ArticlePDF Available

Laccaria rubroalba sp. Nov. (Hydnangiaceae, Agaricales) from Southwestern China

DOI:10.11646/phytotaxa.284.1.4
Authors:
XIA LUO
XIA LUO
XIA LUO
  • This person is not on ResearchGate, or hasn't claimed this research yet.
LEI YE
LEI YE
LEI YE
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Jie Chen at Universidad Veracruzana
Jie Chen
Samantha C. Karunarathna
Samantha C. Karunarathna
Show all 7 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract and Figures

The novel species Laccaria rubroalba is described from Southwestern China by using both morphological characteristics and molecular data. It is characterized by small basidiomata; reddish white pileus when moist or young, white to pale when dry; 4-spored basidia and globose to broadly ellipsoid, hyaline, moderately echinulate basidiospores. Phylogenetic relationships inferred from ITS sequence data confirmed the separation of this new species from other closely related species in the genus Laccaria. The new species is compared with similar taxa. A description, line drawings and colour photographs of the new species, and phylogenetic tree to show the placement of the new species are provided.
Figures - uploaded by Samantha C. Karunarathna
Author content
All figure content in this area was uploaded by Samantha C. Karunarathna
Content may be subject to copyright.
Content uploaded by Samantha C. Karunarathna
Author content
All content in this area was uploaded by Samantha C. Karunarathna on Dec 08, 2016
Content may be subject to copyright.
Phytotaxa 284 (1): 041–050
http://www.mapress.com/j/pt/
Copyright © 2016 Magnolia Press Article PHYTOTAXA
ISSN 1179-3155 (print edition)
ISSN 1179-3163 (online edition)
Accepted by Masoomeh Ghobad-Nejhad: 21 Oct. 2016; published: 9 Nov. 2016
http://dx.doi.org/10.11646/phytotaxa.284.1.4
41
Laccaria rubroalba sp. nov. (Hydnangiaceae, Agaricales) from Southwestern China
XIA LUO1,2,3,4, LEI YE1,2,3, JIE CHEN1, SAMANTHA C. KARUNARATHNA1,2,3, JIANCHU XU2,3, KEVIN D.
HYDE1,2,3 & PETER E. MORTIMER2,3*
1Center of Excellence in Fungal Research, Mae Fah Luang University, Chiang Rai, 57100, Thailand
2Centre for Mountain Ecosystem Studies, Kunming Institute of Botany, Chinese Academy of Sciences, 650201, Kunming, China
3World Agroforestry Centre, East and Central Asia Office, 132 Lanhei Road, Kunming 650201, China
4School of Biology and Food Engineering, Chuzhou University, Chuzhou, 239000, China
*Corresponding author: Peter E. Mortimer, email address: P.Mortimer@cgiar.org
Abstract
The novel species Laccaria rubroalba is described from Southwestern China by using both morphological characteristics
and molecular data. It is characterized by small basidiomata; reddish white pileus when moist or young, white to pale when
dry; 4-spored basidia and globose to broadly ellipsoid, hyaline, moderately echinulate basidiospores. Phylogenetic relation-
ships inferred from ITS sequence data confirmed the separation of this new species from other closely related species in the
genus Laccaria. The new species is compared with similar taxa. A description, line drawings and colour photographs of the
new species, and phylogenetic tree to show the placement of the new species are provided.
Keywords: Mushrooms, Mycorrhizal fungi, Phylogeny, Taxonomy, Yunnan Province
Introduction
Laccaria Berk. & Broome (Hydnangiaceae, Agaricales) is an ectomycorrhizal genus with a cosmopolitan distribution.
Species in this genus range from host-generalists to host-specialists (Giachini et al. 2004, Sheedy et al. 2013, Wilson
et al. 2013, Sheedy et al. 2015). Some Laccaria species, such as L. amethystine Cooke (Wilson et al. 2013) and L.
laccata (Scop.: Fr.) Cooke (Osmundson et al. 2005), are pioneers in harsh conditions (Wadud et al. 2014). Laccaria
species also have potential for high altitude land recovery (Osmundson et al. 2005). Species of Laccaria have been
used in experimental systems for studies of ectomycorrhizal basidiomycetes. Lately, several new species of Laccaria
have been described worldwide.
Laccaria is one of the most readily identifiable mushroom genera and is characterized by thick, widely spaced
lamellae, purple or orange to brown or flesh-coloured fruiting bodies with adnate to slightly decurrent gills and hyaline
and ornamented basidiospores in most species. Combined morphological and molecular characteristics can provide
useful data to identity Laccaria species (Gardes et al. 1990, Mueller 1991, Osmundson et al. 2005).
Yunnan Province, located in Southwestern China, is known to be one of the most important biodiversity hotspots
of the world (Xu et al. 2009, Popa et al. 2014). Six species have been recorded in Yunnan province, China, among the
39 known Laccaria species in the world. During the last decade, numerous new Laccaria species have been described
from this region, such as, L. alba Zhu L. Yang & L. Wang and L. angustilamella Zhu L. Yang & L. Wang (Wang et
al. 2004), L. fulvogrisea F. Popa, Rexer & G. Kost (Popa et al. 2014), L. aurantia F. Popa, Rexer & G. Kost and L.
yunnanensis F. Popa, Rexer & G. Kost (Popa et al. 2014). Our survey on macrofungi in Yunnan Province, China has
been carried out from 2012 (Guo et al. 2014, Li et al. 2014, Ye et al. 2014). Under the framework of this survey, we
studied four collections of Laccaria from Mengsong, Yunnan Province. The collections were identified as a new
species based on both morphological characteristics and molecular data. In this paper, we introduce L. rubroalba with
a full description, line drawings, colour photographs and a phylogenetic tree to show the placement and uniqueness of
the new species.
LUO ET AL.
42 • Phytotaxa 284 (1) © 2016 Magnolia Press
Materials and methods
Collection site and collections
Four collections of the new Laccaria species were found in mixed forest dominated by Fagaceae and other broad-leaf
trees between August and September of 2012 and 2013 in Mengsong, Yunnan Province, Southwestern China.
FIGURE 1. Basidiomata of Laccaria rubroalba A–C: KUN-HKA 90766, E–G: KUN-HKA 90753.
Morphological studies
Each collection was photographed in situ, gathered, wrapped in aluminum foil, and placed in a collection box with
compartments in order to avoid mixing or crushing. The macro-morphological description of fresh samples was carried
out soon after returning from the field following the methodology described in Lodge et al. (2004) (fig. 1). Colour
coding was according to Kornerup and Wanscher (1978). Specimens were dried using an electric food dryer at 35
°C. Dry specimens are deposited at herbarium of Kunming Institute of Botany, Chinese Academy of Sciences. Index
LACCARIA RUBROALBA SP. NOV. FROM CHINA Phytotaxa 284 (1) © 2016 Magnolia Press • 43
Fungorum (2016), Faces of fungi database (Jayasiri et al. 2015, Index Fungorum 2016) and MycoBank (Robert et
al. 2014) numbers are registered. Microscopic structures were examined from dry specimens following the protocols
of Largent and Thiers (1977) (fig. 2). Detailed measurements of at least 20 basidiospores, basidia and cystidia, were
taken from at least three collections. Basidiospore dimensions were given excluding ornamentation and the apiculus.
In addition, the length/wide ratio (Q) was calculated.
FIGURE 2. Line drawings of microstructures of Laccaria rubroalba. a. Pileipellis b. Hymenium with basidia c. Pleurocystidia d.
