ArticlePDF Available

Abstract and Figures

Integrin-mediated cell adhesion and signaling is of critical importance for neuronal differentiation. Recent evidence suggests that an “inside-out” activation of β1-integrin, similar to that observed in hematopoietic cells, contributes to the growth and branching of dendrites. In this study, we investigated the role of the hematopoietic adaptor protein adhesion and degranulation promoting adapter protein (ADAP) in these processes. We demonstrate the expression of ADAP in the developing and adult nervous hippocampus, and in outgrowing dendrites of primary hippocampal neurons. We further show that ADAP occurs in a complex with another adaptor protein signal-transducing kinase-associated phosphoprotein-homolog (SKAP-HOM), with the Rap1 effector protein RAPL and the Hippo kinase macrophage-stimulating 1 (MST1), resembling an ADAP/SKAP module that has been previously described in T-cells and is critically involved in “inside-out” activation of integrins. Knock down of ADAP resulted in reduced expression of activated β1-integrin on dendrites. It furthermore reduced the differentiation of developing neurons, as indicated by reduced dendrite growth and decreased expression of the dendritic marker microtubule-associated protein 2 (MAP2). Our data suggest that an ADAP-dependent integrin-activation similar to that described in hematopoietic cells contributes to the differentiation of neuronal cells.
Content may be subject to copyright.
ORIGINAL RESEARCH
published: 30 September 2016
doi: 10.3389/fnmol.2016.00091
Integrin Activation Through the
Hematopoietic Adapter Molecule
ADAP Regulates Dendritic
Development of Hippocampal
Neurons
Marlen Thiere 1,Stefanie Kliche 2,Bettina Müller 1,Jan Teuber 1,Isabell Nold 1
and Oliver Stork 1,3*
1Department of Genetics and Molecular Neurobiology, Institute of Biology, Otto-von-Guericke-University, Magdeburg,
Germany, 2Institute of Molecular and Clinical Immunology, Medical Faculty, Otto-von-Guericke-University, Magdeburg,
Germany, 3Center for Behavioral Brain Sciences, Magdeburg, Germany
Edited by:
Marina Guizzetti,
Oregon Health & Science University,
USA
Reviewed by:
Barbara Viviani,
University of Milan, Italy
Bernhard Wehrle-Haller,
University of Geneva, Switzerland
*Correspondence:
Oliver Stork
oliver.stork@ovgu.de
Received: 01 April 2016
Accepted: 13 September 2016
Published: 30 September 2016
Citation:
Thiere M, Kliche S, Müller B,
Teuber J, Nold I and Stork O (2016)
Integrin Activation Through the
Hematopoietic Adapter Molecule
ADAP Regulates Dendritic
Development of Hippocampal
Neurons.
Front. Mol. Neurosci. 9:91.
doi: 10.3389/fnmol.2016.00091
Integrin-mediated cell adhesion and signaling is of critical importance for neuronal
differentiation. Recent evidence suggests that an “inside-out” activation of β1-integrin,
similar to that observed in hematopoietic cells, contributes to the growth and
branching of dendrites. In this study, we investigated the role of the hematopoietic
adaptor protein adhesion and degranulation promoting adapter protein (ADAP) in
these processes. We demonstrate the expression of ADAP in the developing and
adult nervous hippocampus, and in outgrowing dendrites of primary hippocampal
neurons. We further show that ADAP occurs in a complex with another adaptor protein
signal-transducing kinase-associated phosphoprotein-homolog (SKAP-HOM), with the
Rap1 effector protein RAPL and the Hippo kinase macrophage-stimulating 1 (MST1),
resembling an ADAP/SKAP module that has been previously described in T-cells and is
critically involved in “inside-out” activation of integrins. Knock down of ADAP resulted in
reduced expression of activated β1-integrin on dendrites. It furthermore reduced the
differentiation of developing neurons, as indicated by reduced dendrite growth and
decreased expression of the dendritic marker microtubule-associated protein 2 (MAP2).
Our data suggest that an ADAP-dependent integrin-activation similar to that described
in hematopoietic cells contributes to the differentiation of neuronal cells.
Keywords: integrin, adaptor proteins, neurite outgrowth, MAP2, hippocampus, primary cell culture, mouse
INTRODUCTION
The nervous system and the immune system share many mechanisms concerning the recognition
of cells and extracellular matrix components, as well as the intracellular signaling induced by
these events. The adhesion and degranulation promoting adapter protein (ADAP) may be a
common regulatory factor in these processes. ADAP is expressed in various hematopoietic cells
including T-cells, platelets, mast cells, dendritic cells, natural killer cells, granulocytes, monocytes,
macrophages (Wang and Rudd, 2008; Witte et al., 2012) and microglia (Engelmann et al., 2015), but
public databases suggest that ADAP may also be expressed in neuronal cells during development
and adulthood1.
www.brain-maps.org
Frontiers in Molecular Neuroscience | www.frontiersin.org 1September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
ADAP protein occurs in two isoforms with molecular weights
of 120 kDa and 130 kDa, without discernable enzymatic or
transcriptional activity (Wang and Rudd, 2008). It contains
a proline-rich region, several tyrosine-based signaling motifs,
two helical SH3 domains, and an Ena/VASP binding motif
to mediate protein-protein and protein-lipids interactions
(Peterson, 2003; Wang and Rudd, 2008;Witte et al., 2012;
Engelmann et al., 2015). It serves as a hub for the association
of additional adaptor proteins, Ena/VASP proteins and kinases
in T-cells, thereby facilitating T-cell activation, differentiation
and adhesion (Peterson, 2003; Zhang and Wang, 2012; Witte
et al., 2012). ADAP deficient T-cells show reduced T-cell
receptor (TCR)-mediated differentiation and proliferation and
an attenuated up-regulation of the T-cell activation markers
CD69, CD25 and CD54 as well as release of interleukin-2
and interferon γ(Peterson et al., 2001; Medeiros et al.,
2007; Wang et al., 2007; Burbach et al., 2008; Srivastava
et al., 2010). In addition, loss of ADAP attenuates TCR-
and chemokine-mediated integrin activation required for T-
cell adhesion, interaction with antigen-presenting cells and
migration in vitro and in vivo (Peterson et al., 2001; Wang
et al., 2007; Burbach et al., 2011; Kliche et al., 2012; Mitchell
et al., 2013). However, the potential role of ADAP in integrin
activation during neuronal differentiation has not been studied
so far.
Neurons express various β1- and β3-integrins (Wu and
Reddy, 2012) that interact with the rich extracellular matrix of
the nervous system (e.g., fibronectin, laminin, or collagens) and
with diffusible factors that serve as guidance cues mediating
migration and neurite growth (e.g., netrins, semaphorins and
ephrins; Myers et al., 2011). Beta-integrins are expressed during
dendritic differentiation (Schmid and Anton, 2003; Rehberg
et al., 2014) and provide sites of adhesion and signals for
the dynamic rearrangement of cytoskeletal elements during
dendrite development. Stimulation of integrins with laminin
or semaphorin 7A enhances the growth and restructuring of
dendrites in cortical neurons in culture (Moresco et al., 2005),
whereas integrin blockage leads to retraction of dendrites of
retinal ganglion cells in vivo (Marrs et al., 2006). Hippocampal
neurons also require β1-integrins for dendritic differentiation
both in culture and in vivo (Schlomann et al., 2009; Warren
et al., 2012; Rehberg et al., 2014). While classically it has
been considered that integrins in neurons are expressed
in a pre-activated state and mostly mediate signaling from
the extracellular matrix and diffusible factors (‘‘outside-in’’),
recent evidence has demonstrated the importance of controlled
integrin trafficking and ‘‘inside-out’’ activation during neurite
development. Specifically, increased expression of activated β1-
integrin on the dendritic surface has been reported following
stimulation of hippocampal neurons with semaphorin 3A
(Schlomann et al., 2009; Rehberg et al., 2014).
These processes bear striking resemblance to the ADAP-
dependent inside-out activation of integrins in T-cells, where
upon stimulation of the TCR or chemokine receptors, αLβ2 and
α4β1 integrins are activated to bind to their respective ligands.
Consequently an increased proportion of integrins is induced
to a high-affinity conformation on the cell surface (affinity
modulation), followed by integrin clustering and association with
the actin cytoskeleton (avidity regulation; Abram and Lowell,
2009; Hogg et al., 2011).
ADAP in T-cells is associated with SKAP55 to regulate
the affinity/avidity modulation of integrin function via the
assembly of two complexes, ADAP/SKAP55/RAPL/MST1
and ADAP/SKAP55/RIAM/MST/Kindlin-3/Talin, which are
associated with the alpha or beta chain of the integrin αLβ2,
respectively (Kliche et al., 2012). Three components of the
ADAP associated molecular complex in T-cells, Talin, Kindlin-1
(an isoform of Kindlin-3) and the Rap1 effector protein RIAM
have previously also been found to regulate β1- and β3-integrin
function in neurons (Dent et al., 2011; Myers et al., 2011; Tan
et al., 2012).
Based on these observations and its prominent expression in
the nervous system, we hypothesized that ADAP may be involved
in the activation of integrins during neuronal differentiation.
We examined the expression of ADAP during dendritogenesis
of cultivated hippocampal neurons and investigated the effect of
ADAP knock down on neuronal differentiation and underlying
mechanisms. Our data suggest that ADAP occurs in developing
neurons in association with signal-transducing kinase-associated
phosphoprotein-homolog (SKAP-HOM; homolog of SKAP55),
RAPL and MST1, and stimulates β1 integrin activation as well as
dendritic growth in these cells.
MATERIALS AND METHODS
Mice
C57BL/6 (M&B Taconic, Berlin) mice were bred and
maintained under specific pathogen-free conditions at the
Otto-von-Guericke University, Magdeburg, Germany. Animal
maintenance and tissue collection were done according to the
guidelines of the State of Saxony-Anhalt, Germany and approved
by the Landesverwaltungsamt Sachsen-Anhalt.
Cell Culture
HEK-293T cells (supplied by Deutsche Stammsammlung von
Mikroorganismen und Zellkulturen GmbH; DSMZ Braunschweig,
Germany) were used for testing plasmid constructs. Transfection
was done with Lipofectaminer2000 (Thermo Scientific)
according to the manufacturer’s protocol. For Western Blotting,
cells were lyzed 48 h after transfection. PC-12 cells were cultured
in RPMI medium containing 10% horse serum (v/v), 5% fetal
bovine serum (v/v) and 1% L-Glutamine (v/v; all Thermo
Scientific). Differentiation was induced with NGF (50 ng/µl;
Sigma-Aldrich) under reduced serum condition [RPMI medium
containing 0, 2% horse serum (v/v) and 1% L-glutamine (v/v)].
Splenic CD3+T-cells from mice were purified using T-cell
isolation kit and AutoMacs magnetic separation system (Miltenyi
Biotec).
