Content uploaded by Peng Tan
Author content
All content in this area was uploaded by Peng Tan on Apr 28, 2018
Content may be subject to copyright.
Full length article
Vegetable oil induced inflammatory response by altering TLR-NF-
k
B
signalling, macrophages infiltration and polarization in adipose tissue
of large yellow croaker (Larimichthys crocea)
Peng Tan
a
, Xiaojing Dong
a
, Kangsen Mai
a
,
b
,WeiXu
a
, Qinghui Ai
a
,
b
,
*
a
Key Laboratory of Aquaculture Nutrition and Feed, Ministry of Agriculture and the Key Laboratory of Mariculture, Ministry of Education, Ocean University
of China, 5 Yushan Road, Qingdao, Shandong, 266003, People's Republic of China
b
Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology,1 Wenhai Road,
Qingdao, Shandong, 266237, People's Republic of China
article info
Article history:
Received 7 September 2016
Received in revised form
19 October 2016
Accepted 2 November 2016
Available online 3 November 2016
Keywords:
Fish oil
Vegetable oil
Immunity
Adipose tissue
Large yellow croaker
abstract
High level of vegetable oil (VO) in diets could induce strong inflammatory response, and thus decrease
nonspecific immunity and disease resistance in most marine fish species. The present study was con-
ducted to investigate whether dietary VO could exert these anti-immunological effects by altering TLR-
NF-
k
B signalling, macrophages infiltration and polarization in adipose tissue of large yellow croaker
(Larimichthys crocea). Three iso-nitrogenous and iso-lipid diets with 0% (FO, fish oil, the control), 50% (FV,
fish oil and vegetable oil mixed) and 100% (VO, vegetable oil) vegetable oil were fed to fish with three
replicates for ten weeks. The results showed that activities of respiratory burst (RB) and alternative
complement pathway (ACP), as well as disease resistance after immune challenge were significantly
decreased in large yellow croaker fed VO diets compared to FO diets. Inflammatory response of exper-
imental fish was markedly elevated by VO reflected by increase of pro-inflammatory cytokines (IL1
b
and
TNF
a
) and decrease of anti-inflammatory cytokine (arginase I and IL10) genes expression. TLR-related
genes expression, nucleus p65 protein, IKK
a
/
b
and I
k
B
a
phosphorylation were all significantly
increased in the AT of large yellow croaker fed VO diets. Moreover, the expression of macrophage
infiltration marker proteins (cluster of differentiation 68 [CD68] and colony-stimulating factor 1 receptor
[CSF1R]) was significantly increased while the expression of anti-inflammatory M2 macrophage polar-
ization marker proteins (macrophage mannose receptor 1 [MRC1] and cluster of differentiation 209
[CD209]) was significantly decreased in the AT of large yellow croaker fed VO diets. In conclusion, VO
could induce inflammatory responses by activating TLR-NF-
k
B signalling, increasing macrophage infil-
tration into adipose tissue and polarization of macrophage in large yellow croaker.
©2016 Published by Elsevier Ltd.
1. Introduction
Fish oil (FO), which contains a relatively high content of long-
chain polyunsaturated fatty acids (LC-PUFA), is the traditionally
major lipid component of the fish diet. With the development of
aqua-feed industry, the increasing demand for FO has post great
pressure on fishery resources that have been exploited at their
maximum sustainable limit [1]. Vegetable oil (VO), with relatively
considerable output, acceptable price, relatively low organic
contaminant status, and relatively high content of unsaturated fatty
acids, is a promising alternative to FO. However, high inclusion of
VO resulted in decreased non-specific immunity parameters,
especially for marine fish species, such as gilthead sea bream
(Sparus aurata)[2,3], European sea bass (Dicentrarchus labrax),
Atlantic salmon (Salmo salar)[4], and large yellow croaker (Lar-
imichthys crocea)[5]. Moreover, numerous studies indicated that
VO resulted in the overexpression of pro-inflammatory cytokine
genes expression and inflammatory response in Senegalese sole
Abbreviations: TLR, toll-like receptor; NF-
k
B, nuclear factor kappa beta; RB,
respiratory burst; LZM, lysozyme; ACP, alternative complement pathway; CMR,
cumulative mortality rate; DHA, ducosahexenoic acid; EPA, eicosapentaenoic acid;
AT, adipose tissue; IKK
a
/
b
, inhibitor of NF-
k
B kinase
a
/
b
;I
k
B
a
, inhibitor of NF-
k
B;
CD68, cluster of differentiation 68; CSF1R, colony-stimulating factor 1 receptor;
MRC1, macrophage mannose receptor 1; CD209, cluster of differentiation 209; IL1
b
,
interleukin 1
b
; TNF
a
, tumour necrosis factor
a
; Arg I, arginase I; IL10, interleukin
10; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
*Corresponding author.
E-mail addresses: aiqinghui@163.com,qhai@ouc.edu.cn (Q. Ai).
Contents lists available at ScienceDirect
Fish & Shellfish Immunology
journal homepage: www.elsevier.com/locate/fsi
http://dx.doi.org/10.1016/j.fsi.2016.11.009
1050-4648/©2016 Published by Elsevier Ltd.
Fish & Shellfish Immunology 59 (2016) 398e405
(Solea senegalensis)[6], gilthead sea bream [4] and large yellow
croaker [7]. Persistent attempts have been conducted to elucidate
the mechanism of VO in inducing fish immunity problems from the
perspective of membrane fluidity, eicosanoid pathways [8], and
pattern recognition receptor pathways [9]. Besides, studies have
been carried out to reveal the immune-regulation mechanism of
VO in the head kidney [4], intestine [4], liver [4], heart [10] because
of their close relationship with immunity. However, as far as we
know, no information was available about immune response to VO
in the adipose tissue (AT) of any fish species.
During the past decade, the immunity role of adipose tissue (AT)
has attracted ever-increasing attention in mammal studies since
the discovery of inflammatory response induced by macrophages
infiltration into AT [11]. AT has been well known to regulate lipid
homeostasis by storing excess energy in the form of triglycerides,
while more and more studies have indicated that fatty acids are
closely related to the accumulation of adipose tissue macrophages
(ATMs) [12,13]. The infiltration of ATMs and polarization toward
pro-inflammatory M1 type macrophage were confirmed to be
closely related to the activation of NF-
k
B signalling and the over-
expression of pro-inflammatory cytokines, such as TNF
a
, IL6 and
IL1
b
[14]. Mammal studies have verified that the anti-inflammatory
role of fish oil was partially resulted from the suppression of ATMs
infiltration and decrease of AT pro-inflammatory cytokines
expression [15,16]. Besides, the paracrine of pro-inflammatory cy-
tokines by ATMs has been found to induce inflammatory response
[17]. The increasing inflammatory response was usually accompa-
nied by the decreasing non-specific immune response in fish spe-
cies, though the mechanism was still unclear [6,18,19]. In thus, the
decrease of non-specific immunity by dietary VO may partially due
to the pro-inflammatory cytokines secreted by AT.