Basidiospores
Phylogenetic analysis
DNA extraction, PCR amplification and sequencing
DNA was extracted from dry basidiomata by using the Biospin Fungus Genomic DNA Extraction Kit (BSC14S1)
according to the manufacturer’s protocol. The internal transcribed spacer (ITS) region of the nuclear ribosomal
DNA (rDNA) were amplified using the primers ITS1-F (5‘CTTGGTCATTTAGAGGAAGTAA3’) and ITS4
(5‘TCCTCCGCTTATTGATATGC3’) following the studies of Gardes et al. (1990) and Popa et al. (2014). DNA
sequencing was performed at BGI Sequencer, Beijing, China.
LUO ET AL.
44 • Phytotaxa 284 (1) © 2016 Magnolia Press
Sequence alignment and phylogenetic analyses
Contig assembly for generating one consensus sequences from forward and reverse sequences was conducted using
SeqMan Pro (DNASTAR, Madison, WI). Sequences generated for this study plus those retrieved from GenBank
were initially aligned using the program MAFFT (Katoh & Standley 2013) with default settings, and then manually
adjusted in BioEdit v. 7.0.4. The ITS alignment was treated with Gblocks version 0.91 b (Castresana 2000), eliminating
poorly aligned positions and ambiguous regions. Maximum likelihood (ML) analysis was performed with RAxML-
HPC BlackBox (8.0.0) (Stamatakis 2006, Stamatakis et al. 2008) under GTRGAMMA model with one thousand
rapid bootstrap (BS) replicates. Bayesian analysis was performed with MrBayes 3.2 (Ronquist & Huelsenbeck 2003,
Ronquist et al. 2012) using GTR+I+G model selected by AIC in MrModeltest 2.2 (Nylander 2004). Bayesian analysis
included two independent runs of 5,000,000 generations with four nchains per run, a sampling frequency of 100 and
print frequency to 1000 generations. A burn-in of 10% with nst = 6, rates = invgamma, statefreqpr = dirichlet (1,1,1,1),
and, for other parameters, default settings were used. As a result, all compatible groups consensus tree from both
analyses was selected.
Results
Phylogenetic analyses
The expanded ITS dataset comprised 77 sequences and 646 positions. Four sequences were newly obtained for this
study and 73 sequences were retrieved from GeneBank (Benson et al. 2013). Mythicomyces corneipes was used as the
out group following Popa et al. (2016). Sequences for all known Laccaria species were retrieved from GenBank for
phylogenic analyses as in the studies of Popa et al. (2016) and Montoya et al. (2015). Table 1 shows an overview of all
sequences used in the phylogenetic analyses. Maximum likelihood (ML) and Bayesian analyses (BI) generated very
similar topologies, and thus only that from the ML analysis is presented along with the bootstrap statistics (BS) and
posterior probabilities (PP) values more than 60% and 0.8, respectively, at the nodes (fig. 3). Phylogenetic analyses
revealed that four newly sampled specimens formed a distinct lineage with strong support (97BS/1PP).
TABLE 1. Taxa information and GenBank accession numbers of Laccaria specimens used in the molecular phylogenetic analyses.
Taxon Location Voucher specimen Genbank accession no.
L. acanthospora TYPE China: Xizang - JX504102
L. acanthospora China: Tibet - JX504119
L. acanthospora China: Tibet - JX504161
L. affinis France GMM7619 KM067853
L. alba China - JX504131
L. alba China: Yunnan - JX504094
L. alba China - JX504126
L. amethysteo-occidentalis Canada f16573 FJ627031
L. amethysteo-occidentalis USA - JX504112
L. amethystina Denmark: Zealand MC01-520 AM113954
L. amethystina France - JX504150
L. anglica France - GQ406459
L. angustilamella China: Yunnan - JX504168
L. angustilamella China:Yunnan - JX504118
L. angustilamella China:Yunnan - JX504132
L. aurantia China: Yunnan MB-FB-001109 JQ681209
L. aurantia China: Yunnan MB-FB-001106 JQ670895
...Continued on next page
LACCARIA RUBROALBA SP. NOV. FROM CHINA Phytotaxa 284 (1) © 2016 Magnolia Press • 45
TABLE 1. (Continued)
Taxon Location Voucher specimen Genbank accession no.
L. bicolor China: Yunnan - JX504159
L. bicolor USA - JX504114
L. bicolor USA - JX504105
L. bicolor North America - JX504115
L. bullipellis TYPE China : Xizang - JX504100
L. canaliculata Australia: Victoria - JX504136
L. canaliculata Australia - JX504137
L. cf. canaliculata Australia MEL:2360196 JX270720
L. cf. lateritia Australia MEL:2359691 JX270695
L. cf. lateritia Australia MEL:2359692 JX270736
L. cf. masoniae Australia MEL:2359694 JX270741
L. fulvogrisea China: Yunnan MB-FB-001110 JQ681210
L. fulvogrisea China: Yunnan MB-FB-001101 JQ670896
L. glabripes New Zealand - JX504140
L. himalayensis TYPE China: Xizang - JX504101
L. himalayensis China: Xizang - JX504104
L. laccata France - JX504147
L. laccata Austria IB2004243 EF644110
L. laccata USA JMP0036 EU819477
L. lateritia Malaysia RBG Kew K(M) 166658 JN235950
L. lateritia India RBG Kew K(M) 166659 JN235949
L. lateritia Australia - FJ168596
L. masoniae Australia: Tasmania - JX504139
L. montana North America TENN 42885 DQ149866
L. montana North America TWO 319 DQ149862
L. murina Japan - AB211271
L. negrimarginata TYPE China: Tibet - JX504120
L. nobilis North America TENN 42527 DQ149861
L. nobilis North America CLC 1445 DQ149863
L. oblongospora France - GQ406466
L. ochropurpurea USA: Illinois - JX504169
L. ochropurpurea Canada - KM406966
L. ohiensis Europe - JX504106
L. proxima Europe C19 EC174 AY750156
L. proxima France - JX504152
L. proxima Germany FP-98555 DQ499641
L. proxima North America TENN 42922 DQ149852
L. pseudomontana North America Cripps 1771 DQ149870
...Continued on next page
LUO ET AL.
46 • Phytotaxa 284 (1) © 2016 Magnolia Press
TABLE 1. (Continued)
Taxon Location Voucher specimen Genbank accession no.
L. pseudomontana North America Cripps 1625 DQ149871
L. pumila North America CLC 1252 DQ149864
L. pumila North America TWO 501 DQ149873
L. roseoalbescens Mexico LM5099 KJ874328
L. roseoalbescens Mexico LM5042 KJ874327
L. rubroalba sp.nov. China: Yunnan KUN-HKA 90758 KX449357
L. rubroalba sp.nov. China: Yunnan KUN-HKA 90753 KX449358
L. rubroalba sp.nov. China: Yunnan KUN-HKA 90766 KX449359
L. rubroalba sp.nov. China: Yunnan KUN-HKA 90751 KX449360
L. salmonicolor TYPE China: Tibet - JX504143
L. stellata Panama SYC 207 KP877339
L. stellata Panama SYC 109 KP877340
L. tortilis Europe DBGH 20904 DQ149872
L. tortilis France GMM7635 KM067859
L. trichodermophora USA: Texas - JX504157
L. trullisata - - JX504170
L. vinaceoavellanea Japan TNS:A2984 JN942785
L. vinaceoavellanea Japan TNS:A0559 JN942803
L. yunnanensis China: Yunnan MB-FB-001108 JQ681208
L. yunnanensis China: Yunnan MB-FB-001107 JQ670897
Mythicomyces corneipes Germany ES11.10.2.A KC964108
Mythicomyces corneipes Germany AFTOL-ID 972 DQ404393
Taxonomy
Laccaria rubroalba X. Luo, L. Ye, Mortimer & K.D. Hyde, sp. nov.
