Structural insights into the assembly and regulation of distinct viral capsid complexes

Abstract

The assembly and regulation of viral capsid proteins into highly ordered macromolecular complexes is essential for viral replication. Here, we utilize crystal structures of the capsid protein from the smallest and simplest known viruses capable of autonomously replicating in animal cells, circoviruses, to establish structural and mechanistic insights into capsid morphogenesis and regulation. The beak and feather disease virus, like many circoviruses, encode only two genes: a capsid protein and a replication initiation protein. The capsid protein forms distinct macromolecular assemblies during replication and here we elucidate these structures at high resolution, showing that these complexes reverse the exposure of the N-terminal arginine rich domain responsible for DNA binding and nuclear localization. We show that assembly of these complexes is regulated by single-stranded DNA (ssDNA), and provide a structural basis of capsid assembly around single-stranded DNA, highlighting novel binding interfaces distinct from the highly positively charged N-terminal ARM domain.

Full text

ARTICLE
Received 2 May 2016 |Accepted 25 Aug 2016 |Published 4 Oct 2016
Structural insights into the assembly and regulation
of distinct viral capsid complexes
Subir Sarker1,2, Marı
´a C. Terro
´n3, Yogesh Khandokar4, David Araga
˜o5, Joshua M. Hardy6, Mazdak Radjainia6,
Manuel Jime
´nez-Zaragoza7, Pedro J. de Pablo7,8, Fasse
´li Coulibaly6, Daniel Luque3, Shane R. Raidal1,2
& Jade K. Forwood2,4
The assembly and regulation of viral capsid proteins into highly ordered macromolecular
complexes is essential for viral replication. Here, we utilize crystal structures of the capsid
protein from the smallest and simplest known viruses capable of autonomously replicating
in animal cells, circoviruses, to establish structural and mechanistic insights into capsid
morphogenesis and regulation. The beak and feather disease virus, like many circoviruses,
encode only two genes: a capsid protein and a replication initiation protein. The capsid protein
forms distinct macromolecular assemblies during replication and here we elucidate these
structures at high resolution, showing that these complexes reverse the exposure of the
N-terminal arginine rich domain responsible for DNA binding and nuclear localization.
We show that assembly of these complexes is regulated by single-stranded DNA (ssDNA),
and provide a structural basis of capsid assembly around single-stranded DNA, highlighting
novel binding interfaces distinct from the highly positively charged N-terminal ARM domain.
DOI: 10.1038/ncomms13014 OPEN
1School of Animal and Veterinary Sciences, Charles Sturt University, Boorooma Street, Wagga Wagga, New South Wales 2678, Australia. 2Graham Centre
for Agricultural Innovation, NSW Department of Primary Industries and Charles Sturt University, Boorooma Street, Wagga Wagga, New South Wales 2678,
Australia. 3Centro Nacional de Microbiologı
´a/ISCIII, Majadahonda, Madrid 28220, Spain. 4School of Biomedical Sciences, Charles Sturt University,
Wagga Wagga, New South Wales 2678, Australia. 5Australian Synchrotron, 800 Blackburn Road, Clayton, Victoria 3168, Australia. 6Infection and Immunity
Program, Monash Biomedicine Discovery Institute and Department of Biochemistry and Molecular Biology, Monash University, Melbourne, Victoria 3800,
Australia. 7Fı
´sica de la Materia Condensada, Universidad Auto
´noma de Madrid, 28049 Madrid, Spain. 8Insituto de Fı
´sica de la Materia Condensada
(IFIMAC), Universidad Auto
´noma de Madrid, 28049 Madrid, Spain. Correspondence and requests for materials should be addressed to J.K.F. (email:
jforwood@csu.edu.au) or to S.R.R. (email: shraidal@csu.edu.au) or to F.C. for cryoEM (email: fasseli.coulibaly@monash.edu).
NATURE COMMUNICATIONS | 7:13014 | DOI: 10.1038/ncomms13014 | www.nature.com/naturecommunications 1

The assembly of viral capsid proteins into large macro-
molecular complexes is essential for viral replication.
Circoviruses, the smallest and simplest of all viruses
known to autonomously replicate in vertebrates, represent models
of biological efficiency, harbouring only two genes encoded
within a two kilobase (kb) single-stranded DNA (ssDNA)
genome. During replication, the capsid protein forms distinct
assemblies ranging from large non-enveloped spherical capsid
virions with icosahedral symmetry to smaller complexes localized
in the cytoplasm and nucleus1–4. How disparate and complex
molecular assemblies associate from single viral proteins remains
to be resolved at a molecular level, particularly for assemblies that
switch between icosahedral and non-icosahedral symmetry and
present different functional modalities. Here, we present three
high-resolution X-ray crystallographic structures for distinct
macromolecular assemblies of the capsid (Cap) protein from
the beak and feather disease virus (BFDV), a circovirus infecting
critically endangered parrots. These complexes include a 10 nm
assembly, resolved at 2.0 Å and comprised of two face-to-face
pentamers of the Cap molecules, and two 17 nm assemblies
comprised of 60 Cap monomers in the absence and presence of
ssDNA, determined to 2.5 and 2.3 Å resolution respectively in the
same space group, arranged as 12 pentamers. These assemblies
exhibit distinct monomeric and pentameric units, and unique
inverted morphologies that reverse the accessibility of the DNA
binding and nuclear localization signal (NLS) domains present
within the N-terminal arginine rich motif (ARM), important for
viral assembly. We also show that assembly is highly influenced
by ssDNA, and have elucidated cryo electron microscopy
(cryoEM) and crystal structures of the capsid protein bound to
ssDNA, identifying an unexpected DNA-binding interface. Our
results provide unique insights into a regulation mechanism of
viral capsid morphogenesis based on ssDNA recognition that
couples assembly and genome packaging.