To our knowledge, no investigation has been conducted to
elucidate the immune regulation mechanisms of VO from the
perspective of ATMs accumulation and polarization in AT in this
and other fish species. Thus, this study was conducted to investi-
gate non-specific immunity parameters, ATM infiltration and po-
larization marker proteins expression and TLR-NF-
k
B signalling in
large yellow croaker (Larimichthys crocea) in response to dietary
VO. It was aimed to better understand the mechanism about how
dietary VO induce inflammatory response and decrease fish
immunity.
2. Materials and methods
2.1. Animals, diets formulation and animal husbandry
Disease-free and equal sizes of large yellow croaker was from a
commercial farm in Ningbo, China. Before the experiment, fish was
acclimatized by feeding a control diet for two weeks. Diet formu-
lations and animal husbandry were described in a previous study
[20]. Briefly, soybean meal and defatted fish meal were the main
protein sources. Three iso-nitrogenous (41% crude protein) and iso-
lipid (12% crude lipid) diets were formulated with the replacement
of fish oil by vegetable oil as follows: 0% replacement (FO), 50%
replacement (FV, fish oil: soybean oil: linseed oil ¼2:1:1) and 100%
replacement (VO, soybean oil: linseed oil ¼1:1). The approximate
compositions were analysed and are shown in Table 1. The content
of different fatty acids in the experimental diets (mg/g) were
determined and are shown in Table 2.
Animal experiment for the large yellow croaker was processed
in a net cage system at Xihu Harbor (Ningbo, China). After fasting
for 24 h, large yellow croaker (mean weight 8.93 g ±0.21 g) was
randomly divided into 9 floating cages with 60 fish per cage. Each
type of diet was randomly divided into 3 parts, and each diet was
randomly assigned to a net cage. Fish was fed twice a day to
apparent satiation for 70 days. Husbandry was under appropriate
conditions.
The protocols for animal husbandry and handling employed in
this study were approved by the Institutional Animal Care and Use
Committee of the Ocean University of China.
Table 1
Formulation of the experimental diets (% dry matter) [20].
Ingredients FO
a
FV
b
VO
c
Defatted white fish meal
d
15 15 15
Soybean meal 32 32 32
Casein
e
11 11 11
Wheat meal 26 26 26
Mineral premix
f
222
Vitamin premix
g
222
Attractant
h
0.3 0.3 0.3
Mould inhibitor
i
0.1 0.1 0.1
Lecithin 2.6 2.6 2.6
Fish oil 9 4.5 0
Soybean oil 0 2.5 4.5
Linseed oil 0 2.5 4.5
Total 100 100 100
dry %
Crude protein 41.67 41.74 41.71
Crude lipid 12.85 12.70 12.76
a
FO: Fish oil group.
b
FV: blend of vegetable oil (linseed oil/soybean oil ¼1:1) replacing fish oil at 50%.
c
VO: blend of vegetable oil replacing fish oil at 100%.
d
Defatted fish meal: 72.1% crude protein and 1.4% crude lipid; white fish meal
was defatted with ethanol (fish meal:ethanol ¼1:2 (w:v)) at 37
Cfor three
replications.
e
Casein: 88% crude protein and 1.3% crude lipid, Alfa Aesar, Avocado Research
Chemicals Ltd, UK.
f
Mineral premix (mg or g kg
1
diet): CuSO
4
$5H
2
O 10 mg; Na
2
SeO
3
(1%) 25 mg;
ZnSO
4
$H
2
O, 50 mg; CoCl
2
$6H
2
O (1%) 50 mg; MnSO
4
$H
2
O 60 mg; FeSO
4
$H
2
O80mg
Ca(IO
3
)
2
180 mg; MgSO
4
$7H
2
O 1200 mg; zeolite 18.35 g.
g
Vitamin premix (mg or g kg
1
diet): vitamin D 5 mg; vitamin K 10 mg; vitamin
B12 10 mg; vitamin B6 20 mg; folic acid 20 mg; vitamin B1 25 mg; vitamin A 32 mg;
vitamin B2 45 mg; pantothenic acid 60 mg; biotin 60 mg; niacin acid 200 mg;
a
-
tocopherol 240 mg; inositol 800 mg; ascorbic acid 2000 mg; microcrystalline cel-
lulose 16.47 g.
h
Phagostimulant: Glycine/Betaine ¼1:3.
i
Preservative: Fumarate/Calcium pnpionabe ¼1:1.
Table 2
The content of different fatty acids in the experimental diets (mg/g)
a
[20].
Fatty acid FO FV VO
C 14: 0 0.76 0.42 0.10
C 16: 0 4.51 3.96 3.13
C 18: 0 1.63 1.72 1.71
PSFA
b
6.90 6.10 4.94
C 16: 1 1.08 0.53 0.06
C 18: 1 3.59 4.58 5.47
PMUFA
c
4.67 5.11 5.53
C 18: 2n-6 4.35 8.85 12.66
C 20: 4n-6 0.12 0.07 0.04
Pn-6 PUFA
d
4.47 8.93 12.70
C 18: 3n-3 0.43 3.32 6.98
C 20: 5n-3 1.25 0.62 0.06
C 22: 6n-3 1.85 0.88 0.08
Pn-3 PUFA
e
3.53 4.82 7.12
Pn-3/Pn-6 PUFA 0.79 0.54 0.56
Pn-3 LC-PUFA 3.10 1.49 0.14
Total fatty acids 21.18 26.82 31.09
a
Some fatty acids, of which the contents are minor, trace amount or not detected,
such as C22: 0, C24: 0, C14: 1, C20: 2n-6, C20:3n-6, were not listed in the table.
b
SFA: saturated fatty acid.
c
MUFA: monounsaturated fatty acid.
d
n-6 PUFA: n-6 poly-unsaturated fatty acid.
e
n-3 PUFA: n-3 poly-unsaturated fatty acid.
