ArticlePDF Available

Vegetable oil induced inflammatory response by altering TLR-NF-κB signalling, macrophages infiltration and polarization in adipose tissue of large yellow croaker (Larimichthys crocea)

Authors:

Abstract and Figures

High level of vegetable oil (VO) in diets could induce strong inflammatory response, and thus decrease nonspecific immunity and disease resistance in most marine fish species. The present study was conducted to investigate whether dietary VO could exert these anti-immunological effects by altering TLR-NF-κB signalling, macrophages infiltration and polarization in adipose tissue of large yellow croaker (Larimichthys crocea). Three iso-nitrogenous and iso-lipid diets with 0% (FO, fish oil, the control), 50% (FV, fish oil and vegetable oil mixed) and 100% (VO, vegetable oil) vegetable oil were fed to fish with three replicates for ten weeks. The results showed that activities of respiratory burst (RB) and alternative complement pathway (ACP), as well as disease resistance after immune challenge were significantly decreased in large yellow croaker fed VO diets compared to FO diets. Inflammatory response of experimental fish was markedly elevated by VO reflected by increase of pro-inflammatory cytokines (IL1β and TNFα) and decrease of anti-inflammatory cytokine (arginase I and IL10) genes expression. TLR-related genes expression, nucleus p65 protein, IKKα/β and IκBα phosphorylation were all significantly increased in the AT of large yellow croaker fed VO diets. Moreover, the expression of macrophage infiltration marker proteins (cluster of differentiation 68 [CD68] and colony-stimulating factor 1 receptor [CSF1R]) was significantly increased while the expression of anti-inflammatory M2 macrophage polarization marker proteins (macrophage mannose receptor 1 [MRC1] and cluster of differentiation 209 [CD209]) was significantly decreased in the AT of large yellow croaker fed VO diets. In conclusion, VO could induce inflammatory responses by activating TLR-NF-κB signaling, increasing macrophage infiltration into adipose tissue and polarization of macrophage in large yellow croaker.
No caption available
… 
No caption available
… 
No caption available
… 
No caption available
… 
Content may be subject to copyright.
Full length article
Vegetable oil induced inammatory response by altering TLR-NF-
k
B
signalling, macrophages inltration and polarization in adipose tissue
of large yellow croaker (Larimichthys crocea)
Peng Tan
a
, Xiaojing Dong
a
, Kangsen Mai
a
,
b
,WeiXu
a
, Qinghui Ai
a
,
b
,
*
a
Key Laboratory of Aquaculture Nutrition and Feed, Ministry of Agriculture and the Key Laboratory of Mariculture, Ministry of Education, Ocean University
of China, 5 Yushan Road, Qingdao, Shandong, 266003, People's Republic of China
b
Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology,1 Wenhai Road,
Qingdao, Shandong, 266237, People's Republic of China
article info
Article history:
Received 7 September 2016
Received in revised form
19 October 2016
Accepted 2 November 2016
Available online 3 November 2016
Keywords:
Fish oil
Vegetable oil
Immunity
Adipose tissue
Large yellow croaker
abstract
High level of vegetable oil (VO) in diets could induce strong inammatory response, and thus decrease
nonspecic immunity and disease resistance in most marine sh species. The present study was con-
ducted to investigate whether dietary VO could exert these anti-immunological effects by altering TLR-
NF-
k
B signalling, macrophages inltration and polarization in adipose tissue of large yellow croaker
(Larimichthys crocea). Three iso-nitrogenous and iso-lipid diets with 0% (FO, sh oil, the control), 50% (FV,
sh oil and vegetable oil mixed) and 100% (VO, vegetable oil) vegetable oil were fed to sh with three
replicates for ten weeks. The results showed that activities of respiratory burst (RB) and alternative
complement pathway (ACP), as well as disease resistance after immune challenge were signicantly
decreased in large yellow croaker fed VO diets compared to FO diets. Inammatory response of exper-
imental sh was markedly elevated by VO reected by increase of pro-inammatory cytokines (IL1
b
and
TNF
a
) and decrease of anti-inammatory cytokine (arginase I and IL10) genes expression. TLR-related
genes expression, nucleus p65 protein, IKK
a
/
b
and I
k
B
a
phosphorylation were all signicantly
increased in the AT of large yellow croaker fed VO diets. Moreover, the expression of macrophage
inltration marker proteins (cluster of differentiation 68 [CD68] and colony-stimulating factor 1 receptor
[CSF1R]) was signicantly increased while the expression of anti-inammatory M2 macrophage polar-
ization marker proteins (macrophage mannose receptor 1 [MRC1] and cluster of differentiation 209
[CD209]) was signicantly decreased in the AT of large yellow croaker fed VO diets. In conclusion, VO
could induce inammatory responses by activating TLR-NF-
k
B signalling, increasing macrophage inl-
tration into adipose tissue and polarization of macrophage in large yellow croaker.
©2016 Published by Elsevier Ltd.
1. Introduction
Fish oil (FO), which contains a relatively high content of long-
chain polyunsaturated fatty acids (LC-PUFA), is the traditionally
major lipid component of the sh diet. With the development of
aqua-feed industry, the increasing demand for FO has post great
pressure on shery resources that have been exploited at their
maximum sustainable limit [1]. Vegetable oil (VO), with relatively
considerable output, acceptable price, relatively low organic
contaminant status, and relatively high content of unsaturated fatty
acids, is a promising alternative to FO. However, high inclusion of
VO resulted in decreased non-specic immunity parameters,
especially for marine sh species, such as gilthead sea bream
(Sparus aurata)[2,3], European sea bass (Dicentrarchus labrax),
Atlantic salmon (Salmo salar)[4], and large yellow croaker (Lar-
imichthys crocea)[5]. Moreover, numerous studies indicated that
VO resulted in the overexpression of pro-inammatory cytokine
genes expression and inammatory response in Senegalese sole
Abbreviations: TLR, toll-like receptor; NF-
k
B, nuclear factor kappa beta; RB,
respiratory burst; LZM, lysozyme; ACP, alternative complement pathway; CMR,
cumulative mortality rate; DHA, ducosahexenoic acid; EPA, eicosapentaenoic acid;
AT, adipose tissue; IKK
a
/
b
, inhibitor of NF-
k
B kinase
a
/
b
;I
k
B
a
, inhibitor of NF-
k
B;
CD68, cluster of differentiation 68; CSF1R, colony-stimulating factor 1 receptor;
MRC1, macrophage mannose receptor 1; CD209, cluster of differentiation 209; IL1
b
,
interleukin 1
b
; TNF
a
, tumour necrosis factor
a
; Arg I, arginase I; IL10, interleukin
10; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
*Corresponding author.
E-mail addresses: aiqinghui@163.com,qhai@ouc.edu.cn (Q. Ai).
Contents lists available at ScienceDirect
Fish & Shellsh Immunology
journal homepage: www.elsevier.com/locate/fsi
http://dx.doi.org/10.1016/j.fsi.2016.11.009
1050-4648/©2016 Published by Elsevier Ltd.
Fish & Shellsh Immunology 59 (2016) 398e405
(Solea senegalensis)[6], gilthead sea bream [4] and large yellow
croaker [7]. Persistent attempts have been conducted to elucidate
the mechanism of VO in inducing sh immunity problems from the
perspective of membrane uidity, eicosanoid pathways [8], and
pattern recognition receptor pathways [9]. Besides, studies have
been carried out to reveal the immune-regulation mechanism of
VO in the head kidney [4], intestine [4], liver [4], heart [10] because
of their close relationship with immunity. However, as far as we
know, no information was available about immune response to VO
in the adipose tissue (AT) of any sh species.
During the past decade, the immunity role of adipose tissue (AT)
has attracted ever-increasing attention in mammal studies since
the discovery of inammatory response induced by macrophages
inltration into AT [11]. AT has been well known to regulate lipid
homeostasis by storing excess energy in the form of triglycerides,
while more and more studies have indicated that fatty acids are
closely related to the accumulation of adipose tissue macrophages
(ATMs) [12,13]. The inltration of ATMs and polarization toward
pro-inammatory M1 type macrophage were conrmed to be
closely related to the activation of NF-
k
B signalling and the over-
expression of pro-inammatory cytokines, such as TNF
a
, IL6 and
IL1
b
[14]. Mammal studies have veried that the anti-inammatory
role of sh oil was partially resulted from the suppression of ATMs
inltration and decrease of AT pro-inammatory cytokines
expression [15,16]. Besides, the paracrine of pro-inammatory cy-
tokines by ATMs has been found to induce inammatory response
[17]. The increasing inammatory response was usually accompa-
nied by the decreasing non-specic immune response in sh spe-
cies, though the mechanism was still unclear [6,18,19]. In thus, the
decrease of non-specic immunity by dietary VO may partially due
to the pro-inammatory cytokines secreted by AT.
To our knowledge, no investigation has been conducted to
elucidate the immune regulation mechanisms of VO from the
perspective of ATMs accumulation and polarization in AT in this
and other sh species. Thus, this study was conducted to investi-
gate non-specic immunity parameters, ATM inltration and po-
larization marker proteins expression and TLR-NF-
k
B signalling in
large yellow croaker (Larimichthys crocea) in response to dietary
VO. It was aimed to better understand the mechanism about how
dietary VO induce inammatory response and decrease sh
immunity.
2. Materials and methods
2.1. Animals, diets formulation and animal husbandry
Disease-free and equal sizes of large yellow croaker was from a
commercial farm in Ningbo, China. Before the experiment, sh was
acclimatized by feeding a control diet for two weeks. Diet formu-
lations and animal husbandry were described in a previous study
[20]. Briey, soybean meal and defatted sh meal were the main
protein sources. Three iso-nitrogenous (41% crude protein) and iso-
lipid (12% crude lipid) diets were formulated with the replacement
of sh oil by vegetable oil as follows: 0% replacement (FO), 50%
replacement (FV, sh oil: soybean oil: linseed oil ¼2:1:1) and 100%
replacement (VO, soybean oil: linseed oil ¼1:1). The approximate
compositions were analysed and are shown in Table 1. The content
of different fatty acids in the experimental diets (mg/g) were
determined and are shown in Table 2.
