ArticlePDF Available

Antioxidant and Anti-skin cancer potential of a Ketocarotenoid pigment Astaxanthin isolated from a green microalga Haematococcus pluvialis Flotow

Authors:

Abstract and Figures

Universally, astaxanthin is known for its powerful antioxidant potential which occurs naturally in various marine and fresh water organisms. Haematococcus pluvialis, a unicellular green microalga is one of the efficient producers of astaxanthin but comparatively in high concentration. The skin cancer is a major crisis coupled with direct exposure of radiations from the sunlight due to ozone depletion. Especially, in Australia two/third of the people has been diagnosed skin cancer below the age of 70. In this present study, the isolated pigment astaxanthin has been appraised for the antioxidant and anti-skin cancer potential. About 90% of astaxanthin was extracted from the enriched biomass of green alga Haematococcus pluvialis. The IC50 value of astaxanthin towards antioxidant and anticancer activity was found to be 39.1 ± 1.14 µg/ml and 63 ± 0.22 µg/ml respectively. The gene expression fold of caspase 3 was enhanced further for different time periods of 0, 6 and 12 hours during the treatment of astaxanthin with the skin cancer cells. While investigating the gene expression of oncogene Bcl-2 and tumor suppressor gene p53, the IC50 concentration of astaxanthin was found to suppress and induce both the genes respectively. Hence, it has been proven that astaxanthin can prevent the proliferation of skin cancer cells.
Content may be subject to copyright.
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 902
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
Antioxidant and Anti-skin cancer potential
of a Ketocarotenoid pigment Astaxanthin
isolated from a green microalga
Haematococcus pluvialis Flotow
Infant Santhose, B.1, Elumalai, S.*2, Rajesh Kanna, G.3
1Department of Biotechnology, Faculty of Science and Humanities, SRM University, Kattangulathur,
Chennai 603 203.
2Department of Biotechnology, University of Madras, Maraimalai Campus, Chennai - 600 039.
3Department of Plant Biology and Biotechnology, Presidency College (Autonomous), Chennai - 600
005.
Abstract: Universally, astaxanthin is known for its powerful antioxidant potential which occurs naturally in various
marine and fresh water organisms. Haematococcus pluvialis, a unicellular green microalga is one of the efficient
producers of astaxanthin but comparatively in high concentration. The skin cancer is a major crisis coupled with direct
exposure of radiations from the sunlight due to ozone depletion. Especially, in Australia two/third of the people has
been diagnosed skin cancer below the age of 70. In this present study, the isolated pigment astaxanthin has been
appraised for the antioxidant and anti-skin cancer potential. About 90% of astaxanthin was extracted from the enriched
biomass of green alga Haematococcus pluvialis. The IC50 value of astaxanthin towards antioxidant and anticancer
activity was found to be 39.1 ± 1.14 µg/ml and 63 ± 0.22 µg/ml respectively. The gene expression fold of caspase 3
was enhanced further for different time periods of 0, 6 and 12 hours during the treatment of astaxanthin with the skin
cancer cells. While investigating the gene expression of oncogene Bcl-2 and tumor suppressor gene p53, the IC50
concentration of astaxanthin was found to suppress and induce both the genes respectively. Hence, it has been
proven that astaxanthin can prevent the proliferation of skin cancer cells.
Key Words: Haematococcus pluvialis; Astaxanthin; Skin Cancer; DPPH; MTT
—————————— ——————————
Corresponding author:
Dr. S. Elumalai,
Professor and Head,
Department of Biotechnology,
University of Madras, Chennai
E mail ID: ananandal@gmail.com
1. Introduction
The incidence and dispersion of melanoma and non-melanoma skin cancer (MSC and
NMSC) is the major public health concern among people (Young et al., 2005). About 90% of the
MSC and NMSC are caused by the carcinogenesis due to enormous UV exposure (Skin cancer
foundation, 2008). The rate of NMSC was increased by 3-8% annually in Europe, US, Canada
and Australia since 1960 (Diepgen and Mahler, 2002). Several epidemiological studies have
linked the rising rates of NMSC with ozone depletion, increased exposure to UV light, changes
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 903
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
in clothing style, increased longevity, and increased outdoor activities (Diepgen and Mahler,
2002).