P. Tan et al. / Fish & Shellfish Immunology 59 (2016) 398e405 399
2.2. Sample collections
At the end of the feeding trial and after being fasted for 24 h, 5
fish per cage were randomly collected and anaesthetized (MS222;
Sigma, USA). Blood samples were collected from the caudal
vasculature using a 1-mL syringe, injected into an EP tube and
allowed to clot at room temperature for 2 h before being stored for
6 h at 4
C. The clot was removed, and residual blood cells were
separated from the straw-coloured serum by centrifugation
(3000 g, 10 min, 4
C). The bloodless fish were sacrificed and
packed on ice. After removed the abdominal membrane with
scalpel, the adipose tissue was scrape from the abdominal wall.
Washed with PBS, the adipose tissue was collected in 1.5-mL
cryogenic micro-tubes (Sangon, China). All samples were immedi-
ately frozen in liquid nitrogen and stored at 80
C prior to analysis.
2.3. Head kidney macrophage separations and respiratory burst
activity assays
Head kidney macrophages were separated as described in a
previous study with some modifications [21]. Five fish was
randomly collected and dissected to obtain the head kidneys after
anaesthetized (MS222; Sigma, USA). Head kidneys, cut into small
fragments then washed with L-15 medium (Sigma, USA), were
forced to pass through 100
m
m cell strainer (Falcon, USA) using 2 mL
syringe piston into 50 mL centrifuge tube (Corning, USA). The L-15
medium was supplied with 100 U penicillin and streptomycin,
2 mM L-alanyl-
L
-glutamine (Thermo Fisher Scientific, USA) and 2%
fetal bovine serum (Gibco, USA). Separated cell density was coun-
tered in a haemocytometer and modulated to 1 10
7
mL. Viability
of cells were determined by the trypan blue staining method and
was guaranteed >95% for further experiment.
Head kidney macrophages respiratory burst activity was
measured by the nitro-blue-tetrazolium (NBT) (Sigma, USA) assay,
described as previous study with some modifications [21]. A sus-
pension of head kidney macrophages (100
m
L, 1 10
7
/mL) was
added to a 96-well cell culture plate and centrifuged for 10 min
(1500 g, Sorvall Legend RT, Germany). The supernatant was then
replaced by 200
m
L of L-15 medium (NBT, Sigma, USA, 1 mg/mL;
phorbol 12-myristate 13-acetate, PMA, Sigma, USA, 1
m
g/mL). Cell
fixation was performed after incubation (40 min, 18
C, in the dark)
using 200
m
L of absolute methanol per well. Subsequently, each
well was washed with 70% methanol aqueous solution and incu-
bated for 10 min. The procedure was repeated, and the plate was
air-dried. Blue precipitation formed in the well and was dissolved
with 120
m
L of a potassium hydroxide aqueous solution (2 M) and
DMSO (Sinopharm Chemical Reagent, China). The respiratory burst
activity was expressed as the absorbance value detected under a
630-nm wave length.
2.4. Serum lysozyme activity assays
Serum lysozyme activity was measured by the self-contrasted
method described in a previous study [22]. Briefly, a reaction
mixture of 10
m
L of serum and a 1.4
m
L 0.2 mg/mL Micrococcus
lysodeikticus (Sigma, USA) suspension was incubated at 25
Cfor
10 min. The absorbance value was detected under a 540-nm wave
length once per minute. One unit was defined as the absorbance
value that attenuated 0.001 in one minute utilizing 1 mL serum.
2.5. Alternative complement pathway (ACP) activity
The alternative complement pathway activity was determined
as previously described [23]. Briefly, a series of volumes of the
diluted serum ranging from 0.1 to 0.25 mL was dispensed into test
tubes, and the total volume was brought up to 0.25 mL with
barbitone buffer in the presence of ethyleneglycol-bis (2-
aminoethoxy)-tetra acetic acid (EGTA) and Mg
2þ
. Subsequently,
0.1 mL of rabbit red blood cells (RaRBC) was added to each tube.
After incubation for 90 min at 20
C, 3.15 mL of 0.9% NaCl was added
to the test tubes. Samples were centrifuged at 1600 g for 5 min at
4
C to eliminate unlysed RaRBC. The optical density of the super-
natant was measured at 414 nm. A lysis curve was prepared to
determine the volume of serum that yielded 50% hemolysis, and
the value of ACH50 units/mL was obtained for each group.
2.6. Mortality after challenged with Vibrio anguillarum
At the end of the feeding trial, large yellow croaker was immune
challenged with Vibrio anguillarum (provided by Pro. Jing Xing,
Ocean University of China). Procedures for bacteria preparation
were according to methods described previously with some mod-
ifications [24]. Briefly, the bacterial strain was streaked onto blood
agar plates and grow at room temperature for 20 h. A single colony
was chosen for expanding the culture in a liquid medium at 37
C
for 12 h. Just before the immune challenge, the V. anguillarum
culture was suspended in phosphate-buffer saline. The suspension
was kept on ice before use. Before injection, ten fish per net cage
were anaesthetized with MS222 (Sigma, USA). A one-half lethal
concentration of V. anguillarum (8 10
8
CFU) was injected into the
enterocoelia of the fish according to preliminary experiments. After
the injection, the fish were left to recover in an aerated tank before
being returned to their original cages. Mortality was monitored
every day for 7 days.
2.7. RNA extractions, cDNA synthesis, and quantitative real-time
polymerase chain reaction (q-PCR)
Adipose tissue was ground to powder in liquid nitrogen and
added to Trizol reagent (Takara, China). Subsequently, total RNA
was extracted following the manufacturer's protocol. To remove
genomic DNA, extracted RNA was treated with RNase-Free DNase
(Takara, China) in 42
Cfor 2 min. The integrity of RNA was detected
by electrophoresis using 1.2% denatured agarose gel. The quantity
of RNA was determined by a Nano Drop
®
2000 spectrophotometer
(Thermo Fisher Scientific, USA). Total RNA with a 260/280-nm
absorbance ratio of 1.8e2.0 was used for further experiments.
The extracted RNA was reversely transcribed to first-strand cDNA
by the Primer Script ™RT reagent Kit (Takara, China) following the
manufacturer's instructions.
Real-time polymerase chain reaction was performed as previ-
ously described [25]. Three replicate extractions were performed
for each sample. The primers were designed following the pub-
lished sequences (Table 3). To calculate the expression of immune-
related genes, the comparative CT method (2
-△△CT
method) was
adopted, and the value stood for the n-fold difference relative to the
calibration [26].