Animal experiment for the large yellow croaker was processed
in a net cage system at Xihu Harbor (Ningbo, China). After fasting
for 24 h, large yellow croaker (mean weight 8.93 g ±0.21 g) was
randomly divided into 9 oating cages with 60 sh per cage. Each
type of diet was randomly divided into 3 parts, and each diet was
randomly assigned to a net cage. Fish was fed twice a day to
apparent satiation for 70 days. Husbandry was under appropriate
conditions.
The protocols for animal husbandry and handling employed in
this study were approved by the Institutional Animal Care and Use
Committee of the Ocean University of China.
Table 1
Formulation of the experimental diets (% dry matter) [20].
Ingredients FO
a
FV
b
VO
c
Defatted white sh meal
d
15 15 15
Soybean meal 32 32 32
Casein
e
11 11 11
Wheat meal 26 26 26
Mineral premix
f
222
Vitamin premix
g
222
Attractant
h
0.3 0.3 0.3
Mould inhibitor
i
0.1 0.1 0.1
Lecithin 2.6 2.6 2.6
Fish oil 9 4.5 0
Soybean oil 0 2.5 4.5
Linseed oil 0 2.5 4.5
Total 100 100 100
dry %
Crude protein 41.67 41.74 41.71
Crude lipid 12.85 12.70 12.76
a
FO: Fish oil group.
b
FV: blend of vegetable oil (linseed oil/soybean oil ¼1:1) replacing sh oil at 50%.
c
VO: blend of vegetable oil replacing sh oil at 100%.
d
Defatted sh meal: 72.1% crude protein and 1.4% crude lipid; white sh meal
was defatted with ethanol (sh meal:ethanol ¼1:2 (w:v)) at 37
Cfor three
replications.
e
Casein: 88% crude protein and 1.3% crude lipid, Alfa Aesar, Avocado Research
Chemicals Ltd, UK.
f
Mineral premix (mg or g kg
1
diet): CuSO
4
$5H
2
O 10 mg; Na
2
SeO
3
(1%) 25 mg;
ZnSO
4
$H
2
O, 50 mg; CoCl
2
$6H
2
O (1%) 50 mg; MnSO
4
$H
2
O 60 mg; FeSO
4
$H
2
O80mg
Ca(IO
3
)
2
180 mg; MgSO
4
$7H
2
O 1200 mg; zeolite 18.35 g.
g
Vitamin premix (mg or g kg
1
diet): vitamin D 5 mg; vitamin K 10 mg; vitamin
B12 10 mg; vitamin B6 20 mg; folic acid 20 mg; vitamin B1 25 mg; vitamin A 32 mg;
vitamin B2 45 mg; pantothenic acid 60 mg; biotin 60 mg; niacin acid 200 mg;
a
-
tocopherol 240 mg; inositol 800 mg; ascorbic acid 2000 mg; microcrystalline cel-
lulose 16.47 g.
h
Phagostimulant: Glycine/Betaine ¼1:3.
i
Preservative: Fumarate/Calcium pnpionabe ¼1:1.
Table 2
The content of different fatty acids in the experimental diets (mg/g)
a
[20].
Fatty acid FO FV VO
C 14: 0 0.76 0.42 0.10
C 16: 0 4.51 3.96 3.13
C 18: 0 1.63 1.72 1.71
PSFA
b
6.90 6.10 4.94
C 16: 1 1.08 0.53 0.06
C 18: 1 3.59 4.58 5.47
PMUFA
c
4.67 5.11 5.53
C 18: 2n-6 4.35 8.85 12.66
C 20: 4n-6 0.12 0.07 0.04
Pn-6 PUFA
d
4.47 8.93 12.70
C 18: 3n-3 0.43 3.32 6.98
C 20: 5n-3 1.25 0.62 0.06
C 22: 6n-3 1.85 0.88 0.08
Pn-3 PUFA
e
3.53 4.82 7.12
Pn-3/Pn-6 PUFA 0.79 0.54 0.56
Pn-3 LC-PUFA 3.10 1.49 0.14
Total fatty acids 21.18 26.82 31.09
a
Some fatty acids, of which the contents are minor, trace amount or not detected,
such as C22: 0, C24: 0, C14: 1, C20: 2n-6, C20:3n-6, were not listed in the table.
b
SFA: saturated fatty acid.
c
MUFA: monounsaturated fatty acid.
d
n-6 PUFA: n-6 poly-unsaturated fatty acid.
e
n-3 PUFA: n-3 poly-unsaturated fatty acid.
P. Tan et al. / Fish & Shellsh Immunology 59 (2016) 398e405 399
2.2. Sample collections
At the end of the feeding trial and after being fasted for 24 h, 5
sh per cage were randomly collected and anaesthetized (MS222;
Sigma, USA). Blood samples were collected from the caudal
vasculature using a 1-mL syringe, injected into an EP tube and
allowed to clot at room temperature for 2 h before being stored for
6 h at 4
C. The clot was removed, and residual blood cells were
separated from the straw-coloured serum by centrifugation
(3000 g, 10 min, 4
C). The bloodless sh were sacriced and
packed on ice. After removed the abdominal membrane with
scalpel, the adipose tissue was scrape from the abdominal wall.
Washed with PBS, the adipose tissue was collected in 1.5-mL
cryogenic micro-tubes (Sangon, China). All samples were immedi-
ately frozen in liquid nitrogen and stored at 80
C prior to analysis.
2.3. Head kidney macrophage separations and respiratory burst
activity assays
Head kidney macrophages were separated as described in a
previous study with some modications [21]. Five sh was
randomly collected and dissected to obtain the head kidneys after
anaesthetized (MS222; Sigma, USA). Head kidneys, cut into small
fragments then washed with L-15 medium (Sigma, USA), were
forced to pass through 100
m
m cell strainer (Falcon, USA) using 2 mL
syringe piston into 50 mL centrifuge tube (Corning, USA). The L-15
medium was supplied with 100 U penicillin and streptomycin,
2 mM L-alanyl-
L
-glutamine (Thermo Fisher Scientic, USA) and 2%
fetal bovine serum (Gibco, USA). Separated cell density was coun-
tered in a haemocytometer and modulated to 1 10
7
mL. Viability
of cells were determined by the trypan blue staining method and
was guaranteed >95% for further experiment.
Head kidney macrophages respiratory burst activity was
measured by the nitro-blue-tetrazolium (NBT) (Sigma, USA) assay,
described as previous study with some modications [21]. A sus-
pension of head kidney macrophages (100
m
L, 1 10
7
/mL) was
added to a 96-well cell culture plate and centrifuged for 10 min
(1500 g, Sorvall Legend RT, Germany). The supernatant was then
replaced by 200
m
L of L-15 medium (NBT, Sigma, USA, 1 mg/mL;
phorbol 12-myristate 13-acetate, PMA, Sigma, USA, 1
m
g/mL). Cell
xation was performed after incubation (40 min, 18
C, in the dark)
using 200
m
L of absolute methanol per well. Subsequently, each
well was washed with 70% methanol aqueous solution and incu-
bated for 10 min. The procedure was repeated, and the plate was
air-dried. Blue precipitation formed in the well and was dissolved
with 120
m
L of a potassium hydroxide aqueous solution (2 M) and
DMSO (Sinopharm Chemical Reagent, China). The respiratory burst
activity was expressed as the absorbance value detected under a
630-nm wave length.
2.4. Serum lysozyme activity assays
Serum lysozyme activity was measured by the self-contrasted
method described in a previous study [22]. Briey, a reaction
mixture of 10
m
L of serum and a 1.4
m
L 0.2 mg/mL Micrococcus
lysodeikticus (Sigma, USA) suspension was incubated at 25
Cfor
10 min. The absorbance value was detected under a 540-nm wave
length once per minute. One unit was dened as the absorbance
value that attenuated 0.001 in one minute utilizing 1 mL serum.
2.5. Alternative complement pathway (ACP) activity
The alternative complement pathway activity was determined
as previously described [23]. Briey, a series of volumes of the
diluted serum ranging from 0.1 to 0.25 mL was dispensed into test
tubes, and the total volume was brought up to 0.25 mL with
barbitone buffer in the presence of ethyleneglycol-bis (2-
aminoethoxy)-tetra acetic acid (EGTA) and Mg
2þ
. Subsequently,
0.1 mL of rabbit red blood cells (RaRBC) was added to each tube.
After incubation for 90 min at 20
C, 3.15 mL of 0.9% NaCl was added
to the test tubes. Samples were centrifuged at 1600 g for 5 min at
4
C to eliminate unlysed RaRBC. The optical density of the super-
natant was measured at 414 nm. A lysis curve was prepared to
determine the volume of serum that yielded 50% hemolysis, and
the value of ACH50 units/mL was obtained for each group.
2.6. Mortality after challenged with Vibrio anguillarum
At the end of the feeding trial, large yellow croaker was immune
challenged with Vibrio anguillarum (provided by Pro. Jing Xing,
Ocean University of China). Procedures for bacteria preparation
were according to methods described previously with some mod-
ications [24]. Briey, the bacterial strain was streaked onto blood
agar plates and grow at room temperature for 20 h. A single colony
was chosen for expanding the culture in a liquid medium at 37
C
for 12 h. Just before the immune challenge, the V. anguillarum
culture was suspended in phosphate-buffer saline. The suspension
was kept on ice before use. Before injection, ten sh per net cage
were anaesthetized with MS222 (Sigma, USA). A one-half lethal
concentration of V. anguillarum (8 10
8
CFU) was injected into the
enterocoelia of the sh according to preliminary experiments. After
the injection, the sh were left to recover in an aerated tank before
being returned to their original cages. Mortality was monitored
every day for 7 days.
2.7. RNA extractions, cDNA synthesis, and quantitative real-time
polymerase chain reaction (q-PCR)
Adipose tissue was ground to powder in liquid nitrogen and
added to Trizol reagent (Takara, China). Subsequently, total RNA
was extracted following the manufacturer's protocol. To remove
genomic DNA, extracted RNA was treated with RNase-Free DNase
(Takara, China) in 42
Cfor 2 min. The integrity of RNA was detected
by electrophoresis using 1.2% denatured agarose gel. The quantity
of RNA was determined by a Nano Drop
®
2000 spectrophotometer
(Thermo Fisher Scientic, USA). Total RNA with a 260/280-nm
absorbance ratio of 1.8e2.0 was used for further experiments.