Astaxanthin is a symmetric ketocarotenoid, (3, 3’-dihydroxy-β, β’-carotene- 4,4’-dione)
found predominantly in marine forms including microalgae, trout, salmon, shrimp, krill, crayfish
and crustaceans (Breithaupt, 2007). Natural astaxanthin is usually found either conjugated to
proteins or esterified with fatty acids. Since, the consumers of aquatic ecosystem are not capable
of carotenoid de novo synthesis where the xanthophyll and other carotenoid pigment found in
their bodies (e.g. canthaxanthin and lutein). Hence, microorganisms (producers) being the main
source of carotenoid for them (Johnson and An, 1991). The carotenoid pigment isolated from the
microalga Haematococcus sp. was named as “haematochromtill 1944 and which was identified
as astaxanthin a principle carotenoid pigment accumulated quantitatively high in the microalga
Haematococcus sp. up to 4-5% cell dry weight (Tisher, 1944). In 1954, Droop described the
conditions governing astaxanthin formation. He showed that the action of light and carbon
dioxide were dependent on one another, but that of organic carbon (such as acetate) is
independent of light.
Thus, astaxanthin formation could occur in the dark when energy is derived from organic
carbon. Encystment and astaxanthin production can be induced by low nitrate or phosphate, high
temperature or light, or the addition of sodium chloride in the culture medium (Boussiba and
Vonshak, 1991; Kobayashi et al., 1992; Fan et al., 1994; Kakizono et al., 1992). Studies have
demonstrated that the significant role played by natural carotenoid in regulating immunity and
disease etiology. Astaxanthin significantly reduces DNA damage, stimulates lymphocyte
proliferation and increases natural killer cell cytotoxic activity produces increased number of T-
cells and enhances the total number of antibody producing B-cells.
In addition, it also has pro-vitamin-A property more effective antioxidant than other carotenoids,
decelerate age-related macular degeneration, immunomodulatory effects, etc. (Lorenz and
Cysewsky, 2000; Dufosse et al., 2005; Breithaupt, 2007). The salivary immunoglobulin A (sIgA)
is an antibody plays a major role in the immunity; where the supplementation of astaxanthin to
the soccer players have shown elevated levels of sIgA and hampers muscle damages by their
anti-inflammatory potential (Baralic et al., 2015).
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 904
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
Therefore, the astaxanthin is used in pharmaceutics, neutraceutics, cosmetics and food
additives with a recent great success on the market (Dufosse et al., 2005). During March 2010,
researchers at Washington State University showed that astaxanthin inhibits cancer cell growth
by decreasing free radical induced cellular damage, reducing inflammation and increasing
immune response. Various drugs are being implied to treat skin cancer, but astaxanthin is a
wonder drug due to its strong free radical quenching property. A431 skin cancer cell line is a
model cell line (epidermoid carcinoma) used in biomedical research. They contain no
functional p53, a potent tumor suppressor gene, and so are highly sensitive to mutagenic stimuli.
A431 skin cancer cells were established from an epidermoid carcinoma in the skin/epidermis of
an 85- year-old female patient ("A431 - Cytokines and Cells Online Pathfinder Encyclopedia").
In this present study, the isolated ketocarotenoid pigment astaxanthin from the green microalga
Haematococcus pluvialis was evaluated for its antioxidant and anticancer activity against a skin
cancer cell line A431.
2. Materials and Methods
2.1: DPPH free radical scavenging assay
The free radical scavenging potential of astaxanthin (test sample) was determined by the
DPPH free radical scavenging assay (Blois, 1958). The DPPH free radical scavenging activity of
the pigment astaxanthin was calculated in terms of percentage of inhibition of the free radicals
by using the following formula.
Percentage of inhibition (%) = (Absorbance of Control - Absorbance of Sample) × 100
Absorbance of Control
2.2: Apoptotic cell-toxicity assay
The cell viability of the skin cancer cell line A431 was assessed against the test sample
astaxanthin based on the MTT assay described by Mosmann in 1983. The absorbance of purple
blue formazan dye was measured by Microplate reader at 570 nm (Biorad 680). The cytotoxicity
was determined using Graph pad prism5 software. The 50% inhibitory concentration value (IC50)
of the test sample (astaxanthin) was evaluated and recorded.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 905
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
2.3: DNA laddering assay
The A431 skin cancer cells were treated with different concentrations of astaxanthin (25
µl to 250 µl). Then the cells were nourished with DMEM medium and incubated for 24 hours.
The genomic DNA was extracted and separated with 2 µl of DNA ladder electrophoretically
using 1.2 % of agarose gel at 100 V. The separated DNA bands were observed at 312 nm in a
UV illuminator.