Results
Structural characterization of capsid assemblies. To carry out
genome replication, most DNA viruses invade the nucleus of a
host cell to utilize polymerases and other host enzymes. Circo-
viruses, harbouring as few as two genes, lack an autonomous
DNA polymerase and depend on the high-fidelity host machinery
for de novo DNA synthesis by rolling circle replication5. However,
unlike many non-enveloped animal DNA viruses such as
parvoviruses, adenoviruses and polyomavirus which replicate in
the nucleus with accumulated mature virus particles released by
karyolysis or apoptotic pathways, pathogenic circoviruses cause
large globular intracytoplasmic inclusions composed of
paracrystalline virus arrays (Supplementary Fig. 1). In addition
to these paracrystalline array assemblies, circovirus capsid
proteins have been shown to exist in multiple conformational
assemblies during replication, including small intracytoplasmic
non-membrane bound assemblies of 0.1–0.5 mm, larger
membrane bound inclusion bodies of 0.5–5.0 mm, intranuclear
inclusion bodies composed of circular virus complexes of
10–12 nm, as well as fully mature, single icosahedral virus like
particles (VLPs) of 17 nm (refs 1–4). These assemblies reflect in
part the multiple functions performed by Cap, some of which
extend beyond its structural role. Once internalized, Cap recruits
host dynein/microtubule machinery to travel through the
cytoplasm towards the nuclear membrane6. Passage of viral
molecules across the nuclear pore complex occurs via protein
importation routes directed by NLSs in the flexible ARM domain
of Cap which are recognized by host receptors of the importin
family and other cofactors7.Cap also interacts with the
replicase associated protein8, mediates DNA binding, and can
self-associate to form a range of intracellular assemblies1–4,7.
To better understand the capacity of capsid proteins to form
different assemblies, the BFDV-Cap protein was recombinantly
expressed, purified and confirmed by EM and atomic force
microscopy (AFM) to form both VLPs of B17 nm and the
smaller assembly of B10 nm, matching those observed during
infection1–4 (Fig. 1 and Supplementary Fig. 2). To resolve these
complexes at atomic resolution, a combination of crystallography
and EM approaches were employed. X-ray diffraction to 2.0Å
enabled the atomic coordinates of the 10 nm complex to be
elucidated. Ten capsid molecules with D5-symmetry were present
Pentamer 1
Pentamer 1
Pentamer 2
10-mer
Pentamer 2
10 nm
Pentamer
=12x
=12x
+=
60-mer
17 nm
50 nm
Figure 1 | Structural characterization of two distinct BFDV-Cap complexes. Left panel, negatively stained electron micrograph of the BFDV Cap protein
shows two populations corresponding to VLPs (red box), and a smaller assembly of B10 nm in diameter (blue box). Right panel, X-ray crystal structures
allow modelling of the two complexes to 2.0 Å (10 nm, top), and 2.5 Å (17 nm, bottom). The smaller complex is comprised of 10 Cap molecules arranged as
two interlocking discs, with each disc containing five Cap molecules. The larger VLP is comprised of 12 pentamers arranged with T¼1 icosahedral symmetry.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms13014
2NATURE COMMUNICATIONS | 7:13014 | DOI: 10.1038/ncomms13014 | www.nature.com/naturecommunications

in the asymmetric unit (ASU; Fig. 1, Table 1) (ref. 9), and all
capsid monomers within the ASU were structurally equivalent,
with the greatest root mean square deviation (r.m.s.d.) between
any two monomers o0.5 Å. Each Cap monomer was comprised
of a canonical viral jelly roll10 built of two, four-stranded
antiparallel b-sheets, with sheet one comprised of b-strands B, I,
D, G, and the other sheet comprised of b-strands C, H, E, F
(Supplementary Fig. 3). These monomers associate tightly to
form two pentamers in a face-to-face orientation, analogous to
two interlocking discs (Fig. 1). The assembly buries an extensive
surface area of 13,650 Å2, of which 60% is associated between
monomers contained within each pentamer, and 40% buried at
the interface between the two pentamers (Supplementary Fig. 4).
Monomers within each pentamer are arranged radially around a
central pore of B7 Å, with Tyr115 exposed at the surface of the
pore, and Val117 lining the inner surface (Supplementary Fig. 5).
Each monomer within a pentamer associates with two adjacent
monomers, burying 1,660 Å2of surface area, and these
interactions are mediated through salt bridge (SB) interactions
and an extensive hydrogen bonding (HB) network
(Supplementary Table 1, Supplementary Fig. 4). Interactions
between the two pentamers are also extensive, with every Cap
monomer forming interactions with two Cap molecules in
adjacent pentamers, burying 655 and 415 Å2of surface area at
each interface. These interactions are predominantly mediated
through hydrogen bond (HB) interactions (Supplementary
Table 1). The overall diameter of the decameric assembly is
10 nm, and encloses an internal volume11 of 306,078 Å3,B1/7
the volume of the fully mature virus capsid assembly (see below).