The extracted RNA was reversely transcribed to rst-strand cDNA
by the Primer Script RT reagent Kit (Takara, China) following the
manufacturer's instructions.
Real-time polymerase chain reaction was performed as previ-
ously described [25]. Three replicate extractions were performed
for each sample. The primers were designed following the pub-
lished sequences (Table 3). To calculate the expression of immune-
related genes, the comparative CT method (2
-△△CT
method) was
adopted, and the value stood for the n-fold difference relative to the
calibration [26].
2.8. Western blot
The nuclear proteins of adipose tissue were extracted using NE-
PERNuclear and Cytoplasmic Extraction Reagents (Thermo Fisher
Scientic, USA) according to the manufacturer's instructions.
Membrane proteins of adipose tissue were extracted using the
Mem-PERPlus Membrane Protein Extraction Kit (Thermo Fisher
Scientic, USA) according to the manufacturer's instructions. Total
adipose tissue proteins were extracted according to methods pre-
viously described [27]. The protein content was quantied using a
Bradford Protein Assay Kit (Beyotime Institute of Technology,
China). An equal amount of protein (20
m
g) was loaded into wells
P. Tan et al. / Fish & Shellsh Immunology 59 (2016) 398e405400
and separated by 10% sodium dodecyl sulphate polyacrylamide gel
electrophoresis. Proteins in the gel were transferred to a poly-
vinylidene uoride (PVDF) membrane (Millipore, USA), followed by
membrane blocking at room temperature for 2 h. In the freezer
used for the chromatography experiment, PVDF membranes were
incubated with primary antibody overnight. The membranes were
then washed ve times for 3 min each with Tris buffered saline with
Tween(TBST) and incubated for 2 h with horseradish peroxide
(HRP)-conjugated secondary antibody in the TBST. Immune com-
plexes were visualized using an Electrochemiluminescence (ECL)
Kit (Beyotime Institute of Technology, China).
Polyclonal anti-Lamin B, anti-IKK
a
/
b
,anti-I
k
B
a
and Na
þ
/K
þ
-
ATPase antibodies were obtained from Santa Cruz Biotechnology
(USA), whereas polyclonal antiphospho-IKK
a
/
b
, antiphospho-I
k
B
a
,
and anti-p65 antibodies were purchased from Cell Signalling
Technology (USA). Anti-CD68, anti-CSF1R, and anti-CD209 were
obtained from Abcam (England). Polyclonal anti-MRC1 was ob-
tained from Sangon (China). Anti-glyceraldehyde 3-phosphate de-
hydrogenase (GAPDH) and HRP-conjugated secondary antibodies
were obtained from Golden Bridge Biotechnology (China).
2.9. Calculations and statistical analysis
Cumulative mortality rate ¼(Ni eNf) 100/Ni. Ni is the initial
number of sh in each cage before the immune challenge, while Nf
is the nal number of sh in each cage that survived after the im-
mune challenge (Ni ¼10).
Statistical analysis was performed using SPSS 20.0 (SPSS, Inc.,
USA). Data was subjected to one-way analysis of variance (ANOVA)
followed by Tukey's test. For statistically signicant differences,
P<0.05 was required. The results were presented as the
means ±S.E.M (standard error of the means).
3. Results
3.1. Non-specic immunity parameters and disease resistance
Head kidney macrophages respiratory burst (RB) activity of
macrophages was signicantly decreased in sh fed VO diets when
compared with the control (P<0.05) (Fig. 1a). No signicant dif-
ference in the serum lysozyme (LZM) activity was observed among
groups (P>0.05) (Fig. 1b). A signicant decrease in the alternative
complement pathway (ACP) activity was observed in large yellow
croaker fed FV or VO diets (P<0.05) (Fig. 1c). Moreover, a signi-
cant decrease of the disease resistance was found in large yellow
croaker fed FV or VO diets, which manifested in a signicantly
higher cumulative mortality rate (CMR) (P<0.05) (Fig. 1d).
However, there was no signicant difference of ACP activity and
CMR between sh fed FV and VO diets (P>0.05).
3.2. TLR-NF-
k
B signalling activation in adipose tissue
3.2.1. Q-PCR analyses for TLR-related genes expression
TLR-related genes expression in AT of large yellow croaker
indicated that TLR1, TLR3, TLR5, TLR9, TLR22 and MyD88 was all
signicantly increased when sh was fed with FV or VO diets
(P<0.05). The mRNA expression of TLR2 and TLR7 was signicantly
increased when sh was fed with VO diet. There was no signicant
difference of TLR2 and TLR7 mRNA expression between sh fed FO
and FV (P>0.05) (Fig. 2).
3.2.2. Western blot for NF-
k
B signalling protein expression in AT of
large yellow croaker
IKK
a
/
b
, p-IKK
a
/
b
,I
k
B
a
, p-I
k
B
a
, total p65 (t-p65) and nucleus p65
(n-p65) protein expression levels were determined by Western
blot. Data indicated that the ratio of p-IKK
a
/
b
to IKK
a
/
b
, and p-I
k
B
a
to I
k
B
a
was signicantly increased in the AT of large yellow croaker
when sh was fed FV or VO diets (P<0.05). Ratio of n-p65 to t-p65
was signicantly increased in the AT of large yellow croaker when
sh was fed with VO diet (P<0.05). No signicant difference was
observed among IKK
a
/
b
,I
k
B
a
and t-p65 in all treatments (P>0.05)
(see Fig. 3).
3.3. Macrophage inltration and polarization in AT
3.3.1. Western blot analyses for macrophage inltration and
polarization marker proteins
Western blot analyses for macrophage inltration marker pro-
teins dcluster of differentiation 68 (CD68) dindicated that CD68
protein expression level was signicantly increased in AT of sh fed
VO (P<0.05). Similarity, macrophage inltration marker protein
colony stimulating factor 1 receptor (CSF-1R) protein expression
level was signicantly increased in AT of sh fed FV or VO diets
(P<0.05) (Fig. 4a). Moreover, the expression level of M2-type
macrophage marker protein, macrophage mannose receptor 1
(MRC1) was signicantly decreased in the AT of large yellow
croaker when fed VO diets (P<0.05) (Fig. 4a). Another M2-type
macrophage marker protein, cluster of differentiation 209
(CD209) was found signicantly increased in AT of sh fed with FV
or VO diets (P<0.05) (Fig. 4a).
3.3.2. Q-PCR analyses for M1-and M2-type macrophage-related
cytokine genes expression
Q-PCR analyses for anti-inammatory M1 macrophage marker
Table 3
Primers used in this study.
Primer names Forward primer sequence (5
0
to 3
0
)Tm(
C) Fragment(bp) PCR efciency(%)
L-TLR1-F/R TGTGCCACCGTTTGGATA/TTCAGGGCGAACTTGTCG 57 95 99
L-TLR2-F/R TCTGCTGGTGTCAGAGGTCA/GGTGAATCCGCCATAGGA 57 98 98
L-TLR3-F/R ACTTAGCCCGTTTGTGGAAG/CCAGGCTTAGTTCACGGAGG 58 159 102
L-TLR7-F/R ATGCAATGAGCCAAAGTCT/CATGTGAGTCAATCCCTCC 54 185 97
L-TLR9-F/R AACGGAGGTCACAGGAGG/TAGCACCACTGGACAGCAC 55 133 98
L-TLR13-F/R CCTCCTGTTTATGGTAGTGTCC/GCTCGTCATGGGTGTTGTAG 56 161 98
L-TLR22-F/R TATGCGAGCAGGAAGACC/CAGAAACACCAGGATCAGC 54 132 96
L-MyD88-F/R TACGAAGCGACCAATAACCC/ATCAATCAAAGGCCGAAGAT 57 144 98
L-Arg I-F/R AACCACCCGCAGGATTACG/AAACTCACTGGCATCACCTCA 58 119 99
L-IL10-F/R AGTCGGTTACTTTCTGTGGTG/TGTATGACGCAATATGGTCTG 55 144 99
L-IL1
b
-F/R CATCTGGAGGCGGTGGAGGA/GGGACAGACCTGAGGGTGGT 57 119 100
L-TNF
a
-F/R CGTCGTTCAGAGTCTCCTGC/TGTACCACCCGTGTCCCACT 58 189 99
L-
b
actin-F/R GACCTGACAGACTACCTCATG/AGTTGAAGGTGGTCTCGTGGA 58 136 100
TLR: toll-like receptor, MyD88: myeloid differentiation factor 88, Arg I: arginase I, IL10: interleukin 10, IL1
b
: interleukin 1
b
, TNF
a
: tumour necrosis factor
a
.
P. Tan et al. / Fish & Shellsh Immunology 59 (2016) 398e405 401
genes indicated that in the AT of large yellow croaker fed VO diet,
the IL1
b
and TNF
a
expression levels were signicantly higher than
those of the control group (P<0.05), while no signicant difference
was found between FV and VO group (P>0.05) (Fig. 4b). Expression
level of M2 macrophage marker gene arginase I (Arg I) was
signicantly lower in the AT of large yellow croaker fed VO diet
(P<0.05). Besides, mRNA expression of Arg I expression level was
signicantly lower in AT of sh fed VO than fed FV (P<0.05)
(Fig. 4b). The mRNA expression level of IL10, another M2 macro-
phage marker gene, was found signicantly lower in AT of sh fed
FV or VO diets, but no signicant difference was observed between
FV and VO groups (P<0.05) (Fig. 4b).
4. Discussion
Nonspecic immunity and disease resistance were both
decreased when dietary sh oil was partially or totally replaced by
vegetable oil according to the ndings of extensive studies on
several sh species [4]. In this study, RB activity and ACP activity
were both signicantly decreased in large yellow croaker fed FV or
VO diets. Previous study demonstrated that n-3 LC-PUFA promoted
RB activity of macrophages in large yellow croaker [4]. Thus, the
decrease of RB in the present study could be partially due to the
scarce of n-3 LC-PUFA in vegetable oil. In the present study, content
of linoleic acid in diets increased with the increasing portion of
vegetable oil (Table 2). High proportion of linoleic acid was
conrmed to decreased the non-specic immunity parameters in
large yellow croaker [7], grouper (Epinephelus malabaricus) [28]
and Atlantic Salmon [29]. Therefore, the decrease of RB activity
and ACP activity may also due to the high content of linoleic acid in
diets.