2.4: Caspase activity assay
The activity of caspase-3 belongs to A431 skin cancer cells were determined
chromogenically by cleavage of substrate: Ac-DEVD-7-amino-4-methylcoumarin pNA. (Short
caspase specific peptides) according to described methods (Kohler et al., 2002). Cleavage of the
chromogenic peptide substrates was monitored by pNA release in a 405 nm scan II plate reader
(Biorad, USA). Chromogenic units were converted to percentage by comparing the untreated
control cells generated free pNA. Quantification of caspase activity was calculated as fold
increase over control samples.
2.5: Gene expression assay
Total RNA was isolated using TRIZOL-(Sigma, India) according to the manufacturer’s
instructions. Frequently, the test sample (astaxanthin) in TRIZOL was repeatedly pipetted in and
out to disrupt the A431 skin cancer cells. The test samples (astaxanthin) were incubated for 5
min. at room temperature to permit complete dissociation of nucleoprotein complexes. RT-PCR
was performed in triplicate using SuperScriptTM two Step RT-PCR with platinum® Taq kit
according to the manufacturer’s recommendations (Invitrogen, Carlsbad, CA, U.S.A.).
For cDNA synthesis, Complementary DNA was synthesized from 1 µg total RNA from
each sample in 20 µL of reaction buffer (contained 50 mM Tris-HCl, pH 8.3, 75 mM KCl and 3
mM MgCl2) using SuperScript II reverse transcriptase enzyme (Genetech, RT-PCR mix-
Germany) in a 20 µl volume reaction containing 10 mM dithiothreitol, 10 U RNase inhibitor
(Promega, Madison, WI, USA), 1 mM dNTPs and 2.5 µM random hexamers. The cDNA (1 µl)
was then amplified in 20 µl of reaction buffer for 35 cycles of denaturation (94°C for 30 s),
annealing (50°C for 30 s), and extension (72°C for 30 s) using the following primers: Primers
used were b-actin (FW 5’ -ATGTTTGAGACCTTCAACAC- 3/ RW 5 -
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 906
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
CACGTCACACTTCATGATGG- 3’) (expected product 489 bp). p53: FW, 5'-
AGGGTTAGTTTACAATCAGC-3', RW, 5'-GGTAGGTGCAAATGCC-3'; bcl-2 FW, 5'-
TCGATGTGATGCCTCTGCGAA GAAC-3'; RW, 5'- ATTGCACTGCCAAACGGAGCTG-3';
The cDNA amplified as described above were run on a 1.2% agarose/EtBr gel in 1X TAE
(Tris-acetate-EDTA) buffer and then visualized under UV illuminator (Sambrook and Russel
2001). The density of each band on the agarose gel was measured using ImageJ pixel
quantitation software. Background measurements were subtracted, and a relative number was
assigned to each band intensity (Grifantini et al., 2003).
3. Results
3.1. DPPH free radical scavenging activity
The 50 % inhibitory concentration (IC50) of the astaxanthin required to hamper the
generation of free radicals was found to be 39.1 ± 1.14 µg / ml (Fig. 1) when compared to a
positive control (ascorbic acid). The free radical scavenging potential of the astaxanthin isolated
from H. pluvialis was found auspicious to control the emerging free radicals.
DPPH chelating activity
Sample
Ascorbic acid
0
20
40
60
80
100
12.5 µl
25 µl
50 µl
100 µl
200 µl
Test Samples in µg/ml
DPPH in Percentage (%)
Fig. 1: DPPH free radical scavenging activity of astaxanthin in comparison with a positive
control
3.2. Apoptotic cell-toxic activity
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 907
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
The apoptotic toxicity of the skin cancer cells remained significant with 22.080±4.760 %
and 33.52 ± 2.32 % upon astaxanthin treatment with the concentration of 500 µg/ml and 100
µg/ml on A431 skin cancer cells respectively (Fig. 2). The inhibitory concentration IC50 and IC30
values to prevent the proliferation of skin cancer cells were found to be 63 µg/ml and 37.8 µg/ml
respectively.
