+
population in the epidermis cells (mean ±S.E.)
between control (white bar) and diabetic mice (black bar). Scale bars = 10 μm in (A), (B) and (F) N.S., not
significant; *P<0.01. Five mice per each group for (A, F and G), four mice per each group for (B, C), and
three mice per each group for (D, E,) were examined and experiments were repeated twice.
doi:10.1371/journal.pone.0166215.g004
Fig 5. Reduced proliferation in the epidermal cells of the diabetic mice. (A) Ki67-positive cells
(arrowheads) were significantly reduced in the epidermis of the diabetic mice compared with the control mice.
Dot lines indicate the epidermis-dermis junction. Scale bars = 50 μm. (B) Ki67
+
population in the epidermis
cells (mean ±S.E.) between control (white bar) and diabetic mice (black bar). *P<0.01. Five mice per group
were examined.
doi:10.1371/journal.pone.0166215.g005
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 12 / 22
function of the skin [31,32], this finding also supported the findings on the skin barrier defects
in the diabetic mice.
Epidermal differentiation is disturbed in the diabetic mice
The epidermal differentiation process is regulated in physiological conditions. Conversely, it is
not fully determined as to whether hyperglycemia alters the physiological epidermal differenti-
ation process [13]. Here, we examined several markers to identify the epidermal differentiation
status in these mice.
First of all, basal cells (CD45
-
MHCII
-
Sca-1
+
Integrin α6
+
) were isolated from the epider-
mal sheets by a cell sorter, and then the expressions of both keratin 5 (K5) and keratin 14 (K14)
mRNAs were examined. It was found that these factors were significantly reduced in the dia-
betic mice (Fig 8A and 8B). Consistent with these findings, immunohistochemistry confirmed
Fig 6. Aberrant cornified envelopes and their recovery by insulin treatment in the diabetic mice. (A) The cornified envelopes
(CEs) were isolated from the same area of dorsal skin in the three groups. (B) Quantification of CE numbers per 1 mm
2
(mean ±S.
E.) in the skin of the control (white bar), diabetic mice (black bar) and insulin-treated diabetic mice (gray bar) is shown. (C) CEs
isolated from control, diabetic, and insulin-treated diabetic mice are shown after 20 minute sonication. (D) Percentage of destroyed
CEs (mean ±S.E.) after 20 minutes sonication in control (white bar), diabetic mice (black bar) and insulin-treated diabetic mice (gray
bar) is shown. Arrowheads indicate destroyed CEs. *P<0.01. Three mice per each group for (A-D) were examined and experiments
were repeated twice.
doi:10.1371/journal.pone.0166215.g006
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 13 / 22
that the expressions of both K5 and K14 markedly decreased in the diabetic mice (Fig 8C–8H).
Because K5 and K14 are markers of proliferation [33], this result suggests hyperglycemia led to
less proliferation in the epidermis. In turn, the expression pattern for Keratin 10 (K10) and lor-
icrin appeared different between the control mice and the diabetic mice. While these two pro-
teins were physiologically confined to suprabasal cells in the control mice, they were
ectopically positive in the stratum corneum of the diabetic mice (Fig 8I, 8J, 8L and 8M).
Finally, the expression of filaggrin in the diabetic mice was likely identical to that in the control
mice (Fig 8O and 8P). Importantly, these altered expressions of the keratinocyte differentiation
markers were blocked by insulin treatment (Fig 8A–8Q). Altogether, these data suggest that
hyperglycemia could perturb epidermal differentiation.
Hyperglycemia, but not STZ, is responsible for skin disease in the
diabetic mice
An important issue to be addressed in our animal model is the cytotoxicity of STZ. Hyperinsu-
linemia due to insulin pellets would be also another potential factor that affects keratinocyte
homeostasis. Though we established another mouse model, control mice with insulin pellets,
all died because of severe hypoglycemia before analyses. For these reasons, the effects of STZ
and insulin on keratinocyte proliferation were examined in primary mouse keratinocyte cul-
tures. Consistent with previous reports [7,34] and our data in vivo (Fig 5), hyperglycemia
reduced cell proliferation (Fig 9). Conversely, STZ, insulin, or a combination of STZ with insu-
lin had no effect on keratinocyte proliferation (Fig 9). These data suggest that neither STZ nor
insulin may have any major effects on keratinocyte proliferation.