Primary Hippocampal Culture
Dissociated primary hippocampal cultures were prepared using
the Neural Tissue dissociation Kit (P) from Milteny Biotec
according to manufacturer’s protocol. Briefly, hippocampi from
embryonic day 18 (E18) mice were dissected, dissociated in
Frontiers in Molecular Neuroscience | www.frontiersin.org 2September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
papain-enzyme mix and incubated under rotation at 37-C
for 15 min in Hanks balanced salt solution (HBBS, Thermo
Scientific). Dissociated cells in DMEM were plated at a
density of 40,000–80,000 cells/cm2(for transfection) or 200,000
cells/cm2(for immunocytochemistry) on poly-D-lysine-coated
(Sigma-Aldrich) coverslips. Four hours after plating, DMEM
containing 10% FBS (v/v), 2 mM L-GlutaMAX, was changed
to Neurobasalrmedium containing 2% B27- supplement (v/v;
all Thermo Scientific), 0.5 mM L-GlutaMAX. After 2 days in
vitro (DIV), cells were treated with 10 µM AraC (Sigma-Aldrich)
to inhibit Glia proliferation. On DIV7 media was changed
to neurobasal medium containing 2% B27 (v/v) supplement
without GlutaMAX. Neuronal cultures were transfected at DIV7
using Lipofectaminer2000 (Life Technologies), according to
the manufacturer’s protocol (see above). After transfection,
coverslips were cultured for two additional days in neurobasal
medium containing 2% B27 (v/v). The developmental stages
of the transfected neurons were carefully monitored (Kaech
and Banker, 2006) and their viability was evaluated according
to the smoothness and regularity in shape of somata and the
uniformity in diameter and smoothness of neurites (Xiang et al.,
1996). We also controlled for phase bright somata and granule
accumulation (Yang et al., 2010). Transfection did not result in a
change of these parameters, or in the occurrence of fragmented
neurites or rough, condensed and irregularly shaped somata in
any experimental group.
Constructs
The expression vector pll.3.7 (Rubinson et al., 2003) was
obtained from Addgene and used for cloning of ADAP
shRNA targeting oligonucleotide. ADAP shRNA sequences
targeting both isoforms of the mouse ADAP mRNA
(NM_011815.5/NM_001278269.1) were designed using the
shRNA retriever online tool2. Hairpin oligonucleotides with
the loop sequence TTCAAGAGA were cloned into pll3.7
downstream of its U6 promoter, using Hpa1 and Xho1
restriction sites. This construct was co-transfected with a
murine ADAP overexpressing construct in HEK-293T cells
to test the efficiency to knock down mouse ADAP mRNA
(Figure 2C). Ultimately, an shRNA construct expressing the
fragment GCCAGGATTCTCAAAGGTAGC and targeting
nucleotides 572–593 was chosen for further experiments. As
controls we used both, a nonsense construct [pll3.7-shrandom
(50TCGTCATGACGTGCATAGG 30)] and a pll3.7 empty
backbone in all experiments. These controls did not differ in
any of the parameters analyzed and therefore were averaged
for statistical analysis and data presentation. Moreover, a
cDNA clone of Flag-tagged human ADAP (Musci et al.,
1997), insensitive to these knock-down constructs was used
for reconstitution of ADAP expression. Control experiments
revealed that an expression of ADAP from this vector in the
absence of a knock-down constructs frequently induced aberrant
morphology, in particular axon swellings, that were never
observed in the other experimental conditions including the
rescue groups. Therefore, ADAP overexpression was not further
2katahdin.cshl.org
considered in our experiments. In control, knock down and
reconstitution vectors, enhanced green fluorescence protein was
independently expressed under a cytomegaly virus promoter
from the same construct to visualize transfected cells. To confirm
antibody specificity we furthermore inserted murine His-tagged
ADAP into vector pCMS4 for heterologous expression in
HEK293T cells. For Luciferase reporter assays, the plasmids
pGL4.32 [luc2P/NF-kB-RE/Hygro] and pRL-TK were obtained
from Promega.
Immunocytochemistry
Immunocytochemistry and neurite growth analysis were done
using a modified protocol from Rehberg et al. (2014). For
immunocytochemistry primary neurons were fixed with 4%
paraformaldehyde and 4% sucrose in 0.1 M PBS, pH 7.4. Cells
were permeabilized with PBS containing 0.3% Triton X-100 and
unspecific binding was blocked with 10% BSA in PBS, followed
by primary antibody incubation in blocking solution at room
temperature for 1–2 h. Cells were washed in PBS, incubated
for 1 h at room temperature with suitable Alexa conjugated
secondary antibodies in 2.5% bovine serum albumin in PBS
[donkey anti-mouse Alexa 647 (Thermo Scientific), donkey anti-
sheep Cy3 (Dianova), donkey anti-rat Cy3 (Dianova)]. Cells were
again washed with PBS, embedded with Immu-Mount (Thermo
Scientific) and examined using Leica DMIR2 confocal and Leica
DMI6000 epifluorescence microscopes.
Morphological Assessment of Transfected Neurons
Transfected primary neurons were fixed with 4%
paraformaldehyde and 4% sucrose in 0.1 M PBS, pH 7.4.
Dendrites of GFP-filled neurons were identified according
to their morphological features (Kaech and Banker, 2006)
and MAP2 counterstaining. Dendritic arborization was then
evaluated according to the method of Sholl (1953), using a
DMI6000 microscope and QWin software (Leica Microsystems).
Analysis of Activated β1-integrin and Total β1-integrin
Integrin activation was examined using an antibody for the
high affinity conformation of CD29 (Ab 9EG7; BD Bioscience)
according to a modified protocol from Tan et al. (2012) and
Rehberg et al. (2014). The antibody was added to a final
dilution of 1:50 to the culture medium and incubated for
15 min at 37C. Cells were then washed with warm culture
medium and fixed with 4% PFA, 4% sucrose in PBS for
30 min. Cells were permeabilized with PBS containing 0.3%
Triton-X and counterstained with an antibody against MAP2
(1:1000; Millipore). Total β1-integrin was stained with an
antibody against β1-integrin (1:500; Abcam). After washing
in PBS, Alexa 647-coupled anti-mouse (Thermo Scientific);
Alexa 555-coupled anti-rabbit (Thermo Scientific) and Cy3-
coupled anti-rat (Dianova) secondary antibodies were applied
for 1 h at room temperature. Cells were washed in PBS and
mounted using ImmuMountTM. Each 10 GFP-labeled cells
per condition and experiment were randomly selected under
the DMI6000 light microscope and the immunofluorescence
signal was quantified using the inbuilt LAS AF software
under identical light intensity and exposure settings between
Frontiers in Molecular Neuroscience | www.frontiersin.org 3September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
cells. Each cell was tracked as a stack of 30 images with
a width of 0.2 µm per image. Blind deconvolution was
performed, dendrites and soma of each neuron were traced
and fluorescence intensity was analyzed with the histogram
tool of the LAS AF software. Labeling intensity was expressed
in relation to the surface area of the respective compartment,
as visualized by the EGFP expressed from the transfected
construct. Morphological parameters and MAP2 counterstaining
were used to differentiate dendritic, somatic and axonal
compartments.
Quantitative PCR
RNA isolation and first strand synthesis were done as previously
described (Albrecht et al., 2013; Rehberg et al., 2014). In
brief, RNA was isolated from mouse primary hippocampal
neurons on DIV3, 7, 14 and 21 using Cells-to-cDNA IITM-
Cell Lysis Buffer (Ambionr). cDNA was generated with
M-MLV reverse transcriptase Omniscript (Qiagen) using oligo-
dt primers and random decamer primers. Quantitative PCR was
done on a StepOnePlus real-time PCR System using TaqMan
reagents and TAM-labeled predesigned expression assays for
ADAP (Mm00803629_m1), p65 (Mm00501346_m1) or c-Rel
(Mm01239661_m1; all Thermo Scientific). Initial deuridination
and denaturation (2 min 50C, 10 min 95C) were followed by
40 cycles of 15 s 95C, 1 min 60C and expression values were
calculated in relation to those obtained with the VIC-labeled
housekeeping gene assay for GAPDH (4352923E) in the same
wells.
Western Blotting
Western blotting was done as previously described (Rehberg
et al., 2014). Briefly, hippocampi and cultured cells were
lyzed in laurylmaltosid/NP40 lysis buffer, (1% lauryl maltoside
N-dodycyl-D-maltoside (Merck), 1% NP-40 (Sigma-Aldrich),
1 mM Na-orthovanadate, 1 mM PMSF, 50 mM Tris-HCl,
pH7.4, 10 mM NaF, 10 mM EDTA, and 160 mM NaCl)
incubated on ice for 20 min and centrifuged at 16000×g
for 30 min. The protein concentration of the postnuclear
supernatant was determined using the Roti-Nanoquant reagent
(Roth) according to the manufacturer’s instructions. Cell lysates
or precipitates were separated by SDS-PAGE and transferred to
PVDF or nitrocellulose membranes (Immobilon FL; Millipore).
The following antibodies were used sheep anti-ADAP [kindly
provided by Gary Koretzky University of Pennsylvania; (Musci
et al., 1997)] mouse anti-α-tubulin (Sigma-Aldrich); mouse anti-
ADAP mAb (BD Bioscience), rabbit anti-ADAP (EPR2547Y;
Abcam), as well as rat mAbs against Riam and RAPL (Horn
et al., 2009; Kliche et al., 2012), MST1 (BD Bioscience)
and SKAP-HOM (Marie-Cardine et al., 1998). Membranes
were then incubated with horseradish peroxidase-conjugated
secondary antibodies (Dianova) and signals were detected with
a LuminolTM detection system (Roth) exposing to X-ray films
(Amersham).
Immunoprecipitation
Immunoprecipitation (IP) was performed to identify protein-
protein interaction. Total cell lysate (500 µg) were supplemented
with 30 µg BSA to reduce non-specific binding, the ADAP sheep
serum (10 µl) and 30 µl Protein A-agarose (Santa Cruz) for
2 h at 4C. After washing the beads with laurylmaltosid/NP40
lysis buffer, precipitates were analyzed by Western Blotting as
described above.
In-Cell Western
MAP2-immunoreactivity in transfected cell cultures was
quantified with an In-Cell WesternTM assay. Dissociated
neurons were transfected with Lipofectaminer2000 (Thermo
Scientific) on DIV7 and fixed on DIV9 with 4% PFA/4%
sucrose followed by permeabilization with PBS containing 0.1%
Triton-X at room temperature. Primary anti-MAP2 antibody
(1:200, Millipore) was diluted in Odysseyr-blocking buffer
(LI-CORr) and plates were incubated at 4C over night. After
washing in PBS, 0.1% Tween (5 ×5 min), a secondary antibody
(1:1000; IRDyer800CW goat anti-mouse) was applied together
with CellTagTM 700 stain (1:500; LI-CORr) for 1 h at room
temperature. After washing in PBS, 0.1% Tween (5 ×5 min at
room temperature) fluorescence intensity signals were analyzed
with the Odysseyr-Infrared Imager (LI-CORr) and MAP2
signals were normalized to the total cell number as detected with
the CellTagTM 700 stain.