1
10
50
100
500
Fig.2: Apoptotic cell-toxicity assay of astaxanthin on A431 skin cancer cell lines
3.3. DNA Laddering Assay
The experiment was characterized by the activation of endogenous endonucleases with
subsequent cleavage of the chromatin DNA into inter-nucleosomal fragments of roughly 50 base
pairs (bp) and multiples thereof (100, 150 etc.). This method of DNA laddering assay can be
used to detect the apoptosis of cancer cells due to the treatment of the test compound. The gel
image (Fig. 3) particularly lane 3 and 4 shows the fragmented and drifted DNA due to the
apoptotic activity of cancer cells by the treatment of the astaxanthin extracted from the green
microalga Haematococcus pluvialis.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 908
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
Fig. 3: The agarose gel image showing bands of DNA, lane 1: DNA ladder; lane 2: normal
A431 skin cancer cell’s DNA; lane 3 and 4: A431 skin cancer cell’s DNA treated with the
test compound astaxanthin
3.4. Caspase activity assay
The mRNA levels of caspase 3 were evaluated for better understanding the action of
astaxanthin over apoptosis of skin cancer cells. The mRNA expression fold of caspase 3 was
compared with the control cells (untreated cells) and analyzed for 0, 6 and 12 hours and the
values were 1.05±0.05, 1.37±0.03 and 1.795±0.075 respectively (Fig. 4). Hence, the result
confirmed that the caspase 3 expression was elevated while increasing the time of incubation
with the test compound astaxanthin.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 909
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
0
6
12
0.0
0.5
1.0
1.5
2.0
Time in hours
Expression fold
*
**
Fig. 4: Caspase activity assay showing the expression fold of caspase 3 gene
3.5. Gene expression assay
A group of genes P-53, Bcl-2, NFkB and Beta actin were chosen for the gene expression
studies. The gene expression was compared with the house keeping gene beta actin as an internal
control (Fig. 5). The gene expression of p53, Bcl-2 and NFkB were compared between the
astaxanthin treated and the untreated cells of A431 skin cancer cells. The activity of the tumor
suppressor gene p53 was increased to two folds while Bcl-2 is an oncogene whose activity is
reduced and NFkB is a gene which is responsible for cell survival and there is no such
considerable change in the astaxanthin treated A431 skin cancer cells (Fig. 6). Therefore, the test
compound astaxanthin is determined to be effective against the skin cancer cell line A431.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 910
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
Fig. 5: The agarose gel image with bands showing the expression fold of different genes,
lane 1: DNA ladder; lane 2: Control (normal cDNA genes) lane 3: bands from A431 skin
cancer cells and lane 4: bands belongs to A431 skin cancer cells treated with astaxanthin
Control
IC30
IC50
0.0
0.5
1.0
1.5
2.0
2.5
P53
BCL-2
NFκB
*
**
*
Expression fold
Fig. 6: The IC30 and IC50 values of astaxanthin treated A431 skin cancer cells showing
expression fold of three genes p53, Bcl-2 and NFkB, where the suppression of Bcl-2 and
over-expression of p53 was obtained at IC50
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 911
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
4. Discussion
Due to strong free radical scavenging property of astaxanthin, it has been proved as a
neutraceutical and pharmaceutical agent against free radical supported diseases including
cardiovascular diseases, neuro-degenerative diseases, oral, colon and liver cancers (Lorenz and
Cysewski, 2000; Guerin et al., 2003). During such high oxidative stress conditions, the
astaxanthin and its esters has proven to be a strong free radical scavengers which can restore the
inactivated antioxidant enzymes. The ROS quenching enzymes such as superoxide dismutase,
catalase, peroxidase and thiobarbituric acid reactive substances (TBARS) were obtained in high
concentration in the blood plasma of rat while feeding with biomass of H. pluvialis as a source of
astaxanthin (Ranga Rao, 2010). The astaxanthin proved against the hydroperoxides and
superoxide free radicals and which is even high in diabetic patients (Hashimoto et al., 2013). The
age related macular degeneration was treated with astaxanthin and resulted that the cells were
well protected against the oxidative stresses (Li et al., 2014).
The oral supplementation of astaxanthin protects the retinal photoreceptors of eyes when
exposed to UV (Tso and Lam, 1996); prevents UV-induced photooxidation and protect skin and
eggs of salmon fish (Connor and Brien, 1998). In this present study, the DPPH free radical
scavenging assay has significantly proven the antioxidant potential of the test compound
astaxanthin isolated from green microalga Haematococcus pluvialis. The antioxidant results
from the present investigation paved the way to analyze the cell viability of the skin cancer cells
using the MTT assay using a skin cancer cell line A431. Hence, the cell viability of the skin
cancer cells was found to be decreased by increasing the concentration of the astaxanthin which
significantly reveals the enhancement of apoptosis of skin cancer cells.