Interestingly, the N-termini of every Cap monomer is positioned
towards the exterior of the assembly, and therefore the highly
positively charged N-terminal ARMdomains (14IRRRYARPYRRR
HIRRYRRRRRHF37), crucial for DNA binding and association
with nuclear import receptors, are highly accessible as modelled
using I-tasser12 in Fig. 2. This contrasts strongly with the 60-mer
Cap assembly where all N-termini are buried within the interior
of the virus (see below and Fig. 2). The ability of the virus to
present these functional domains is important for localizing Cap
to the nucleus, allowing co-localization with newly replicated viral
ssDNA, as well as interaction and packaging of the viral DNA.
Premature formation of icosahedral VLPs (see ‘Discussion’
section) would internalize and mask these domains, causing
mis-localization and segregation of the capsid from its ssDNA
genome. The ability of ssDNA to influence the equilibrium
between these two species is also presented below.
The crystal structure of the second assembly identified in
electron micrographs (Fig. 1) and infected tissue1–4 was resolved
to 2.3 Å and comprised of sixty capsid molecules arranged as
twelve pentamers (Fig. 1). Five capsid proteins were present in the
ASU, with the unit cell comprised of 480 Cap proteins arranged
as eight icosahedral VLPs. The assembly buries a total surface
area of 182,920 Å2(compared with 13,650 Å2in the 10-mer), with
Table 1 | Data collection and refinement statistics.
Cap 10-mer 5J09 Cap 60-mer 5J36 Cap 60-mer:ssDNA 5J37
Data collection
Space group P2
1
2
1
2
1
F432 F432
Cell dimensions
a,b,c(Å) 78.8, 148.4, 188.6 377.3, 377.3, 377.3 377.3, 377.3, 377.3
a,b,g(°) 90, 90, 90 90, 90, 90 90, 90, 90
Resolution (Å) 30–2.0 (2.03–2.0)* 34–2.55 (2.60–2.55) 40–2.3 (2.34–2.30)
R
pim
0.043 (0.241) 0.075 (0.438) 0.067 (0.416)
I/s(I) 10.7 (2.9) 7.3 (1.6) 7.5 (1.6)
CC
1/2
0.99 (0.87) 0.99 (0.68) 0.99 (0.70)
Completeness (%) 99.2 (98.0) 99.9 (99.8) 100.0 (100.0)
Redundancy 4.4 (4.1) 9.1 (7.1) 8.6 (5.9)
Refinement
Resolution (Å) 30–2.0 (2.07–2.00) 34–2.55 (2.64–2.55) 40–2.3 (2.38–2.30)
No. unique reflections 149,556 (14,483) 74,754 (7,344) 101,169 (9,985)
R
work
0.2079 (0.2462) 0.1912 (0.2542) 0.1729 (0.2430)
R
free
0.2385 (0.2879) 0.2162 (0.2861) 0.1970 (0.2743)
No. atoms 15,272 8,662 9,275
Protein 13,865 8,310 8,135
Ligand ssDNA NA NA 480
Ligand PO
4
NA 25 25
Water 1,407 327 635
Bfactors 28.09 35.35 32.5
Protein 27.54 35.25 32.4
Ligand ssDNA NA NA 66.0
Ligand PO
4
NA 97.9 45.8
Water 33.6 33.0 34.0
R.m.s. deviations
Bond lengths (Å) 0.002 0.002 0.003
Bond angles (°) 0.58 0.57 0.64
Ramachandran plot (%)
Favoured 98 98 98
Allowed 2 2 2
Outliers 0 0 0
Rotamer outliers (%) 1.1 0.78 0.56
Clashscore 1.12 0.60 0.88
NA, not applicable; r.m.s, root mean square; ssDNA, single-strand DNA.
*Values in parentheses are for highest-resolution shell.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms13014 ARTICLE
NATURE COMMUNICATIONS | 7:13014 | DOI: 10.1038/ncomms13014 | www.nature.com/naturecommunications 3

a notable shift in the ratio of intra- and inter-pentamer
interactions, the majority now occurring between pentamers
(68% involved in inter-pentamer interactions compared with 40%
in the decamer). The interactions that occur within the pentamer
are comparable to the 10 nm assembly, with each capsid burying
1,934 Å2, mediated through 22 HB and 4 SB (compared with
1,660 Å2for the 10-mer assembly). Each pentamer interacts with
five other pentamers, and every Cap molecule within a pentamer
interacts with three other Cap molecules from other pentamers.
Two sets of these interactions are identical and together bury
3,390 Å2(through 52 HBs, 4 SBs; Extended Data Table 1), and the
third interaction site buries 774 Å2(mediated through eight HBs,
Supplementary Table 1). The diameter of the VLP is 17 nm,
corresponding to the size of the infectious particle, and exhibits a
volume of 2,171,590 Å3. Structural comparison with the porcine
circovirus2 (PCV2) VLP, the only other circovirus VLP structure
to be determined to date, reveals an r.m.s.d of 2.19 Å over 210
residues13 between the monomeric units, a slightly reduced
internal volume of 2,034,684 Å3of the VLP, less buried surface
area of 141,240 Å2(compared with 182,920 Å2of the BFDV VLP)
and a reduction in the number of bonds that mediate VLP
formation (1,020 for PCV2; 2,700 for BFDV; see Extended Data
Table 1 for full interactions). The most striking differences lie at
the centre of the 3-fold axis symmetry, where in BFDV, two
insertions of eight and four residues (EDLTTANQ
182
; GGPN
203
)
create protruding loops from the VLP and extensive interactions
(see Supplementary Table 1 for complete list of interactions).