Luciferase Assays
To detect NF-κB-activity in stimulated primary hippocampal
neurons vs. unstimulated neurons, a Dual GlowrLuciferase
assay system (Promega) and pGL4.32[luc2P/NF-κB-RE/Hygro]
reporter were used. Neurons were transfected on DIV7 with
NF-κB-Luc reporter and a Renilla-Luciferase control vector
(pRL-TK; Schultz et al., 2006; Mikenberg et al., 2007). TNFα(100
ng/ml) and Insulin (10 µg/ml; both Sigma-Aldrich) stimulation
were done on DIV9 for 90 min before measurement commenced.
Dual-Luciferaserreporter assay was performed according to the
manufacturer’s protocol. Briefly, after washing with PBS cell were
lyzed with 1×passive lysis buffer (5×PLB; Promega) for 15 min
at room temperature. 1×luciferase assay buffer II (LARII) was
added and after 10 min firefly luminescence was measured using
a Luminescence spectrophotometer (Tecan InfiniterM200).
The same volume of 1×Stop & Glowrwas added and after
10 min, Renilla luminescence was measured. Reporter activity
was calculated as the ratio of experimental reporter pGL4.32
[luc2P/NF-kB-RE/Hygro] luminescence to control reporter pRL-
TK luminescence and normalized to control pLL3.7 controls.
Statistics
Statistical analysis was performed with one-way ANOVA
followed by Fischer’s protected least significant difference
(PLSD) test. Student’s t-test was used for direct pairwise
comparisons. A p-value of p<0.05 was considered to be
significant.
RESULTS
ADAP is Expressed in Neuronal Cells
ADAP expression was tested in primary hippocampal cultures,
as well as in hippocampal tissue during development and
Frontiers in Molecular Neuroscience | www.frontiersin.org 4September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
FIGURE 1 | Expression of adhesion and degranulation promoting adapter protein (ADAP) in hippocampal neurons. (A) ADAP expression can be detected
in the somata of primary hippocampal neurons and along their MAP2-positive dendritc and MAP2-negative/Tau-positive axonal structures. Scale bar, 100 µm.
(B) Immunoblot analysis with two different ADAP antibodies confirms the expression in juvenile (postnatal day 9) and adult (postnatal day 90) hippocampus, as well
as in neurally differentiated PC12 cells (after 4 days of NGF treatment). ADAP expression in murine CD3+T-cells is shown for comparison. (C) The specificity of
immunocytochemical ADAP labeling is demonstrated in HEK-293T cells, which do not express endogenous ADAP. Positive signals are strictly limited to those cells
that have been transfected with His-tagged ADAP, whereas non-transfected cells marked by DAPI staining alone are negative for ADAP immunoreactivity. Scale bar,
100 µm. (D) In 7 days in vitro (DIV7) hippocampal neurons, SKAP-HOM is distributed in soma and proximal dendrites along with ADAP, but not in a MAP2-negative
neurite (arrow). Scale bar, 100 µm. (E) Immunoprecipitation (IP) of hippocampal lysate identifies SKAP-HOM, RAPL and MST1, but not RIAM as binding partners of
ADAP in neuronal tissue. WL, whole lysate.
adulthood. Immunocytochemical staining revealed ADAP
expression in somata, dendrites and axons of primary neurons
(Figures 1A,D,4), as various stages of neuronal differentiation,
including DIV3 (Figure 4A), DIV7 (Figures 1A,D), DIV10
(Figure 4B), as well as DIV14, DIV18 and DIV21 (data not
shown).
We further examined the expression of ADAP in different
compartments of the neuronal cell during development.
Double immunocytochemistry reveals a high degree of
overlap with the dendritic marker MAP2. The co-localization
is pronounced during early neuronal differentiation
(DIV3), when MAP2 labels both outgrowing axons and
dendrites. At this time point, ADAP can be found along
the core neurite microtubules and the microtubule network
of growth cones and growth tips and MAP2-negative
ADAP-positive filaments are rarely observed (Figure 4A).
However, at later stages of development ADAP-positive
axons without MAP2 labeling are frequently observed in
addition to the generally double-labeled dendritic structures
(Figures 1A,D).
Western blot analysis further confirmed the expression of
ADAP in the developing and adult hippocampus in vivo,
Frontiers in Molecular Neuroscience | www.frontiersin.org 5September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
with two different antibodies that detected a band of approx.
120 kDa corresponding to the ADAP signal obtained in naive
T-cells. ADAP was also found in neural differentiated PC12 cells
(Figure 1B).
The specificity of immunocytochemical ADAP labeling was
confirmed using heterologous expression of ADAP-His tagged
protein in HEK-293T cells, which are devoid of endogenous
ADAP expression. Only cells with detectable signal against the
His-Tag (1:500; Santa Cruz) displayed immunoreactivity for
ADAP antibodies (Figure 1C).
ADAP Occurs in an Adaptor
Protein/Signaling Complex in Neural Cells
In T-cells ADAP exists in complex with SKAP55, RAPL
or RIAM, and the Hippo kinase MST1. This complex
is known to mediate TCR-induced inside-out activation
of integrins. Indeed, staining of hippocampal neurons
for SKAP-HOM resulted in a distributed labeling of
somata and dendrites, similar to ADAP (Figure 1D).
Moreover, using anti-ADAP antibodies, we were able to
co-precipitate the SKAP55 homolog SKAP-HOM, as well as
RAPL and MST1, but not RIAM from hippocampal tissue
(Figure 1E).
ADAP is Required for Expression of
Activated β1-integrin on Developing
Dendrites
In T-cells the ADAP/SKAP55 module is critically involved in
the inside-out activation of integrins. We therefore analyzed
the expression of activated β1-integrin in somata, dendrites
and axons of acutely transfected primary neurons. In fact, in
dendrites ADAP knock down resulted in a decreased labeling
with the activity dependent β1-integrin antibody 9EG7. Labeling
was recovered to control levels, when a shRNA-resistant form
of human ADAP was co-expressed (F(2,145)=3.208, p<0.05;
control vs. knock down p<0.05, Fischer’s PLSD; Figures 2A,B).
By contrast, in the somata (control 303.305 ±24.39, knock
down 202.32 ±40.75, rescue 284.86 ±79.41; F(2,70)=2.026
p>0.05) and axons (control 75.715 ±24.29, knock down
94.8 ±47.15, rescue 61.644 ±15, 21; F(2,65)=0.339
p>0.05) no significant changes were found, although
a general trend towards reduction of activated β1-integrin
was apparent after ADAP knock down compared to the
control.
Next, we investigated the expression of total β1-integrin
on dendrites, axons and somata, using an activation stage-
independent antibody. On the dendrites of ADAP knock-down
cells (Figures 2D,E) we found an increase in β1-integrin intensity
compared to rescue and control condition (F(2,204)=10.232,
p0.005; knock down vs. rescue p0.005; knock down vs.
control p0.05; rescue vs. control p0.005). At the same
time, the somata of these cells showed a reduction in β1-integrin
intensity (control 62.33 ±1.9, knock down 38.78 ±3.5, rescue
69.68 ±5.7; F(2,103)=6.307, p0.005; knock down vs.
rescue p0.005; knock down vs. control p0.005). No
significant change in β1-integrin labeling was found in the axonal
compartment (control 9.27 ±1.21, knock down 11.09 ±1.28
rescue 8.35 ±1.31; F(2,110)=1.153 p0.05).
ADAP Promotes Neurite Outgrowth
Activation of β1-integrin is critical for dendritic development
in neuronal cells (Schlomann et al., 2009; Rehberg et al., 2014);
therefore we next examined the potential effect of ADAP
knock down on dendrite formation in primary hippocampal
neurons (Figure 3). Here we observed that shRNA-mediated
ADAP knock-down induces a significant reduction of neurite
growth, which can be recovered by co-expression of an shRNA-
resistant ADAP expression construct. Quantification of neurites
with the Sholl method demonstrated a significant reduction
in the number of dendritic intersections, which returned to
control levels when ADAP expression was reconstituted (one-
way ANOVA F(2,108)=4.327, p<0.05; p<0.05, control vs.
knock down, p<0.05, knock down vs. rescue, p<0.05, Fisher’s
PLSD). Axonal structures in contrast were not significantly
affected (control 355.06 ±32.83 knock down 180.3 ±112.26
rescue 307.3 ±175.16; F(2,98)=2.321 p>0.05).
ADAP Knock Down Decreases MAP2
Immunoreactivity in Neurons
MAP2 is important for the stabilization of microtubules during
neurogenesis and is enriched in dendrites, implicating a role
in stabilizing dendritic shape during neuron development.
When analyzing the morphology of hippocampal neurons,
we recognized the close association of ADAP with MAP2-
positive structures at different stages of development
(Figure 4). Moreover, we noticed an apparent loss of
MAP2 immunoreactivity in ADAP-knock-down cells
(Figure 5A). To quantify this effect we used the In-Cell
WesternTM method in acutely transfected neuronal cells.
With an average transfection rate of 50% knock down
of ADAP significantly decreased MAP2 labeling intensity
compared to controls, however, in contrast to integrin
labeling and dendrite growth, this effect could not be rescued
through ADAP re-expression (Figures 5B,C;F(2,72)=6.034
p<0.005; knock down vs. control p<0.05; rescue vs. control
p<0.05).
ADAP Knock Downs Decreases Baseline
NF-κB Activity in Neurons
In T-cells, ADAP is involved in the activation of the transcription
factor NF-κB (Medeiros et al., 2007; Srivastava et al., 2010;
Thaker et al., 2015). To test for a potential involvement of
this ADAP function in neuronal differentiation we examined
the activity of NF-κB under conditions of ADAP knock down
and reconstitution using a luciferase reporter assay. Indeed,
ADAP knock down led to a significant reduction in NF-κB
activity under basal differentiation conditions that was not
recovered by the rescue construct (F(2,8)=29.558; p<0.001;
control vs. knock down p<0.01; control vs. rescue p<0.01;
Figure 6A). Under stimulation with insulin, no significant effect
of ADAP expression was found (F(2,8)=3.021 p>0.12) but
a strong trend for reduction was evident in the knock-down
Frontiers in Molecular Neuroscience | www.frontiersin.org 6September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
FIGURE 2 | ADAP complex and integrin activation. (A) ADAP is involved in the dendritic expression of activated β1-integrin in hippocampal neurons (DIV9).
Antibody 9EG7 detects activated β1-integrins on the soma and neurites; reduced labeling intensity is evident in cells with shRNA-mediated knock down of ADAP
and recovery to control levels is seen upon re-expression of a knock-down resistant ADAP clone. Scale bar, 100 µm(B) Quantitative analysis of labeling intensity
along dendrites confirms the reduction of 9EG7 labeling upon ADAP knock down as well as its rescue (n=24–30 per condition). (C) Effective knock down of murine
ADAP and its rescue through re-expression of the shRNA-resistant human form (hADAP) in HEK-293T cells. (D,E) In contrast to the activated form, total β1-integrin
was increased on the dendrites following ADAP knock down, indicating that the observed reduction in dendritic labeling with antibody 9EG7 is related to reduced
β1-integrin activation by conformational change rather than changes in expression level. Data are Mean ±SEM. p<0.01.
samples. Furthermore, under the stimulation of canonical NF-
κB signaling with TNF-α, no difference was observed in NF-κB
activity between different ADAP manipulations (F(2,8)=1.432
p>0.31).