The Caspase-3 is commonly activated by numerous death signals and cleaves a variety of
important cellular proteins among the caspases identified. Failure of caspase mediated apoptosis
is one of the main contributions to tumor development and autoimmune diseases (Kumar, 2007
and Wang et al., 2005). The agarose gel image from this present study has shown the
fragmentation of DNA by DNA Laddering assay which indicates the activity of the caspase
activated DNase (CAD) during astaxanthin treatment with the skin cancer cells. Therefore, the
mRNA expression fold of caspase 3 was found to be enhanced by the treatment of astaxanthin
and further increased by increasing the duration of the treatment. As a result from this present
study, the apoptotic cells may form a ladder of DNA fragments during electrophoretic
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 912
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
separation. Thus, the astaxanthin has proven to be a potent antitumor drug to cause DNA damage
to the cancer cells (Jamieson and Lippard, 1999).
The different types of carotenoid pigments have already been reported to hamper the
propagation of human breast cancer MCF-7 cell line in vitro (Li et al., 2002) especially,
astaxanthin was reported to minimize the occurrence of pre-neoplastic lesions and neoplasm in
mice with bladder cancer. The benign prostate cancer was caused due to the over expression of
5-α-reductase enzyme which was suppressed by the supplementation of astaxanthin (Anderson et
al., 2001). Bcl-2 is unique among proto-oncogenes, being localized to mitochondria and
interfering with programmed cell death independent of promoting cell division (Hockenbery et
al., 1990). Bcl-2 inhibits most types of apoptotic cell death, implying a common mechanism of
lethality. Bcl-2 is localized to intracellular sites of oxygen free radical generation including
mitochondria, endoplasmic reticulum and nuclear membranes (Hockenbery et al., 1993).
Whereas, NFkB (nuclear factor kappa beta) is a transcription factor that plays important roles in
the immune system (Bonizzi and Karin, 2004) and a ubiquitous transcription factor involved in
proliferative signaling and tumor promotion and is activated by oxidants and other stimuli known
to generate ROS (Dhar et al., 2002) Moreover, pathological dysregulation of NFkB is linked to
inflammatory and autoimmune diseases as well as cancer.
This present investigation upon the evaluation of astaxanthin towards the apoptosis of
skin cancer cells was focused on the expression of such genes including p53, Bcl-2 and NFkB.
The astaxanthin upon the treatment of skin cancer cells has enhanced the expression of the p53
gene responsible for the suppression of tumor induction. At the same time the expression of an
oncogene Bcl-2 was hampered and there is no significant modulation in the expression of gene
NFkB responsible for autoimmune system. Furthermore, animal model studies are much needed
to evaluate the potential activity of astaxanthin on skin cancer treatment.
5. Conclusion
Therefore, the overall investigation infers that the ketocarotenoid compound astaxanthin
isolated from a green microalga Haematococcus pluvialis is very potent to suppress the
proliferation of the skin cancer cells and thereby to enhance the apoptosis of skin cancer cells.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 913
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
6. Conflict of interest
According to the authors there is no conflict of interest.
7. References
1. "A431 - Cytokines and Cells Online Pathfinder Encyclopaedia".
2. Anderson, M. 2001. Method of inhibiting 5-α-reductase with astaxanthin to prevent and
treat benign prostate hyperplasia (BHP) and prostate cancer in human males. U. S. Patent
No. 6277417.
3. Baralic, I., Andjelkovic, M., Djordjevic, B., Dikic, N., Radivojevic, N., Suzin-Zivkovic,
V., Radojevic-Skodric, S. and Pejic, S. 2015. Evidence-Based Complementary and
Alternative Medicine. Article ID 783761, 9 pages.
http://dx.doi.org/10.1155/2015/783761.
4. Blois, M.S. 1958. Antioxidant determinations by the use of a stable free radical. Nature,
29: 1199 – 1200.
5. Bonizzi, G. and Karin, M. 2004. The two NFkB activation pathways and their role in
innate and adaptive immunity. Trends in Immunol., 25: 280-288.
6. Boussiba, S. and A. Vonshak. 1991. Astaxanthin accumulation in the green alga
Haematococcus pluvialis. Plant Cell Physiol., 32(7): 1077-1082.
7. Breithaupt, D. E. 2007. Modern application of xanthophylls in animal feeding - a review.
Trends Food Sci. Technol., 18: 501-506.
8. Connor, I. O., Brien, N. O. 1998. Modulation of UV-A light-induced oxidative stress by
β-carotene, lutein and astaxanthin in cultured fibroblasts. J. Dermatol. Sci., 16: 226-230.