Thus while these axes have been reported to create a valley in the
PCV2 VLP (ref. 13), these regions represent some of the most
protruded areas in the BFDV VLP.
Since both BFDV Cap assemblies are comprised of pentameric
protomers, we tested whether these units could be computation-
ally interchanged within respective assemblies. Superimposition
of pentamers within the biological unit of each complex revealed
that neither pentamer could substitute within the respective
assembly, moreover superimposition of individual Cap proteins
also produced major steric clashes within respective complexes
(Supplementary Fig. 6). Key differences within the Cap molecules
reside predominantly within the loop regions of the smaller
b-sheet jelly roll domain (CHEF), spanning residues 42–46,
77–97, 126–153 and 166–211 (Supplementary Fig. 6). Differences
in buried surface area between the two assemblies, 182,920 Å2for
the 60-mer, and 13,650 Å2for the 10-mer, suggests that the
60-mer should be highly favoured; however, analysis by AFM and
EM shows a higher proportion of the 10-mer complexes in the
absence of ssDNA (Fig. 3). We proposed that this is due to a
destabilizing effect caused from the repulsion of the highly
positively charged ARM domains present within the 60-mer
when ssDNA is not packaged (see Figs 2 and 3; overall charge of
the virus interior is þ1,960 in the absence of ssDNA). To test
whether the presence of ssDNA could stabilize the assembly of a
full virus capsid, we compared the assemblies in the absence and
presence of a ssDNA oligonucleotide. We found that in the
presence of ssDNA, 60-mer particles were highly favoured with
10-mer complexes almost non-existent in electron micrographs
(Fig. 3). This transition may be highly informative for virus
assembly; the synthesis of the Cap and newly synthesized viral
ssDNA occurs in cytoplasm and nucleus respectively, thus
segregated by the nuclear envelope. Premature assembly of the
60-mer Cap particles in the cytoplasm would produce empty
VLP’s and also mask the NLS and DNA-binding domains,
preventing co-localization and packaging of viral ssDNA in the
nucleus. Thus, in the absence of DNA, Cap preferentially forms
10-mer complexes, where the highly accessible ARM domains can
mediate nuclear localization and DNA binding (Fig. 3). Once
Cap is localized to the nucleus, the presence of the ssDNA viral
genome favours the 60-mer assembly since the strong positively
charged repulsive forces are neutralized by binding the ssDNA
viral genome. Interestingly, the overall positive charge of the
N-terminal Cap molecules in the 60-mer assembly ( þ1,960) is
almost exactly equal to the ssDNA charge of the viral genome
(B2 kb ssDNA genome), creating a neutral and comparatively
RRRYARPYRRRHIRRYRRRRRHFRRRR
NLS/DNA BD Jelly roll domain
10-mer
60-mer
Inverted exposure of
NLS/DNA
binding domain
10-mer
60-mer
N-terminal domain immuno-labelling
200 nm
Figure 2 | The N-terminal ARM domain accessibility is inverted in Cap complexes. X-ray crystal structures reveal that the N-termini of all Cap molecules
are positioned on the exterior and interior of the 10- and 60-mer complexes respectively (top panel). The accessibility of the highly positively charged
N-terminal ARM domains containing both NLS and DNA-binding activity, modelled using I-tasser12 in blue cartoon, is confirmed in electron microscopy
immunogold-labelling experiments of the N-terminal domain.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms13014
4NATURE COMMUNICATIONS | 7:13014 | DOI: 10.1038/ncomms13014 | www.nature.com/naturecommunications

stable particle (Fig. 3). This is supported in our stability assays
(Fig. 3, bottom panels), and consistent with other studies
demonstrating that nucleotide binding promotes spontaneous
formation of VLPs (ref. 13).
Structural basis of BFDV-Cap interaction with ssDNA.
Analysis of the electrostatic charges on the interior and exterior
surfaces of the particles revealed a highly positively charged
interior surface, and a possible additional interface for DNA
binding (Supplementary Fig. 7). These positively charged surfaces
are distinct from the positively charged ARM domains, and
mediated through dense clusters of internalized Lys and Arg
residues (R
46
,R
51
,R
100
,K
102
,K
105
,R
109
,K
154
,K
155
,R
160
,K
163
,
R
164
,R
167
,K
169
,K
230
). To determine the precise mechanism of
DNA binding, we co-crystallized the BFDV-Cap protein in the
presence of ssDNA labelled with AlexaFluor488 and Alexa-
Fluor647. Crystals diffracting to 2.3 Å formed in the presence of
labelled DNA were highly fluorescent (Supplementary Fig. 8), and
displayed clear positive difference density (Supplementary Fig. 8)
corresponding to ssDNA. The capsid-DNA complex, modelled
and refined to an R-factor/Free R-factor (R-work/Rfree) of 0.173
and 0.197, respectively, revealed an extensive array of electrostatic
interactions with each ssDNA chain interacting with residues T
49
,
R
51
,K
102
,L
103
,K
105
,K
163
,L
165
,Y
234
,Q
236
of one Cap chain, K
154
,
K
155
of an adjacent chain within the pentamer, and F
42
, and R
46
of an adjacent, inter-pentamer chain (Fig. 4). That each ssDNA
chain spans three Cap monomers, both within and across pen-
tameric protomers is consistent with the increased stability
observed in our assays (Fig. 3). These DNA-binding residues are
highly conserved in BFDV genomes (Supplementary Fig. 9). In
total, 180 nucleotides are modelled on the interior surface of the
capsid, and cryoEM data suggests that the remaining unmodelled
ssDNA would occupy the interior of the virus capsid assembly,
thus shielding the positively charged ARM domains (Fig. 4).