AT is well known to regulate lipid homeostasis by storing excess
energy in the form of triglycerides for an extended period of time.
Recently, AT has been found to play an important role during the
immunity modulation [12]. Although the specic mechanism has
not been completely understood, available evidence indicated that
inammation affected by fatty acids in AT was mainly associated
with TLR-NF-
k
B signalling, macrophage inltration and polariza-
tion [30]. In mammals, toll-like receptor 4 (TLR4) was identied as a
receptor of fatty acids and a mediator of pro-inammatory cytokine
production by ATMs. Saturated fatty acids and linoleic acids have
been demonstrated to activate TLR4 and then mediate the pro-
duction of pro-inammatory cytokines in macrophages through
activating several serine kinases, such as I
k
B kinase [31e33].In
contrast, n-3 PUFA suppressed TLR4-mediated pro-inammatory
cytokine production in macrophages. For example, Lee et al. [34]
found that DHA suppressed NF-
k
B signalling by TLR4 in macro-
phage. In this study, the expression of TLRs and MyD88 in the AT of
large yellow croaker fed a FO diet was signicantly lower compared
to that fed FV and VO diets. In addition, the elevation ratio of p-IKK/
IKK, p-I
k
B/I
k
B, and n-p65/t-p65 in the AT of large yellow croaker
indicated the activation of NF-
k
B signalling by replacement of di-
etary FO with VO. These results indicated that the anti-
inammatory role of FO could be partially accomplished by sup-
pressing the activation of TLRs and downstream signalling in the AT
of large yellow croaker. The mechanism by which fatty acids
modulated TLRs and subsequent signalling was still not completely
elucidated. However, evidence suggested that n-3 LC-PUFA play a
role in preventing TLR4 translocation into lipid rafts, an initial event
that is involved in TLRs and subsequent NF-
k
B signalling [35].
Moreover, in a recent study, TLR4 recruitment into lipid rafts was
inhibited in rats from sh oil group rather than soybean oil (linoleic
acid rich) group [36]. Thus, it is speculated that FO rather than VO
disrupts the formation of the lipid raft and then suppresses TLRs-
NF-
k
B signalling in the AT of large yellow croaker.
Fig. 1. Non-specic immunity parameters and disease resistance in large yellow
croaker. Fig. 1a presents the head kidney macrophages respiratory burst activity. Data
is given in absorbance value detected under a 630-nm wave length. Fig. 1b indicates
the serum lysozyme activities associated with different dietary treatments. Fig. 1c
indicates the alternative complement pathway activity. Data is presented as ACH50.
Fig. 1d shows the cumulative mortality rate (CMR) in large yellow croaker after the
immune challenge with V. anguillarum for 7days. Values are the means ±S.E.M of three
replicates. Different letters assigned to the bars in each gure represent signicant
differences among the dietary treatments using Tukey's test (P<0.05). S.E.M.: stan-
dard error of the means.
P. Tan et al. / Fish & Shellsh Immunology 59 (2016) 398e405402
In this study, CSF1R and CD68 proteins, two marker proteins for
macrophages [14], were both enhanced in the AT of large yellow
croaker fed diets with partial or total VO. Notably, the expression of
macrophage marker proteins was positively correlated to that of
TLR-NF-
k
B activation in AT of large yellow croaker. This indicated
that TLR-NF-
k
B activation could induce the increased inltration of
macrophages into AT in sh species, just as the process in mammals
[4]. Chemokines, such as adipocyte-secreted monocyte chemotactic
protein 1 (MCP1), could exert the direct roles in recruiting macro-
phages into AT [37]. Deletion of the MCP1 gene reduced the accu-
mulation of macrophages while over-expression of the MCP1 gene
induced macrophage recruitment into AT [4]. Thus, TLR-NF-
k
B
signalling activation may promote production of chemokines,
which induces the inltration of macrophages into AT [38].
Inltration of ATMs was usually accompanied by the polariza-
tion of macrophages into different types. ATMs phenotypically
divided into two types of cells: classicalpro-inammatory M1-
type macrophagesand alternatively activatedanti-
inammatory M2-type macrophages. M1-type macrophages
signicantly contributed to the increased production of pro-
inammatory cytokines, such as TNF
a
and IL1
b
. M2-type macro-
phages were highly active in particle uptake, which was reected
by the expression of non-opsonic pathogen receptors such as MRC1
(or CD206) [39], and CD209 [40]. The M2-type macrophages pro-
duced anti-inammatory cytokines, such as IL10, IL4 and IL13,
which was marked by the expression of Arg I and several other
genes [34]. Polarization of macrophages was considered to be
related to their nutritional status such as dietary lipids, fatty acids
Fig. 2. TLR-related genes expression in AT of large yellow croaker. TLR-related genes expression of TLR1, TLR2, TLR3, TLR7, TLR9, TLR13, TLR22 and MyD88 are determined in the AT
of large yellow croaker fed different diets. Values are means ±S.E.M (n ¼3). Different letters assigned to the bars represent signicant differences using Tukey's test (P<0.05). TLR:
toll-like receptor; MyD88: myeloid differentiation factor 88; S.E.M.: stand error of the means.
Fig. 3. Western blot analyses for NF-
k
B signalling activation in the AT of large yellow croaker. The right panel features the ratio of p-IKK
a
/
b
to IKK
a
/
b
, p-I
k
BtoI
k
B and n-p65 to t-
p65. GAPDH and Lamin B are selected as total and nucleus reference proteins, respectively. Data are expressed as the A.U. of the Western blot and are depicted as a ratio of the target
protein to the reference protein. Values are the means ±S.E.M (n ¼3). Different letters assigned to the bars represent signicant differences using Tukey's test (P<0.05). NF-
k
B:
nuclear factor kappa beta; AT: adipose tissue; IKK
a
/
b
: inhibitor of IKK
a
/
b
kinase
a
/
b
; p-IKK
a
/
b
: phosphorylation inhibitor of nuclear factor kappa-B kinase
a
/
b
;I
k
B
a
: inhibitor of NF-
k
B
a
; p-I
k
B
a
: phosphorylation inhibitor of NF-
k
B
a
; t-p65: total p65; n-p65: nucleus p65; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
P. Tan et al. / Fish & Shellsh Immunology 59 (2016) 398e405 403
and lipid mediators [4]. In this study, cytokines (TNF
a
and IL1
b
)
from M1-type macrophages were signicantly increased in the AT
of large yellow croaker fed FV or VO diets compared to that in FO
diets. By contrast, M2-type macrophage marker proteins (MRC1
and CD209) and M2-type macrophage-related cytokines (IL10 and
Arg I) were both signicantly decreased in the AT of large yellow
croaker fed FV or VO diets. This indicated VO increased the polar-
ization of macrophages toward M1 ATMs in AT of large yellow
croaker. This nding was in accordant with nding in a rat model,
in which mRNA expression of M1 type macrophage inltration
marker gene (F4/80) was signicantly higher in rat fed diet with
soybean oil inclusion than the control group. Besides, diet with
soybean oil inclusion resulted in the over expression of pro-
inammatory cytokines, such as TNF
a
and IL6, but reduced the
expression of anti-inammatory cytokine IL10 [33]. In contrast,
studies indicated that DHA specically enhanced anti-
inammatory IL-10 secretion and reduced the expression of pro-
inammatory M1 macrophages [41]. The polarization of ATMs
was toward M1 ATMs in mice fed a high fat diet, while toward M2
ATMs in obese mice fed diets with n-3 PUFA. Coincidentally, a
recent investigation focused on fatty acids in the murine adipocyte
macrophage co-culture model and showed that DHA decreased
mRNA expression of M1 type ATMs polarization markers while
increasing anti-inammatory cytokines [42]. Thus, it is the rela-
tively higher amount of n-3 LC-PUFA that account for the low po-
larization rate toward M1 ATMs and low pro-inammatory
response in AT of large yellow croaker fed the FO diet. The relative
high content of linoleic acids in FV and VO diets lead to the relative
high polarization rate toward M1 ATMs and relative high pro-
inammatory response in AT.
5. Conclusion
Dietary VO decreased the non-specic immunity and disease
resistance in large yellow croaker. VO could increase expression of
pro-inammatory cytokine which may results from the activation
of TLR-NF-
k
B signalling, increase of macrophage inltration into AT
and macrophage polarization to M1 type ATMs.
Acknowledgements
This work was supported by the National Science Fund for
Distinguished Young Scholars of China [grant number: 31525024],
the National Natural Science Foundation of China grants [grant
number: 31372541, 31172425] and the Scientic and Technological
Innovation Project from Laboratory for Marine Fisheries and
Aquaculture nancially supported by Qingdao National Laboratory
for Marine Science and Technology [grant number: 2015ASKJ02]
and AoShan Talents Program [grant number: 2015ASTP]. We thank
H.L. Xu, J.Q. Li, W. Ren and K. Cui for their assistance in feeding trials
and Dr. D.D. Xu for her skillful technical assistance in Western blot
analyses. Thanks are also due to X.J. Xiang and B. Yang for their help
during the experiment.
References
[1] M.J. Leaver, J.M. Bautista, B.T. Bj
ornsson, E. J
onsson, G. Krey, D.R. Tocher, et al.,
Towards sh lipid nutrigenomics: current state and prospects for n-sh
aquaculture, Rev. Fish. Sci. 16 (2008) 73e94.
[2] D. Montero, T. Kalinowski, A. Obach, L. Robaina, L. Tort, M.J. Caballero, et al.,
Vegetable lipid sources for gilthead seabream (Sparus aurata): effects on sh
health, Aquaculture 225 (2003) 353e370.
[3] D. Montero, V. Grasso, M. Izquierdo, R. Ganga, F. Real, L. Tort, et al., Total
substitution of sh oil by vegetable oils in gilthead sea bream (Sparus aurata)
diets: effects on hepatic Mx expression and some immune parameters, Fish
shellsh Immunol. 24 (2008) 147e155.
[4] !!! INVALID CITATION !!!.
[5] R. Zuo, K. Mai, W. Xu, G.M. Turchini, Q. Ai, Dietary ALA, but not LNA, increase
growth, reduce inammatory processes, and increase anti-oxidant capacity in
the marine nsh Larimichthys crocea, Lipids 50 (2015) 149e163.