The NF-κB family members p65 and c-Rel have previously
been described to control neuronal differentiation and plasticity.
To determine the potential target of ADAP-mediated NF-κB in
neurons, we analyzed the mRNA-expression of p65 and c-Rel in
hippocampal primary culture and found a significant p65-mRNA
expression with a pronounced increase on DIV7 and DIV14
(one-way ANOVA F(3,32)=3.741 p<0.05; DIV7 vs. DIV21 and
DIV14 vs. DIV21 p<0.05; Figure 6B). c-Rel-mRNA in contrast
was not detectable in our cultures.
DISCUSSION
In the current study, we demonstrate the involvement of the
hematopoietic scaffold molecule ADAP in dendrite formation
of hippocampal neurons. Our data suggest that ADAP in
the nervous system may act analogous to ADAP in T-cells,
i.e., by assembling a specific signaling complex for the
inside-out activation of integrins and by controlling cell
differentiation.
Depending on their conformation, integrins display low,
intermediate, or high affinity to their ligands. Activation of
integrin adhesion can be triggered by inducing an increased
proportion of the high-affinity conformations of integrins
Frontiers in Molecular Neuroscience | www.frontiersin.org 7September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
FIGURE 3 | ADAP is required for dendritic outgrowth. (A) The complexity of dendritic structures is reduced upon ADAP knock down and recovered upon
expression of the rescue construct. Dendrite formation was analyzed in primary hippocampal neurons based on the reconstruction of transfected cells via the EGFP
signal. Scale bar, 100 µm. (B) Quantification of dendrite branches using Sholl’s method revealed a significant reduction in the total number of dendritic intersections
(n=25–29 per condition). (C) Reduction of intersections is evident in knock-down cells along the entire dendritic arbor, whereas the rescue construct enhances
growth over the first 150 µm. Data are Mean ±SEM. p<0.01.
on the cell surface. Subsequently, ligand binding stimulates
integrin clustering (avidity regulation) and association with
the actin cytoskeleton to mediate macromolecular adhesion
complex formation. Moreover, integrin-ligand binding induces
outside-insignaling to control adhesion, spreading, migration
as well as cellular differentiation, survival and proliferation
(Abram and Lowell, 2009; Hogg et al., 2011; Margadant et al.,
2011).
ADAP/SKAP-HOM-Module
Research in T-cells has demonstrated that ADAP is a critical
factor for the activation of integrins: ADAP and SKAP55,
which form a signaling unit ‘‘the ADAP/SKAP55-module’’
to recruit the two Rap1 effector proteins RAPL and RIAM
(Rap1–GTP-interacting adapter molecule), the small GTPase
Rap1, the Ste20-like kinase MST1, as well as the FERM-
domain containing proteins Talin and Kindlin-3 for integrin
activation at the plasma membrane (Raab et al., 2011; Kliche
et al., 2012; Kasirer-Friede et al., 2014). The formation of these
macromolecular complexes is required for integrin activation
leading to adhesion and migration and to promote proliferation
and differentiation of T-cells (Ménasché et al., 2007; Witte
et al., 2012). ADAP and/or SKAP55 (homolog of SKAP-HOM)
are crucial for receptor-mediated integrin signaling events in
various cell types of the immune system including T-cells,
platelets, dendritic cells and neutrophils (Peterson et al., 2001;
Griffiths and Penninger, 2002; Togni et al., 2005, 2012; Kasirer-
Friede et al., 2007; Wang et al., 2007; Reinhold et al., 2009;
Block et al., 2012). Thus ADAP and/or SKAP55 control T-
cell adhesion, interactions of T-cells with antigen-presenting
cells, and T-cell migration in vitro and in vivo (Kliche et al.,
2006, 2012; Wang et al., 2007, 2009; Burbach et al., 2008;
Mitchell et al., 2013). We now demonstrate that ADAP,
SKAP-HOM, RAPL, RIAM and MST1 all are expressed in
hippocampal tissue and that ADAP, SKAP-HOM, RAPL and
MST1 can be co-precipitated under the same conditions as from
T-cells. This strongly suggests that an ADAP complex exists in
neurons that is comparable to the ADAP/SKAP55/RAPL/MST1
complex in T-cells and might similarly control the activity
state of integrins during neuronal development (Warren et al.,
2012).
ADAP is Involved in β1-Integrin Activation
Neurons express various β1- and β3-integrins (Wu and Reddy,
2012) that interact with the rich extracellular matrix of
the nervous system (e.g., fibronectin, laminin, or collagen)
and diffusible factors that serve as guidance cues mediating
migration and neurite growth (e.g., netrins, semaphorins
and ephrins; Myers et al., 2011). Overall it seems that
in neurons integrins are rather in an open conformation
Frontiers in Molecular Neuroscience | www.frontiersin.org 8September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
FIGURE 4 | Association of ADAP with MAP2-positive structures in hippocampal neurons. (A) Confocal microscopy reveals that during early neurite
formation (DIV3), ADAP is richly expressed along outgrowing neurites and highly co-localized with MAP2. Co-localization is evident in both the core neurite and at the
growth tip, including filamentous and filopodial structures. Only occasionally, small MAP2-negative filaments appear labeled by ADAP (arrows). Scale bars, 100 µm
and 50 µm. (B) A high degree of co-localization with MAP2 is also evident at later stages of dendrite development (DIV10). Scale bar, 100 µm.
and that further activation occurs by inside-out activation
upon excitation or by outside-in mechanism such as high
concentration of ligands in the extracellular matrix (Lin
et al., 2005; Sekine et al., 2012). In addition, local activation
of integrins also directs axon outgrowth or growth cone
formation through integrin-recycling (Myers et al., 2011). Gain-
of function and loss-of function studies identified several
signaling molecules that regulate β1- and β3-integrin function
in neurons. These include members of the Arf, Ras and Rho
GTPases, integrin-linked kinase, focal adhesion kinase (FAK)
and the two FERM-domain containing proteins Talin and
Kindlin-1 (Myers et al., 2011; Tan et al., 2012, 2015; Kerstein
et al., 2013).
We could show that ADAP and SKAP-HOM are both
expressed throughout the soma and dendrites of developing
neurons. ADAP could be observed in dendritic growth
tips during early development and in association with
MAP2-positive dendritic microtubules at different stages of
development. This is in line with an association of RAPL
and MST1 with microtubules observed in various cell types
(Fujita et al., 2005; Oh et al., 2006).
In primary hippocampal culture, β1-integrins are the
predominant form in early neuronal development and
critical for dendritic differentiation (Schlomann et al., 2009;
Warren et al., 2012; Rehberg et al., 2014). Their activation
in outgrowing neurites involves a phosphorylation at the
Frontiers in Molecular Neuroscience | www.frontiersin.org 9September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
FIGURE 5 | ADAP stimulates MAP2 expression. (A) The immunofluorescence signal of the dendritic marker MAP2 is reduced in ADAP knock-down neurons,
compared to control transfected neurons. Scale bar, 100 µm. (B) MAP2 labeling in transfected primary cultures using the In-Cell-Western method confirmed the
overall reduction of MAP2 labeling intensity upon ADAP knock down (n=20–22 wells per condition). Labeling is normalized for the intensity of cell stain, which
shows similar density of cells in the different experimental groups. (C) Quantification of In-Cell-Westerns confirms a significant reduction of MAP2 labeling intensity in
ADAP knock-down samples. In contrast to dendritic growth measurement, co-expression of the rescue construct does not recover MAP2 expression levels. Data
are Mean ±SEM. p<0.05.
cytoplasmic tail, sorting to recycling endosomes and trafficking
to the plasma membrane (Schlomann et al., 2009; Tan
et al., 2012). Similarly, a re-localization of α5β1 integrins
from soma to the dendrite has been demonstrated during
dendrite formation and dendritic maturation in neurons of
the hippocampus and neocortex (Bi et al., 2001). In T-cells,
the ADAP/SKAP55/RAPL/MST1 complex associates with the
α-chain of LFA-1 and mediates its intracellular trafficking
(Kliche et al., 2012). We now show that suppression of ADAP
expression in hippocampal neurons reduces the amount of
activated β1-integrin on the surface of outgrowing dendrites,
while the labeling for total β1-integrin is increased in this
compartment. To be conservative in our evaluation, we
did not correct integrin surface labeling for the total size
of the cellular compartment. The fact that ADAP knock
down induces both reduced 9EG7 labeling and reduction in
dendritic growth may thus have led to an underestimation
of the former effect. This supports the hypothesis that the
ADAP/SKAP-HOM module in neuronal cells may be involved
in the inside-out activation of integrins during dendritic
Frontiers in Molecular Neuroscience | www.frontiersin.org 10 September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
FIGURE 6 | ADAP reduces baseline NF-κB activity in hippocampal neurons. (A) Under minimal medium conditions, the NF-κB-induced luciferase signal in
primary neurons is reduced in cells with ADAP knock down, irrespective of the presence of the rescue construct. By contrast, when grown under insulin
supplementation, a recovery to control levels becomes evident in the rescue group. Application of TNF-αincreases luciferase activity in all groups, indicating an
efficient activation of the canonical NF-κB pathway (N=3). (B) mRNA expression of p65 in primary culture peaks at DIV7 (N=3). Data are Mean ±SEM. p<0.05,
compared to DIV3.
differentiation. An apparent redistribution of β1-integrins
from the soma to the dendrites of ADAP deficient neurons
may occur as a compensatory change in these cells in order
to limit the detrimental effects of their reduced ‘‘inside-out’’
activation.
ADAP Knock Down Reduced MAP2
Expression in Developing Neurons
To assess the effect of ADAP knock down on neuronal
differentiation, we analyzed the growth of dendrites and the
expression of the differentiation marker MAP2 in these cells.
Both indices were significantly reduced upon shRNA-mediated
knock down, again, in analogy to the reduced production of
differentiation markers in ADAP-deficient T-cells. The reduction
of MAP2 levels may be considered as a mere marker of
reduced neuronal differentiation in ADAP knock-down cells.
However, this phenomenon may also be more directly involved
in the process as MAP2 is critical for dendritogenesis and
dendritic outgrowth (Bernhard et al., 1985; Harada et al.,
2002) and the level of MAP2 expression is controlled by
integrin stimulation in developing neurons (Domingo-Espín
et al., 2012; Jeon et al., 2012). Axonal growth was not
significantly affected in our experiments, but might well be
responsive to ADAP manipulation at an earlier time of
differentiation.