Our results provide detailed, high-resolution structural insights
into ssDNA-mediated regulation of viral Cap assembly into
distinct complexes with inverted functional domains. This has
important implications for rationalizing antibodies against
N-terminal domain fragments previously reported in the
literature, but not structurally resolved13. Understanding these
complexes also provides a platform for the delivery of novel
therapies, with the decameric structure representing the smallest
viral nano-cage (Supplementary Fig. 10), exhibiting highly
desirable properties including a charged interior surface capable
of binding small interfering RNA sequences, and exposure of the
N-terminus providing a plethora of cell specific tags to be
engineered to direct viral assemblies.
Methods
Cloning, expression and purification.The target gene encoding BFDV-Cap
residues 14–247 was amplified from a plasmid containing the BFDV entire genome
(KF385406) and cloned into the pMCSG21 expression vector by ligation
independent cloning using the specific primers; forward primer TACTTCCAAT
CCAATGCCAGACGACGATATGCCCGCCCA and reverse primer TTATCCAC
TTCCAATGTTATTAAGTACTGGGATTGTTAGGGGCAAAC where the bolded
nucleotides are required for the ligation independent cloning procedure14 and the
underlined nucleotides are complementary to the gene sequence. This construct
encodes an N-terminal 6-his tag, TEV protease site, and residues encoding the
BFDV-Cap protein. The fidelity of the construct was confirmed by DNA
sequencing and the recombinant plasmid overexpressed in Escherichia coli BL21
(DE3) Rosetta 2 cells (Novagen, USA). A 5 ml Luria–Bertani (LB) starter culture
containing 100 mgml1spectinomycin was used to inoculate 500 ml of LB
expression media. The cells were grown at 37 °CtoanOD
600
of 0.6, the
temperature lowered to 25 °C, and protein expression induced by addition of 1 mM
Externalized NLS allows
interaction with nuclear
import receptor
IMPORTIN
Packaging of ∼2 kb ssDNA
genome creates a neutral
and stable virus particle and
favours 60-mer assembly
Viral genome
ssDNA
ssDNA
No
ssDNA
No ssDNA
Positively charged
repulsion of interior
(+1960) favours 10-
mer assembly
TEV assay
1234 1234 1234
AssayStability
0 h 24 h
Figure 3 | The population of the two viral complexes is regulated by ssDNA. Negatively stained images of Cap complexes (see electron micrograph
inserts in top panel) reveal 10-mer complexes are highly favoured in the absence of ssDNA, while ssDNA promotes 60-mer particle assembly. This is
highly intuitive for the localization of Cap to the nucleus, as well as its interaction and packaging of the ssDNA viral genome. Synthesis of Cap molecules,
occurring in the cytoplasm which is segregated from its ssDNA genome, require an accessible NLS and DNA-binding domains for interaction with nuclear
import receptors and viral ssDNA respectively. Under these conditions, the 10-mer complexes are favoured over the 60-mer, which if formed in the
cytoplasm would render these functional domains inaccessible, inhibiting nuclear localization and interaction with ssDNA. This is supported by Tobacco
Etch Virus (TEV) and stability Assays (bottom panels), showing that in the absence of ssDNA (lane 1), the N-termini are exposed and susceptible to TEV
proteolysis (left panel), and that the protein is less stable (right panel). Premature assembly of empty VLPs are limited in the absence of ssDNA due to the
strong repulsive forces of the positively charged ARM domains. In the presence of ssDNA (lane 2), but not double-stranded DNA (lane 3) or plasmid DNA
(lane 4), 60-mer particles are strongly favoured (see micrograph inserted in top panel). In the nucleus, the presence of ssDNA promotes the formation of
60-mer particles that are more stable, with the negatively charged ssDNA neutralizing the charge of the positively charged N-terminal ARM domains.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms13014 ARTICLE
NATURE COMMUNICATIONS | 7:13014 | DOI: 10.1038/ncomms13014 | www.nature.com/naturecommunications 5

isopropyl-b-D-1-thiogalactopyranoside (IPTG; Sigma). Following expression for
12 h at 25 °C, the cells were collected by centrifugation at 6,000 r.p.m. for 30 min
and the cell pellet resuspended in buffer A, containing 20mM N-cyclohexyl-3-
aminopropanesulfonic acid, pH 10.5, 500 mM NaCl, 30 mM imidazole, pH 10.5
and stored at 20 °C. The bacterial cells were lysed by two repetitive freeze-thaw
cycles in the presence of 20 mg lysozyme, 0.5 mg of DNaseI and FastBreak Cell
Lysis buffer (1X; Promega). Lysates were centrifuged at 15,000 r.p.m. for 30 min at
4°C, and the supernatant filtered through a 0.45 mm low protein-binding filter and
applied to a 5 ml Ni2þcolumn (HisTrap HP, GE Healthcare) preequilibrated with
buffer A. Following extensive washing of the column (410 column volumes) the
protein was eluted using an increasing gradient of buffer B (20 mM N-cyclohexyl-
3-aminopropanesulfonic acid, pH 10.5, 500 mM NaCl and 500 mM imidazole,
pH 10.5). Elution fractions were pooled and further purified by size exclusion
chromatography (Superdex 200 column, GE healthcare) in GST-A containing
20 mM Tris pH 8.0, 125 mM NaCl. The peak fractions were pooled and
concentrated to 15 mg ml 1using an Amicon ultrafiltration device (Millipore), the
purity assessed by SDS–PAGE to be 495% pure, aliquoted and stored at 80 °C.