Fig 7. Ultrastructural analyses of non-wounded skin from the diabetic mice. Low magnification of the
skin of control and diabetic mice is shown in (A) and (C). Black boxes are magnified in (B, D, and E). (B, D)
Hemidesmosomes are indicated by white arrowheads. (E) Parakeratotic nuclei are present in the stratum
corneum of the diabetic mice. Hf, hair follicle. Scale bars = 20 μm in (A, C), 2.5 μm in (E), and 500 nm (B, D).
Two mice were examined in the control and the diabetic mice, respectively.
doi:10.1371/journal.pone.0166215.g007
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 14 / 22
Fig 8. Aberrant expression of skin proliferation/differentiation markers in the diabetic mice. (A, B)
Keratin 5 (K5) and 14 (K14) expression was determined by real-time PCR using cDNA prepared from
CD45
-
MHCII
-
Sca-1
+
Integrin α6
+
cells. Individual gene expression was normalized to that of the ribosomal
protein, large, P0 (RPLP0) housekeeping gene. Four mice were examined in each group and experiments
were repeated twice. Representative data are shown. (C-Q) The immunofluorescence analysis of the skin
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 15 / 22
Discussion
In this study, we demonstrated that the skin barrier dysfunction with impaired the prolifera-
tion/differentiation processes of keratinocytes in diabetic mice was attributable to
hyperglycemia.
It has been reported that skin complications develop in 11.4% to 71% of diabetic patients
[13,33]. In particular, skin infections are often deteriorating in diabetic patients, resulting in
higher mortality and long-term hospitalization [5,35–38]. While precise mechanisms remain
unknown, these skin diseases would be associated with increase in the susceptibility to micro-
bial infection in diabetes [39,40]. Since skin physiologically has the outside-in barrier that
blocks the invasion of harmful substances and pathogenic microorganisms from the outside
into the epidermis, the susceptibility to microbial infection in diabetes might be associated
with the skin barrier dysfunction.
Here, we examined the LY dye leakage to assess the outside-in barrier function in the stra-
tum corneum of diabetic mice. This method allowed us to determine spots where the skin bar-
rier was damaged. We found that several LY dye spots were larger than 10 μm in diameter
sections is presented. Green signals indicate K5 (C-E) or K14 (F-H) in basal layer. While keratin 10 (K10,
green) is positive in the suprabasal cells in control mice (I), it was also positive in the stratum corneum in
diabetic mice (arrows in J). Likewise, loricrin (LOR) was also present in the stratum corneum as well as the
granular and spinous layers (M), while it was detected in the granular and spinous layers of control mice (L).
Filaggrin (FLG) expression (green in O-Q) was not dramatically changed. Insulin therapy dramatically
inhibited these alterations in diabetic mice (E, H, K, N, Q). Nuclei are stained with DAPI (blue). Scale
bars = 10 μm. Five mice were examined in each group and experiments were repeated twice.
doi:10.1371/journal.pone.0166215.g008
Fig 9. High glucose, but not STZ, insulin, or a combination of STZ and insulin, suppressed
proliferation of keratinocytes in vitro.Different media that corresponded to the conditions in vivo in our
model were examined to check whether these media conditions affected proliferation of keratinocytes.
Experiments were repeated twice. *P<0.01.
doi:10.1371/journal.pone.0166215.g009
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 16 / 22
(S1 Fig). Conversely, fungal infections have been statistically more common in diabetic
patients, compared to the control group and of note, skin and nail mycosis often leads to
limb/toe amputation in diabetic patients [39]. Given the fact that the size of the hypha of fungi
is approximately 6–12 μm in diameter [41], our data suggest that such barrier defects in the
non-wounded skin in diabetes may allow hypha of fungi to easily invade into the stratum
corneum.