Index Fungorum number: IF552302; Facesoffungi number: FoF 02078
Etymology:—The species epithet “rubroalba” refers to the pileus colour of the new species.
Diagnosis:—The new species differs from known species of Laccaria by medium sized basidiomata; pileus
22–40 mm in diameter, translucent-striate, reddish white when moist or young, becoming white to paler when dry;
lamellae distant, adnate; globose to subglobose to broadly ellipsoid, hyaline, moderately echinulate basidiospores (5)
6–9 (10) × 5–7 (8) μm, Q = 0.97–1.31; basidia, 4-spored, clavate. Pileipellis a cutis, 4–9 (13) μm diameter thickness.
Description:—Basidiomata medium size. Pileus 22–40 mm in diam., less than 1 mm thick at disc., hemispherical
to convex, flattened with age, centrally depressed to umbilicate, smooth with translucent-striate ridges, reddish white
(10A2) when moist or young, becoming white to paler when dry. Context soft. Lamellae up to 4 mm broad, distant,
adnate, ventricose to broadly ventricose, flesh-coloured. Stipe 20–31 × 2–4 mm, cylindrical with an enlarged base,
centrally inserted, fistulose, fleshy brown, becoming pale brownish with age, and with rhizomorphs.
Basidiospores (5) 6–9 (10) × 5–7 (8) μm, Q = 0.97–1.31, globose, to subglobose to broadly ellipsoid, hyaline,
moderately echinulate, 1.2–2.7 μm long, 0.73–0.96 μm broad at the base. Basidia 28–56 × 9–10 (11) μm, 4-spored,
some 2-spored, hyaline. Pleurocystidia (20) 25–40 (55) × 4–6 (7) μm, flexuous to narrowly-cylindrical. Cheilocystidia
rare, (11) 12–26 (26) × 5–9 μm, cylindrical to capitate; margin cell 18–33 × 3–6 μm, cylindric to clavate. Pileipellis
a cutis to interwoven, 4–9 (13) μm diam thickness, consisting of radiating interwoven hyphae, with rounded top and
thick-walls (up to 1.20 μm). Hyphae 3–6 μm diam, Clamp connections present.
LACCARIA RUBROALBA SP. NOV. FROM CHINA Phytotaxa 284 (1) © 2016 Magnolia Press • 47
FIGURE 3. Maximum-likelihood (ML) phylogram based on ITS rDNA sequence data showing the phylogenetic position of Laccaria
rubroalba with selected Laccaria species. The right number on the nodes denotes the bootstrap values ≥ 60%. The left number on the
nodes indicates the Bayesian analysis probability values ≥ 0.80 in percent.
LUO ET AL.
48 • Phytotaxa 284 (1) © 2016 Magnolia Press
Habitat and Distribution:—Scattered on a trunk of Castanopsis mekongensis in a tropical forest dominated by
mixed Fagaceae and broad-leaf trees in Xishuangbanna, Yunnan, China.
Material examined:—CHINA. Yunnan Province: Xishuangbanna, Mengsong village, elevation 1734 m, N21°
30’ 52”, E100° 28’ 44.76”, 18 August 2013, Xia Luo (KUN-HKA 90753, Holotype). CHINA. Yunnan Province:
Xishuangbanna, Mengsong village, elevation 1694 m, N21° 30’ 53”, E100° 28’ 49.1”, 5 September 2012, Xia Luo
(KUN-HKA 90758, Paratype). CHINA. Yunnan Province: Xishuangbanna, Mengsong village, elevation 1635 m, N21°
30’ 14.4”, E100° 29’ 22.5”, 12 October 2012, Xia Luo (KUN-HKA 90766, Paratype). CHINA. Yunnan Province:
Xishuangbanna, Mengsong village, elevation 1635 m, N21° 30’ 14.4”, E100° 29’ 22.5”, 20 September 2012, Xia Luo
(KUN-HKA F90751, Paratype).
Discussion
Laccaria rubroalba is morphologically characterized by its medium sized basidiomata; reddish white to pale white
pileus (22–40 mm); globose to subglobose to broadly ellipsoid, hyaline, with moderately echinulate basidiospores; and
flesh-coloured distant lamellae.
Laccaria yunnanensis (Popa et al. 2014) resembles L. rubroalba, however, L. yunnanensis differs from the latter
in having bigger basidiomata, brownish to flesh-coloured basidiomata, convex to hemispherical, large, striate pileus
(60–100 mm), and large pleurocystidia, (50) 55–65 (70) × (10) 15–25(30) μm, and pileipellis consisting of radiating
interwoven thin-walled hyphae. Laccaria fulvogrisea (Popa et al. 2014) differs from L. rubroalba by having grey to
brownish basidiomata, large echinulate basidiospores and long cheilocystidia. Laccaria salmonicolor A.W. Wilson &
G.M. Muell. (Wilson et al. 2013) is morphologically similar to L. rubroalba, but differs from the latter by having reddish-
brown basidiomata with salmon-pink lamellae, smaller, globose, moderately echinulate basidiospores, and pileipellis
a cuits. Laccaria rubroalba is morphologically similar to L. laccata (Osmundson et al. 2005), but the basidiomata of
L. laccata convex or nearly omphaloid, pale orange, lamellae thick and broadly attached. Laccaria himalayensis A.W.
Wilson & G.M. Muell. (Wilson et al. 2013) differs from L. rubroalba by having the characteristics such as brown
at the disk to orange-pink at margin of the pileus, adnate to decurrent lamellae, orange-pink, moderately echinulate,
globose basidiospores, pileipellis cutis of cylindrical and irregularly inflated hyphae. Furthermore, L. acanthospora
A.W. Wilson & G.M. Muell. (Wilson et al. 2013) differs from L. rubroalba in having orange basidiomata, broad and
distant lamellae, pink-lavender hues on the stipe, longer and broad echinulate basidiospores.
According to our phylogenetic results (fig. 3), the internal transcribed spacer (ITS) region of the nuclear ribosomal
DNA of L. rubroalba differs from the corresponding sequences known form other Laccaria species. Laccaria
rubroalba is phylogenetically closely related to L. aurantia, but the latter differs from L. rubroalba at seven positions
in ITS sequence with strong support (82 BS/1 PP). Morphologically, L. aurantia (Popa et al. 2014) has broad and
orange lamellae, globose and balloon-like, large and short densely echinulate basidiospores, pileipellis semper hypha
intertextis, and short pleurocystidia.
Acknowledgments
We would like to thank CGIAR Research Program 6: Forest, Trees and Agroforestry, the Kunming Institute of Botany,
Chinese Academy of Science (CAS) and the Chinese Ministry of Science and Technology, under the 12th 5-year
National Key Technology Support Program (NKTSP) 2013BAB07B06 integration and comprehensive demonstration
of key technologies on Green Phosphate-mountain Construction for providing the financial support for this study.
Thailand Research Fund grant-Taxonomy, Phylogeny and biochemistry of Thai Basidiomycetes (BRG 5580009); the
National Research Council of Thailand (NRCT), projects-Taxonomy, Phylogeny and cultivation of Lentital species in
northern Thailand (NRCT/55201020007), Mae Fah Luang University project-Taxonomy, Phylogeny and cultivation
of Lentinula species in northern Thailand (MFU/54 1 01 02 00 48), and Thailand Research Fund grant-Taxonomy,
Phylogeny and biochemistry of Thai Basidiomycetes (BRG 5580009) are also thanked for supporting this study.