[6] D. Montero, V. Benitez-Dorta, M.J. Caballero, M. Ponce, S. Torrecillas,
M. Izquierdo, et al., Dietary vegetable oils: effects on the expression of
immune-related genes in Senegalese sole (Solea senegalensis) intestine, Fish
shellsh Immunol. 44 (2015) 100e108.
[7] R. Zuo, K. Mai, W. Xu, G.M. Turchini, Q. Ai, Dietary ALA, but not LNA, increase
growth, reduce inammatory processes, and increase anti-oxidant capacity in
the marine nsh Larimichthys crocea, Lipids (2014) 1e15.
[8] P.C. Calder, Marine omega-3 fatty acids and inammatory processes: effects,
mechanisms and clinical relevance, Biochimica Biophysica Acta (BBA)-Mo-
lecular Cell Biol. Lipids 1851 (2015) 469e484.
[9] R. Zuo, Q. Ai, K. Mai, W. Xu, J. Wang, H. Xu, et al., Effects of dietary n-3 highly
unsaturated fatty acids on growth, nonspecic immunity, expression of some
immune related genes and disease resistance of large yellow croaker (Lar-
michthys crocea) following natural infestation of parasites (Cryptocaryon
irritans), Fish shellsh Immunol. 32 (2012) 249e258.
[10] L. Martinez-Rubio, S. Morais, Ø. Evensen, S. Wadsworth, K. Ruohonen,
J.L. Vecino, et al., Functional feeds reduce heart inammation and pathology in
Atlantic salmon (Salmo salar L.) following experimental challenge with
Atlantic salmon reovirus (ASRV), PloS one 7 (2012) e40266.
[11] H. Xu, G.T. Barnes, Q. Yang, G. Tan, D. Yang, C.J. Chou, et al., Chronic inam-
mation in fat plays a crucial role in the development of obesity-related insulin
resistance, J. Clin. Invistig. 112 (2003) 1821e1830.
[12] C.N. Lumeng, J.L. Bodzin, A.R. Saltiel, Obesity induces a phenotypic switch in
adipose tissue macrophage polarization, J. Clin. Invistig. 117 (2007) 175e184.
[13] K.R. Coenen, M.L. Gruen, A. Chait, A.H. Hasty, Diet-induced increases in
adiposity, but not plasma lipids, promote macrophage inltration into white
adipose tissue, Diabetes 56 (2007) 564e573.
[14] S.P. Weisberg, D. McCann, M. Desai, M. Rosenbaum, R.L. Leibel, A.W. Ferrante,
Obesity is associated with macrophage accumulation in adipose tissue, J. Clin.
Invistig. 112 (2003) 1796e1808.
[15] J. Todoric, M. L
ofer, J. Huber, M. Bilban, M. Reimers, A. Kadl, et al., Adipose
Fig. 4. Analyses of macrophage inltration and polarization marker proteins and
cytokine gene expression in AT. Western blot analyses of macrophage inltration and
proliferation marker proteins, namely, CSF1R, CD68, MRC1 and CD209, in the AT of
large yellow croaker when fed FO, FV and VO diets are shown in Fig. 4a. The left panel
of Fig. 4a presents the Western blot image of target proteins. The right panel of Fig. 4a
presents the ratio of target proteins to Na
þ
-K
þ
-ATPase. Q-PCR analyses for cytokine
genes (TNF
a
and IL1
b
) expressed by M1 macrophage and cytokine genes (Arg I and
IL10) expressed by M2 macrophages in the AT of large yellow croaker when fed FO, FV
and VO diets are presented in Fig. 4b. Values are means ±S.E.M (n ¼3). Different
letters assigned to the bars represent signicant differences using Tukey's test
(P<0.05). CSF1R: colony stimulating factor 1 receptor; CD68: cluster of differentiation
68; MRC1: macrophage mannose receptor 1; CD209: cluster of differentiation 209;
IL1
b
: interleukin 1
b
; TNF
a
: tumour necrosis factor
a
; Arg I: arginase I; IL10: interleukin
10; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
P. Tan et al. / Fish & Shellsh Immunology 59 (2016) 398e405404
tissue inammation induced by high-fat diet in obese diabetic mice is pre-
vented by n3 polyunsaturated fatty acids, Diabetologia 49 (2006)
2109e2119.
[16] V. Saraswathi, L. Gao, J.D. Morrow, A. Chait, K.D. Niswender, A.H. Hasty, Fish
oil increases cholesterol storage in white adipose tissue with concomitant
decreases in inammation, hepatic steatosis, and atherosclerosis in mice,
J. Nutr. 137 (2007) 1776e1782.
[17] A.A. De Boer, J.M. Monk, L.E. Robinson, Docosahexaenoic acid decreases pro-
inammatory mediators in an in vitro murine adipocyte macrophage co-
culture model, PloS one 9 (2014) e85037.
[18] D. Montero, F. Mathlouthi, L. Tort, J.M. Afonso, S. Torrecillas, A. Fernandez-
Vaquero, et al., Replacement of dietary sh oil by vegetable oils affects hu-
moral immunity and expression of pro-inammatory cytokines genes in
gilthead sea bream Sparus aurata, Fish shellsh Immunol. 29 (2010)
1073e1081.
[19] S.L. Seierstad, Ø. Haugland, S. Larsen, R. Waagbø, Ø. Evensen, Pro-inamma-
tory cytokine expression and respiratory burst activity following replacement
of sh oil with rapeseed oil in the feed for Atlantic salmon (Salmo salar L.),
Aquaculture 289 (2009) 212e218.
[20] X. Dong, Comparision Study on Regulation of Delta 6 Fatty Acyl Desaturase
Among Rainboe Trout, Japanese Seabass and Large Yellow Croaker, Ocean
University of China, Qingdao: Qingdao Shandong, 2015.
[21] C.J. Secombes, Isolation of salmonid macrophages and analysis of their killing
activity, Tech. sh Immunol. 1 (1990) 137e154.
[22] A.E. Ellis, Lysozyme assays, Tech. sh Immunol. 1 (1990) 101e103.
[23] Q. Ai, K. Mai, L. Zhang, B. Tan, W. Zhang, W. Xu, et al., Effects of dietary
b
-1, 3
glucan on innate immune response of large yellow croaker, Pseudosciaena
crocea, Fish Shellsh Immunol. 22 (2007) 394e402.
[24] B. Ching, S. Jamieson, J. Heath, D. Heath, A. Hubberstey, Transcriptional dif-
ferences between triploid and diploid Chinook salmon (Oncorhynchus tsha-
wytscha) during live Vibrio anguillarum challenge, Heredity 104 (2010)
224e234.
[25] R. Zuo, Q. Ai, K. Mai, W. Xu, J. Wang, H. Xu, et al., Effects of dietary docosa-
hexaenoic to eicosapentaenoic acid ratio (DHA/EPA) on growth, nonspecic
immunity, expression of some immune related genes and disease resistance
of large yellow croaker (Larmichthys crocea) following natural infestation of
parasites (Cryptocaryon irritans), Aquaculture 334e337 (2012) 101e109.
[26] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using
real-time quantitative PCR and the 2
DD
CT
method, methods 25 (2001)
402e408.
[27] D. Xu, G. He, K. Mai, H. Zhou, W. Xu, F. Song, Postprandial nutrient-sensing
and metabolic responses after partial dietary shmeal replacement by soya-
bean meal in turbot (Scophthalmus maximus L.), Br. J. Nutr. 115 (2016)
379e388.
[28] F.-C. Wu, H.-Y. Chen, Effects of dietary linolenic acid to linoleic acid ratio on
growth, tissue fatty acid prole and immune response of the juvenile grouper
Epinephelus malabaricus, Aquaculture 324e325 (2012) 111e117.
[29] I.K. Petropoulos, K.D. Thompson, A. Morgan, J.R. Dick, D.R. Tocher, J. G Bell,
Effects of substitution of dietary sh oil with a blend of vegetable oils on liver
and peripheral blood leucocyte fatty acid composition, plasma prostaglandin
E2and immune parameters in three strains of Atlantic salmon (Salmo salar),
Aquac. Nutr. 15 (2009) 596e607.
[30] M. Masoodi, O. Kuda, M. Rossmeisl, P. Flachs, J. Kopecky, Lipid signaling in
adipose tissue: connecting inammation &metabolism, Biochimica Bio-
physica Acta (BBA)-Molecular Cell Biol. Lipids 1851 (2015) 503e518.
[31] S. Shoelson, J. Lee, M. Yuan, Inammation and the IKKß/I? B/NF-? B axis in
obesity-and diet-induced insulin resistance, Int. J. Obes. Relat. Metabolic
Disord. 27 (2003).
[32] H. Shi, M.V. Kokoeva, K. Inouye, I. Tzameli, H. Yin, J.S. Flier, TLR4 links innate
immunity and fatty acideinduced insulin resistance, J. Clin. Invistig. 116
(2006) 3015e3025.
[33] X. Wang, Differential effects of high-fat-diet rich in lard oil or soybean oil on
osteopontin expression and inammation of adipose tissue in diet-induced
obese rats, Eur. J. Nutr. 52 (2013) 1181e1189.
[34] J.Y. Lee, J. Ye, Z. Gao, H.S. Youn, W.H. Lee, L. Zhao, et al., Reciprocal modulation
of Toll-like receptor-4 signaling pathways involving MyD88 and phosphati-
dylinositol 3-kinase/AKT by saturated and polyunsaturated fatty acids, J. Biol.
Chem. 278 (2003) 37041e37051.
[35] S.W. Wong, M.-J. Kwon, A.M. Choi, H.-P. Kim, K. Nakahira, D.H. Hwang, Fatty
acids modulate Toll-like receptor 4 activation through regulation of receptor
dimerization and recruitment into lipid rafts in a reactive oxygen species-
dependent manner, J. Biol. Chem. 284 (2009) 27384e27392.
[36] K. Kim, N. Jung, K. Lee, J. Choi, S. Kim, J. Jun, et al., Dietary omega-3 poly-
unsaturated fatty acids attenuate hepatic ischemia/reperfusion injury in rats
by modulating toll-like receptor recruitment into lipid rafts, Clin. Nutr. 32
(2013) 855e862.