Another skin function is the inside-out skin barrier, through which water evaporation from
epidermis is adequately regulated in order to maintain biological body fluid homeostasis.
Xerosis is an example of skin disease where such barrier functions are impaired [42]. In fact,
the skin disease is characterized by dry skin and persistent itching, and is commonly observed
in diabetic patients [13]. For these reasons, it is likely that the inside-out barrier function
would be impaired in diabetic patients. Given the hypothesis, TEWL has been utilized to evalu-
ate the barrier function in diabetic patients as well as in experimental animals [37–40]. How-
ever, these studies showed that TEWL was not altered in diabetes compared with the control
[6,9,43,44]. This result was not in agreement with the hypothesis and therefore, Quondamat-
teo pointed out the possibility that altered structures such as cutaneous microcirculation
might mask the alteration of TEWL or that barrier defect signs other than TEWL might exist
in diabetic patients and animal models [13].
Tape stripping is an efficient method to remove corneocytes [45]. In general, tape stripping
is utilized to examine stratum corneum mass, barrier function and penetration of topical sub-
stances [46]. Another application of tape stripping is to reveal existing barrier defects. For
instance, Ackerl et al. demonstrated that tape stripping revealed a significant increase of
TEWL in plectin-conditional knockout mice compared with that in the control group,
although TEWL was comparable between these knockout and control mice before tape strip-
ping [25]. Based on our finding of abundant corneocytes in non-wounded skin of diabetes, we
hypothesized that a significant number of corneocytes might mask an abnormal inside-out
barrier in the skin of diabetic mice. Hence, a tape stripping prior to TEWL measurement
revealed that TEWL significantly increased in the diabetic mice compared to that in the con-
trol mice. Basically, tape stripping usually causes inflammation due to its mechanical stress
[25]. Indeed, more than 12 tape strips were reported to induce inflammation, resulting in a sig-
nificant increase in TEWL [47,48]. We confirmed such findings in our model (S2 Fig). How-
ever, a problem is that the cause of an increased skin permeability remains unclear. For these
reasons, mild way of tape stripping (4 tape strips) was applied in this study [25,49] to impair
only skin barrier function without inflammation. Altogether, our data suggest that the skin of
diabetic mice is more susceptible to the inside-out barrier defects with the onset of external
stimulus, compared with the skin of control mice.
In physiological epidermis, keratinocytes express several markers upon movement into the
suprabasal layers. The final step is the conversion of living cells into corneocytes, which are
scaffolded by cell envelopes. Importantly, the proliferation/differentiation process is tightly
controlled in physiological conditions [50]. Our data showing a decreased expression of K5
and K14 in the basal cells, an ectopic expression of K10/loricrin, and sensitivity of cell enve-
lopes in the diabetic mice to mechanical stress, all of which would suggest that hyperglycemia
disrupted the proliferation/differentiation process of keratinocytes in the diabetic mice.
Since we demonstrated that ZO-1 distribution in the epidermis was associated with skin bar-
rier dysfunction by experiments using diabetic mice and those with insulin treatment, altered
ZO-1 distribution appears to contribute to skin barrier dysfunction. We showed that ZO-1 pos-
itive area per keratinocyte was increased in type 1 diabetic mice, while Taylor et al reported
greater area with adherens junction protein, E-cadherin positive per keratinocyte [8]. Intrigu-
ingly, it has been shown that ZO-1 regulates barrier formation and adherens junctions through
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 17 / 22
VE-cadherin in endotheial cells [51]. Additionally, hyperglycemia alters ZO-1 distribution
through the down-regulation of Cx43, gap junction protein, leading to barrier disruption in air-
way epithelium [52]. In contrast, the precise mechanism of the process of the alteration of ZO-1
expression to cause barrier dysfunction is still unclear in the skin of diabetic mice. Future study
to examine the role of ZO-1 in the epidermis of diabetes should be warranted.