2.8. Western blot
The nuclear proteins of adipose tissue were extracted using NE-
PER™Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher
Scientific, USA) according to the manufacturer's instructions.
Membrane proteins of adipose tissue were extracted using the
Mem-PER™Plus Membrane Protein Extraction Kit (Thermo Fisher
Scientific, USA) according to the manufacturer's instructions. Total
adipose tissue proteins were extracted according to methods pre-
viously described [27]. The protein content was quantified using a
Bradford Protein Assay Kit (Beyotime Institute of Technology,
China). An equal amount of protein (20
m
g) was loaded into wells
P. Tan et al. / Fish & Shellfish Immunology 59 (2016) 398e405400
and separated by 10% sodium dodecyl sulphate polyacrylamide gel
electrophoresis. Proteins in the gel were transferred to a poly-
vinylidene fluoride (PVDF) membrane (Millipore, USA), followed by
membrane blocking at room temperature for 2 h. In the freezer
used for the chromatography experiment, PVDF membranes were
incubated with primary antibody overnight. The membranes were
then washed five times for 3 min each with Tris buffered saline with
Tween™(TBST) and incubated for 2 h with horseradish peroxide
(HRP)-conjugated secondary antibody in the TBST. Immune com-
plexes were visualized using an Electrochemiluminescence (ECL)
Kit (Beyotime Institute of Technology, China).
Polyclonal anti-Lamin B, anti-IKK
a
/
b
,anti-I
k
B
a
and Na
þ
/K
þ
-
ATPase antibodies were obtained from Santa Cruz Biotechnology
(USA), whereas polyclonal antiphospho-IKK
a
/
b
, antiphospho-I
k
B
a
,
and anti-p65 antibodies were purchased from Cell Signalling
Technology (USA). Anti-CD68, anti-CSF1R, and anti-CD209 were
obtained from Abcam (England). Polyclonal anti-MRC1 was ob-
tained from Sangon (China). Anti-glyceraldehyde 3-phosphate de-
hydrogenase (GAPDH) and HRP-conjugated secondary antibodies
were obtained from Golden Bridge Biotechnology (China).
2.9. Calculations and statistical analysis
Cumulative mortality rate ¼(Ni eNf) 100/Ni. Ni is the initial
number of fish in each cage before the immune challenge, while Nf
is the final number of fish in each cage that survived after the im-
mune challenge (Ni ¼10).
Statistical analysis was performed using SPSS 20.0 (SPSS, Inc.,
USA). Data was subjected to one-way analysis of variance (ANOVA)
followed by Tukey's test. For statistically significant differences,
P<0.05 was required. The results were presented as the
means ±S.E.M (standard error of the means).
3. Results
3.1. Non-specific immunity parameters and disease resistance
Head kidney macrophages respiratory burst (RB) activity of
macrophages was significantly decreased in fish fed VO diets when
compared with the control (P<0.05) (Fig. 1a). No significant dif-
ference in the serum lysozyme (LZM) activity was observed among
groups (P>0.05) (Fig. 1b). A significant decrease in the alternative
complement pathway (ACP) activity was observed in large yellow
croaker fed FV or VO diets (P<0.05) (Fig. 1c). Moreover, a signifi-
cant decrease of the disease resistance was found in large yellow
croaker fed FV or VO diets, which manifested in a significantly
higher cumulative mortality rate (CMR) (P<0.05) (Fig. 1d).
However, there was no significant difference of ACP activity and
CMR between fish fed FV and VO diets (P>0.05).
3.2. TLR-NF-
k
B signalling activation in adipose tissue
3.2.1. Q-PCR analyses for TLR-related genes expression
TLR-related genes expression in AT of large yellow croaker
indicated that TLR1, TLR3, TLR5, TLR9, TLR22 and MyD88 was all
significantly increased when fish was fed with FV or VO diets
(P<0.05). The mRNA expression of TLR2 and TLR7 was significantly
increased when fish was fed with VO diet. There was no significant
difference of TLR2 and TLR7 mRNA expression between fish fed FO
and FV (P>0.05) (Fig. 2).
3.2.2. Western blot for NF-
k
B signalling protein expression in AT of
large yellow croaker
IKK
a
/
b
, p-IKK
a
/
b
,I
k
B
a
, p-I
k
B
a
, total p65 (t-p65) and nucleus p65
(n-p65) protein expression levels were determined by Western
blot. Data indicated that the ratio of p-IKK
a
/
b
to IKK
a
/
b
, and p-I
k
B
a
to I
k
B
a
was significantly increased in the AT of large yellow croaker
when fish was fed FV or VO diets (P<0.05). Ratio of n-p65 to t-p65
was significantly increased in the AT of large yellow croaker when
fish was fed with VO diet (P<0.05). No significant difference was
observed among IKK
a
/
b
,I
k
B
a
and t-p65 in all treatments (P>0.05)
(see Fig. 3).
3.3. Macrophage infiltration and polarization in AT
3.3.1. Western blot analyses for macrophage infiltration and
polarization marker proteins
Western blot analyses for macrophage infiltration marker pro-
teins dcluster of differentiation 68 (CD68) dindicated that CD68
protein expression level was significantly increased in AT of fish fed
VO (P<0.05). Similarity, macrophage infiltration marker protein
colony stimulating factor 1 receptor (CSF-1R) protein expression
level was significantly increased in AT of fish fed FV or VO diets
(P<0.05) (Fig. 4a). Moreover, the expression level of M2-type
macrophage marker protein, macrophage mannose receptor 1
(MRC1) was significantly decreased in the AT of large yellow
croaker when fed VO diets (P<0.05) (Fig. 4a). Another M2-type
macrophage marker protein, cluster of differentiation 209
(CD209) was found significantly increased in AT of fish fed with FV
or VO diets (P<0.05) (Fig. 4a).
3.3.2. Q-PCR analyses for M1-and M2-type macrophage-related
cytokine genes expression
Q-PCR analyses for anti-inflammatory M1 macrophage marker
Table 3
Primers used in this study.