Various binding partners of ADAP exist that may be
involved in integrin activation and dendrite formation of primary
neurons. Our data suggest that ADAP may act in association
with SKAP-HOM, RAPL/MST1. We did not observe a co-
precipitation with the Talin-binding Rap1-effector RIAM, which
is found in an independent integrin-activating ADAP/SKAP55
module in T-cells (Kliche et al., 2012). Further, the interaction
of ADAP with Ena/VASP (Krause et al., 2000) may control
neuritogenesis via reorganization of the actin cytoskeleton
differentially in the presence and absence of integrin substrates
(Gupton and Gertler, 2010). Several association partners bind
ADAP dependent on its phosphorylation through the Src
family kinase c-Fyn (Sylvester et al., 2010). c-Fyn, in turn,
is involved in integrin activation in mouse hippocampus
(Bourgin et al., 2007) and firmly established as a factor
of neurite outgrowth including the semaphorin 3A-induced
dendritic branching of primary hippocampal neurons (Morita
et al., 2006). A possible Fyn-dependent interaction partner
of ADAP is Nck2, which has been implicated in growth
factor-induced neuritogenesis in PC12 cells (Guan et al.,
2007). Moreover, Crk has been specifically implicated in
dendritogenesis of hippocampal neurons induced by Reelin,
however, it did not affect dendrite growth under unstimulated
conditions as employed in our experiments (Matsuki et al.,
2008).
FIGURE 7 | Model of ADAP actions in neurons. In hippocampal neurons
ADAP exists in a complex with SKAP-HOM, RAPL and MST1. ADAP
stimulates the “inside out” activation of β1 integrins on the dendrites of these
neurons and enhances dendritic growth in primary hippocampal culture.
Modulation of NF-κB activity and MAP2 expression through ADAP may also
contribute to the dendritic development, but require further investigation as
they could not be rescued through the reconstitution of ADAP expression in
our experiments.
Frontiers in Molecular Neuroscience | www.frontiersin.org 11 September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
ADAP Deficiency Leads to a Reduction in
NF-κB Activity
Finally, reduced neuronal differentiation in ADAP deficient
cells may involve the deficits of NF-κB signaling. NF-κB
is constitutively active in glutamatergic neurons such as in
hippocampus (O’Neill and Kaltschmidt, 1997; Kaltschmidt and
Kaltschmidt, 2009) and crucial for dendritic growth, branching
and spine number (Gutierrez et al., 2005; Salama-Cohen et al.,
2006; O’Sullivan et al., 2010). In T-cells, a pool of ADAP
that is not associated to SKAP55 activates the canonical
NF-κB pathway after TCR/CD28-stimulation (Medeiros et al.,
2007). Our glia-free culture system allowed us to examine
cell autonomous ADAP effects in neurons largely independent
of stimulation of the NF-κB signaling pathway through glia-
derived cytokines. We probed the canonical pathway using
exogenous TNFα, but found no deficit in ADAP-deficient
cells, although a significantly reduced NF-κB activity was
evident under basal conditions. This suggests that ADAP can
stimulate NF-κB signaling in developing neurons but may be
dispensable for its activation through glia-derived cytokines.
Whether the observed decrease of baseline NF-κB activity is
due to a reduced integrin-mediated signaling mediated by
ADAP/SKAP-HOM/RAPL/MST1 or promoted by ADAP alone
remains to be determined. The lack of a rescue in NF-κB activity
upon ADAP re-expression might be related to insufficient re-
expression levels or a requirement of dynamic rather than
constitutive ADAP expression regulation in this function.
Nevertheless, the comparison with other knock down effects
suggests that ADAP-dependent NF-κB activity is dispensable
for dendritic outgrowth, but might play a role in MAP2
expression.
In summary, we demonstrate that the hematopoietic
adaptor protein ADAP is critical for the ‘‘inside-out’’
activation of β1-integrin and integrin-dependent dendritic
differentiation in hippocampal neurons. Several potential
interaction partners exist for ADAP that have been
implicated in neuronal development, suggesting that this
versatile adaptor protein may play a similarly important
role as an integrator of intracellular signals during
neuronal differentiation as described for T-cell development
(Figure 7).
AUTHOR CONTRIBUTIONS
MT, JT and IN performed cell culture experiments;
SK immunoprecipitation and Western analysis; BM generated
ADAP knock-down constructs; MT, SK and OS analyzed data
and wrote the manuscript.
ACKNOWLEDGMENTS
We are grateful to A. Koffi von Hoff for expert technical support
and Dr. Roland Hartig for help with confocal microscopy. The
study was supported by grants, from the German Research
foundation (CRC854, TP10 to OS and SK; TP12 to SK, STO488/4
to OS) and the federal state of Saxony-Anhalt and the ‘‘European
Regional Development Fund’’ (ERDF 2007-2013), Vorhaben:
Centre for Behavioral Brain Sciences (CBBS), to OS.
REFERENCES
Abram, C. L., and Lowell, C. A. (2009). The ins and outs of leukocyte integrin
signaling. Annu. Rev. Immunol. 27, 339–362. doi: 10.1146/annurev.immunol.
021908.132554
Albrecht, A., Thiere, M., Bergado-Acosta, J. R., Poranzke, J., Müller, B., and
Stork, O. (2013). Circadian modulation of anxiety: a role for somatostatin in
the amygdala. PLoS One 8:e84668. doi: 10.1371/journal.pone.0084668
Bernhard, R., Huber, G., and Matus, A. (1985). Differences in the developmental
patterns of three microtubule-associated proteins in the rat cerebellum.
J. Neurosci. 5, 977–991.
Bi, X., Lynch, G., Zhou, J., and Gall, C. M. (2001). Polarized distribution of α5
integrin in dendrites of hippocampal and cortical neurons. J. Comp. Neurol.
435, 184–193. doi: 10.1002/cne.1201
Block, H., Herter, J. M., Rossaint, J., Stadtmann, A., Kliche, S., Lowell, C. A.,
et al. (2012). Crucial role of SLP-76 and ADAP for neutrophil recruitment in
mouse kidney ischemia-reperfusion injury. J. Exp. Med. 209, 407–421. doi: 10.
1084/jem.20111493
Bourgin, C., Murai, K. K., Richter, M., and Pasquale, E. B. (2007). The
EphA4 receptor regulates dendritic spine remodeling by affecting β1-integrin
signaling pathways. J. Cell Biol. 178, 1295–1307. doi: 10.1083/jcb.2006
10139
Burbach, B. J., Srivastava, R., Ingram, M. A., Mitchell, J. S., and Shimizu, Y. (2011).
The pleckstrin homology domain in the SKAP55 adapter protein defines
the ability of the adapter protein ADAP to regulate integrin function and
NF-kappaB activation. J. Immunol. 186, 6227–6237. doi: 10.4049/jimmunol.
1002950
Burbach, B. J., Srivastava, R., Medeiros, R. B., Gorman, W. E. O., Peterson, E. J., and
Shimizu, Y. (2008). Distinct regulation of integrin-dependent T-cell conjugate.
J. Immunol. 181, 4840–4851. doi: 10.4049/jimmunol.181.7.4840
Dent, E. W., Gupton, S. L., and Gertler, F. B. (2011). The growth cone cytoskeleton
in axon outgrowth and guidance. Cold Spring Harb. Perspect. Biol. 3:a001800.
doi: 10.1101/cshperspect.a001800
Domingo-Espín, J., Petegnief, V., de Vera, N., Conchillo-Solé, O., Saccardo, P.,
Unzueta, U., et al. (2012). RGD-based cell ligands for cell-targeted drug delivery
act as potent trophic factors. Nanomedicine 8, 1263–1266. doi: 10.1016/j.nano.
2012.06.005
Engelmann, S., Togni, M., Kliche, S., Reinhold, D., Schraven, B., and Reinhold, A.
(2015). The adhesion- and degranulation-promoting adaptor protein and its
role in the modulation of experimental autoimmune encephalomyelitis. Crit.
Rev. Immunol. 35, 1–14. doi: 10.1615/critrevimmunol.2014012162
Fujita, H., Fukuhara, S., Sakurai, A., Yamagishi, A., Kamioka, Y., Nakaoka, Y., et al.
(2005). Local activation of Rap1 contributes to directional vascular endothelial
cell migration accompanied by extension of microtubules on which RAPL, a
Rap1-associating molecule, localizes. J. Biol. Chem. 280, 5022–5031. doi: 10.
1074/jbc.m409701200
Griffiths, E. K., and Penninger, J. M. (2002). ADAP-ting TCR signaling to
integrins. Sci. STKE 2002:re3. doi: 10.1126/stke.2002.127.re3
Guan, S., Chen, M., Woodley, D., and Li, W. (2007). Nckβadapter controls
neuritogenesis by maintaining the cellular paxillin level. Mol. Cell. Biol. 27,
6001–6011. doi: 10.1128/mcb.01807-06
Gupton, S. L., and Gertler, F. B. (2010). Integrin signaling switches the cytoskeletal
and exocytic machinery that drives neuritogenesis. Dev. Cell 18, 725–736.
doi: 10.1016/j.devcel.2010.02.017
Gutierrez, H., Hale, V. A., Dolcet, X., and Davies, A. (2005). NF-κB signalling
regulates the growth of neural processes in the developing PNS and CNS.
Development 132, 1713–1726. doi: 10.1242/dev.01702
Harada, A., Teng, J., Takei, Y., Oguchi, K., and Hirokawa, N. (2002). MAP2 is
required for dendrite elongation, PKA anchoring in dendrites and proper PKA
signal transduction. J. Cell Biol. 158, 541–549. doi: 10.1083/jcb.200110134
Frontiers in Molecular Neuroscience | www.frontiersin.org 12 September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
Hogg, N., Patzak, I., and Willenbrock, F. (2011). The insider’s guide to leukocyte
integrin signalling and function. Nat. Rev. Immunol. 11, 416–426. doi: 10.
1038/nri2986
Horn, J., Wang, X., Reichardt, P., Stradal, T. E., Warnecke, N., Simeoni, L.,
et al. (2009). Src homology 2-domain containing leukocyte-specific
phosphoprotein of 76 kDa is mandatory for TCR-mediated inside-out
signaling, but dispensable for CXCR4-mediated LFA-1 activation, adhesion
and migration of T cells. J. Immunol. 183, 5756–5767. doi: 10.4049/jimmunol.
0900649
Jeon, W. B., Park, B. H., Choi, S. K., Lee, K.-M., and Park, J.-K. (2012). Functional
enhancement of neuronal cell behaviors and differentiation by elastin-mimetic
recombinant protein presenting Arg-Gly-Asp peptides. BMC Biotechnol. 12:61.
doi: 10.1186/1472-6750-12-61
Kaech, S., and Banker, G. (2006). Culturing hippocampal neurons. Nat. Protoc. 1,
2406–2415. doi: 10.1038/nprot.2006.356
Kaltschmidt, B., and Kaltschmidt, C. (2009). NF-κB in the nervous system.
Cold Spring Harb. Perspect. Biol. 1:a001271. doi: 10.1101/cshperspect.
a001271
Kasirer-Friede, A., Kang, J., Kahner, B., Ye, F., Ginsberg, M. H., and Shattil, S. J.
(2014). ADAP interactions with talin and kindlin promote platelet integrin
αIIβ3 activation and stable fibrinogen binding. Blood 123, 3156–3165. doi: 10.