It is unlikely that STZ would be a cause for keratinocyte alterations as STZ did not exhibit
cytotoxicity of keratinocytes. In addition, skin phenotype in STZ-injected mice was amelio-
rated by insulin treatment. However, there are a couple of studies mentioning STZ could be
cytotoxic to keratinocytes [53]. Such difference could be attributed to differing concentrations
of STZ used and different cell types. 10 mM STZ was used on HaCat cells in other studies,
whereas 7.5 mM was administered to primary keratinocytes in this study. Since systemic
administration of 150 mg/kg STZ would correspond to a blood concentration of 7.5 mM, we
believe that application of 7.5 mM of STZ to primary keratinocytes would be suitable. Perhaps,
the safety window for STZ usage might be very narrow and 10 mM STZ might be potent
enough to affect keratinocyte function.
Finally, we tested the effect of insulin on cultured keratinocytes. Since insulin has multiple
protective actions on several organs in addition to lowering blood glucose [54], it is safe to
assume that the direct effect of insulin might contribute to ameliorating skin damage. We
found that insulin did not have any effect on keratinocyte proliferation, suggesting that the
protective effects of insulin were attributed to controlling blood glucose concentration, but not
to the direct effects from insulin per se.
Overall, our study directly demonstrated that both the outside-in barrier and the inside-out
barrier are impaired by hyperglycemia with alterations of keratinocyte integrity in type 1 dia-
betic mice. Our findings would be helpful for the understanding of the mechanisms behind
the development of skin complications in diabetes.
Supporting Information
S1 Fig. The rates of occurrence of arbitrarily sized dye leakage spots in the stratum cor-
neum of diabetic mice. Dye leakage spots were counted according to the size of diameter
from examined four diabetic mice. Experiments were repeated twice and representative data
are shown. Both control and insulin-treated diabetic mice had no dye leakage.
(EPS)
S2 Fig. TEWL after twelve tape strips in control, the diabetic, and insulin-treated diabetic
mice. There was no significant difference in the three groups. The average values ±S. E. of 10
mice in each group were shown. Experiments were repeated twice.
(EPS)
Acknowledgments
We thank T. Yamamoto and Y. Mori for their technical assistance. This work was supported
by a grant-in–aid from the Japanese Ministry of Education, Culture, Sports, Science, and Tech-
nology (no. 26462730 to JO), and grants in-aid from the Cosmetology Research Foundation
and Astrazeneca to JO.
Author Contributions
Conceptualization: JO HK TN TT JU.
Data curation: JO M. Katagi YN TK M. Kubota.
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 18 / 22
Formal analysis: JO YN TK M. Katagi.
Funding acquisition: JO HM.
Investigation: JO M. Katagi YN TK M. Kubota.
Methodology: JO HK TN TT.
Project administration: JO HK JU.
Resources: JO M. Katagi HM.
Software: JO JU.
Supervision: JO HK JU.
Validation: JO HK JU.
Visualization: JO HK TN.
Writing – original draft: JO HK TN.
Writing – review & editing: JO HK TN.
References
1. Pavicic T, Korting HC. Xerosis and callus formation as a key to the diabetic foot syndrome: dermatologic
view of the problem and its management. J Dtsch Dermatol Ges. 2006; 4(11):935–41. Epub 2006/11/
04. doi: 10.1111/j.1610-0387.2006.06123.x PMID: 17081268.
2. Jeffcoate WJ, Harding KG. Diabetic foot ulcers. Lancet. 2003; 361(9368):1545–51. doi: 10.1016/s0140-
6736(03)13169-8 PMID: 12737879.
3. Ngo BT, Hayes KD, DiMiao DJ, Srinivasan SK, Huerter CJ, Rendell MS. Manifestations of cutaneous
diabetic microangiopathy. Am J Clin Dermatol. 2005; 6(4):225–37. Epub 2005/08/03. PMID: 16060710.
4. Eaglstein WH, Callen JP. Dermatologic comorbidities of diabetes mellitus and related issues. Arch Der-
matol. 2009; 145(4):467–9. Epub 2009/04/22. doi: 10.1001/archdermatol.2009.31 PMID: 19380670.