9. Dhar, A., Young, M. R. and Colburn, N. H. 2002. The role of AP-1, NF-kappaB and
ROS/NOS in skin carcinogenesis: the JB6 model is predictive. Mol. Cell Biochem., 234
235: 185–193.
10. Diepgen, T. and Mahler, V. 2002. The epidemiology of skin cancer. British Journal of
Dermatology, 146: (Suppl. 61) 1–6.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 914
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
11. Droop, M. R. 1954. Conditions governing haematochrome formation and loss in the alga
Haematococcus pluvialis Flotow. Arch. Mikrobiol., 20: 391-397.
12. Dufosse, L., Galaupa, P., Yaronb, A., Arad, S. M., Blanc, P., Chidambara Murthy, K. N.
and Ravishankar, G. A. 2005. Microorganisms and microalgae as sources of pigments for
food use: a scientific oddity or an industrial reality? Trends Food Sci. Technol., 16: 389
406.
13. Fan, L., Vonshak, A. and Boussiba, S. 1994. Effect of temperature and irradiance on
growth of Haematococcus pluvialis. J. Phycol., 30: 829-833.
14. Grifantini, R., Sebastian, S., Frigimelica, E., Draghi, M., Bartolini, E., Muzzi, A.,
Rappuoli, R., Grandi, G. and Genco, C. A. 2003. Identication of iron-activated and -
repressed Fur-dependent genes by transcriptome analysis of Neisseria meningitidis group
B. Proc. Natl. Acad. Sci., 100: 9542–9547.
15. Guerin, M., Huntley, M. E., Olaizola, M. 2003. Haematococcus astaxanthin: applications
for human health and nutrition. Trends Biotechnol., 21: 210-216.
16. Hashimoto, H., Arai, K., Hayashi, S., Okamoto, H., Takahashi, J., Chikuda, M. and
Obara, Y. 2013. Effects of astaxanthin on antioxidation in human aqueous humor. Journal
of Clinical Biochemical Nutrition 53(1):1-7.
17. Hockenbery, D. M., Nunez, G. and Milliman, C. 1990. BCL-2 is an inner mitochondrial
membrane protein that blocks programmed cell death. Nature, 348: 334–336.
18. Hockenbery, D. M., Oltvai, Z. N., Yin, X-M., Milliman, C. L. and Korsmeyer, S. J. 1993.
Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell, 75(2): 241–251.
19. Jamieson, E. R., Lippard, S. J. 1999. Structure, recognition, and processing of cisplatin-
DNA adducts. Chem. Rev., 99: 2467–2498.
20. Johnson, E. A. and An, G. H. 1991. Astaxanthin from microbial sources. Crit. Rev.
Biotechnol., 11: 297–326.
21. Kakizono, T., Kobayashi, M. and Nagai, S. 1992. Effect of carbon/nitrogen ratio on
encystment accompanied with astaxanthin formation in a green alga, Haematococcus
pluvialis. J. Ferm. Bioeng., 74: 403-405.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 915
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
22. Kobayashi, M., Kakizono, T., Nishio, N. and Nagai, S. 1992. Effects of Light Intensity,
Light Quality, and Illumination Cycle on Astaxanthin Formation in a Green Alga,
Haematococcus pluvialis. Journal of Fermentation and Bioengineering, 74 (1): 61-63.
23. Kohler, A., Schwindling, S. and Conrath, U. 2002. Benzothiadiazole-induced priming for
potentiated responses to pathogen infection, wounding, and infiltration of water into
leaves requires the NPR1/NIM1 gene in Arabidopsis. Plant Physiol., 128: 1046–1056.
24. Kumar, S. 2007. Caspase function in programmed cell death: Cell Death and
Differentiation, 14: 32–43.
25. Li, Q. and Verma, I. M. 2002. NFkB regulation in the immune system. Nat. Rev.
Immunol., 2: 725-73.
26. Li, Z., Dong, X., Liu, H., Chen, X., Shi, H., Fan, Y., Hou, D. and Zhang, X. 2014.
Astaxanthin protects ARPE19 cells from oxidative stress via upregulation of
Nrf2regulated phase II enzymes through activation of PI3K/Akt. Molecular Vision
19:1656-1666.
27. Lorenz, R. T., Cysewski, G. R. 2000. Commercial potential for Haematococcus
microalgae as a natural source of astaxanthin. Trends Biotechnol., 18: 160-167.
28. Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: application
to proliferation and cytotoxicity assays. J. Immunol. Methods, 65: 55.