[37] J.K. Olson, S.D. Miller, Microglia initiate central nervous system innate and
adaptive immune responses through multiple TLRs, J. Immunol. 173 (2004)
3916e3924.
[38] T. Suganami, K. Tanimoto-Koyama, J. Nishida, M. Itoh, X. Yuan, S. Mizuarai, et
al., Role of the Toll-like receptor 4/NF-
k
B pathway in saturated fatty acid-
einduced inammatory changes in the interaction between adipocytes and
macrophages, Arterioscler., thromb., Vasc. Biol. 27 (2007) 84e91.
[39] M. Stein, S. Keshav, N. Harris, S. Gordon, Interleukin 4 potently enhances
murine macrophage mannose receptor activity: a marker of alternative
immunologic macrophage activation, J. Exp. Med. 176 (1992) 287e292.
[40] T.B. Geijtenbeek, R. Torensma, S.J. van Vliet, G.C. van Duijnhoven, G.J. Adema,
Y. van Kooyk, et al., Identication of DC-SIGN, a novel dendritic cellespecic
ICAM-3 receptor that supports primary immune responses, Cell 100 (2000)
575e585.
[41] E. Oliver, F.C. McGillicuddy, K.A. Harford, C.M. Reynolds, C.M. Phillips,
J.F. Ferguson, et al., Docosahexaenoic acid attenuates macrophage-induced
inammation and improves insulin sensitivity in adipocytes-specic differ-
ential effects between LC n-3 PUFA, J. Nutr. Biochem. 23 (2012) 1192e1200.
[42] A.A. De Boer, J.M. Monk, L.E. Robinson, Docosahexaenoic acid decreases pro-
inammatory mediators in an in vitro murine adipocyte macrophage co-
culture model, PloS one 9 (2014) e85037.
P. Tan et al. / Fish & Shellsh Immunology 59 (2016) 398e405 405
... Among all the fish-specific TLRs, TLR22 is widely explored as the typical member in many fish species [15][16][17][18]. Previous studies on large yellow croaker (Larimichthys crocea) have revealed that TLR22 could respond to fatty acids [19,20]. However, the role and downstream regulation mechanism of TLR22 in the PA-induced inflammatory response remain unclear in fish. ...
... One of mechanisms by which the innate immune system senses stimulation is through TLR signaling. As the TLR family in teleost was different from that in mammals, the change of TLR-related genes in large yellow croaker was detected according to a previous study [19]. The results showed that PA significantly activated the expressions of TLRs and adaptor proteins. ...
Article
Full-text available
Palmitic acid (PA) is a saturated fatty acid (SFA) that can cause an inflammatory response, while docosahexaenoic acid (DHA) is always used as a nutritional modulator due to its anti-inflammatory properties. However, the potential molecular mechanism is still not completely elucidated in fish. Herein, the PA treatment induced an inflammatory response in macrophages of large yellow croaker (Larimichthys crocea). Meanwhile, the mRNA expression of Toll-like receptor (TLR)-related genes, especially tlr22, and the phosphorylation of the mitogen-activated protein kinase (MAPK) pathway were significantly upregulated by PA. Further investigation found that the PA-induced inflammatory response was suppressed by tlr22 knockdown and MAPK inhibitors. Moreover, the results of the peroxisome proliferator-activated receptor γ (PPARγ) agonist and inhibitor treatment proved that PPARγ was involved in the PA-induced inflammation. PA treatment decreased the protein expression of PPARγ, while tlr22 knockdown and MAPK inhibitors recovered the decreased expression. Besides, the PA-induced activation of Nrf2 was regulated by p38 MAPK. Furthermore, DHA-executed anti-inflammatory effects by regulating the phosphorylation of the MAPK pathway and expressions of PPARγ and Nrf2. Overall, the present study revealed that DHA alleviated PA-induced inflammation in macrophages via the TLR22-MAPK-PPARγ/Nrf2 pathway. These results could advance the understanding of the molecular mechanism of the SFA-induced inflammatory response and provide nutritional mitigative strategies.
... Excessive lipid deposition in the hepatic tissue can lead to hepatic injury and a proinflammatory response [46,47]. Hepatic injury normally correlates with increased serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. ...
... Our previous results showed that vegetable oil could induce proinflammatory response through the nuclear factor-kappa B (NF-κB) pathway [47,48]. In agreement, the SO diet significantly increased the expression of proinflammatory genes, such as the csf1r, tlr1, tnfrs11b, and il20ra. ...
Article
Full-text available
In this study, we fed yellow drum juveniles (initial body weigh 5.57 ± 0.03 g) a fish-oil-based, soybean-oil-based (SO), or berberine chloride (BBR 50 mg kg-1 in a SO-based diet) diet with three replicates of each treatment for 56 days. Dietary BBR supplementation significantly increased growth performance but decreased SO-induced viscerosomatic index and condition factor increases. Hepatic tissue Oil Red O staining indicated that BBR supplementation completely compensated for the SO-induced excessive lipid deposition. BBR supplementation resulted in a significant decrease in saturated fatty acids but a significant increase in the proportion of n-6 polyunsaturated fatty acids in hepatic tissue. RNA sequencing revealed that amelioration of hepatic lipid deposition by BBR supplementation could be attributed to an increase in fatty acid β-oxidation. Dietary BBR also decreased the SO-induced proinflammatory gene expression, characterized by the suppression of cytokine–cytokine receptor interaction pathway. Collectively, our findings demonstrated the beneficial effects of dietary BBR on growth performance, hepatic lipid deposition, and proinflammatory gene expression. The amelioration of hepatic lipid deposition by BBR is likely caused by an increase in fatty acid β-oxidation, which promotes energy production for body growth.
... An additional consideration arises from the well demonstrated effect that anti-inflammatory cytokines, such as TGF-b, have on the inhibition of the production of proinflammatory cytokines, thereby suppressing the inflammatory response in teleost (85). In fact, a diametral opposite variation between the expression of anti-inflammatory and proinflammatory cytokines has been reported in some teleosts (86)(87)(88). Consistently, in the present study, the expression of anti-inflammatory cytokines TGF-b and IL-10 was significantly increased with the inclusion of protein hydrolysates. A possible driver for this observed increased expression of IL-10 could be linked to the increasingly higher content of free glycine in groups with higher protein hydrolysates inclusion, and glycine has been reported, in mammals, to possesses the ability to promote IL-10 expression and consequently reduce inflammatory response (89). ...
Article
Full-text available
The present study was conducted to investigate the effects of dietary inclusion of protein hydrolysates on growth performance, digestive enzyme activities, protein metabolism, and intestinal health in larval largemouth bass ( Micropterus salmoides ). The experimental feeding trial presented in this study was based on five isonitrogenous and isolipidic diets formulated with graded inclusion levels of protein hydrolysates, and it showed that protein hydrolysates improved growth performance, reduced larval deformity rate, and increased the activity of digestive enzymes, including pepsin and trypsin. Gene expression results revealed that the supplementation of protein hydrolysates upregulated the expression of intestinal amino acid transporters LAT2 and peptide transporter 2 (PepT2), as well as the amino acid transporters LAT1 in muscle. Dietary provision of protein hydrolysates activated the target of rapamycin (TOR) pathway including the up-regulation of TOR and AKT1, and down-regulation of 4EBP1. Additionally, the expression of genes involved in the amino acids response (AAR) pathway, ATF4 and REDD1, were inhibited. Protein hydrolysates inhibited the transcription of some pro-inflammatory cytokines, including IL-8 and 5-LOX, but promoted the expression of anti-inflammatory cytokines TGF-β and IL-10. The 16S rRNA analysis, using V3-V4 region, indicated that dietary protein hydrolysates supplementation reduced the diversity of the intestine microbial community, increased the enrichment of Plesiomonas and reduced the enrichment of Staphylococcus at the genus level. In summary, protein hydrolysates have been shown to be an active and useful supplement to positively complement other protein sources in the diets for largemouth bass larvae, and this study provided novel insights on the beneficial roles and possible mechanisms of action of dietary protein hydrolysates in improving the overall performance of fish larvae.
... Primer sequences for neuropeptide Y (npy), cocaine-and amphetamine-regulated transcript (cart), proopiomelanocortin (pomc), ghrelin, and stearoyl-CoA desaturase 1 (scd1) were designed and synthesized according to published sequences in GenBank ( Table 4). The primers for β-actin, fatty acid synthetase (fas), sterol regulatory element-binding protein 1 (srebp-1), carnitine palmitoyl transferase 1 (cpt-1), peroxisome proliferator-activated receptor (pparα), adipose triglyceride lipase (atgl), diacylglycerol acyltransferase 2 (dgat2), acetyl CoA carboxylase 1 (acc1), and acyl-CoA oxidase (aco) were directly synthesized according to corresponding sequences in published papers [22,[26][27][28][29] (Table 4). The real-time quantitative PCR program was 95°C for 2 min, followed by 40 cycles of 95°C for 10 s, 58°C for 10 s, and 72°C for 20 s. ...
Article
Full-text available
The study of lipid nutrition is an important guarantee for the development of high-efficiency artificial microdiet for fish larvae. Existing studies on lipid nutrition of larvae mainly focus on nutrient requirements and metabolism through a single lipid source. However, there are few reports on the effects of different marine-based lipid sources on fish larvae. In this study, a 30-day feeding experiment was conducted to evaluate the effects of different dietary marine-based lipid sources on survival, growth performance, appetite gene expression, activities of digestive enzyme, antioxidant responses, and lipid metabolism of large yellow croaker (Larimichthys crocea) larvae (initial weight 4.71±0.21 mg). Four isonitrogenous (520 g/kg crude protein) and isolipidic (190 g/kg crude lipid) diets were formulated to contain fish oil (FO), krill oil (KO), squid viscera oil (SVO), and Schizochytrium sp. oil (SSO), respectively. Results showed that larvae fed with the SSO diet had significantly higher survival rate (SR) than those fed with dietary FO and SVO (P<0.05). However, larvae fed with the SSO diet had significantly lower final body weight (FBW) and specific growth rate (SGR) than those fed with other diets (P<0.05). Furthermore, larvae fed with the SSO diet had significantly higher percentage of total n-3 long-chain polyunsaturated fatty acids (LC-PUFA) than those fed with other diets, followed by KO and SVO diets (P<0.05). Larvae fed with the SSO diet had significantly lower mRNA expression of orexigenic genes (npy and ghrelin) and significantly higher mRNA expression of anorexigenic gene (cart) than those fed with dietary FO (P<0.05). Meanwhile, larvae fed with the SSO diet had significantly higher activity of alkaline phosphatase (AKP) in intestinal segments (IS) and brush border membrane (BBM) than those fed with dietary FO and SVO (P<0.05). Larvae fed with the SSO diet had significantly higher activity of total antioxidant capacity (T-AOC) than those fed with dietary FO (P<0.05). The TG content and mRNA expression of lipogenesis genes (srebp-1c, fas, and scd1) were markedly lower in larvae fed with SSO, KO, and SVO diets than in those fed with dietary FO (P<0.05). Meanwhile, larvae fed with KO and SSO diets had significantly higher mRNA expression of the lipolysis gene (cpt-1) than those fed with other diets (P<0.05). In conclusion, results of the present study showed that FO can be completely replaced in large yellow croaker larvae feed with KO and SVO without negative effects. Moreover, the complete replacement of FO by SSO can improve survival, activities of digestive enzyme, antioxidant responses, and lipid metabolism, despite inhibiting the appetite and growth of large yellow croaker larvae.