5. Suaya JA, Eisenberg DF, Fang C, Miller LG. Skin and soft tissue infections and associated complica-
tions among commercially insured patients aged 0–64 years with and without diabetes in the U.S. PLoS
One. 2013; 8(4):e60057. Epub 2013/04/18. doi: 10.1371/journal.pone.0060057 PMID: 23593162;
PubMed Central PMCID: PMCPmc3622669.
6. Sakai S, Endo Y, Ozawa N, Sugawara T, Kusaka A, Sayo T, et al. Characteristics of the epidermis and
stratum corneum of hairless mice with experimentally induced diabetes mellitus. J Invest Dermatol.
2003; 120(1):79–85. doi: 10.1046/j.1523-1747.2003.12006.x PMID: 12535201.
7. Chen XF, Lin WD, Lu SL, Xie T, Ge K, Shi YQ, et al. Mechanistic study of endogenous skin lesions in
diabetic rats. Exp Dermatol. 2010; 19(12):1088–95. Epub 2010/08/13. doi: 10.1111/j.1600-0625.2010.
01137.x PMID: 20701629.
8. Taylor KR, Costanzo AE, Jameson JM. Dysfunctional gammadelta T cells contribute to impaired kerati-
nocyte homeostasis in mouse models of obesity. J Invest Dermatol. 2011; 131(12):2409–18. doi: 10.
1038/jid.2011.241 PMID: 21833015.
9. Park HY, Kim JH, Jung M, Chung CH, Hasham R, Park CS, et al. A long-standing hyperglycaemic con-
dition impairs skin barrier by accelerating skin ageing process. Exp Dermatol. 2011; 20(12):969–74.
Epub 2011/10/25. doi: 10.1111/j.1600-0625.2011.01364.x PMID: 22017743.
10. Zakharov P, Talary MS, Kolm I, Caduff A. Full-field optical coherence tomography for the rapid estima-
tion of epidermal thickness: study of patients with diabetes mellitus type 1. Physiol Meas. 2010; 31
(2):193–205. Epub 2009/12/18. doi: 10.1088/0967-3334/31/2/006 PMID: 20016116.
11. Bertheim U, Engstrom-Laurent A, Hofer PA, Hallgren P, Asplund J, Hellstrom S. Loss of hyaluronan in
the basement membrane zone of the skin correlates to the degree of stiff hands in diabetic patients.
Acta Derm Venereol. 2002; 82(5):329–34. Epub 2002/11/15. PMID: 12430730.
12. Rodgers KE, Ellefson DD, Espinoza T, Hsu YH, diZerega GS, Mehrian-ShaiR. Expression of intra-
cellular filament, collagen, and collagenase genes in diabetic and normal skin after injury. Wound
Repair Regen. 2006; 14(3):298–305. Epub 2006/07/01. doi: 10.1111/j.1743-6109.2006.00124.x
PMID: 16808808.
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 19 / 22
13. Quondamatteo F. Skin and diabetes mellitus: what do we know? Cell Tissue Res. 2014; 355(1):1–21.
Epub 2013/12/10. doi: 10.1007/s00441-013-1751-2 PMID: 24318789.
14. Bognar P, Nemeth I, Mayer B, Haluszka D, Wikonkal N, Ostorhazi E, et al. Reduced inflammatory
threshold indicates skin barrier defect in transglutaminase 3 knockout mice. J Invest Dermatol. 2014;
134(1):105–11. doi: 10.1038/jid.2013.307 PMID: 23884312.
15. Okano J, Lichti U, Mamiya S, Aronova M, Zhang G, Yuspa SH, et al. Increased retinoic acid levels
through ablation of Cyp26b1 determine the processes of embryonic skin barrier formation and perider-
mal development. J Cell Sci. 2012; 125(Pt 7):1827–36. doi: 10.1242/jcs.101550 PMID: 22366455.
16. Okano J, Kojima H, Katagi M, Nakae Y, Terashima T, Nakagawa T, et al. Epidermis-dermis junction as
a novel location for bone marrow-derived cells to reside in response to ionizing radiation. Biochem Bio-
phys Res Commun. 2015; 461(4):695–701. Epub 2015/04/30. doi: 10.1016/j.bbrc.2015.04.094 PMID:
25922286.