Crystallization.Crystallization experiments were performed using the hanging
drop vapour diffusion method and screened using commercially available screens
(PEG/Ion, PEG/Ion 2, Crystal Screen, Crystal Screen 2, ProPlex and PACT
premier) in VDX 48-well plates from Hampton Research. The crystallization drops
consisted of 1.5 ml of protein solution mixed with 1.5 ml of reservoir solution,
suspended above 300 ml of reservoir solution and incubated at 290 K. Small crystals
obtained from the screens were optimized by varying the precipitant, buffer, salt
concentrations and additives. The final crystallization conditions for the 10-mer
contained 1.1 M ammonium sulfate, Tris (pH 8.5) and 0.1 M iron chloride;
final crystallization conditions for the 60-mer contained 0.8 M Na/K hydrogen
phosphate (pH 7.4). Crystals formed in the presence of HPLC purified ssDNA
contained the fluorescent labelled dye at the 3’ end and following sequences
(BFDVRepAlexaFlour488: 50-CCGGACGCAAAATGAAGGAAGTCGCGCGAGA
GTTCCC-30; BFDVRepAlexaFlour647: 50-CGCGGTGACCGTCTCTCGCCACAA
TGCCCA-30) purchased from Sigma-Aldrich, USA.
Data collection and structure determination.All crystals were collected and
cryoprotected in the well reservoir solution containing 25% glycerol and imme-
diately flash-cooled in liquid nitrogen. All diffracted data were collected at the
Australian Synchrotron on the MX2 macromolecular crystallography beamline.
All data sets were indexed, integrated and scaled using the program iMOSFLM
(ref. 15) and scaled with Aimless from the ccp4 suite16,17. The structure was solved
by molecular replacement with the program Phaser9using a modified model of
residues 46 to 246 of the PCV2 capsid virion from PCV2 (ref. 13) as a search model
(B30% sequence identity). Refinement and model building was performed in
Phenix refine18 and COOT, respectively (see Table 1)19. Lack of electron density
for the N-terminal 6-His tag and ARM domains precluded modelling of these
regions and were not present in the final structure.
Stability and TEV cleavage assay.Each reaction contained purified BFDV-Cap
(360 mg) mixed with 2 mM of ssDNA, dsDNA and ds-plasmid DNA in a final
volume of 30 ml. In the absence of DNA, the volume of the reaction mixture was
adjusted with respective buffer. The stability of the BFDV-Cap proteins were
assessed by centrifugation to remove precipitated proteins, and the supernatant
analysed by SDS–PAGE after 0 and 24 h incubation at room temperature. Tobacco
etch virus (TEV) assays were performed by treating the samples with 5 ml of TEV
(3.3 mg ml 1), and assessed by SDS–PAGE after 1 h incubation.
Negative stain and immuno-labelling electron microscopy.For negative
staining, samples were applied to glow-discharged carbon-coated grids and stained
with 2% aqueous uranyl acetate. For immunogold labelling, complexes were
applied to glow-discharged carbon-coated grids and the grids were blocked with
TNE buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 5 mM EDTA), 5% normal
goat serum, 1% BSA. Monoclonal aHis serum was incubated for 45 min, followed
by three washes with TNE, 0.5% normal goat serum, 0.1% BSA. The samples were
then incubated with aMouse antibody conjugated to 5-nm gold particles for 1 h,
washed and negatively stained as above. Images were recorded on a 1 k Gatan CCD
camera in a Tecnai 12 FEI microscope operated at 120 kV. Samples containing
ssDNA contained the following synthetically produced oligonucleotide: 50-CGCG
GTGACCGTCTCTCGCCACAATGCCCA-30.
Transmission electron microscopy.Feather samples for transmission electron
microscopy were fixed in 5% glutaraldehyde in phosphate buffer with 1% calcium
chloride (200:1) and stored for 2 h at room temperature. Fixed tissues were washed
in Sorenson’s buffer and covered with Dalton’s Chrome Osmic Acid for 1.5 h at
4°C. The samples were then dehydrated with 70, 90, 95 and 100% ethanol then in
two changes of propylene oxide over 15 min. Samples were placed in propylene
oxide/EPON 812 (60:40) for 1 h at 4 °C before being embedded in capsules for 24 h
at 6 °C. Ultra-thin sections were cut at 90 nm and placed on 200 mesh copper grids,
stained with uranyl acetate for 5–7 min, washed and then stained with lead citrate
X-ray crystal structure of cap 60-mer
bound to ssDNA Detailed cap:DNA interactions
CryoEM
**R46
R51
**F42
T49 Q236
K102
L103
L165
K163
*K155
*K154
Y234
K105
Full view Cut away view
Capsid protein
ssDNA
R192
K102 R167
K163
K154
K163
R41
R167
Figure 4 | X-ray crystal and cryoEM structures of the Cap:ssDNA complex reveal novel ssDNA binding sites. Top panel: Crystal diffraction of the
Cap:ssDNA complex to 2.3 Å enabled modelling of 180 nucleotides (spheres) on the interior of the capsid (cartoon). Detailed interactions are presented in
the top right panel, involving a range of side-chain interactions (presented as sticks). Residues listed with * and ** are from adjacent Cap monomers within
and external to a pentameric protomer, respectively. A cryoEM reconstruction of the Cap:ssDNA complex (bottom panel) to 4.5 Å revealed density
supporting the modelled ssDNA in the crystal structure, contiguous to the centre of the VLP (bottom panel). Electron density corresponding to the capsid
protein is coloured in brown. The surface of the capsid interacting with the DNA is coloured in magenta. The remaining electron density is represented as a
blue mesh both in the difference map (bottom left panel) and the full reconstruction (middle panel).