... Intestinal ACP activity and serum C3 level had a marked increase in groups S3 compared to the group SO (P < 0.05) ( Figure 2I). We previously verified that dietary SO induced inflammation through TLRs activation (31). In this study, relative to the group SO, octanoate supplementation lowered the relative mRNA expression of TLRs-related genes (tlr1, tlr2, tlr3, tlr7, tlr9, tlr13, tlr22, and myd88) in group S2 ( Figure 2J). ...
Article
Full-text available
Octanoate is a type of classical medium-chain fatty acids, which is widely used to treat neurological and metabolic syndrome. However, the specific role of octanoate in repairing intestinal health impairment is currently unknown. Therefore, we investigated whether dietary octanoate repaired the intestinal damage induced by surplus soybean oil in Larimichthys crocea. In this study, dietary octanoate alleviated abnormal morphology of the intestine and enhanced expression of ZO-1 and ZO-2 to improve intestinal physical barrier. Further, dietary octanoate increased antioxidant enzymic activities and decreased the level of ROS to alleviate the intestinal oxidative stress. Dietary octanoate also attenuated the expression of proinflammatory cytokines and the polarity of macrophage to reduce the intestinal inflammatory response. Moreover, the result of intestinal microbial 16S rRNA sequence showed that dietary octanoate repaired the intestinal mucosal microbial dysbiosis, and increased the relative abundance of Lactobacillus. Dietary octanoate supplementation also increased the level of acetic acid in intestinal content and serum through increasing the abundance of acetate-producing strains. Overall, in Larimichthys crocea, dietary octanoate might alleviated oxidative stress, inflammatory response and microbial dysbiosis to repair the intestinal damage induced by surplus soybean oil. This work provides vital insights into the underlying mechanisms and treatment strategies for intestinal damage in vertebrates.
... CD209 is a Ca 2+ -independent C-type lectin-like receptor that recognizes a wide range of pathogens (e.g., viruses, bacteria, and parasites) and participates in activating T and B lymphocytes (135). CD209 has been reported as a marker for anti-inflammatory M2 macrophages, in large yellow croaker (136). MXRA5 has antiinflammatory and anti-fibrotic properties in mammals (137). ...
Article
Full-text available
Gill damage represents a significant challenge in the teleost fish aquaculture industry globally, due to the gill’s involvement in several vital functions and direct contact with the surrounding environment. To examine the local and systemic effects accompanying gill damage (which is likely to negatively affect gill function) of Atlantic salmon, we performed a field sampling to collect gill and liver tissue after several environmental insults (e.g., harmful algal blooms). Before sampling, gills were visually inspected and gill damage was scored; gill scores were assigned from pristine [gill score 0 (GS0)] to severely damaged gills (GS3). Using a 44K salmonid microarray platform, we aimed to compare the transcriptomes of pristine and moderately damaged (i.e., GS2) gill tissue. Rank Products analysis (5% percentage of false-positives) identified 254 and 34 upregulated and downregulated probes, respectively, in GS2 compared with GS0. Differentially expressed probes represented genes associated with functions including gill remodeling, wound healing, and stress and immune responses. We performed gill and liver qPCR for all four gill damage scores using microarray-identified and other damage-associated biomarker genes. Transcripts related to wound healing (e.g., neb and klhl41b) were significantly upregulated in GS2 compared with GS0 in the gills. Also, transcripts associated with immune and stress-relevant pathways were dysregulated (e.g., downregulation of snaclec 1-like and upregulation of igkv3) in GS2 compared with GS0 gills. The livers of salmon with moderate gill damage (i.e., GS2) showed significant upregulation of transcripts related to wound healing (i.e., chtop), apoptosis (e.g., bnip3l), blood coagulation (e.g., f2 and serpind1b), transcription regulation (i.e., pparg), and stress-responses (e.g., cyp3a27) compared with livers of GS0 fish. We performed principal component analysis (PCA) using transcript levels for gill and liver separately. The gill PCA showed that PC1 significantly separated GS2 from all other gill scores. The genes contributing most to this separation were pgam2, des, neb, tnnt2, and myom1. The liver PCA showed that PC1 significantly separated GS2 from GS0; levels of hsp70, cyp3a27, pparg, chtop, and serpind1b were the highest contributors to this separation. Also, hepatic acute phase biomarkers (e.g., serpind1b and f2) were positively correlated to each other and to gill damage. Gill damage-responsive biomarker genes and associated qPCR assays arising from this study will be valuable in future research aimed at developing therapeutic diets to improve farmed salmon welfare.
... Consistently, Tan et al. (2016) identified this phenomenon in large yellow croaker (Larimichthys crocea). The addition of dietary VO increases the expression of the two pro-inflammatory cytokines, also studied in gilthead sea bream, and reduces those of anti-inflammatory cytokines in the adipose tissue (Fig. 23.11). ...
Chapter
Lipids are vital. This chapter focuses on recent biomolecular progress in dietary lipid with farmed invertebrates and fishes as well as ecological model organisms. Deficient or excess levels of lipids aggravate disease/pathogen susceptibility; modes of action are sketched and discussed in depth in Chap. 24. First indications point out that different lipid doses trigger different pathways; whether this notion is generalizable remains to be elucidated. The role of lipids as elicitor of biomolecular regulatory pathways of digestion, immunity, and disease resistance is beginning to be understood. First inventories of intestinal microbiota in fishes on different lipidic diets show there might be a potential of probiotic modulation. High-fat diets (HFD) can compromise the immune response by influencing the physical properties of immune cell membranes, membrane-associated signaling molecules, and receptor sites. HFDs combined with high dietary carbohydrates emerge as risky diet, since it upregulates disproportionately large numbers of genes associated with mitochondrial metabolism, neurodegenerative diseases, and liver dysfunction. The involvement of epigenetic pathways in lipid metabolism is beginning to be detected: Dietary fat does not influence growth in a given species but alters hepatic expression of miRNAs and genes related to lipid metabolism causing severe lipid deposition. HFDs induce a fatty liver, which blocks the TCA cycle, disrupts protein and carbohydrate metabolism, and results in reduced growth. Moreover, with “enteroendocrine cells silencing” by HFD via gut microbiota modulation, a new mechanism of nutrient sensing and signaling is detected that might serve as basis for new probiotic HFD treatments.
Article
This study was conducted to investigate the effects and regulation of dietary vegetable oil (VO, enriched with α-linolenic acid [ALA] and linoleic acid [LNA]) on the nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB) pathways in large yellow croaker. In vivo study showed that the VO diet significantly decreased the activity of antioxidant enzymes and antioxidant enzyme-related mRNA expression in the liver tissue, in comparison with the fish oil (FO) diet (P < 0.05). The suppression of antioxidant capacity might be due to the decrease of nuclear Nrf2 protein translocation, Nrf2 binding to antioxidant response element (ARE) sequences, and subsequently, antioxidant genes transcription as electrophoretic mobility shift assay (EMSA) and luciferase assay showed. VO-derivated ALA and LNA exerted a lower antioxidant capacity than FO-derivated DHA and EPA, characterized by significantly lower nucleus Nfr2 protein expression but significantly higher ROS production values in primary hepatocytes (P < 0.05). The pro-inflammatory genes (tumor necrosis factor α [TNFα] and interleukin 1β [IL1β]) expression was significantly higher in the liver tissue of fish fed the VO diet which might be due to the activation of the NF-κB pathway (P < 0.05). Knockdown of the Nrf2 gene negatively affected the anti-inflammatory effect of fatty acids by increasing the expression of TNFα and the IL1β gene and nuclear p65 protein (P < 0.05). In general, the results indicated that dietary vegetable oil decreased antioxidant capacity but induced inflammatory responses through the Nrf2/NF-κB pathway.
Article
LPCAT3, a subtype of lysophosphatidylcholine acyltransferases, is a key enzyme in phosphatidylcholine remodeling pathway and plays a significant role in mediating inflammatory response in mammals. However, its inflammatory function in fish has yet to be discovered. Herein, this study aimed to investigate its role in inflammation in Larimichthys crocea. We analyzed the coding sequence of Larimichthys crocea LPCAT3 (Lc-LPCAT3) and explored the effect of Lc-LPCAT3 on palmitate (PA)-induced inflammation. We found that in macrophage cell line of Larimichthys crocea, the mRNA expression of Lc-lpcat3 was upregulated by PA with the elevated pro-inflammatory genes expression, including il1β, il6, il8, tnfα and ifnγ. Next, the role of Lc-LPCAT3 in inflammation induced by PA was further investigated. Results showed that knockdown of Lc-LPCAT3 mitigated PA-induced pro-inflammatory genes mRNA expression, including il1β, il8, tnfα and ifnγ, in which JNK signaling pathway was involved. In contrast, overexpression of Lc-LPCAT3 induced pro-inflammatory genes expression including il1β, tnfα and ifnγ. Furthermore, several transcription factors with negative regulation of Lc-LPCAT3 promoter activity were discovered including LXRα, RXRα, PPARα, PPARγ, CEBPα, CEBPβ, CEBPδ, SREBP1 and SREBP2, and SREBP1 had the strongest regulatory effect. In conclusion, we first discovered that fish LPCAT3 participated in PA-induced inflammation, and targeting SREBP1 might be an effective coping strategy.