Kevin D. Hyde thanks the Chinese Academy of Sciences, project number 2013T2S0030, for the award of Visiting
Professorship for Senior International Scientists at Kunming Institute of Botany. We wish to thanks Molecular biology
experiment platform at Kunming institute of botany, Chinese Academy of science for providing DNA extraction and
extensions. The authors also would like to thank Jiayu Guo, Huili Li, and Fu Gao for the contribution of fieldwork.
LACCARIA RUBROALBA SP. NOV. FROM CHINA Phytotaxa 284 (1) © 2016 Magnolia Press • 49
References
Benson, D.A., Cavanaugh, M., Clark, K., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J. & Sayers, E.W. (2013) GenBank. Nucleic acids
research 41: 36–42.
http://dx.doi.org/10.1093/nar/gks1195
Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular biology
and evolution 17:540–552.
http://dx.doi.org/10.1093/oxfordjournals.molbev.a026334
Index Fungorum (2016) Available from: http://www.indexFungorum.org/names (accessed 20 August 2016 )
Gardes, M., Fortin, J., Mueller, G. & Kropp, B. (1990) Restriction fragment length polymorphisms in the nuclear ribosomal DNA of four
Laccaria spp.: L. bicolor, L. laccata, L. proxima. and L. amethystina. Phytopathology 80: 1312–1317.
http://dx.doi.org/10.1094/Phyto-80-1312
Giachini, A.J., Souza, L.A.B. & Oliveira, V.L. (2004) Species richness and seasonal abundance of ectomycorrhizal fungi in plantations of
Eucalyptus dunnii and Pinus taeda in southern Brazil. Mycorrhiza 14: 375–381.
http://dx.doi.org/10.1007/s00572-004-0297-2
Guo, J., Karunarathna, S.C., Mortimer, P.E., Xu, J. & Hyde, K.D. (2014) Phylogenetic diversity of Russula from Xiaozhongdian, Yunnan,
China, inferred from Internal transcribed spacer sequence data. Chiang Mai Journal 41: 001–011.
Jayasiri, S.C., Hyde, K.D., Ariyawansa, H.A., Bhat, J., Buyck, B., Cai, L., Dai, Y.C., Abd-Elsalam, K.A., Ertz, D. & Hidayat, I. (2015) The
faces of fungi database: fungal names linked with morphology, phylogeny and human impacts. Fungal Diversity 74: 3–18.
http://dx.doi.org/10.1007/s13225-015-0351-8
Katoh, K. & Standley, D.M. (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability.
Molecular biology and evolution 30: 772–780.
http://dx.doi.org/10.1093/molbev/mst010
Kornerup, A. & Wanscher, J. (1978) Methuen handbook of colour. 3rd edn London: Eyre Methuen.
Largent, D.L. & Thiers, H.D. (1977) How to identify mushrooms to genus II: field identification of genera. Mad River Press. Eureka, pp.
1–32.
Li, H., Mortimer, E.E., Karunarathna, S.C., Xu, J. & Hyde, K.D. (2014) New species of Phallus from a subtropical forest in Xishuangbanna,
China. Phytotaxa 163 (2): 91–103.
http://dx.doi.org/10.11646/phytotaxa.163.2.3
Lodge, D.J., Ammirati, J.F., O’Dell, T.E. & Mueller, G.M. (2004) Collecting and describing macrofungi. Biodiversity of fungi: inventory
and monitoring methods. Elsevier Academic. San Diego, California, pp. 128–158.
Montoya, L., Bandala, V.M., Baroni, T.J. & Horton, T.R. (2015) A new species of Laccaria in montane cloud forest from eastern Mexico.
Mycoscience 56: 597–605.
http://dx.doi.org/10.1016/j.myc.2015.06.002
Mueller, G.M. (1991) Laccaria laccata complex in North America and Sweden: intercollection pairing and morphometric analyses.
Mycologia 83: 578–594.
http://dx.doi.org/10.2307/3760213
Nylander, J. (2004) MrModeltest 2.2. Computer software distributed by the University of Uppsala.
Osmundson, T.W., Cripps, C.L. & Mueller, G.M. (2005) Morphological and molecular systematics of Rocky Mountain alpine Laccaria.
Mycologia 97: 949–972.
http://dx.doi.org/10.3852/mycologia.97.5.949
Popa, F., Jimenéz, S.Y.C., Weisenborn, J., Donges, K., Rexer, K.H. & Piepenbring, M. (2016) A new Laccaria species from cloud forest
of Fortuna, Panama. Mycological Progress 15: 1–8.
http://dx.doi.org/10.1007/s11557-015-1139-7
Popa, F., Rexer, K.H., Donges, K., Yang, Z.L. & Kost, G. (2014) Three new Laccaria species from Southwest China (Yunnan). Mycological
Progress 13: 1105–1117.
http://dx.doi.org/10.1007/s11557-014-0998-7
Robert, V., Stegehuis, G. & Stalpers, D. (2014) The MycoBank engine and related databases. Available from: mycobank.org (accessed 11
January 2016)
Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–
1574.
http://dx.doi.org/10.1093/bioinformatics/btg180
Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck, J.P.
LUO ET AL.
50 • Phytotaxa 284 (1) © 2016 Magnolia Press
(2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology
61: 539–542.
http://dx.doi.org/10.1093/sysbio/sys029
Sheedy, E.M., Van de Wouw, A.P., Howlett, B.J. & May, T.W. (2013) Multigene sequence data reveal morphologically cryptic phylogenetic
species within the genus Laccaria in southern Australia. Mycologia 105: 547–563.
http://dx.doi.org/10.3852/12-266
Sheedy, E.M., van de Wouw, A.P., Howlett, B.J. & May, T.W. (2015) Population genetic structure of the ectomycorrhizal fungus Laccaria
sp A resembles that of its host tree Nothofagus cunninghamii. Fungal Ecology 13: 23–32.
http://dx.doi.org/10.1016/j.funeco.2014.08.005
Stamataki, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models.
Bioinformatics 22: 2688–2690.
http://dx.doi.org/10.1093/bioinformatics/btl446
Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid bootstrap algorithm for the RAxML web servers. Systematic Biology 57:
758–771.
http://dx.doi.org/10.1080/10635150802429642
Wadud, M.A., Nara, K., Lian, C.L., Ishida, T.A. & Hogetsu, T. (2014) Genet dynamics and ecological functions of the pioneer
ectomycorrhizal fungi Laccaria amethystina and Laccaria laccata in a volcanic desert on Mount Fuji. Mycorrhiza 24: 551–563.
http://dx.doi.org/10.1007/s00572-014-0571-x
Wang, L., Yang, Z.L. & Liu, J.H. (2004) Two new species of Laccaria (Basidiomycetes) from China. Nova Hedwigia 79: 511–517.
http://dx.doi.org/10.1127/0029-5035/2004/0079-0511
Wilson, A.W., Hosaka, K., Perry, B.A. & Mueller, G.M. (2013) Laccaria (Agaricomycetes, Basidiomycota) from Tibet (Xizang Autonomous
Region, China). Mycoscience 54: 406–419.
http://dx.doi.org/10.1016/j.myc.2013.01.006
Xu, J.C., Lebel, L. & Sturgeon, J. (2009) Functional links between biodiversity, livelihoods and culture in a Hani Swidden Landscape in
southwest China. Ecology and Society 14: 20.