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms13014
6NATURE COMMUNICATIONS | 7:13014 | DOI: 10.1038/ncomms13014 | www.nature.com/naturecommunications

for 4 min. Sections were washed thoroughly by dipping the grid in distilled water
then allowed to dry on clean filter paper.
Atomic force microscopy.Measurements were performed with an AFM (Nanotec
Electro
´nica, Madrid, Spain) operating in Jumping mode plus (Ortega-Esteban),
using force-versus-Z-piezo-displacement curves at every point after a nanometric
lateral displacement of the tip when it is far from the sample. Rectangular
silicon-nitride cantilevers (RC800PSA, Olympus, Center Valley, PA) with a nom-
inal spring constant of 0.05 N m 1were used and calibrated by Sader’s method20,
thus allowing to take images at low forces (between 60 and 90 pN). The
experiments were carried out in a liquid medium composed of 5 ml of BFDV
complexes with or without ssDNA (at a concentra tion of 1 mg ml 1in 50 mM
Tris, 125 mM NaCl), diluted in 45 ml of 50 mM Tris, 125 mM NaCl to a final
concentration of 0.1 mg ml 1. Each sample was incubated for 15 min on a fresh
highly ordered pyrolytic graphite surface (ZYA quality; NT-MDT, Tempe, AZ) and
washed with buffer until a volume of 100 ml was reached. The tip was also
prewetted with a 30 ml drop of buffer before image acquisition. Images were
processed using the WSxM software21.
Cryo electron microscopy.Five microlitres of sample was applied to a glow-
discharged holey carbon grid (Quantifoil R1.2/1.3) for preparing frozen-hydrated
specimen using a Vitrobot Mark IV (FEI) with a 3 s blotting time at 100%
humidity. Grids were transferred under liquid nitrogen to a Titan Krios trans-
mission EM (FEI) operated at 300 kV and set for parallel illumination. One second
exposures with a calibrated magnification of B127, 000 (corresponding to a pixel
size of 1.02 Å on the specimen) were automatically recorded on a Falcon 2 camera
(FEI) in movie mode using a dose rate of 45 electrons per second controlled by data
acquisition software EPU (FEI). The corresponding 17 sub-frames were fractio-
nated in 7 frames as follows: Sub-frame 1 was discarded. Sub-frames 2–7 were
recorded as frames 1–6, respectively. Sub-frames 8–16 were pooled and integrated
as frame 7. Sub-frame 17 was discarded. The defocus was set to a range of 0.6mmto
3.5 mm in intervals of 0.2 mm.
Image processing.Movies were integrated in EMAN 2 (ref. 22) by averaging all
seven frames. RELION 1.4 (ref. 23) was used as wrapper for CTF estimation with
CTFFIND3 (ref. 24) and for evaluating integrated images for astigmatism and drift.
Approximately 60,000 particles were automatically selected from a small subset of
the remaining images using the swarm tool of the e2boxer.py program of EMAN2.
Two dimensional classification of this initial data set in RELION 1.4 provided class
averages that served as templates for particle selection across all retained images
using the autopick function in RELION 1.4. Particles were extracted with a box size
of 400 400 pixels and subjected to another round of 2D classification in RELION
1.4 yielding high-quality class averages. Three representative classes were subjected
to the e2initialmodel.py program in EMAN2 for generating an initial model. The
initial model was low-pass filtered to 60 Å and provided to 3D classification in
RELION 1.4 for disentangling the full data set into homogenous subsets. Particles
assigned to the best 3D class were further refined using the ‘gold-standard’
approach in RELION 1.4. Beam-induced movements were corrected by movie
processing and particle polishing only extracting frames 1–6 of the movies and
without a shifting particles average. Resolution of the final reconstructions was
determined using the gold-standard Fourier Shell Correlation (FSC) criterion:
FSC ¼0.143. The pixel size was determined to be 1.02 Å by optimization of the fit
of the crystal structure of Cap into the cryoEM reconstruction using Chimera. A
difference map between the fitted crystal structure of Cap and the cryoEM
reconstruction was computed in Chimera.
Data availability.Structures described in this manuscript have been deposited in
Protein Data Bank under accession code 5J09, 5J36, and 5J37 for the 10-mer,
60-mer and 60-mer þssDNA structures, respectively. The cryo-EM data has been
deposited and issued the code EMDB-8306. The authors declare that all other data
supporting the findings of this study are included in the manuscript and its
Supplementary Files or are available from the corresponding author on request.
References
1. Li, L. et al. Circovirus in tissues of dogs with vasculitis and hemorrhage. Emerg.
Infect. Dis. 19, 534–541 (2013).
2. Rodriguez-Carino, C. et al. Porcine circovirus type 2 morphogenesis in a clone
derived from the l35 lymphoblastoid cell line. J. Comp. Pathol. 144, 91–102 (2011).
3. Rodriguez-Carino, C. & Segales, J. Ultrastructural findings in lymph nodes
from pigs suffering from naturally occurring postweaning multisystemic
wasting syndrome. Vet. Pathol. 46, 729–735 (2009).