17. Nagao K, Kobayashi T, Moro K, Ohyama M, Adachi T, Kitashima DY, et al. Stress-induced production
of chemokines by hair follicles regulates the trafficking of dendritic cells in skin. Nat Immunol. 2012; 13
(8):744–52. doi: 10.1038/ni.2353 PMID: 22729248.
18. Lichti U, Anders J, Yuspa SH. Isolation and short-term culture of primary keratinocytes, hair follicle pop-
ulations and dermal cells from newborn mice and keratinocytes from adult mice for in vitro analysis and
for grafting to immunodeficient mice. Nat Protoc. 2008; 3(5):799–810. Epub 2008/05/03. doi: 10.1038/
nprot.2008.50 PMID: 18451788.
19. Kojima H, Hidaka H, Matsumura K, Fujita Y, Nishio Y, Maegawa H, et al. Concerted regulation of early
enterocyte differentiation by insulin-like growth factor I, insulin, and transforming growth factor-beta1.
Proc Assoc Am Physicians. 1998; 110(3):197–206. Epub 1998/06/13. PMID: 9625526.
20. Zheng JM, Zhu JM, Li LS, Liu ZH. Rhein reverses the diabetic phenotype of mesangial cells over-
expressing the glucose transporter (GLUT1) by inhibiting the hexosamine pathway. Br J Pharmacol.
153. England2008. p. 1456–64. doi: 10.1038/bjp.2008.26 PMID: 18264122
21. Zipes D, Jalife J. Cardiac electrophysiology: from cell to bedside/. Philadelphia, PA: Saunders/Elsevier;
2014. 155 p.
22. Mildner M, Jin J, Eckhart L, Kezic S, Gruber F, Barresi C, et al. Knockdown of filaggrin impairs diffusion
barrier function and increases UV sensitivity in a human skin model. J Invest Dermatol. 2010; 130
(9):2286–94. Epub 2010/05/07. doi: 10.1038/jid.2010.115 PMID: 20445547.
23. Indra AK, Leid M. Epidermal permeability barrier measurement in mammalian skin. Methods Mol Biol.
2011; 763:73–81. Epub 2011/08/30. doi: 10.1007/978-1-61779-191-8_4 PMID: 21874444; PubMed
Central PMCID: PMCPMC3306247.
24. Schwindt DA, Wilhelm KP, Maibach HI. Water diffusion characteristics of human stratum corneum at
different anatomical sites in vivo. J Invest Dermatol. 1998; 111(3):385–9. Epub 1998/09/18. doi: 10.
1046/j.1523-1747.1998.00321.x PMID: 9740228.
25. Ackerl R, Walko G, Fuchs P, Fischer I, Schmuth M, Wiche G. Conditional targeting of plectin in prenatal
and adult mouse stratified epithelia causes keratinocyte fragility and lesional epidermal barrier defects.
J Cell Sci. 2007; 120(Pt 14):2435–43. doi: 10.1242/jcs.004481 PMID: 17606998.
26. Kubo A, Nagao K, Amagai M. Epidermal barrier dysfunction and cutaneous sensitization in atopic dis-
eases. J Clin Invest. 2012; 122(2):440–7. Epub 2012/02/02. doi: 10.1172/jci57416 PMID: 22293182;
PubMed Central PMCID: PMCPmc3266780.
27. Furuse M, Hata M, Furuse K, Yoshida Y, Haratake A, Sugitani Y, et al. Claudin-based tight junctions are
crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J Cell Biol. 2002;
156(6):1099–111. Epub 2002/03/13. doi: 10.1083/jcb.200110122 PMID: 11889141; PubMed Central
PMCID: PMCPMC2173463.
28. Janich P, Pascual G, Merlos-Suarez A, Batlle E, Ripperger J, Albrecht U, et al. The circadian molecular
clock creates epidermal stem cell heterogeneity. Nature. 2011; 480(7376):209–14. doi: 10.1038/
nature10649 PMID: 22080954.