Ye, L., Mortimer, P.E., Xu J., Karunarathna, S.C. & Hyde, K.D. (2014) The genus phylloporus (Boletaceae, Boletales), from Mekong
River Basin (Yunnan Province, China). Chiang Mai Journal of Science 41: 798–810.
... Laccaria is a cosmopolitan genus and many studies have contributed to its species diversity since its publication in the year of 1883 (Berkeley and Broome 1883;Heinemann 1964;Singer 1967;Besson and Kühner 1971;Kühner 1980;Lahaie 1981;Bon 1983;Clémençon 1984;Mueller 1984Mueller , 1991Mueller , 1992Singer 1986;Vellinga 1986;Ballero andContu 1987, 1989;May 1991;Kropp and Mueller 1999;Wang et al. 2004;Osmundson et al. 2005;Wilson et al. 2013Wilson et al. , 2017Popa et al. 2014Popa et al. , 2016Luo et al. 2016;Vincenot et al. 2017;Cho et al. 2018Cho et al. , 2020Corrales et al. 2020;Li 2020). Species in this genus have a strong geographical differentiation, at least in the Laccaria sect. ...
... In China, most Laccaria species were applied with western names before the study of Wang et al. (2004). Since then, several studies have documented the Chinese Laccaria species, especially from the southwestern regions (Wang et al. 2004;Wilson et al. 2013;Popa et al. 2014;Luo et al. 2016;Vincenot et al. 2017;Cho et al. 2018;Li 2020). During the past 20 years, ca. ...
... During the past 20 years, ca. 19 Laccaria species were reported from China with both molecular and morphological evidence (Wang et al. 2004;Wilson et al. 2013;Popa et al. 2014;Luo et al. 2016;Vincenot et al. 2017;Cho et al. 2018;Li 2020). However, the species recognition of this genus in China is still in its infancy. ...
Two new Laccaria species from China based on molecular and morphological evidence
Article
Full-text available
  • Apr 2021
Laccaria fagacicola and L. pallidorosea, two new species collected from subtropical broad-leaved forests, were described in this study with both molecular and morphological evidence. Laccaria fagacicola is characterized by its brownish orange basidioma and globose to subglobose, echinulate basidiospores with spines 1–2 μm long and 1–1.5 μm wide at base. Laccaria pallidorosea has a small and pinkish basidioma, and globose to subglobose, echinate basidiospores with spines 1.5–2 μm long and 2 μm wide at base. Phylogenetic analyses based on internal transcribed spacer (ITS) region indicated that L. fagacicola is sister to L. rubroalba and L. aurantia, while L. pallidorosea is related to L. versiforma and L. salmonicolor. These two new species are described, illustrated, and compared with closely related and morphologically similar species.
View
... Laccaria Berkeley & Broome (1883: 370), a cosmopolitan gilled-mushroom genus (Hydnangiaceae, Agaricales, Basidiomycota), is well known for its ectomycorrhizal association with a wide range of host trees and occurrence in various habitat types (Mueller 1992;Vincenot et al. 2011;Popa et al. 2014). Laccaria species are characterized by terrestrial, collybioid to omphaloid basidiocarps; a convex to plane or umbilicate, hygrophanous pileus; thick, waxy, sinuate to subdecurrent, often widely spaced lamellae; inamyloid, acyanophilous, echinulate basidiospores; a hymenium typically devoid of pleurocystidia; and clamped hyphae (Singer 1986;Mueller 1992;Vellinga 1995;Luo et al. 2016;Popa et al. 2016). Currently, seventy-four species of Laccaria (excluding synonyms) are listed in the Index Fungorum website (www.indexfungorum.org, ...
... It is hard to morphologically differentiate between the species of Laccaria owing to their high level of phenotypic plasticity (Mueller & Vellinga 1986;Osmundson 2003;Popa et al. 2016). However, morphological characters and molecular data together can help in accurate identification of species within the genus (Osmundson et al. 2005;Wilson et al. 2013;Luo et al. 2016;Popa et al. 2014Popa et al. , 2016. ...
... An nrITS-based dataset was prepared for performing the phylogenetic analysis. The dataset consisted of the newly generated nrITS sequence of the new species, the sequences of the closest Laccaria species revealed by the BLASTn search using the nrITS sequence of our new species and the sequences of Laccaria treated in previous phylogenetic studies on Laccaria (Wilson et al. 2013;Montoya et al. 2015;Popa et al. 2014Popa et al. , 2016Luo et al. 2016;Cho et al. 2018). In addition to these sequences, two sequences of Mythicomyces corneipes (Fr.) ...
Laccaria violaceotincta: A new species from tropical India based on morphology and molecular phylogeny
Article
Full-text available
  • Feb 2019
Laccaria violaceotincta sp. nov. is described from Kerala State, India based on morphology and molecular phylogeny. All the collections of the species were made from a freshwater swamp forest predominantly composed of species of Myristica. The Maximum Likelihood (ML) analysis of sequence of the internal transcribed spacer (nrITS) of the ribosomal RNA gene clearly revealed its novelty as well as its position within the genus Laccaria. A taxonomic description, photographs of the basidiocarps and the micro-structures, comparisons with phenetically similar and phylogenetically related species and a phylogram depicting the placement of the new species are provided.
View
... Laccaria is characterized by a brown to orange or purple collybioid to omphaloid basidiocarp; a convex to plane or umblicate, hygrophanous pileus; sinuate to subdecurrent, thick, waxy, often widely spaced lamellae; globose to oblong, echinulate, acyanophilus, inamyloid, multinucleate basidiospores; a hymenium usually without pleurocystidia and clamped hyphae (Latha et al., 2019;Luo et al., 2016;Mueller, 1992;Popa et al., 2016;Singer, 1986). Morphological data are not enough to differentiate between the species of Laccaria because of their high phenotypic plasticity level (Mueller & Vellinga, 1986;Osmundson, 2003;Popa et al., 2016). ...
... Morphological data are not enough to differentiate between the species of Laccaria because of their high phenotypic plasticity level (Mueller & Vellinga, 1986;Osmundson, 2003;Popa et al., 2016). Although, combined micro-morphological and molecular data can be helpful in the correct identification of species within the genus (Luo et al., 2016;Osmundson et al., 2005;Popa et al., 2014Popa et al., , 2016Wilson et al., 2013). Cooke based on morpho-anatomical characters (Ahmad et al., 1997;Sultana et al., 2011), while only L. moshuijun Popa & Zhu L. Yang has been characterized using molecular tools also (Ishaq et al., 2021;Khalid, 2022). ...
Laccaria murina and L. pumila from Pakistan, a study based on SEM and nrITS molecular marker
Article
Two species of the genus Laccaria , are described as new reports for Pakistan. Laccaria murina has been collected from a Himalayan moist temperate forest in Khanspur, KP, while L. pumila was found in the moist temperate forests of Kumrat Valley in Dir Upper, KP, and at higher altitudes of the Deosai plains of Gilgit‐Baltistan, Pakistan. Phylogenetic analysis based on the nrITS region clustered the Pakistani species with L. murina sequences with other Asian collections and L. pumila from USA and Netherlands. SEM of basidiospores along with detailed micro‐morphological data are provided. General distribution, habitat, ecology, and diagnostic features are also discussed. Research Highlights It has new reports from Pakistan, studies based on light, scanning electron microscopy, and nrITS molecular markers. These species have been described with detailed micro‐morphological and molecular phylogenetic analyses. General distribution, ecology, diagnostic features, and comparisons with closely related specimens have been provided. Graphical representation of DNA extraction and geographical locations of sampling sites are also illustrated (Figures 1 and 2 ). Very few members of this genus are already described from Pakistan.