Article
Full-text available
While the beneficial roles of dietary phospholipids on health status and overall performances of fish larvae have been well demonstrated, the underlying mechanisms remain unclear. To address this gap, the present study was conducted to investigate the effects of dietary phospholipids on growth performance, intestinal development, immune response and microbiota of larval largemouth bass ( Micropterus salmoides ). Five isonitrogenous and isolipidic micro-diets were formulated to contain graded inclusion levels of phospholipids (1.69, 3.11, 5.23, 7.43 and 9.29%). Results showed that the supplementation of dietary phospholipids linearly improved the growth performance of largemouth bass larvae. The inclusion of dietary phospholipids increased the activity of digestive enzymes, such as lipase, trypsin and alkaline phosphatase, and promoted the expression of tight junction proteins including ZO-1, claudin-4 and claudin-5. Additionally, dietary phospholipids inclusion alleviated the accumulation of intestinal triacylglycerols, and further elevated the activity of lysozyme. Dietary phospholipids inhibited the transcription of some pro-inflammatory cytokines, including il-1β , and tnf-α , but promoted the expression of anti-inflammatory cytokines tgf-β , with these modifications being suggested to be mediated by the p38MAPK/Nf-κB pathway. The analysis of bacterial 16S rRNA V3-4 region indicated that the intestinal microbiota profile was significantly altered at the genus level with dietary phospholipids inclusion, including a decreased richness of pathogenic bacteria genera Klebsiella in larval intestine. In summary, it was showed that largemouth bass larvae have a specific requirement for dietary phospholipids, and this study provided novel insights on how dietary phospholipids supplementation contributes to improving the growth performance, digestive tract development and intestinal health.
Article
Full-text available
Contact between dendritic cells (DC) and resting T cells is essential to initiate a primary immune response. Here, we demonstrate that ICAM-3 expressed by resting T cells is important in this first contact with DC. We discovered that instead of the common ICAM-3 receptors LFA-1 and alphaDbeta2, a novel DC-specific C-type lectin, DC-SIGN, binds ICAM-3 with high affinity. DC-SIGN, which is abundantly expressed by DC both in vitro and in vivo, mediates transient adhesion with T cells. Since antibodies against DC-SIGN inhibit DC-induced proliferation of resting T cells, our findings predict that DC-SIGN enables T cell receptor engagement by stabilization of the DC-T cell contact zone.
Article
Full-text available
Whilst aquaculture feed is increasingly formulated with the inclusion of plant oils replacing fish oil, and increasing research effort has been invested in understanding the metabolic effects of reduced dietary n-3 long chain poly unsaturated fatty acids (n-3 LC-PUFA), relatively little information is available on the potential direct metabolic roles of dietary alpha-linolenic acid (ALA, 18:3n-3) and alpha-linolenic acid/linoleic acid (LNA, 18:2n-6) ratio in cultured marine finfish species. In this study, four plant oil based diets, with varying ALA/LNA ratio (0.0, 0.5, 1.0 and 1.5) were fed to juvenile large yellow croakers (Larimichthys crocea) and compared to a fish oil-based control diet (CD) to evaluate the resulting effects on growth, nonspecific immunity, anti-oxidant capacity and related gene expression. High dietary LNA negatively impacted fish growth performance, nonspecific immunity and antioxidant capacity, but growth and immunity were maintained to levels comparable to CD by increasing the ratio of dietary ALA/LNA. The over-expression of genes associated with inflammation (cyclooxygenase-2 and interleukin-1β) and fatty acid oxidation (carnitine palmitoyl transferase I and acyl CoA oxidase) in croakers fed high concentrations of LNA were reduced to levels comparable to those fed CD by increasing dietary ALA/LNA. This study showed that dietary ALA, by increasing the overall n-3/n-6 PUFA ratio, exerts direct anti-inflammatory and antioxidant effects, similar to those exerted by dietary n-3 LC-PUFA.
Article
In this study, we chose a carnivorous fish, turbot ( Scophthalmus maximus L.), to examine its nutrient-sensing and metabolic responses after ingestion of diets with fishmeal (FM), or 45 % of FM replaced by soyabean meal (34·6 % dry diet) balanced with or without essential amino acids (EAA) to match the amino acid profile of FM diet for 30 d. After a 1-month feeding trial, fish growth, feed efficiency and nutrient retention were markedly reduced by soyabean meal-incorporated (SMI) diets. Compared with the FM diet, SMI led to a reduction of postprandial influx of free amino acids, hypoactivated target of rapamycin signalling and a hyperactivated amino acid response pathway after refeeding, a status associated with reduced protein synthesis, impaired postprandial glycolysis and lipogenesis. These differential effects were not ameliorated by matching an EAA profile of soyabean meal to that of the FM diet through dietary amino acid supplementation. Therefore, this study demonstrated that the FM diet and SMI diets led to distinct nutrient-sensing responses, which in turn modulated metabolism and determined the utilisation efficiency of diets. Our results provide a new molecular explanation for the role of nutrient sensing in the inferior performance of aquafeeds in which FM is replaced by soyabean meal.
Article
Contact between dendritic cells (DC) and resting T cells is essential to initiate a primary immune response. Here, we demonstrate that ICAM-3 expressed by resting T cells is important in this first contact with DC. We discovered that instead of the common ICAM-3 receptors LFA-1 and alphaDbeta2, a novel DC-specific C-type lectin, DC-SIGN, binds ICAM-3 with high affinity. DC-SIGN, which is abundantly expressed by DC both in vitro and in vivo, mediates transient adhesion with T cells. Since antibodies against DC-SIGN inhibit DC-induced proliferation of resting T cells, our findings predict that DC-SIGN enables T cell receptor engagement by stabilization of the DC-T cell contact zone.
Article
Expression of the macrophage mannose receptor is inhibited by interferon gamma (IFN-gamma), a T helper type 1 (Th-1)-derived lymphokine. Interleukin 4 (IL-4), a Th-2 lymphocyte product, upregulates major histocompatibility class II antigen expression but inhibits inflammatory cytokine production by macrophages. We have studied the effect of IL-4 on expression of the macrophage mannose receptor (MMR) by elicited peritoneal macrophages. We found that recombinant murine IL-4 enhances MMR surface expression (10-fold) and activity (15-fold), as measured by the respective binding and degradation of 125I-mannose-bovine serum albumin. Polymerase chain reaction analysis of cDNAs from purified primary macrophage populations revealed that MMR, but not lysozyme or tumor necrosis factor alpha, mRNA levels were markedly increased by IL-4. The above effects were associated with morphologic changes. These data establish IL-4 as a potent and selective enhancer of murine MMR activity in vitro. IL-4 induces inflammatory macrophages to adopt an alternative activation phenotype, distinct from that induced by IFN-gamma, characterized by a high capacity for endocytic clearance of mannosylated ligands, enhanced (albeit restricted) MHC class II antigen expression, and reduced proinflammatory cytokine secretion.
Article
The decreased availability of fish oil, traditionally used as oil source in marine aquafeeds, has lead to the search for alternatives oils. Vegetable oils (VO) are being extensively used as lipid sources in marine fish diets, inducing an imbalance on certain dietary fatty acids. Alteration on the dietary ratio of w-6/w-3 has been described to have detrimental effects on fish immunity. Senegalese sole has high susceptibility to stress and diseases, and little is known on the effects of dietary VO on its immunity. In this study, Senegalese sole juveniles were fed diets (56% crude protein, 12% crude lipid) containing linseed (100LO), soybean (100SO) or fish (100FO) oils as unique oil source. Growth, cortisol and intestinal fatty acid composition were determined after 90 days. Moreover, at the final of the experiment a stress test (5 min of net chasing) was carried out. To evaluate the effect of diets and stress on intestine immunology, expression profiles of a set of 53 immune-related genes using RT-qPCR was also performed. The use of VO did not induced changes in fish growth, but affected fatty acid profile of intestine and expression of immune-related genes. The use of SO (rich in n-6 fatty acids) induced an over-expression of those genes related to complement pathway, recognizing pathogen associated to molecular patterns, defensive response against bacteria, defensive response against viruses, antigen differentiation, cytokines and their receptors. This general over-expression could indicate an activation of inflammatory processes in fish gut. When a stress was applied, a decrease of mRNA levels of different immune-related genes with respect to the unstressed control could be observed in fish fed 100FO. However, fish fed 100LO, with a higher ALA/LA ratio, seemed to ameliorate the effects of combined effects of FO substitution plus stressful situation whereas fish fed 100SO did not show this type of response. Copyright © 2015. Published by Elsevier Ltd.
Article
Inflammation is a condition which contributes to a range of human diseases. It involves a multitude of cell types, chemical mediators, and interactions. Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are omega-3 (n-3) fatty acids found in oily fish and fish oil supplements. These fatty acids are able to partly inhibit a number of aspects of inflammation including leukocyte chemotaxis, adhesion molecule expression and leukocyte-endothelial adhesive interactions, production of eicosanoids like prostaglandins and leukotrienes from the n-6 fatty acid arachidonic acid, production of inflammatory cytokines, and T-helper 1 lymphocyte reactivity. In addition, EPA gives rise to eicosanoids that often have lower biological potency than those produced from arachidonic acid and EPA and DHA give rise to anti-inflammatory and inflammation resolving mediators called resolvins, protectins and maresins. Mechanisms underlying the anti-inflammatory actions of marine n-3 fatty acids include altered cell membrane phospholipid fatty acid composition, disruption of lipid rafts, inhibition of activation of the pro-inflammatory transcription factor nuclear factor kappa B so reducing expression of inflammatory genes, activation of the anti-inflammatory transcription factor peroxisome proliferator activated receptor γ and binding to the G protein coupled receptor GPR120. These mechanisms are interlinked, although the full extent of this is not yet elucidated. Animal experiments demonstrate benefit from marine n-3 fatty acids in models of rheumatoid arthritis (RA), inflammatory bowel disease (IBD) and asthma. Clinical trials of fish oil in RA demonstrate benefit, but clinical trials of fish oil in IBD and asthma are inconsistent with no overall clear evidence of efficacy. This article is part of a Special Issue entitled "Oxygenated metabolism of PUFA: analysis and biological relevance."