Primer names Forward primer sequence (5
0
to 3
0
)Tm(
C) Fragment(bp) PCR efficiency(%)
L-TLR1-F/R TGTGCCACCGTTTGGATA/TTCAGGGCGAACTTGTCG 57 95 99
L-TLR2-F/R TCTGCTGGTGTCAGAGGTCA/GGTGAATCCGCCATAGGA 57 98 98
L-TLR3-F/R ACTTAGCCCGTTTGTGGAAG/CCAGGCTTAGTTCACGGAGG 58 159 102
L-TLR7-F/R ATGCAATGAGCCAAAGTCT/CATGTGAGTCAATCCCTCC 54 185 97
L-TLR9-F/R AACGGAGGTCACAGGAGG/TAGCACCACTGGACAGCAC 55 133 98
L-TLR13-F/R CCTCCTGTTTATGGTAGTGTCC/GCTCGTCATGGGTGTTGTAG 56 161 98
L-TLR22-F/R TATGCGAGCAGGAAGACC/CAGAAACACCAGGATCAGC 54 132 96
L-MyD88-F/R TACGAAGCGACCAATAACCC/ATCAATCAAAGGCCGAAGAT 57 144 98
L-Arg I-F/R AACCACCCGCAGGATTACG/AAACTCACTGGCATCACCTCA 58 119 99
L-IL10-F/R AGTCGGTTACTTTCTGTGGTG/TGTATGACGCAATATGGTCTG 55 144 99
L-IL1
b
-F/R CATCTGGAGGCGGTGGAGGA/GGGACAGACCTGAGGGTGGT 57 119 100
L-TNF
a
-F/R CGTCGTTCAGAGTCTCCTGC/TGTACCACCCGTGTCCCACT 58 189 99
L-
b
actin-F/R GACCTGACAGACTACCTCATG/AGTTGAAGGTGGTCTCGTGGA 58 136 100
TLR: toll-like receptor, MyD88: myeloid differentiation factor 88, Arg I: arginase I, IL10: interleukin 10, IL1
b
: interleukin 1
b
, TNF
a
: tumour necrosis factor
a
.
P. Tan et al. / Fish & Shellfish Immunology 59 (2016) 398e405 401
genes indicated that in the AT of large yellow croaker fed VO diet,
the IL1
b
and TNF
a
expression levels were significantly higher than
those of the control group (P<0.05), while no significant difference
was found between FV and VO group (P>0.05) (Fig. 4b). Expression
level of M2 macrophage marker gene arginase I (Arg I) was
significantly lower in the AT of large yellow croaker fed VO diet
(P<0.05). Besides, mRNA expression of Arg I expression level was
significantly lower in AT of fish fed VO than fed FV (P<0.05)
(Fig. 4b). The mRNA expression level of IL10, another M2 macro-
phage marker gene, was found significantly lower in AT of fish fed
FV or VO diets, but no significant difference was observed between
FV and VO groups (P<0.05) (Fig. 4b).
4. Discussion
Nonspecific immunity and disease resistance were both
decreased when dietary fish oil was partially or totally replaced by
vegetable oil according to the findings of extensive studies on
several fish species [4]. In this study, RB activity and ACP activity
were both significantly decreased in large yellow croaker fed FV or
VO diets. Previous study demonstrated that n-3 LC-PUFA promoted
RB activity of macrophages in large yellow croaker [4]. Thus, the
decrease of RB in the present study could be partially due to the
scarce of n-3 LC-PUFA in vegetable oil. In the present study, content
of linoleic acid in diets increased with the increasing portion of
vegetable oil (Table 2). High proportion of linoleic acid was
confirmed to decreased the non-specific immunity parameters in
large yellow croaker [7], grouper (Epinephelus malabaricus) [28]
and Atlantic Salmon [29]. Therefore, the decrease of RB activity
and ACP activity may also due to the high content of linoleic acid in
diets.
AT is well known to regulate lipid homeostasis by storing excess
energy in the form of triglycerides for an extended period of time.
Recently, AT has been found to play an important role during the
immunity modulation [12]. Although the specific mechanism has
not been completely understood, available evidence indicated that
inflammation affected by fatty acids in AT was mainly associated
with TLR-NF-
k
B signalling, macrophage infiltration and polariza-
tion [30]. In mammals, toll-like receptor 4 (TLR4) was identified as a
receptor of fatty acids and a mediator of pro-inflammatory cytokine
production by ATMs. Saturated fatty acids and linoleic acids have
been demonstrated to activate TLR4 and then mediate the pro-
duction of pro-inflammatory cytokines in macrophages through
activating several serine kinases, such as I
k
B kinase [31e33].In
contrast, n-3 PUFA suppressed TLR4-mediated pro-inflammatory
cytokine production in macrophages. For example, Lee et al. [34]
found that DHA suppressed NF-
k
B signalling by TLR4 in macro-
phage. In this study, the expression of TLRs and MyD88 in the AT of
large yellow croaker fed a FO diet was significantly lower compared
to that fed FV and VO diets. In addition, the elevation ratio of p-IKK/
IKK, p-I
k
B/I
k
B, and n-p65/t-p65 in the AT of large yellow croaker
indicated the activation of NF-
k
B signalling by replacement of di-
etary FO with VO. These results indicated that the anti-
inflammatory role of FO could be partially accomplished by sup-
pressing the activation of TLRs and downstream signalling in the AT
of large yellow croaker. The mechanism by which fatty acids
modulated TLRs and subsequent signalling was still not completely
elucidated. However, evidence suggested that n-3 LC-PUFA play a
role in preventing TLR4 translocation into lipid rafts, an initial event
that is involved in TLRs and subsequent NF-
k
B signalling [35].
Moreover, in a recent study, TLR4 recruitment into lipid rafts was
inhibited in rats from fish oil group rather than soybean oil (linoleic
acid rich) group [36]. Thus, it is speculated that FO rather than VO
disrupts the formation of the lipid raft and then suppresses TLRs-
NF-
k
B signalling in the AT of large yellow croaker.
Fig. 1. Non-specific immunity parameters and disease resistance in large yellow
croaker. Fig. 1a presents the head kidney macrophages respiratory burst activity. Data
is given in absorbance value detected under a 630-nm wave length. Fig. 1b indicates
the serum lysozyme activities associated with different dietary treatments. Fig. 1c
indicates the alternative complement pathway activity. Data is presented as ACH50.
Fig. 1d shows the cumulative mortality rate (CMR) in large yellow croaker after the
immune challenge with V. anguillarum for 7days. Values are the means ±S.E.M of three
replicates. Different letters assigned to the bars in each figure represent significant
differences among the dietary treatments using Tukey's test (P<0.05). S.E.M.: stan-
dard error of the means.