View
... Notes: Laccaria currently comprises about 85 species ), but numerous new species have been described in recent years (Wilson et al. 2013(Wilson et al. , 2016Popa et al. 2014;Luo et al. 2016;Ramos et al. 2017;Vincenot et al. 2017;Cho et al. 2018;Wang et al. 2019b), a clear indication that the exact number of species in this genus is still undetermined. Laccaria species form mutualistic symbioses with many shrubs and forest tree species and are widely distributed over geographical areas from the tropics to the boreal regions (Gardes et al. 1990;Mueller 1992;Vincenot et al. 2011;Popa et al. 2014). ...
... Lamellae up to 5 mm broad, moderately distant, emarginate, sinuate to adnate with Fig. 182 Phylogram generated from maximum likelihood analysis based on LSU and ITS sequence data representing Laccaria of northern hemisphere and tropical areas. Related sequences aretaken from previous studies (Wilson et al. 2013;Popa et al. 2014;Luo et al. 2016;Ramos et al. 2017;Vincenot et al. 2017;Cho et al. 2018;Wang et al. 2019b). One hundred fifty-six strains are included in the combined analyses which comprise 1624 characters. ...
Fungal diversity notes 1387–1511: taxonomic and phylogenetic contributions on genera and species of fungal taxa
Article
Full-text available
This article is the 13th contribution in the Fungal Diversity Notes series, wherein 125 taxa from four phyla, ten classes, 31 orders, 69 families, 92 genera and three genera incertae sedis are treated, demonstrating worldwide and geographic distribution. Fungal taxa described and illustrated in the present study include three new genera, 69 new species, one new combination, one reference specimen and 51 new records on new hosts and new geographical distributions. Three new genera, Cylindrotorula (Torulaceae), Scolecoleotia (Leotiales genus incertae sedis) and Xenovaginatispora (Lindomycetaceae) are introduced based on distinct phylogenetic lineages and unique morphologies. Newly described species are Aspergillus lannaensis, Cercophora dulciaquae, Cladophialophora aquatica, Coprinellus punjabensis, Cortinarius alutarius, C. mammillatus, C. quercofocculosus, Coryneum fagi, Cruentomycena uttarakhandina, Cryptocoryneum rosae, Cyathus uniperidiolus, Cylindrotorula indica, Diaporthe chamaeropicola, Didymella azollae, Diplodia alanphillipsii, Dothiora coronicola, Efbula rodriguezarmasiae, Erysiphe salicicola, Fusarium queenslandicum, Geastrum gorgonicum, G. hansagiense, Helicosporium sexualis, Helminthosporium chiangraiensis, Hongkongmyces kokensis, Hydrophilomyces hydraenae, Hygrocybe boertmannii, Hyphoderma australosetigerum, Hyphodontia yunnanensis, Khaleijomyces umikazeana, Laboulbenia divisa, Laboulbenia triarthronis, Laccaria populina, Lactarius pallidozonarius, Lepidosphaeria strobelii, Longipedicellata megafusiformis, Lophiotrema lincangensis, Marasmius benghalensis, M. jinfoshanensis, M. subtropicus, Mariannaea camelliae, Melanographium smilaxii, Microbotryum polycnemoides, Mimeomyces digitatus, Minutisphaera thailandensis, Mortierella solitaria, Mucor harpali, Nigrograna jinghongensis, Odontia huanrenensis, O. parvispina, Paraconiothyrium ajrekarii, Parafuscosporella niloticus, Phaeocytostroma yomensis, Phaeoisaria synnematicus, Phanerochaete hainanensis, Pleopunctum thailandicum, Pleurotheciella dimorphospora, Pseudochaetosphaeronema chiangraiense, Pseudodactylaria albicolonia, Rhexoacrodictys nigrospora, Russula paravioleipes, Scolecoleotia eriocamporesi, Seriascoma honghense, Synandromyces makranczyi, Thyridaria aureobrunnea, Torula lancangjiangensis, Tubeufa longihelicospora, Wicklowia fusiformispora, Xenovaginatispora phichaiensis and Xylaria apiospora. One new combination, Pseudobactrodesmium stilboideus is proposed. A reference specimen of Comoclathris permunda is designated. New host or distribution records are provided for Acrocalymma fci, Aliquandostipite khaoyaiensis, Camarosporidiella laburni, Canalisporium caribense, Chaetoscutula juniperi, Chlorophyllum demangei, C. globosum, C. hortense, Cladophialophora abundans, Dendryphion hydei, Diaporthe foeniculina, D. pseudophoenicicola, D. pyracanthae, Dictyosporium pandanicola, Dyfrolomyces distoseptatus, Ernakulamia tanakae, Eutypa favovirens, E. lata, Favolus septatus, Fusarium atrovinosum, F. clavum, Helicosporium luteosporum, Hermatomyces nabanheensis, Hermatomyces sphaericoides, Longipedicellata aquatica, Lophiostoma caudata, L. clematidisvitalbae, Lophiotrema hydei, L. neoarundinaria, Marasmiellus palmivorus, Megacapitula villosa, Micropsalliota globocystis, M. gracilis, Montagnula thailandica, Neohelicosporium irregulare, N. parisporum, Paradictyoarthrinium difractum, Phaeoisaria aquatica, Poaceascoma taiwanense, Saproamanita manicata, Spegazzinia camelliae, Submersispora variabilis, Thyronectria caudata, T. mackenziei, Tubeufa chiangmaiensis, T. roseohelicospora, Vaginatispora nypae, Wicklowia submersa, Xanthagaricus necopinatus and Xylaria haemorrhoidalis. The data presented herein are based on morphological examination of fresh specimens, coupled with analysis of phylogenetic sequence data to better integrate taxa into appropriate taxonomic ranks and infer their evolutionary relationships.
View
... In the monographic work of Laccaria by Mueller [1], 19 species are recognized from North America, and 40 worldwide. New or potential undescribed species from different regions, based on morphological and molecular characteristics of fructifications, or on DNA identifications of environmental samples, have been discovered recently [3,7,8,[10][11][12][13][14][15]. Nowadays, MycoBank recognizes 112 records in this group of fungi, and additionally, Wilson et al. [12] inferred 116 phylogenetic species from 30 countries covering the known geographic range of Laccaria. ...
... Molecular studies on most of those records are needed not only to support their identifications but for being included in phylogenetic studies. Laccaria roseoalbescens T. J. Baroni, Montoya and Bandala, described as new [13] from the mesophytic forest in Veracruz, was recognized under morphological features and confirmed through phylogenetic DNA sequence analyses and recently incorporated by Luo et al. [14] in their molecular phylogeny to confirm the distinction of the new L. rubroalba X. Luo, L. Ye, Mortimer & K.D. Hyde from China. ...
View
... In the monographic work of Laccaria by Mueller (1992), 19 species are recognized from North America, and 40 worldwide. New or potential undescribed species from different regions, based on morphological and molecular characteristics of fructifications, or on DNA identifications of environmental samples, have been discovered recently (Wang et al. 2004, Osmundson et al. 2005, Sheedy et al. 2013, Wilson et al. 2013, Montoya et al. 2015, Luo et al. 2016, Popa et al. 2014. Nowadays, MycoBank recognizes 112 records in this group of fungi, and additionally, Wilson et al. (2017) inferred 116 phylogenetic species from 30 countries covering the known geographic range of Laccaria. ...