29. Candi E. The cornified envelope: a model of cell death in the skin. Nat Rev Mol Cell Biol. England2005.
p. 328–40.
30. Koch PJ, de Viragh PA, Scharer E, Bundman D, Longley MA, Bickenbach J, et al. Lessons from loricrin-
deficient mice: compensatory mechanisms maintaining skin barrier function in the absence of a major
cornified envelope protein. J Cell Biol. 2000; 151(2):389–400. Epub 2000/10/19. PMID: 11038185;
PubMed Central PMCID: PMCPMC2192642.
31. Sakurai K, Sugiura H, Matsumoto M, Uehara M. Occurrence of patchy parakeratosis in normal-appear-
ing skin in patients with active atopic dermatitis and in patients with healed atopic dermatitis: a cause of
impaired barrier function of the atopic skin. J Dermatol Sci. 2002; 30(1):37–42. Epub 2002/10/02.
PMID: 12354418.
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 20 / 22
32. Geng S, Mezentsev A, Kalachikov S, Raith K, Roop DR, Panteleyev AA. Targeted ablation of Arnt in
mouse epidermis results in profound defects in desquamation and epidermal barrier function. J Cell Sci.
2006; 119(Pt 23):4901–12. Epub 2006/11/16. doi: 10.1242/jcs.03282 PMID: 17105764.
33. Alam H, Sehgal L, Kundu ST, Dalal SN, Vaidya MM. Novel function of keratins 5 and 14 in prolifera-
tion and differentiation of stratified epithelial cells. Mol Biol Cell. 2011; 22(21):4068–78. Epub
2011/09/09. doi: 10.1091/mbc.E10-08-0703 PMID: 21900500; PubMed Central PMCID:
PMCPMC3204069.
34. Spravchikov N, Sizyakov G, Gartsbein M, Accili D, Tennenbaum T, Wertheimer E. Glucose effects on
skin keratinocytes: implications for diabetes skin complications. Diabetes. 2001; 50(7):1627–35. Epub
2001/06/26. PMID: 11423485.
35. Geerlings SE, Stolk RP, Camps MJ, Netten PM, Hoekstra JB, Bouter PK, et al. Asymptomatic bacteri-
uria can be considered a diabetic complication in women with diabetes mellitus. Adv Exp Med Biol.
2000; 485:309–14. Epub 2000/12/08. doi: 10.1007/0-306-46840-9_41 PMID: 11109121.
36. Shah BR, Hux JE. Quantifying the risk of infectious diseases for people with diabetes. Diabetes Care.
2003; 26(2):510–3. Epub 2003/01/28. PMID: 12547890.
37. Muller LM, Gorter KJ, Hak E, Goudzwaard WL, Schellevis FG, Hoepelman AI, et al. Increased risk of
common infections in patients with type 1 and type 2 diabetes mellitus. Clin Infect Dis. 2005; 41(3):281–
8. Epub 2005/07/12. doi: 10.1086/431587 PMID: 16007521.
38. Hamilton MA, Hamilton GC, Goeres DM, Parker AE. Guidelines for the statistical analysis of a collabo-
rative study of a laboratory method for testing disinfectant product performance. J AOAC Int. 2013; 96
(5):1138–51. Epub 2013/11/29. PMID: 24282959.
39. Papini M, Cicoletti M, Fabrizi V, Landucci P. Skin and nail mycoses in patients with diabetic foot. G Ital
Dermatol Venereol. 2013; 148(6):603–8. PMID: 24442040.
40. Poradzka A, Jasik M, Karnafel W, Fiedor P. Clinical aspects of fungal infections in diabetes. Acta Pol
Pharm. 2013; 70(4):587–96. Epub 2013/08/08. PMID: 23923382.
41. Lopez-Franco R, Bartnicki-Garcia S, Bracker CE. Pulsed growth of fungal hyphal tips. Proc Natl Acad
Sci U S A. 1994; 91(25):12228–32. Epub 1994/12/06. PMID: 7991610; PubMed Central PMCID:
PMCPMC45410.