1182/blood-2013-08-520627
Kasirer-Friede, A., Moran, B., Nagrampa-Orje, J., Swanson, K., Ruggeri, Z. M.,
Schraven, B., et al. (2007). ADAP is required for normal alphaIIbeta3 activation
by VWF/GP Ib-IX-V and other agonists. Blood 109, 1018–1025. doi: 10.
1182/blood-2006-05-022301
Kerstein, P. C., Jacques-Fricke, B. T., Rengifo, J., Mogen, B. J., Williams, J. C.,
Gottlieb, P. A., et al. (2013). Mechanosensitive TRPC1 channels promote
calpain proteolysis of talin to regulate spinal axon outgrowth. J. Neurosci. 33,
273–285. doi: 10.1523/JNEUROSCI.2142-12.2013
Kliche, S., Breitling, D., Togni, M., Pusch, R., Heuer, K., Wang, X., et al. (2006). The
ADAP/SKAP55 signaling module regulates T-cell receptor-mediated integrin
activation through plasma membrane targeting of Rap1. Mol. Cell. Biol. 26,
7130–7144. doi: 10.1128/mcb.00331-06
Kliche, S., Worbs, T., Wang, X., Degen, J., Patzak, I., Meineke, B., et al. (2012).
CCR7-mediated LFA-1 functions in T cells are regulated by 2 independent
ADAP/SKAP55 modules. Blood 119, 777–785. doi: 10.1182/blood-2011-06-
362269
Krause, M., Sechi, A. S., Konradt, M., Monner, D., Gertler, F. B., and
Wehland, J. (2000). Fyn-binding protein (Fyb)/SLP-76-associated protein
(SLAP), Ena/vasodilator-stimulated phosphoprotein (VASP) proteins and the
Arp2/3 complex link T cell receptor (TCR) signaling to the actin cytoskeleton.
J. Cell Biol. 149, 181–194. doi: 10.1083/jcb.149.1.181
Lin, C.-Y., Lynch, G., and Gall, C. M. (2005). AMPA receptor stimulation increases
alpha5beta1 integrin surface expression, adhesive function and signaling.
J. Neurochem. 94, 531–546. doi: 10.1111/j.1471-4159.2005.03203.x
Margadant, C., Monsuur, H. N., Norman, J. C., and Sonnenberg, A. (2011).
Mechanisms of integrin activation and trafficking. Curr. Opin. Cell Biol. 23,
607–614. doi: 10.1016/j.ceb.2011.08.005
Marie-Cardine, A., Verhagen, A. M., Eckerskorn, C., and Schraven, B.
(1998). SKAP-HOM, a novel adaptor protein homologous to the FYN-
associated protein SKAP55. FEBS Lett. 435, 55–60. doi: 10.1016/s0014-5793(98)
01040-0
Marrs, G. S., Honda, T., Fuller, L., Thangavel, R., Balsamo, J., Lilien, J., et al.
(2006). Dendritic arbors of developing retinal ganglion cells are stabilized
by β1-integrins. Mol. Cell. Neurosci. 32, 230–241. doi: 10.1016/j.mcn.2006.
04.005
Matsuki, T., Pramatarova, A., and Howell, B. W. (2008). Reduction of Crk
and CrkL expression blocks reelin-induced dendritogenesis. J. Cell Sci. 121,
1869–1875. doi: 10.1242/jcs.027334
Medeiros, R. B., Burbach, B. J., Mueller, K. L., Srivastava, R., Moon, J. J., Highfill,
S., et al. (2007). Regulation of NF-κB activation in T-cells via association of
the adapter proteins ADAP and CARMA1. Science 316, 754–758. doi: 10.
1126/science.1137895
Ménasché, G., Kliche, S., Bezman, N., and Schraven, B. (2007). Regulation of T-cell
antigen receptor-mediated inside-out signaling by cytosolic adapter proteins
and Rap1 effector molecules. Immunol. Rev. 218, 82–91. doi: 10.1111/j.1600-
065x.2007.00543.x
Mikenberg, I., Widera, D., Kaus, A., Kaltschmidt, B., and Kaltschmidt, C. (2007).
Transcription factor NF-κB is transported to the nucleus via cytoplasmic
dynein/dynactin motor complex in hippocampal neurons. PLoS One 2:e589.
doi: 10.1371/journal.pone.0000589
Mitchell, J. S., Burbach, B. J., Srivastava, R., Fife, B. T., and Shimizu, Y. (2013).
Multistage T cell—dendritic cell interactions control optimal CD4 T cell
activation through the ADAP-SKAP55-signaling module. J. Immunol. 191,
2372–2383. doi: 10.4049/jimmunol.1300107
Moresco, E. M. Y., Donaldson, S., Williamson, A., and Koleske, A. J. (2005).
Integrin-mediated dendrite branch maintenance requires abelson (Abl)
family kinases. J. Neurosci. 25, 6105–6118. doi: 10.1523/JNEUROSCI.1432-
05.2005
Morita, A., Yamashita, N., Sasaki, Y., Uchida, Y., Nakajima, O., Nakamura,
F., et al. (2006). Regulation of dendritic branching and spine maturation
by semaphorin3A-fyn signaling. J. Neurosci. 26, 2971–2980. doi: 10.
1523/JNEUROSCI.5453-05.2006
Musci, M. A., Hendricks-Taylor, L. R., Motto, D. G., Paskind, M., Kamens,
J., Turck, C. W., et al. (1997). Molecular cloning of SLAP-130, an SLP-76-
associated substrate of the T cell antigen receptor-stimulated protein tyrosine
kinases. J. Biol. Chem. 272, 11674–11677. doi: 10.1074/jbc.272.18.11674
Myers, J. P., Santiago-Medina, M., and Gomez, T. M. (2011). Regulation of axonal
outgrowth and pathfinding by integrin-ECM interactions. Dev. Neurobiol. 71,
901–923. doi: 10.1002/dneu.20931
O’Neill, L. A., and Kaltschmidt, C. (1997). NF-κB: a crucial transcription factor
for glial and neuronal cell function. Trends Neurosci. 20, 252–258. doi: 10.
1016/s0166-2236(96)01035-1
Oh, H. J., Lee, K. K., Song, S. J., Jin, M. S., Song, M. S., Lee, J. H., et al. (2006). Role
of the tumor suppressor RASSF1A in Mst1-mediated apoptosis. Cancer Res. 66,
2562–2569. doi: 10.1158/0008-5472.CAN-05-2951
O’Sullivan, N. C., Croydon, L., McGettigan, P. A., Pickering, M., and Murphy, K. J.
(2010). Hippocampal region-specific regulation of NF-κB may contribute
to learning-associated synaptic reorganisation. Brain Res. Bull. 81, 385–390.
doi: 10.1016/j.brainresbull.2009.11.001
Peterson, E. J. (2003). The TCR ADAPts to integrin-mediated cell
adhesion. Immunol. Rev. 192, 113–121. doi: 10.1034/j.1600-065x.2003.
00026.x
Peterson, E. J., Woods, M. L., Dmowski, S. A., Derimanov, G., Jordan, M. S., Wu,
J. N., et al. (2001). Coupling of the TCR to integrin activation by Slap-130/Fyb.
Science 293, 2263–2265. doi: 10.1126/science.1063486
Raab, M., Smith, X., Matthess, Y., Strebhardt, K., and Rudd, C. E. (2011). SKAP1
protein PH domain determines RapL membrane localization and Rap1 protein
complex formation for T cell receptor (TCR) activation of LFA-1. J. Biol. Chem.
286, 29663–29670. doi: 10.1074/jbc.M111.222661
Rehberg, K., Kliche, S., Madencioglu, D. A., Thiere, M., Müller, B., Meineke, B. M.,
et al. (2014). The serine/threonine kinase ndr2 controls integrin trafficking
and integrin-dependent neurite growth. J. Neurosci. 34, 5342–5354. doi: 10.
1523/JNEUROSCI.2728-13.2014
Reinhold, A., Reimann, S., Reinhold, D., Schraven, B., and Togni, M. (2009).
Expression of SKAP-HOM in DCs is required for an optimal immune response
in vivo.J. Leukoc. Biol. 86, 61–71. doi: 10.1189/jlb.0608344
Rubinson, D. A., Dillon, C. P., Kwiatkowski, A. V., Sievers, C., Yang, L., Kopinja, J.,
et al. (2003). A lentivirus-based system to functionally silence genes in primary
mammalian cells, stem cells and transgenic mice by RNA interference. Nat.
Genet. 33, 401–406. doi: 10.1038/ng1117
Salama-Cohen, P., Arévalo, M.-Á., Grantyn, R., and Rodríguez-Tébar, A. (2006).
Notch and NGF/p75NTR control dendrite morphology and the balance
of excitatory/inhibitory synaptic input to hippocampal neurones through
Neurogenin 3. J. Neurochem. 97, 1269–1278. doi: 10.1111/j.1471-4159.2006.
03783.x
Schlomann, U., Schwamborn, J. C., Müller, M., Fässler, R., and Püschel, A. W.
(2009). The stimulation of dendrite growth by Sema3A requires integrin
engagement and focal adhesion kinase. J. Cell Sci. 122, 2034–2042. doi: 10.
1242/jcs.038232
Schmid, R. S., and Anton, E. S. (2003). Role of integrins in the development
of the cerebral cortex. Cereb. Cortex 13, 219–224. doi: 10.1093/cercor/13.
3.219
Schultz, C., König, H.-G., Del Turco, D., Politi, C., Eckert, G. P., Ghebremedhin,
E., et al. (2006). Coincident enrichment of phosphorylated IκBα, activated IKK
Frontiers in Molecular Neuroscience | www.frontiersin.org 13 September 2016 | Volume 9 | Article 91
Thiere et al. ADAP Controls Integrin-Dependent Dendrite Growth
and phosphorylated p65 in the axon initial segment of neurons. Mol. Cell.
Neurosci. 33, 68–80. doi: 10.1016/j.mcn.2006.06.008
Sekine, K., Kawauchi, T., Kubo, K.-I., Honda, T., Herz, J., Hattori, M., et al. (2012).
Reelin controls neuronal positioning by promoting cell-matrix adhesion via
inside-out activation of integrin α5β1. Neuron 76, 353–369. doi: 10.1016/j.
neuron.2012.07.020
Sholl, D. A. (1953). Dendritic organization in the neurons of the visual and motor
cortices of the cat. J. Anat. 87, 387–406.
Srivastava, R., Burbach, B. J., and Shimizu, Y. (2010). NF-κB activation in T cells
requires discrete control of IκB kinase α/β(IKKalpha/beta) phosphorylation
and IKKγubiquitination by the ADAP adapter protein. J. Biol. Chem. 285,
11100–11105. doi: 10.1074/jbc.m109.068999
Sylvester, M., Kliche, S., Lange, S., Geithner, S., Klemm, C., Schlosser, A., et al.
(2010). Adhesion and degranulation promoting adapter protein (ADAP) is a
central hub for phosphotyrosine-mediated interactions in T cells. PLoS One
5:e11708. doi: 10.1371/journal.pone.0011708
Tan, C. L., Andrews, M. R., Kwok, J. C. F., Heintz, T. G. P., Gumy, L. F., Fässler,
R., et al. (2012). Kindlin-1 enhances axon growth on inhibitory chondroitin
sulfate proteoglycans and promotes sensory axon regeneration. J. Neurosci. 32,
7325–7335. doi: 10.1523/JNEUROSCI.5472-11.2012
Tan, C. L., Kwok, J. C. F., Heller, J. P. D., Zhao, R., Eva, R., and Fawcett, J. W.