... Molecular studies on most of those records are needed not only to support their identifications but for being included in phylogenetic studies. Laccaria roseoalbescens T. J. Baroni, Montoya and Bandala, described as new (Montoya et al. 2015) from the mesophytic forest in Veracruz, was recognized under morphological features and confirmed through phylogenetic DNA sequence analyses and recently incorporated by Luo et al. (2016) in their mo-lecular phylogeny to confirm the distinction of the new L. rubroalba X. Luo, L. Ye, Mortimer & K.D. Hyde from China. ...
A new species and a new record of Laccaria (Fungi, Basidiomycota) found in a relict forest of the endangered Fagus grandifolia var. mexicana
Article
Full-text available
  • Nov 2017
Two species of Laccaria discovered in relicts of Fagus grandifolia var. mexicana forests in eastern Mexico are described based on the macro- and micromorphological features, and their identity supported by molecular analysis of the internal transcribed spacer (ITS) and large subunit (LSU) of the ribosomal RNA gene. The phylogeny obtained here showed that one of the Mexican species is nested in an exclusive clade which in combination with its striking morphological features, infers that it represents a new species, while the other species is placed as a member in the Laccaria trichodermophora clade. This is the first report in Mexico of Laccaria with Fagus grandifolia var. mexicana trees, with which the reported species may form ectomycorrhizal association. Descriptions are accompanied with illustrations of macro- and micromorphological characters and a discussion of related taxa are presented.
View
... Members of this genus are known to form ectomycorrhizal associations with a broad range of gymno-and angiosperm trees (Mueller 1992). Up till now, 12 Laccaria species have been described from China (Wang et al. 2004;Wilson et al. 2013;Popa et al. 2014;Luo et al. 2016;Vincenot et al. 2017). Two unknown taxa of Laccaria were repeatedly collected in the forest of the Heishiding Nature Reserve (111°49′ 09″-111°55′ 01″ E, 23°25′ 15″-23°30′ 02″ N, abbreviated thereafter as Heishiding) by the author while surveying the macrofungi there (Li and Cai 2014;Li et al. 2016;Li and Deng 2018;Li 2019). ...
Two new species of Laccaria from South China, with a note on Hodophilus glaberipes
Article
Full-text available
  • May 2020
Laccaria fengkaiensis and L. prava, collected from Heishiding Nature Reserve, South China, are proposed here as new taxa based on morphological and molecular evidences. These two new species along with Hodophilus glaberipes Ming Zhang et al. are described with photographs and line drawings and compared against related species. Morphologically, Laccaria fengkaiensis is characterized by a medium-sized to large pinkish white to light orange, strong striate to rugulose-striate or rugulose-sulcate pileus, a strong, solid stipe of the same color, 4-spored basidia, globose to obellipsoid basidiospores with moderate echinulae, and a pileipellis with abundant pileocystidia. Laccaria prava is characterized by a moderate-sized but very thin pinkish white to light orange, strong striate to rugulose-striate or rugulose-sulcate pileus, a distorted same colored stipe, 4-spored basidia, obellipsoid to globose basidiospores with moderate echinulae, and a stipitipellis with abundant caulocystidia. Hodophilus glaberipes is characterized by a small basidioma, with a pileus and its lamellae white at first, orange white to brownish orange with age, a white stipe, subglobose to globose basidiospores, and discoloring pastel red in wounds. Phylogenetic analysis of nucleotide sequences of the internal transcribed spacer (ITS) region provided further evidence that Laccaria fengkaiensis and L. prava are new species which are clearly separated from all other Laccaria species with rDNA sequence data available; Hodophilus glaberipes belongs to the H. micaceus superclade, with H. indicus K.N.A. Raj et al. as a closely related sister species.
View
Notes, outline and divergence times of Basidiomycota
Article
Full-text available
  • Nov 2019
The Basidiomycota constitutes a major phylum of the kingdom Fungi and is second in species numbers to the Ascomycota. The present work provides an overview of all validly published, currently used basidiomycete genera to date in a single document. An outline of all genera of Basidiomycota is provided, which includes 1928 currently used genera names, with 1263 synonyms, which are distributed in 241 families, 68 orders, 18 classes and four subphyla. We provide brief notes for each accepted genus including information on classification, number of accepted species, type species, life mode, habitat, distribution, and sequence information. Furthermore, three phylogenetic analyses with combined LSU, SSU, 5.8s, rpb1, rpb2, and ef1 datasets for the subphyla Agaricomycotina, Pucciniomycotina and Ustilaginomycotina are conducted, respectively. Divergence time estimates are provided to the family level with 632 species from 62 orders, 168 families and 605 genera. Our study indicates that the divergence times of the subphyla in Basidiomycota are 406–430 Mya, classes are 211–383 Mya, and orders are 99–323 Mya, which are largely consistent with previous studies. In this study, all phylogenetically supported families were dated, with the families of Agaricomycotina diverging from 27–178 Mya, Pucciniomycotina from 85–222 Mya, and Ustilaginomycotina from 79–177 Mya. Divergence times as additional criterion in ranking provide additional evidence to resolve taxonomic problems in the Basidiomycota taxonomic system, and also provide a better understanding of their phylogeny and evolution.
View
Phylogenetic Diversity of Russula from Xiaozhongdian, Yunnan, China, Inferred from Internal Transcribed Spacer Sequence Data
Article
Full-text available
  • Sep 2014
In this study, we provide the first diversity assessment, based on the phylogenetic analysis of ITS sequence data, of the ectomycorrhizal genus Russula in an important alpine ecosystem. The area studied, a remote sustainable farmland/forestry habitat on the south of Tibetan Plateau, located in Xiaozhongdian, Northwest Yunnan, China, is critical to the east and southeast Asian ecosystem balance. Twenty Russula species were recovered, with Russula cyanoxantha being most common species. Conifer forests (Picea likiangensis and Pinus densata) and birch forests (Betula platyphylla) have similar species diversity, which is higher than in mixed forests (Picea likiangensis, Betula platyphylla, Lyonia and Rhododendron decorum), suggesting the preferred hosts of Russula are Picea likiangensis, Pinus densata and Betula platyphylla.