42. Rawlings A. Skin biology, xerosis, barrier repair and measurement. Drug discovery today Disease
mechanisms. 2008; 5(2):e127–e36.
43. Sakai S, Kikuchi K, Satoh J, Tagami H, Inoue S. Functional properties of the stratum corneum in
patients with diabetes mellitus: similarities to senile xerosis. Br J Dermatol. 2005; 153(2):319–23. doi:
10.1111/j.1365-2133.2005.06756.x PMID: 16086742.
44. Seirafi H, Farsinejad K, Firooz A, Davoudi SM, Robati RM, Hoseini MS, et al. Biophysical characteristics
of skin in diabetes: a controlled study. J Eur Acad Dermatol Venereol. 2009; 23(2):146–9. doi: 10.1111/
j.1468-3083.2008.02950.x PMID: 18702623.
45. Pinkus H. Tape stripping in dermatological research. A review with emphasis on epidermal biology. G
Ital Dermatol Minerva Dermatol. 1966; 107(5):1115–26. Epub 1966/09/01. PMID: 6014779.
46. Farage M, Miller K, Maibach H. Textbook of Aging Skin: Springer Science & Business Media; 2009.
47. Holzmann S, Tripp CH, Schmuth M, Janke K, Koch F, Saeland S, et al. A model system using tape strip-
ping for characterization of Langerhans cell-precursors in vivo. J Invest Dermatol. 2004; 122(5):1165–
74. Epub 2004/05/14. doi: 10.1111/j.0022-202X.2004.22520.x PMID: 15140219.
48. Ghigo C, Mondor I, Jorquera A, Nowak J, Wienert S, Zahner SP, et al. Multicolor fate mapping of Lang-
erhans cell homeostasis. J Exp Med. 2013; 210(9):1657–64. Epub 2013/08/14. doi: 10.1084/jem.
20130403 PMID: 23940255; PubMed Central PMCID: PMCPmc3754858.
49. Kemeny L, Farkas A, Dobozy A. Low-dose dithranol treatment and tape stripping induce tolerance to
dithranol in a mouse ear oedema model. Br J Dermatol. 2002; 146(5):764–9. Epub 2002/05/10. PMID:
12000371.
50. Sotiropoulou PA, Blanpain C. Development and homeostasis of the skin epidermis. Cold Spring Harb
Perspect Biol. 2012; 4(7):a008383. Epub 2012/07/04. doi: 10.1101/cshperspect.a008383 PMID:
22751151; PubMed Central PMCID: PMCPMC3385954.
51. Tornavaca O, Chia M, Dufton N, Almagro LO, Conway DE, Randi AM, et al. ZO-1 controls endothelial
adherens junctions, cell-cell tension, angiogenesis, and barrier formation. J Cell Biol. 2015; 208(6):821–
38. Epub 2015/03/11. doi: 10.1083/jcb.201404140 PMID: 25753039; PubMed Central PMCID:
PMCPMC4362456.
52. Yu H, Yang J, Zhou X, Xiao Q, Lu Y, Xia L. High glucose induces dysfunction of airway epithelial barrier
through down-regulation of connexin 43. Exp Cell Res. 2016; 342(1):11–9. Epub 2016/02/24. doi: 10.
1016/j.yexcr.2016.02.012 PMID: 26902399.
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 21 / 22
53. Harel A, Bloch O, Vardi P, Bloch K. Sensitivity of HaCat keratinocytes to diabetogenic toxins. Biochem
Pharmacol. 2002; 63(2):171–8. Epub 2002/02/14. PMID: 11841791.
54. Liu Y, Petreaca M, Yao M, Martins-Green M. Cell and molecular mechanisms of keratinocyte function
stimulated by insulin during wound healing. BMC Cell Biol. 2009; 10:1. Epub 2009/01/13. doi: 10.1186/
1471-2121-10-1 PMID: 19134226; PubMed Central PMCID: PMCPMC2631465.
Skin Barrier Defects in Non-Wounded Skin of Type 1 Diabetic Mice
PLOS ONE | DOI:10.1371/journal.pone.0166215 November 15, 2016 22 / 22