P. Tan et al. / Fish & Shellfish Immunology 59 (2016) 398e405402
In this study, CSF1R and CD68 proteins, two marker proteins for
macrophages [14], were both enhanced in the AT of large yellow
croaker fed diets with partial or total VO. Notably, the expression of
macrophage marker proteins was positively correlated to that of
TLR-NF-
k
B activation in AT of large yellow croaker. This indicated
that TLR-NF-
k
B activation could induce the increased infiltration of
macrophages into AT in fish species, just as the process in mammals
[4]. Chemokines, such as adipocyte-secreted monocyte chemotactic
protein 1 (MCP1), could exert the direct roles in recruiting macro-
phages into AT [37]. Deletion of the MCP1 gene reduced the accu-
mulation of macrophages while over-expression of the MCP1 gene
induced macrophage recruitment into AT [4]. Thus, TLR-NF-
k
B
signalling activation may promote production of chemokines,
which induces the infiltration of macrophages into AT [38].
Infiltration of ATMs was usually accompanied by the polariza-
tion of macrophages into different types. ATMs phenotypically
divided into two types of cells: “classical”pro-inflammatory M1-
type macrophages”and “alternatively activated”anti-
inflammatory M2-type macrophages. M1-type macrophages
significantly contributed to the increased production of pro-
inflammatory cytokines, such as TNF
a
and IL1
b
. M2-type macro-
phages were highly active in particle uptake, which was reflected
by the expression of non-opsonic pathogen receptors such as MRC1
(or CD206) [39], and CD209 [40]. The M2-type macrophages pro-
duced anti-inflammatory cytokines, such as IL10, IL4 and IL13,
which was marked by the expression of Arg I and several other
genes [34]. Polarization of macrophages was considered to be
related to their nutritional status such as dietary lipids, fatty acids
Fig. 2. TLR-related genes expression in AT of large yellow croaker. TLR-related genes expression of TLR1, TLR2, TLR3, TLR7, TLR9, TLR13, TLR22 and MyD88 are determined in the AT
of large yellow croaker fed different diets. Values are means ±S.E.M (n ¼3). Different letters assigned to the bars represent significant differences using Tukey's test (P<0.05). TLR:
toll-like receptor; MyD88: myeloid differentiation factor 88; S.E.M.: stand error of the means.
Fig. 3. Western blot analyses for NF-
k
B signalling activation in the AT of large yellow croaker. The right panel features the ratio of p-IKK
a
/
b
to IKK
a
/
b
, p-I
k
BtoI
k
B and n-p65 to t-
p65. GAPDH and Lamin B are selected as total and nucleus reference proteins, respectively. Data are expressed as the A.U. of the Western blot and are depicted as a ratio of the target
protein to the reference protein. Values are the means ±S.E.M (n ¼3). Different letters assigned to the bars represent significant differences using Tukey's test (P<0.05). NF-
k
B:
nuclear factor kappa beta; AT: adipose tissue; IKK
a
/
b
: inhibitor of IKK
a
/
b
kinase
a
/
b
; p-IKK
a
/
b
: phosphorylation inhibitor of nuclear factor kappa-B kinase
a
/
b
;I
k
B
a
: inhibitor of NF-
k
B
a
; p-I
k
B
a
: phosphorylation inhibitor of NF-
k
B
a
; t-p65: total p65; n-p65: nucleus p65; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
P. Tan et al. / Fish & Shellfish Immunology 59 (2016) 398e405 403
and lipid mediators [4]. In this study, cytokines (TNF
a
and IL1
b
)
from M1-type macrophages were significantly increased in the AT
of large yellow croaker fed FV or VO diets compared to that in FO
diets. By contrast, M2-type macrophage marker proteins (MRC1
and CD209) and M2-type macrophage-related cytokines (IL10 and
Arg I) were both significantly decreased in the AT of large yellow
croaker fed FV or VO diets. This indicated VO increased the polar-
ization of macrophages toward M1 ATMs in AT of large yellow
croaker. This finding was in accordant with finding in a rat model,
in which mRNA expression of M1 type macrophage infiltration
marker gene (F4/80) was significantly higher in rat fed diet with
soybean oil inclusion than the control group. Besides, diet with
soybean oil inclusion resulted in the over expression of pro-
inflammatory cytokines, such as TNF
a
and IL6, but reduced the
expression of anti-inflammatory cytokine IL10 [33]. In contrast,
studies indicated that DHA specifically enhanced anti-
inflammatory IL-10 secretion and reduced the expression of pro-
inflammatory M1 macrophages [41]. The polarization of ATMs
was toward M1 ATMs in mice fed a high fat diet, while toward M2
ATMs in obese mice fed diets with n-3 PUFA. Coincidentally, a
recent investigation focused on fatty acids in the murine adipocyte
macrophage co-culture model and showed that DHA decreased
mRNA expression of M1 type ATMs polarization markers while
increasing anti-inflammatory cytokines [42]. Thus, it is the rela-
tively higher amount of n-3 LC-PUFA that account for the low po-
larization rate toward M1 ATMs and low pro-inflammatory
response in AT of large yellow croaker fed the FO diet. The relative
high content of linoleic acids in FV and VO diets lead to the relative
high polarization rate toward M1 ATMs and relative high pro-
inflammatory response in AT.
5. Conclusion
Dietary VO decreased the non-specific immunity and disease
resistance in large yellow croaker. VO could increase expression of
pro-inflammatory cytokine which may results from the activation
of TLR-NF-
k
B signalling, increase of macrophage infiltration into AT
and macrophage polarization to M1 type ATMs.
Acknowledgements
This work was supported by the National Science Fund for
Distinguished Young Scholars of China [grant number: 31525024],
the National Natural Science Foundation of China grants [grant
number: 31372541, 31172425] and the Scientific and Technological
Innovation Project from Laboratory for Marine Fisheries and
Aquaculture financially supported by Qingdao National Laboratory
for Marine Science and Technology [grant number: 2015ASKJ02]
and AoShan Talents Program [grant number: 2015ASTP]. We thank
H.L. Xu, J.Q. Li, W. Ren and K. Cui for their assistance in feeding trials
and Dr. D.D. Xu for her skillful technical assistance in Western blot
analyses. Thanks are also due to X.J. Xiang and B. Yang for their help
during the experiment.
References
[1] M.J. Leaver, J.M. Bautista, B.T. Bj€
ornsson, E. J€
onsson, G. Krey, D.R. Tocher, et al.,
Towards fish lipid nutrigenomics: current state and prospects for fin-fish
aquaculture, Rev. Fish. Sci. 16 (2008) 73e94.
[2] D. Montero, T. Kalinowski, A. Obach, L. Robaina, L. Tort, M.J. Caballero, et al.,
Vegetable lipid sources for gilthead seabream (Sparus aurata): effects on fish
health, Aquaculture 225 (2003) 353e370.