4. Stevenson, G. W., Kiupel, M., Mittal, S. K. & Kanitz, C. L. Ultrastructure of porcine
circovirus in persistently infected PK-15 cells. Vet. Pathol. 36, 368–378 (1999).
5. Cheung, A. K. Palindrome regeneration by template strand-switching
mechanism at the origin of DNA replication of porcine circovirus via the
rolling-circle melting-pot replication model. J. Virol. 78, 9016–9029 (2004).
6. Cao, J. et al. Circovirus transport proceeds via direct interaction of the
cytoplasmic dynein IC1 subunit with the viral capsid protein. J. Virol. 89,
2777–2791 (2015).
7. Patterson, E. I., Dombrovski, A. K., Swarbrick, C. M., Raidal, S. R.
& Forwood, J. K. Structural determination of importin alpha in complex with
beak and feather disease virus capsid nuclear localization signal. Biochem.
Biophys. Res. Commun. 438, 680–685 (2013).
8. Heath, L., Williamson, A. L. & Rybicki, E. P. The capsid protein of beak and
feather disease virus binds to the viral DNA and is responsible for transporting
the replication-associated protein into the nucleus. J. Virol. 80, 7219–7225 (2006).
9. McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Crystallogr. 40,
658–674 (2007).
10. Harrison, S. C., Olson, A. J., Schutt, C. E., Winkler, F. K. & Bricogne, G. Tomato
bushy stunt virus at 2.9 A resolution. Nature 276, 368–373 (1978).
11. Voss, N. R. & Gerstein, M. 3V: cavity, channel and cleft volume calculator and
extractor. Nucleic Acids Res. 38, W555–W562 (2010).
12. Yang, J. et al. The I-TASSER Suite: protein structure and function prediction.
Nat. Methods 12, 7–8 (2015).
13. Khayat, R. et al. The 2.3-angstrom structure of porcine circovirus 2. J. Virol. 85,
7856–7862 (2011).
14. Eschenfeldt, W. H., Lucy, S., Millard, C. S., Joachimiak, A. & Mark, I. D.
A family of LIC vectors for high-throughput cloning and purification of
proteins. Methods Mol. Biol. 498, 105–115 (2009).
15. Battye, T. G., Kontogiannis, L., Johnson, O., Powell, H. R. & Leslie, A. G.
iMOSFLM: a new graphical interface for diffraction-image processing with
MOSFLM. Acta Crystallogr. D Biol. Crystallogr. 67, 271–281 (2011).
16. Evans, P. R. & Murshudov, G. N. How good are my data and what is the
resolution? Acta Crystallogr. D Biol. Crystallogr. 69, 1204–1214 (2013).
17. Winn, M. D. et al. Overview of the CCP4 suite and current developments.
Acta Crystallogr. D Biol. Crystallogr. 67, 235–242 (2011).
18. Adams, P. D. et al. PHENIX: a comprehensive Python-based system for
macromolecular structure solution. Acta Crystallogr. D Biol. Crystallogr. 66,
213–221 (2010).
19. Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development
of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501 (2010).
20. Li, R., Ye, H., Zhang, W., Ma, G. & Su, Y. An analytic model for accurate
spring constant calibration of rectangular atomic force microscope cantilevers.
Sci. Rep. 5, 15828 (2015).
21. Horcas, I. et al. WSXM: a software for scanning probe microscopy and a tool
for nanotechnology. Rev. Sci. Instrum. 78, 013705 (2007).
22. Tang, G. et al. EMAN2: an extensible image processing suite for electron
microscopy. J. Struct. Biol. 157, 38–46 (2007).
23. Scheres, S. H. RELION: implementation of a Bayesian approach to cryo-EM
structure determination. J. Struct. Biol. 180, 519–530 (2012).
24. Mindell, J. A. & Grigorieff, N. Accurate determination of local defocus and
specimen tilt in electron microscopy. J. Struct. Biol. 142, 334–347 (2003).
Acknowledgements
J.K.F. and F.C. are funded by Future Fellowships of the Australian Research Council. We
thank the Clive and Vera Ramaciotti Centre for Cryo Electron Microscopy and the
Australian Synchrotron for their technical support.
Author contributions
S.S. performed protein expression, purification, crystallization, TEV and stability assays,
M.C.T. and D.L. performed negative stain immune-labelling experiments, J.K.F., Y.K.
and D.A. assisted with data collection, structure determination and refinement, J.M.H.,
M.R., and F.C. designed and performed cryo-EM experiments, M.J.-Z. and P.J.d.P.
performed A.F.M., and S.S., S.R.R. and J.K.F. designed the experiments, wrote the
manuscript, and finalized the structures.
Additional information
Supplementary Information accompanies this paper at http://www.nature.com/
naturecommunications
Competing financial interests: The authors declare no competing financial interests.
Reprints and permission information is available online at http://npg.nature.com/
reprintsandpermissions/
How to cite this article: Sarker, S. et al. Structural insights into the assembly and
regulation of distinct viral capsid complexes. Nat. Commun. 7, 13014
doi: 10.1038/ncomms13014 (2016).
This work is licensed under a Creative Commons Attribution 4.0
International License. The images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise
in the credit line; if the material is not included under the Creative Commons license,
users will need to obtain permission from the license holder to reproduce the material.
To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
rThe Author(s) 2016
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms13014 ARTICLE
NATURE COMMUNICATIONS | 7:13014 | DOI: 10.1038/ncomms13014 | www.nature.com/naturecommunications 7