(2015). Full length talin stimulates integrin activation and axon regeneration.
Mol. Cell. Neurosci. 68, 1–8. doi: 10.1016/j.mcn.2015.03.011
Thaker, Y. R., Schneider, H., and Rudd, C. E. (2015). TCR and CD28 activate the
transcription factor NF-κB in T-cells via distinct adaptor signaling complexes.
Immunol. Lett. 163, 113–119. doi: 10.1016/j.imlet.2014.10.020
Togni, M., Engelmann, S., Reinhold, D., Schraven, B., and Reinhold, A. (2012).
The adapter protein ADAP is required for selected dendritic cell functions. Cell
Commun. Signal. 10:14. doi: 10.1186/1478-811x-10-14
Togni, M., Swanson, K. D., Reimann, S., Kliche, S., Pearce, A. C., Simeoni, L.,
et al. (2005). Regulation of in vitro and in vivo immune functions by the
cytosolic adaptor protein SKAP-HOM. Mol. Cell. Biol. 25, 8052–8063. doi: 10.
1128/MCB.25.18.8052-8063.2005
Wang, H., Liu, H., Lu, Y., Lovatt, M., Wei, B., and Rudd, C. E. (2007).
Functional defects of SKAP-55-deficient T cells identify a regulatory role for the
adaptor in LFA-1 adhesion. Mol. Cell. Biol. 27, 6863–6875. doi: 10.1128/MCB.
00556-07
Wang, H., and Rudd, C. E. (2008). SKAP-55, SKAP-55-related and ADAP
adaptors modulate integrin-mediated immune-cell adhesion. Trends Cell Biol.
18, 486–493. doi: 10.1016/j.tcb.2008.07.005
Wang, H., Wei, B., Bismuth, G., and Rudd, C. E. (2009). SLP-76-ADAP
adaptor module regulates LFA-1 mediated costimulation and T cell motility.
Proc. Natl. Acad. Sci. U S A 106, 12436–12441. doi: 10.1073/pnas.0900
510106
Warren, M. S., Bradley, W. D., Gourley, S. L., Lin, Y.-C., Simpson, M. A.,
Reichardt, L. F., et al. (2012). Integrin β1 signals through Arg to regulate
postnatal dendritic arborization, synapse density and behavior. J. Neurosci. 32,
2824–2834. doi: 10.1523/JNEUROSCI.3942-11.2012
Witte, A., Degen, J., Baumgart, K., Waldt, N., and Kuropka, B. (2012). Emerging
roles of ADAP, SKAP55 and SKAP-HOM for integrin and NF-κB signaling in
T cells. J. Clin. Cell. Immunol. S12:002. doi: 10.4172/2155-9899.S12-002
Wu, X., and Reddy, D. S. (2012). Integrins as receptor targets for neurological
disorders. Pharmacol. Ther. 134, 68–81. doi: 10.1016/j.pharmthera.2011.
12.008
Xiang, H., Hochman, D. W., Saya, H., Fujiwara, T., Schwartzkroin, P. A., and
Morrison, R. S. (1996). Evidence for p53-mediated modulation of neuronal
viability. J. Neurosci. 16, 6753–6765.
Yang, D., Bruun, D., Andreas, D., and Lein, P. (2010). Method for shipping
live cultures of dissociated rat hippocampal neurons. Curr. Neurobiol. 1,
95–98.
Zhang, Y., and Wang, H. (2012). Integrin signalling and function in immune cells.
Immunology 135, 268–275. doi: 10.1111/j.1365-2567.2011.03549.x
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Copyright © 2016 Thiere, Kliche, Müller, Teuber, Nold and Stork. This is an open-
access article distributed under the terms of the Creative Commons Attribution
License (CC BY). The use, distribution and reproduction in other forums is
permitted, provided the original author(s) or licensor are credited and that the
original publication in this journal is cited, in accordance with accepted academic
practice. No use, distribution or reproduction is permitted which does not comply
with these terms.
Frontiers in Molecular Neuroscience | www.frontiersin.org 14 September 2016 | Volume 9 | Article 91
... For GAD67, the oligonucleotide sequence 5 ′ -GCTGGAAGTGGTAGACATACT-3' (corresponding to NM 008077, base pairs 616-636 in mouse and NM017007 base pairs 531-551, in rat) was used in the same manner. A random sequence shRNA ((5 ′ -TCGTCATGACGTGCATAGG -3 ′ (Thiere et al., 2016), and an anti-luciferase shRNA (shLuc) from pMIR-mU6-Luc (Rehberg et al., 2014) were used as controls. All shRNA constructs under U6 promoter were cloned into pll3.7 vector (Rubinson et al., 2003) using Hpa1-Xho1 restriction sites. ...
Article
Full-text available
A high degree of regional, temporal and molecular specificity is evident in the regulation of GABAergic signaling in stress-responsive circuitry, hampering the use of systemic GABAergic modulators for the treatment of stress-related psychopathology. Here we investigated the effectiveness of local intervention with the GABA synthetic enzymes GAD65 and GAD67 in the dorsal dentate gyrus (dDG) vs ventral DG (vDG) to alleviate anxiety-like behavior and stress-induced symptoms in the rat. We induced shRNA-mediated knock down of either GAD65 or GAD67 with lentiviral vectors microinjected into the dDG or vDG of young adult male rats and examined anxiety behavior, learning and memory performance. Subsequently we tested whether reducing GAD65 expression in the dDG would also confer resilience against juvenile stress-induced behavioral and physiological symptoms in adulthood. While knock down of either isoform in the vDG increased anxiety levels in the open field and the elevated plus maze tests, the knock down of GAD65, but not GAD67, in the dDG conferred a significant reduction in anxiety levels. Strikingly, this manipulation also attenuated juvenile stress evoked anxiety behavior, cognitive and synaptic plasticity impairments. Local GABAergic circuitry in the DG plays an important and highly region-specific role in control of emotional behavior and stress responding. Reduction of GAD65 expression in the dDG appears to provide resilience to juvenile stress-induced emotional and cognitive deficits, opening a new direction towards addressing a significant risk factor for developing stress and trauma-related psychopathologies later in life.
... Two kinases of the Hippo-NDR signaling pathway, that is, Trc and Wts work in concert to establish and maintain dendritic fields, respectively (Emoto, 2012). Dendritic development in Hippocampal neurons is regulated by β1-integrin-hematopoietic adaptor protein adhesion and degranulation promoting adapter protein (ADAP)-mediated activation of Hippo kinase MST1 (Thiere et al., 2016). Moreover, angiomotin (AMOT) tune dendritic morphogenesis in Purkinje cells and in hippocampal cells by forming a complex with YAP1. ...
Article
Hippo signaling pathway is a highly conserved and familiar tissue growth regulator, primarily dealing with cell survival, cell proliferation, and apoptosis. The Yes‐associated protein (YAP) is the key transcriptional effector molecule, which is under negative regulation of the Hippo pathway. Wealth of studies have identified crucial roles of Hippo/YAP signaling pathway during the process of development, including the development of neuronal system. We provide here, an overview of the contributions of this signaling pathway at multiple stages of neuronal development including, proliferation of neural stem cells (NSCs), migration of NSCs toward their destined niche, maintaining NSCs in the quiescent state, differentiation of NSCs into neurons, neuritogenesis, synaptogenesis, brain development, and in neuronal apoptosis. Hyperactivation of the neuronal Hippo pathway can also lead to a variety of devastating neurodegenerative diseases. Instances of aberrant Hippo pathway leading to neurodegenerative diseases along with the approaches utilizing this pathway as molecular targets for therapeutics has been highlighted in this review. Recent evidences suggesting neuronal repair and regenerative potential of this pathway has also been pointed out, that will shed light on a novel aspect of Hippo pathway in regenerative medicine. Our review provides a better understanding of the significance of Hippo pathway in the journey of neuronal system from development to diseases as a whole.
... MST1 participates in long-term potentiation and spatial memory processes [112]. Further research shows that MST1 serves as an important component in the dendritic development of hippocampal neurons [113]. A recent study showed that MST1 might participate in the regulation of brain size, and an interrupted interaction between CDK5RAP2 and MST1 might be relevant in autosomal recessive primary microcephaly [114]. ...
Article
As central components of the Hippo signaling pathway in mammals, the mammalian Sterile 20-like kinase 1 (MST1) and MST2 protein kinases regulate cell proliferation, survival and death and are involved in the homeostasis of many tissues. Recent studies have elucidated the roles of MST1 and MST2 in the nervous system and immune system, particularly in neurological disorders, which are influenced by aging. In this review, we provide a comprehensive overview of these research areas. First, the activation mechanisms and roles of MST1 and MST2 in neurons, non-neuronal cells and immune cells are introduced. The roles of MST1 and MST2 in neurological disorders, including brain tumors, cerebrovascular diseases, neurodegenerative disorders, and neuromuscular disorders, are then presented. Finally, the existing obstacles for further research are discussed. Collectively, the information compiled herein provides a common framework for the function of MST1 and MST2 in the nervous system, should contribute to the design of further experiments, and sheds light on potential treatments for aging associated neurological disorders.
... Primary cultures of hippocampal neurons were obtained from embryonic 18-19-d Sprague-Dawley rats (Jin and Selkoe, 2015;Thiere et al., 2016). The isolated hippocampus was dissociated with trypsin, and the cells were plated on a 24-well culture plate coated with poly-D-lysine and containing Neurobasal medium supplemented with B27 (Gibco, Waltham, MA, USA). ...
Article
Full-text available
The amygdala plays a key role in the pathophysiology of depression, but the molecular mechanisms underlying amygdalar hyperactivity in depression remain unclear. In this study, we used a chronic mild stress (CMS) protocol to separate susceptible and insusceptible rat subgroups. Proteomes in the amygdalae were analyzed differentially across subgroups based on labeling with isobaric tags for relative and absolute quantitation (iTRAQ) combined with mass spectrometry. Of 2,562 quantified proteins, 102 were differentially expressed. Several proteins that might be associated with the stress insusceptibility/susceptibility difference, including synapse-related proteins, were identified in the amygdala. Immunoblot analysis identified changes in VGluT1, NMDA GluN2A and GluN2B and AMPA GluA1 receptors, and PSD-95, suggesting that CMS perturbs glutamatergic transmission in the amygdala. Changes in these regulatory and structural proteins provide insight into the molecular mechanisms underlying the abnormal synaptic morphological and functional plasticity in the amygdalae of stress-susceptible rats. Interestingly, the expression level of CaMKIIβ, potentially involved in regulation of glutamatergic transmission, was significantly increased in the susceptible group. Subsequent in vitro experimentation showed that overexpression of CaMKIIβ increased the expression of PSD-95 and GluA1 in cultured hippocampal neurons. This result suggested that CaMKIIβ functions upstream from PSD-95 and GluA1 to affect LTP-based postsynaptic functional plasticity in the amygdalae of susceptible rats. Therefore, amygdalar CaMKIIβ is a potential antidepressant target. Collectively, our findings contribute to a better understanding of amygdalar synaptic plasticity in depression.