[3] D. Montero, V. Grasso, M. Izquierdo, R. Ganga, F. Real, L. Tort, et al., Total
substitution of fish oil by vegetable oils in gilthead sea bream (Sparus aurata)
diets: effects on hepatic Mx expression and some immune parameters, Fish
shellfish Immunol. 24 (2008) 147e155.
[4] !!! INVALID CITATION !!!.
[5] R. Zuo, K. Mai, W. Xu, G.M. Turchini, Q. Ai, Dietary ALA, but not LNA, increase
growth, reduce inflammatory processes, and increase anti-oxidant capacity in
the marine finfish Larimichthys crocea, Lipids 50 (2015) 149e163.
[6] D. Montero, V. Benitez-Dorta, M.J. Caballero, M. Ponce, S. Torrecillas,
M. Izquierdo, et al., Dietary vegetable oils: effects on the expression of
immune-related genes in Senegalese sole (Solea senegalensis) intestine, Fish
shellfish Immunol. 44 (2015) 100e108.
[7] R. Zuo, K. Mai, W. Xu, G.M. Turchini, Q. Ai, Dietary ALA, but not LNA, increase
growth, reduce inflammatory processes, and increase anti-oxidant capacity in
the marine finfish Larimichthys crocea, Lipids (2014) 1e15.
[8] P.C. Calder, Marine omega-3 fatty acids and inflammatory processes: effects,
mechanisms and clinical relevance, Biochimica Biophysica Acta (BBA)-Mo-
lecular Cell Biol. Lipids 1851 (2015) 469e484.
[9] R. Zuo, Q. Ai, K. Mai, W. Xu, J. Wang, H. Xu, et al., Effects of dietary n-3 highly
unsaturated fatty acids on growth, nonspecific immunity, expression of some
immune related genes and disease resistance of large yellow croaker (Lar-
michthys crocea) following natural infestation of parasites (Cryptocaryon
irritans), Fish shellfish Immunol. 32 (2012) 249e258.
[10] L. Martinez-Rubio, S. Morais, Ø. Evensen, S. Wadsworth, K. Ruohonen,
J.L. Vecino, et al., Functional feeds reduce heart inflammation and pathology in
Atlantic salmon (Salmo salar L.) following experimental challenge with
Atlantic salmon reovirus (ASRV), PloS one 7 (2012) e40266.
[11] H. Xu, G.T. Barnes, Q. Yang, G. Tan, D. Yang, C.J. Chou, et al., Chronic inflam-
mation in fat plays a crucial role in the development of obesity-related insulin
resistance, J. Clin. Invistig. 112 (2003) 1821e1830.
[12] C.N. Lumeng, J.L. Bodzin, A.R. Saltiel, Obesity induces a phenotypic switch in
adipose tissue macrophage polarization, J. Clin. Invistig. 117 (2007) 175e184.
[13] K.R. Coenen, M.L. Gruen, A. Chait, A.H. Hasty, Diet-induced increases in
adiposity, but not plasma lipids, promote macrophage infiltration into white
adipose tissue, Diabetes 56 (2007) 564e573.
[14] S.P. Weisberg, D. McCann, M. Desai, M. Rosenbaum, R.L. Leibel, A.W. Ferrante,
Obesity is associated with macrophage accumulation in adipose tissue, J. Clin.
Invistig. 112 (2003) 1796e1808.
[15] J. Todoric, M. L€
offler, J. Huber, M. Bilban, M. Reimers, A. Kadl, et al., Adipose
Fig. 4. Analyses of macrophage infiltration and polarization marker proteins and
cytokine gene expression in AT. Western blot analyses of macrophage infiltration and
proliferation marker proteins, namely, CSF1R, CD68, MRC1 and CD209, in the AT of
large yellow croaker when fed FO, FV and VO diets are shown in Fig. 4a. The left panel
of Fig. 4a presents the Western blot image of target proteins. The right panel of Fig. 4a
presents the ratio of target proteins to Na
þ
-K
þ
-ATPase. Q-PCR analyses for cytokine
genes (TNF
a
and IL1
b
) expressed by M1 macrophage and cytokine genes (Arg I and
IL10) expressed by M2 macrophages in the AT of large yellow croaker when fed FO, FV
and VO diets are presented in Fig. 4b. Values are means ±S.E.M (n ¼3). Different
letters assigned to the bars represent significant differences using Tukey's test
(P<0.05). CSF1R: colony stimulating factor 1 receptor; CD68: cluster of differentiation
68; MRC1: macrophage mannose receptor 1; CD209: cluster of differentiation 209;
IL1
b
: interleukin 1
b
; TNF
a
: tumour necrosis factor
a
; Arg I: arginase I; IL10: interleukin
10; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
P. Tan et al. / Fish & Shellfish Immunology 59 (2016) 398e405404
tissue inflammation induced by high-fat diet in obese diabetic mice is pre-
vented by n3 polyunsaturated fatty acids, Diabetologia 49 (2006)
2109e2119.
[16] V. Saraswathi, L. Gao, J.D. Morrow, A. Chait, K.D. Niswender, A.H. Hasty, Fish
oil increases cholesterol storage in white adipose tissue with concomitant
decreases in inflammation, hepatic steatosis, and atherosclerosis in mice,
J. Nutr. 137 (2007) 1776e1782.
[17] A.A. De Boer, J.M. Monk, L.E. Robinson, Docosahexaenoic acid decreases pro-
inflammatory mediators in an in vitro murine adipocyte macrophage co-
culture model, PloS one 9 (2014) e85037.
[18] D. Montero, F. Mathlouthi, L. Tort, J.M. Afonso, S. Torrecillas, A. Fernandez-
Vaquero, et al., Replacement of dietary fish oil by vegetable oils affects hu-
moral immunity and expression of pro-inflammatory cytokines genes in
gilthead sea bream Sparus aurata, Fish shellfish Immunol. 29 (2010)
1073e1081.
[19] S.L. Seierstad, Ø. Haugland, S. Larsen, R. Waagbø, Ø. Evensen, Pro-inflamma-
tory cytokine expression and respiratory burst activity following replacement
of fish oil with rapeseed oil in the feed for Atlantic salmon (Salmo salar L.),
Aquaculture 289 (2009) 212e218.
[20] X. Dong, Comparision Study on Regulation of Delta 6 Fatty Acyl Desaturase
Among Rainboe Trout, Japanese Seabass and Large Yellow Croaker, Ocean
University of China, Qingdao: Qingdao Shandong, 2015.