29. Ranga Rao, A., Raghunath Reddy, R. L., Baskaran, V., Sarada, R., Ravishankar, G. A.
2010. Characterization of microalgal carotenoids by mass spectrometry and their
bioavailability and antioxidant properties elucidated in rat model. J. Agric. Food Chem.,
58: 8553–8559.
30. Sambrook, J. and D. Russel (ed.). 2001. Molecular cloning: a laboratory manual, 3rd ed.,
vol. 1, p. 5.14–5.17. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
31. Skin Cancer Foundation. 2008. Skin Cancer Facts [webpage]. Retrieved Oct 17, 2008
from http://www.skincancer.org/Skin-Cancer/2008-Skin-Cancer-Facts.html.
32. Tischer, J. 1944. Über die Carotinoide von Hämatococcus pluvialis. III. (Carotinoide der
Süßwasseralgen. IX. Teil). Hoppe Seylers Z. Physiol. Chem., 281(5–6): 143–155.
IJSER
Intern ational Journ al of Scientific & E ngineering Research, Volume 7, Issue 6, June-2016 916
ISSN 2229-5518
IJSER © 2016
http://www.ijser.org
33. Tso, M. O. M., Lam, T. T. 1996. Method of retarding and ameliorating central nervous
system and eye damage. Assigned to US Neutraceuticals. U. S. Patent No. 5527533.
34. Wang, Z. B., Liu, Y. Q. and Cui, Y. F. 2005. Pathways to caspase activation. Cell Biol.
Int., 29: 489−496.
35. Young, R., Logan, C., Lovato, C., Moffat, B., and Shoveller, J. 2005. Sun Protection as a
Family Health Project in Families with Adolescents. Journal of Health Psychology,
10(3): 333–344.
.
IJSER
... [1][2][3] Astaxanthin has a high value in the pharmaceutical, nutraceutical, and cosmetic fields because of its potent antioxidant potential with an IC 50 value of 39.1 ± 1.14 ppm. 4 The antioxidant activity produced by astaxanthin is 65 times higher than that of vitamin C, 54 times more powerful than β-carotene, 14 times higher than vitamin E, and 20 times stronger than its synthetic form. 5 Due to its potent antioxidant activity, astaxanthin can be used to treat several degenerative diseases caused by free radicals. ...
Article
Astaxanthin, a natural red pigment that belongs to the carotenoid group, has been known as a super antioxidant due to its very strong antioxidant activity (65 times higher than vitamin C, 54 times more potent than -carotene, and 14 times higher than vitamin E). Haematococcus pluvialis is known as microalgae with a high astaxanthin content. The benefit of astaxanthin in health issues is mainly its potential as the treatment for degenerative diseases caused by reactive oxygen or nitrogen species. Thus, it is important to develop Haematococcus pluvialis microalgae as a rich source of natural astaxanthin in the health and pharmaceutical industries.
Article
Full-text available
Reactive oxygen species (ROS) are continuously generated as a by-product of normal aerobic metabolism. Elevated ROS formation leads to potential damage of biological structures and is implicated in various diseases. Astaxanthin, a xanthophyll carotenoid, is a secondary metabolite responsible for the red-orange color of a number of marine animals and microorganisms. There is mounting evidence that astaxanthin has powerful antioxidant, anti-inflammatory, and antiapoptotic activities. Hence, its consumption can result in various health benefits, with potential for therapeutic application. Astaxanthin contains both a hydroxyl and a keto group, and this unique structure plays important roles in neutralizing ROS. The molecule quenches harmful singlet oxygen, scavenges peroxyl and hydroxyl radicals and converts them into more stable compounds, prevents the formation of free radicals, and inhibits the autoxidation chain reaction. It also acts as a metal chelator and converts metal prooxidants into harmless molecules. However, like many other carotenoids, astaxanthin is affected by the environmental conditions, e.g., pH, heat, or exposure to light. It is hence susceptible to structural modification, i.e., via isomerization, aggregation, or esterification, which alters its physiochemical properties. Here, we provide a concise overview of the distribution of astaxanthin in tissues, and astaxanthin structures, and their role in tackling singlet oxygen and free radicals. We highlight the effect of structural modification of astaxanthin molecules on the bioavailability and biological activity. These studies suggested that astaxanthin would be a promising dietary supplement for health applications.