Article
The adhesion and degranulation-promoting adapter protein (ADAP) is expressed in T cells, NK cells, myeloid cells, and platelets. The involvement of ADAP in the regulation of receptor-mediated inside-out signaling leading to integrin activation is well characterized, especially in T cells and in platelets. Due to the fact that animal studies using conventional knock-out mice are limited by the overlapping effects of the different ADAP-expressing cells, we generated conditional ADAP knock-out mice (ADAP fl/fl PF4-Cre tg ). We observed that loss of ADAP restricted to the megakaryocytic lineage has no impact on other hematopoietic cells even after stimulation conditions. ADAP fl/fl PF4-Cre tg mice showed thrombocytopenia in combination with reduced plasma levels of PF4 and TGF-β1. In vitro, platelets from these mice revealed reduced P-selectin expression, lower TGF-β1 release, diminished integrin αIIbβ3 activation and decreased fibrinogen binding after stimulation with podoplanin, the ligand of the C-type lectin-like receptor-2 (CLEC-2). Furthermore, loss of ADAP was associated with impaired CLEC-2-mediated activation of PLCγ2 and Erk1/2. Induction of experimental autoimmune encephalomyelitis (EAE) in mice lacking ADAP expression in platelets caused a more severe disease. In vivo administration of TGF-β1 early after T cell transfer improved EAE severity in mice with loss of ADAP restricted to platelets. Our results reveal a regulatory function of ADAP in platelets in vitro and during autoimmune disease EAE in vivo.
Article
Full-text available
Integrin function is regulated by activation involving conformational changes that modulate ligand-binding affinity and downstream signaling. Activation is regulated through inside-out signaling which is controlled by many signaling pathways via a final common pathway through kindlin and talin, which bind to the intracellular tail of beta integrins. Previous studies have shown that the axon growth inhibitory molecules NogoA and chondroitin sulphate proteoglycans (CSPGs) inactivate integrins. Overexpressing kindlin-1 in dorsal root ganglion (DRG) neurons activates integrins, enabling their axons to overcome inhibitory molecules in the environment, and promoting regeneration in vivo following dorsal root crush. Other studies have indicated that expression of talin head alone or with kindlin can enhance integrin activation. Here, using adult rat DRG neurons, we investigate the effects of overexpressing various forms of talin on axon growth and integrin signaling. We found that overexpression of talin head activated axonal integrins but inhibited downstream signaling via FAK, and did not promote axon growth. Similarly, co-expression of talin head and kindlin-1 prevented the growth-promoting effect of kindlin-1, suggesting that talin head acts as a form of dominant negative for integrin function. Using full-length talin constructs in PC12 cells we observed that neurite growth was enhanced by expression of wild-type talin and more so by two 'activated' forms of talin produced by point mutation (on laminin and aggrecan-laminin substrata). Nevertheless, co-expression of full-length talin with kindlin did not promote neurite growth more than either molecule alone. In vivo, we find that talin is present in PNS axons (sciatic nerve), and also in CNS axons of the corticospinal tract. Copyright © 2015. Published by Elsevier Inc.
Article
Full-text available
The transcription factor NF-κB is needed for the induction of inflammatory responses in T-cells. Whether its activation by the antigen-receptor and CD28 is mediated by the same or different intracellular signaling pathways has been unclear. Here, using T-cells from various knock-out (Cd28−/−, adap−/−) and knock-in (i.e. Cd28 Y-170F) mice in conjunction with transfected Jurkat T-cells, we show that the TCR and CD28 use distinct pathways to activate NF-κB in T-cells. Anti-CD28 ligation alone activated NF-κB in primary and Jurkat T-cells as measured by NF-κB reporter and EMSA assays. Anti-CD28 also activated NF-κB normally in primary T-cells from adap−/− mice, while anti-CD3 stimulation required the adaptor ADAP. Over-expression of ADAP or its binding partner SKAP1 failed to enhance anti-CD28 activation of NF-κB, while ADAP greatly increased anti-CD3 induced NF-κB activity. By contrast, CD28 activation of NF-κB depended on GRB-2 binding to CD28 as seen in CD28 deficient Jurkat T-cells reconstituted with the CD28 YMN-FM mutant, and in primary T-cells from CD28 Y170F mutant knock-in mice. CD28 associated with GRB-2, and GRB-2 siRNA impaired CD28 NF-κB activation. GRB-2 binding partner and guanine nucleotide exchange factor, VAV1, greatly enhanced anti-CD28 driven activation of NF-κB. Further, unlike in the case of anti-CD28, NF-κB activation by anti-CD3 and its cooperation with ADAP was strictly dependent on LAT expression. Overall, we provide evidence that CD28 and the TCR complex regulate NF-κB via different signaling modules of GRB-2/VAV1 and LAT/ADAP pathways respectively.
Article
Full-text available
Integrins have been implicated in various processes of nervous system development, including proliferation, migration, and differentiation of neuronal cells. In this study, we show that the serine/threonine kinase Ndr2 controls integrin-dependent dendritic and axonal growth in mouse hippocampal neurons. We further demonstrate that Ndr2 is able to induce phosphorylation at the activity- and trafficking-relevant site Thr(788/789) of β1-integrin to stimulate the PKC- and CaMKII-dependent activation of β1-integrins, as well as their exocytosis. Accordingly, Ndr2 associates with integrin-positive early and recycling endosomes in primary hippocampal neurons and the surface expression of activated β1-integrins is reduced on dendrites of Ndr2-deficient neurons. The role of Ndr2 in dendritic differentiation is also evident in vivo, because Ndr2-null mutant mice show arbor-specific alterations of dendritic complexity in the hippocampus. This indicates a role of Ndr2 in the fine regulation of dendritic growth; in fact, treatment of primary neurons with Semaphorin 3A rescues Ndr2 knock-down-induced dendritic growth deficits but fails to enhance growth beyond control level. Correspondingly, Ndr2-null mutant mice show a Semaphorin 3A(-/-)-like phenotype of premature dendritic branching in the hippocampus. The results of this study show that Ndr2-mediated integrin trafficking and activation are crucial for neurite growth and guidance signals during neuronal development.
Chapter
NF-кB is a transcription factor with inducible activity present in all neuronal cell types (O’Neill & Kaltschmidt, 1997). Bona fide NF-кB in the nervous system was first described in 1993, consisting of inducible DNA-binding complexes composed of p50 and p65 subunits (Kaltschmidt et al., 1993b). This evidence and the already well-characterized role of NF-кB in the immune system and in inflammation prompted us to propose potential roles of NF-кB in many different neurological diseases (Kaltschmidt et al., 1993a). Now about ten years after, we are happy to summarize the large body of evidence in literature, which proves many of the initial work and extended the field in so many novel directions.
Article
RNA interference (RNAi) has recently emerged as a specific and efficient method to silence gene expression in mammalian cells either by transfection of short interfering RNAs (siRNAs; ref. 1) or, more recently, by transcription of short hairpin RNAs (shRNAs) from expression vectors and retroviruses. But the resistance of important cell types to transduction by these approaches, both in vitro and in vivo, has limited the use of RNAi. Here we describe a lentiviral system for delivery of shRNAs into cycling and non-cycling mammalian cells, stem cells, zygotes and their differentiated progeny. We show that lentivirus-delivered shRNAs are capable of specific, highly stable and functional silencing of gene expression in a variety of cell types and also in transgenic mice. Our lentiviral vectors should permit rapid and efficient analysis of gene function in primary human and animal cells and tissues and generation of animals that show reduced expression of specific genes. They may also provide new approaches for gene therapy.
Article
T cell receptor (TCR)-driven activation of helper T cells induces a rapid polarization of their cytoskeleton towards bound antigen presenting cells (APCs). We have identified the Fyn- and SLP-76–associated protein Fyb/SLAP as a new ligand for Ena/ vasodilator-stimulated phosphoprotein (VASP) homology 1 (EVH1) domains. Upon TCR engagement, Fyb/SLAP localizes at the interface between T cells and anti-CD3–coated beads, where Evl, a member of the Ena/VASP family, Wiskott-Aldrich syndrome protein (WASP) and the Arp2/3 complex are also found. In addition, Fyb/SLAP is restricted to lamellipodia of spreading platelets. In activated T cells, Fyb/SLAP associates with Ena/VASP family proteins and is present within biochemical complexes containing WASP, Nck, and SLP-76. Inhibition of binding between Fyb/SLAP and Ena/VASP proteins or WASP and the Arp2/3 complex impairs TCR-dependent actin rearrangement, suggesting that these interactions play a key role in linking T cell signaling to remodeling of the actin cytoskeleton.
Article
Adaptor proteins mediate protein-protein interactions in signal transduction cascades. These signaling molecules are organized in multimolecular complexes that translate information from cell surface receptors into cellular responses. The cytosolic adhesion- and degranulation-promoting adaptor protein (ADAP) is expressed in T cells, natural killer cells, myeloid cells, and platelets. Here we summarize the data about the function of ADAP in these cells with respect to their contribution to the pathogenesis of experimental autoimmune encephalomyelitis. We discuss possible mechanisms of strongly attenuated experimental autoimmune encephalomyelitis in ADAP-deficient mice.
Article
ADAP is a hematopoietic-restricted adapter protein that promotes integrin activation and is a carrier for other adapter proteins, Src kinase-associated phosphoprotein 1 (SKAP1) and SKAP2. In T lymphocytes, SKAP1 is the ADAP-associated molecule that activates integrins through direct linkages with Rap1 effectors (regulator of cell adhesion and polarization enriched in lymphoid tissues; Rap1-interacting adapter molecule). ADAP also promotes integrin αIIbβ3 activation in platelets, which lack SKAP1, suggesting an ADAP integrin-regulatory pathway different from those in lymphocytes. Here we characterized a novel association between ADAP and 2 essential integrin-β cytoplasmic tail-binding proteins involved in αIIbβ3 activation, talin and kindlin-3. Glutathione S-transferase pull-downs identified distinct regions in ADAP necessary for association with kindlin or talin. ADAP was physically proximal to talin and kindlin-3 in human platelets, as assessed biochemically, and by immunofluorescence microscopy and proximity ligation. Relative to wild-type mouse platelets, ADAP-deficient platelets exhibited reduced co-localization of talin with αIIbβ3, and reduced irreversible fibrinogen binding in response to a protease activated receptor 4 (PAR4) thrombin receptor agonist. When ADAP was heterologously expressed in Chinese hamster ovary cells co-expressing αIIbβ3, talin, PAR1, and kindlin-3, it associated with an αIIbβ3/talin complex and enabled kindlin-3 to promote agonist-dependent ligand binding to αIIbβ3. Thus, ADAP uniquely promotes activation of and irreversible fibrinogen binding to platelet αIIbβ3 through interactions with talin and kindlin-3.