[21] C.J. Secombes, Isolation of salmonid macrophages and analysis of their killing
activity, Tech. fish Immunol. 1 (1990) 137e154.
[22] A.E. Ellis, Lysozyme assays, Tech. fish Immunol. 1 (1990) 101e103.
[23] Q. Ai, K. Mai, L. Zhang, B. Tan, W. Zhang, W. Xu, et al., Effects of dietary
b
-1, 3
glucan on innate immune response of large yellow croaker, Pseudosciaena
crocea, Fish Shellfish Immunol. 22 (2007) 394e402.
[24] B. Ching, S. Jamieson, J. Heath, D. Heath, A. Hubberstey, Transcriptional dif-
ferences between triploid and diploid Chinook salmon (Oncorhynchus tsha-
wytscha) during live Vibrio anguillarum challenge, Heredity 104 (2010)
224e234.
[25] R. Zuo, Q. Ai, K. Mai, W. Xu, J. Wang, H. Xu, et al., Effects of dietary docosa-
hexaenoic to eicosapentaenoic acid ratio (DHA/EPA) on growth, nonspecific
immunity, expression of some immune related genes and disease resistance
of large yellow croaker (Larmichthys crocea) following natural infestation of
parasites (Cryptocaryon irritans), Aquaculture 334e337 (2012) 101e109.
[26] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using
real-time quantitative PCR and the 2
DD
CT
method, methods 25 (2001)
402e408.
[27] D. Xu, G. He, K. Mai, H. Zhou, W. Xu, F. Song, Postprandial nutrient-sensing
and metabolic responses after partial dietary fishmeal replacement by soya-
bean meal in turbot (Scophthalmus maximus L.), Br. J. Nutr. 115 (2016)
379e388.
[28] F.-C. Wu, H.-Y. Chen, Effects of dietary linolenic acid to linoleic acid ratio on
growth, tissue fatty acid profile and immune response of the juvenile grouper
Epinephelus malabaricus, Aquaculture 324e325 (2012) 111e117.
[29] I.K. Petropoulos, K.D. Thompson, A. Morgan, J.R. Dick, D.R. Tocher, J. G Bell,
Effects of substitution of dietary fish oil with a blend of vegetable oils on liver
and peripheral blood leucocyte fatty acid composition, plasma prostaglandin
E2and immune parameters in three strains of Atlantic salmon (Salmo salar),
Aquac. Nutr. 15 (2009) 596e607.
[30] M. Masoodi, O. Kuda, M. Rossmeisl, P. Flachs, J. Kopecky, Lipid signaling in
adipose tissue: connecting inflammation &metabolism, Biochimica Bio-
physica Acta (BBA)-Molecular Cell Biol. Lipids 1851 (2015) 503e518.
[31] S. Shoelson, J. Lee, M. Yuan, Inflammation and the IKKß/I? B/NF-? B axis in
obesity-and diet-induced insulin resistance, Int. J. Obes. Relat. Metabolic
Disord. 27 (2003).
[32] H. Shi, M.V. Kokoeva, K. Inouye, I. Tzameli, H. Yin, J.S. Flier, TLR4 links innate
immunity and fatty acideinduced insulin resistance, J. Clin. Invistig. 116
(2006) 3015e3025.
[33] X. Wang, Differential effects of high-fat-diet rich in lard oil or soybean oil on
osteopontin expression and inflammation of adipose tissue in diet-induced
obese rats, Eur. J. Nutr. 52 (2013) 1181e1189.
[34] J.Y. Lee, J. Ye, Z. Gao, H.S. Youn, W.H. Lee, L. Zhao, et al., Reciprocal modulation
of Toll-like receptor-4 signaling pathways involving MyD88 and phosphati-
dylinositol 3-kinase/AKT by saturated and polyunsaturated fatty acids, J. Biol.
Chem. 278 (2003) 37041e37051.
[35] S.W. Wong, M.-J. Kwon, A.M. Choi, H.-P. Kim, K. Nakahira, D.H. Hwang, Fatty
acids modulate Toll-like receptor 4 activation through regulation of receptor
dimerization and recruitment into lipid rafts in a reactive oxygen species-
dependent manner, J. Biol. Chem. 284 (2009) 27384e27392.
[36] K. Kim, N. Jung, K. Lee, J. Choi, S. Kim, J. Jun, et al., Dietary omega-3 poly-
unsaturated fatty acids attenuate hepatic ischemia/reperfusion injury in rats
by modulating toll-like receptor recruitment into lipid rafts, Clin. Nutr. 32
(2013) 855e862.
[37] J.K. Olson, S.D. Miller, Microglia initiate central nervous system innate and
adaptive immune responses through multiple TLRs, J. Immunol. 173 (2004)
3916e3924.
[38] T. Suganami, K. Tanimoto-Koyama, J. Nishida, M. Itoh, X. Yuan, S. Mizuarai, et
al., Role of the Toll-like receptor 4/NF-
k
B pathway in saturated fatty acid-
einduced inflammatory changes in the interaction between adipocytes and
macrophages, Arterioscler., thromb., Vasc. Biol. 27 (2007) 84e91.
[39] M. Stein, S. Keshav, N. Harris, S. Gordon, Interleukin 4 potently enhances
murine macrophage mannose receptor activity: a marker of alternative
immunologic macrophage activation, J. Exp. Med. 176 (1992) 287e292.
[40] T.B. Geijtenbeek, R. Torensma, S.J. van Vliet, G.C. van Duijnhoven, G.J. Adema,
Y. van Kooyk, et al., Identification of DC-SIGN, a novel dendritic cellespecific
ICAM-3 receptor that supports primary immune responses, Cell 100 (2000)
575e585.
[41] E. Oliver, F.C. McGillicuddy, K.A. Harford, C.M. Reynolds, C.M. Phillips,
J.F. Ferguson, et al., Docosahexaenoic acid attenuates macrophage-induced
inflammation and improves insulin sensitivity in adipocytes-specific differ-
ential effects between LC n-3 PUFA, J. Nutr. Biochem. 23 (2012) 1192e1200.
[42] A.A. De Boer, J.M. Monk, L.E. Robinson, Docosahexaenoic acid decreases pro-
inflammatory mediators in an in vitro murine adipocyte macrophage co-
culture model, PloS one 9 (2014) e85037.
P. Tan et al. / Fish & Shellfish Immunology 59 (2016) 398e405 405