View
The Faces of Fungi database: fungal names linked with morphology, phylogeny and human impacts
Article
Full-text available
  • Nov 2015
Abstract Taxonomic names are key links between various databases that store information on different organisms. Several global fungal nomenclural and taxonomic databases (notably Index Fungorum, Species Fungorum and MycoBank) can be sourced to find taxonomic details about fungi, while DNA sequence data can be sourced from NCBI, EBI and UNITE databases. Although the sequence data may be linked to a name, the quality of the metadata is variable and generally there is no corresponding link to images, descriptions or herbarium material. There is generally no way to establish the accuracy of the names in these genomic databases, other than whether the submission is from a reputable source. To tackle this problem, a new database (FacesofFungi), accessible at www.facesoffungi.org (FoF) has been established. This fungal database allows deposition of taxonomic data, phenotypic details and other useful data, which will enhance our current taxonomic understanding and ultimately enable mycologists to gain better and updated insights into the current fungal classification system. In addition, the database will also allow access to comprehensive metadata including descriptions of voucher and type specimens. This database is user-friendly, providing links and easy access between taxonomic ranks, with the classification system based primarily on molecular data (from the literature and via updated web-based phylogenetic trees), and to a lesser extent on morphological data when molecular data are unavailable. In FoF species are not only linked to the closest phylogenetic representatives, but also relevant data is provided, wherever available, on various applied aspects, such as ecological, industrial, quarantine and chemical uses. The data include the three main fungal groups (Ascomycota, Basidiomycota, Basal fungi) and fungus-like organisms. The FoF webpage is an output funded by the Mushroom Research Foundation which is an NGO with seven directors with mycological expertise. The webpage has 76 curators, and with the help of these specialists, FoF will provide an updated natural classification of the fungi, with illustrated accounts of species linked to molecular data. The present paper introduces the FoF database to the scientific community and briefly reviews some of the problems associated with classification and identification of the main fungal groups. The structure and use of the database is then explained. We would like to invite all mycologists to contribute to these web pages. Keywords Classification . Database . FacesofFungi . Fungi . Phylogeny . Taxonomy
View
The Genus Phylloporus (Boletaceae, Boletales), from Mekong River Basin (Yunnan Province, China)
Article
Full-text available
  • Sep 2014
The genus Phylloporus is a gilled bolete and a typical ectomycorrhizal mushroom which forms mycorrhizal associations with woody Fagaceae or Pinaceae. Collections of Phylloporus were made from Xiaozhongdian (Shangri-La), Haitang (Baoshan) and Mengsong (Xishuangbanna) from May to October 2012. Morphology and sequence analysis revealed that the Phylloporus collections belonged to seven groups and five species: P. imbricatus (Xiaozhongdian, Shangri-La), P. pachcystidiatus and P. yunnanensis (Haitang, Baoshan), P. rubiginosus (Mengsong, Xishuangbanna) and P. megacystidiatus sp. nov (Mengsong, Xishuangbanna). In this paper we introduce one new Phylloporus species: Phylloporus megacystidiatus sp. nov., and new record P. rubiginosus for the first time in Yunnan Province, China. The new species and the new record are described and illustrated with drawings and color photos. Also the species and new record are compared with similar taxa.
View
Laccaria Laccata Complex in North America and Sweden: Intercollection Pairing and Morphometric Analyses
Article
  • Sep 1991
Three intersterility groups, as well as several stocks which were intersterile with all other stocks, were detected among isolates obtained from North American collections referable to the Laccaria laccata complex. Members of these intersterility groups were intersterile with both of the intersterility groups previously identified among tested Swedish isolates referable to L. laccata sensu lato. Genetic divergence was detected between each of the four intersterility groups included in analyses of restriction fragment length polymorphisms of mitochondrial and nuclear ribosomal DNA. Multivariate morphometric analyses, however, only revealed a close correlation between basidioma morphology and intercollection pairing reactions in some cases. The following taxa are recognized from North America based on these studies: L. laccata var. laccata, L. laccata var. pallidifolia, L. longipes, L. montana, L. ohiensis (= L. tetraspora) and L. striatula. The tested Swedish material is referable to L. laccata var. moelleri and, putatively, L. laccata var. pallidifolia and L. ohiensis. These studies demonstrate the importance of using a variety of character sets for investigating taxonomic and biological problems in agarics that form ectomycorrhizae.
View
A new Laccaria species from cloud forest of Fortuna, Panama
Article
  • Feb 2016
A new species of Agaricales, called Laccaria stellata, was collected in a premontane cloud forest in the Fortuna Forest Reserve, Panama, and it is described based on morphological and molecular characteristics. It differs morphologically from all known species of Laccaria by minute, pinkish-orange colored basidiomata, a very thin and translucent pileus, very distant lamellae, 4-spored basidia, and globose basidiospores covered by relatively large echinulae. Molecular rDNA sequence data confirm the separation of this new species from other Laccaria species for which rDNA sequence data are available.
View
A new species of Laccaria in montane cloud forest from eastern Mexico
Article
An undescribed species of Laccaria was discovered in the Santuario del Bosque de Niebla of Xalapa, Mexico, in a montane cloud forest preserved under the protection of the Instituto de Ecología A.C. in Veracruz State. This new species is distinct based on basidiome morphology and supported by phylogenetic analyses of sequences of the internal transcribed spacer (ITS) and nuclear large subunit (nLSU) of the ribosomal RNA gene. Thirteen different collections obtained during 2012-2014, provided documentation of the broad morphological variation and confirmed the diagnostic color changes of this species. It is phylogenetically associated with Metasection Amethystina but lacks violet pigments in the mycelium and stipe base that are characteristic for species placed in that Metasection. Its relationship to other taxa in Laccaria is not obvious at this time. Descriptions, color images of the basidiomata, scanning electron photomicrographs of basidiospores and comparisons with similar taxa are presented.
View
View
Laccaria laccata Complex in North America and Sweden: Intercollection Pairing and Morphometric Analyses
Article
  • Sep 1991
Three intersterility groups, as well as several stocks which were intersterile with all other stocks, were detected among isolates obtained from North American collections referable to the Laccaria laccata complex. Members of these intersterility groups were intersterile with both of the intersterility groups previously identified among tested Swedish isolates referable to L. laccata sensu lato. Genetic divergence was detected between each of the four intersterility groups included in analyses of restriction fragment length polymorphisms of mitochondrial and nuclear ribosomal DNA. Multivariate morphometric analyses, however, only revealed a close correlation between basidioma morphology and intercollection pairing reactions in some cases. The following taxa are recognized from North America based on these studies: L. laccata var. laccata, L. laccata var. pallidifolia, L. longipes, L. montana, L. ohiensis (= L. tetraspora) and L. striatula. The tested Swedish material is referable to L. laccata var. moelleri and, putatively, L. laccata var. pallidifolia and L. ohiensis. These studies demonstrate the importance of using a variety of character sets for investigating taxonomic and biological problems in agarics that form ectomycorrhizae.
View
Three new Laccaria species from Southwest China (Yunnan)
Article
  • Nov 2014
In this paper descriptions of three new Laccaria species from Southwest China (Yunnan) are reported. Macromorphological, micromorphological, and molecular data have been studied to describe the new species and delineate them within the genus Laccaria. The first species Laccaria fulvogrisea is characterized by a grey to brownish coloured fruiting body and large echinulate spores. Laccaria aurantia is characterized by the deeply orange colour and globose balloon-like spores with a fine echinulate ornament. The third species Laccaria yunnanensis has large barrel-shaped pleurocystidia and a brownish to flesh-coloured fruiting body. All three species have 4-spored basidia and were found near or within Quercus and Lithocarpus mixed broad leaved forests at an altitude of above 2,000 m.
View
Population genetic structure of the ectomycorrhizal fungus Laccaria sp. A resembles that of its host tree Nothofagus cunninghamii
Article
The ectomycorrhizal fungus Laccaria sp. A is restricted to temperate rainforest of southeast Australia, associated with its host tree Nothofagus cunninghamii. Eight mitochondrial microsatellite markers were used to investigate the population genetic structure of L. sp. A across its distribution in Tasmania and Victoria. The highest allelic diversity was found in Tasmania, which appeared to contain a panmictic population, whereas the more fragmented Victorian populations were characterized by low allelic diversity and differentiation between east and west. There is evidence of glacial refugia in the west and the northeast of Tasmania, and in Victoria in the Otway Ranges and Central Highlands, with postglacial migration into the Strzelecki Ranges. Narrow host-specificity may have contributed to the presence of population structure in this fungus. Allelic diversity patterns in L. sp. A are largely congruent with diversity patterns already established in populations of its host, N. cunninghamii.
View