Article
Full-text available
The physiologic stress induced by physical activity is reflected in immune system perturbations, oxidative stress, muscle injury, and inflammation. We investigated the effect of astaxanthin (Asx) supplementation on salivary IgA (sIgA) and oxidative stress status in plasma, along with changes in biochemical parameters and total/differential white cell counts. Forty trained male soccer players were randomly assigned to Asx and placebo groups. Asx group was supplemented with 4 mg of Asx. Saliva and blood samples were collected at the baseline and after 90 days of supplementation in preexercise conditions. We observed a rise of sIgA levels at rest after 90 days of Asx supplementation, which was accompanied with a decrease in prooxidant-antioxidant balance. The plasma muscle enzymes levels were reduced significantly by Asx supplementation and by regular training. The increase in neutrophil count and hs-CRP level was found only in placebo group, indicating a significant blunting of the systemic inflammatory response in the subjects taking Asx. This study indicates that Asx supplementation improves sIgA response and attenuates muscle damage, thus preventing inflammation induced by rigorous physical training. Our findings also point that Asx could show significant physiologic modulation in individuals with mucosal immunity impairment or under conditions of increased oxidative stress and inflammation.
Article
Full-text available
Oxidative stress on retinal pigment epithelial (RPE) cells is thought to play a crucial role in the development and progression of age-related macular degeneration. Astaxanthin (AST) is a carotenoid that shows significant antioxidant properties. This study was designed to investigate the protective effect of AST on ARPE-19 cells against oxidative stress and the possible underlying mechanism. ARPE-19 cells exposed to different doses of H2O2 were incubated with various concentrations of AST and cell viability subsequently detected with the (4-[3-[4-iodophenyl]-2-4(4-nitrophenyl)-2H-5- tetrazolio-1,3-benzene disulfonate]; WST-1) assay. The apoptosis rate and intracellular levels of reactive oxygen species (ROS) were measured with flow cytometry. NAD(P)H quinine oxidoreductase 1 (NQO1), hemeoxygenase-1 (HO-1), glutamate-cysteine ligase modifier subunit (GCLM), and glutamate-cysteine ligase catalytic subunit (GCLC) expression were examined with real-time PCR and western blotting. The nuclear localization of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) protein and the expression levels of cleaved caspase-3 and protein kinase B proteins were evaluated with western blotting. AST clearly reduced H2O2-induced cell viability loss, cell apoptosis, and intracellular generation of ROS. Furthermore, treatment with AST activated the Nrf2-ARE pathway by inducing Nrf2 nuclear localization. Consequently, Phase II enzymes NQO1, HO-1, GCLM, and GCLC mRNA and proteins were increased. AST inhibited expression of H2O2-induced cleaved caspase-3 protein. Activation of the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) pathway was involved in the protective effect of AST on the ARPE-19 cells. AST protected ARPE-19 cells against H2O2-induced oxidative stress via Nrf2-mediated upregulation of the expression of Phase II enzymes involving the PI3K/Akt pathway.
Article
Cells of the green microalga Haematococcus pluvialis were induced to accumulate the ketocarotenoid pigment, astaxanthin. This induction was achieved by the application of the following environmental conditions: light intensity (170 μmol m~ -2s -1), phosphate starvation and salt stress (NaCl 0.8%). These conditions retarded cell growth as reflected by a decrease in cell division rate, but led to an increase in astaxanthin content per cell. Accumulation of astaxanthin required nitrogen and was associated with a change in the cell stage from biflagellate vegetative green cells to non-motile and large resting cells. It is suggested that environmental or nutritional stresses, which interfere with cell division, trigger the accumulation of astaxanthin. Indeed, when a specific inhibitor of cell division was applied, a massive accumulation of astaxanthin occurred.
Article
We evaluated the antioxidative effects of astaxanthin through the changes in superoxide scavenging activity, levels of hydrogen peroxide and total hydroperoxides in human aqueous humor. The study subjects were 35 patients who underwent bilateral cataract surgery on one side before and the other side after intake of astaxanthin (6 mg/day for 2 weeks). Their aqueous humor was taken during the surgery and subjected to measurements of the three parameters. After astaxanthin intake, the superoxide scavenging activity was significantly (p<0.05) elevated, while the level of total hydroperoxides was significantly (p<0.05) lowered. There was a significant negative correlation between the superoxide scavenging activity and the level of total hydroperoxides (r = -0.485, p<0.01), but no correlations between the hydrogen peroxide level and the other two parameters. Astaxanthin intake clearly enhanced the superoxide scavenging activity and suppressed the total hydroperoxides production in human aqueous humor, indicating the possibility that astaxanthin has suppressive effects on various oxidative stress-related diseases.