Growth and development of Arabidopsis thaliana under single-wavelength red and blue laser light

Abstract

Indoor horticulture offers a sensible solution for sustainable food production and is becoming increasingly widespread. However, it incurs high energy and cost due to the use of artificial lighting such as high-pressure sodium lamps, fluorescent light or increasingly, the light-emitting diodes (LEDs). The energy efficiency and light quality of currently available horticultural lighting is suboptimal, and therefore less than ideal for sustainable and cost-effective large-scale plant production. Here, we demonstrate the use of high-powered single-wavelength lasers for indoor horticulture. They are highly energy-efficient and can be remotely guided to the site of plant growth, thus reducing on-site heat accumulation. Furthermore, laser beams can be tailored to match the absorption profiles of different plant species. We have developed a prototype laser growth chamber and demonstrate that plants grown under laser illumination can complete a full growth cycle from seed to seed with phenotypes resembling those of plants grown under LEDs reported previously. Importantly, the plants have lower expression of proteins diagnostic for light and radiation stress. The phenotypical, biochemical and proteome data show that the single-wavelength laser light is suitable for plant growth and therefore, potentially able to unlock the advantages of this next generation lighting technology for highly energy-efficient horticulture.

Full text

1
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
www.nature.com/scientificreports
Growth and development of
Arabidopsis thaliana under single-
wavelength red and blue laser light
Amanda Ooi1,*, Aloysius Wong1,*, Tien Khee Ng2, Claudius Marondedze1,3, Christoph Gehring1
& Boon S. Ooi2
Indoor horticulture oers a sensible solution for sustainable food production and is becoming
increasingly widespread. However, it incurs high energy and cost due to the use of articial lighting
such as high-pressure sodium lamps, uorescent light or increasingly, the light-emitting diodes (LEDs).
The energy eciency and light quality of currently available horticultural lighting is suboptimal, and
therefore less than ideal for sustainable and cost-eective large-scale plant production. Here, we
demonstrate the use of high-powered single-wavelength lasers for indoor horticulture. They are highly
energy-ecient and can be remotely guided to the site of plant growth, thus reducing on-site heat
accumulation. Furthermore, laser beams can be tailored to match the absorption proles of dierent
plant species. We have developed a prototype laser growth chamber and demonstrate that plants
grown under laser illumination can complete a full growth cycle from seed to seed with phenotypes
resembling those of plants grown under LEDs reported previously. Importantly, the plants have lower
expression of proteins diagnostic for light and radiation stress. The phenotypical, biochemical and
proteome data show that the single-wavelength laser light is suitable for plant growth and therefore,
potentially able to unlock the advantages of this next generation lighting technology for highly energy-
ecient horticulture.
Indoor horticulture can contribute to solutions for sustainable food production and is particularly appealing
not only to ‘horticultural unfriendly’ regions that experience water scarcity, have limited areas of arable land
(e.g. due to climate change or urban development), or receive insucient amounts of natural sunlight due to
their geographical locations1,2. Indoor farming enables plant production to be carried out all-year-round in a
highly controlled growth environment that requires minimal water consumption and space especially when
conducted in space-saving multi-tiered vertical growth settings that is particularly attractive in dense urban
areas. us, indoor farming allows crops to be cultivated at any time irrespective of the weather patterns to meet
the demands of a growing world population3,4. Commercial indoor farming relies heavily on articial lighting
employing conventional broad-spectrum sources such as the high-pressure sodium (HPS) and metal halide (MH)
lamps, uorescent lights and increasingly, the narrow spectrum light-emitting diodes (LEDs). e currently used
light sources are inecient because of their low light-to-heat output and the suboptimal light qualities for plant
growth. Current lightings also incur high energy cost that may include the cost for extensive cooling to oset the
high heat radiant output and this makes these lightings unsuitable for cost-eective large-scale plant production5.
Recent advancement in solid-state lighting (SSL) technologies has resulted in a signicant contribution to
the development of horticultural illuminants, such as LEDs for indoor plant cultivation in highly controlled
environments and for space-based plant growth systems in NASA’s Advanced Exploration Systems Habitation
Projects (for review see6–8). Application of LED lighting in plant growth was rst documented in lettuce (Lactuca
sativa L. cv. Grand Rapids)9, in which the growth and development under monochromatic red LED (660 nm)
supplemented with blue uorescent lamps (400–500 nm) was comparable to that under cool-white uorescent
and incandescent lights. ereaer and concomitant with the advancement of LED technology, there has been a
1Division of Biological and Environmental Sciences and Engineering, 4700 King Abdullah University of Science and
Technology, Thuwal 23955-6900, Kingdom of Saudi Arabia. 2Division of Computer, Electrical, and Mathematical
Sciences and Engineering, 4700 King Abdullah University of Science and Technology, Thuwal 23955-6900, Kingdom
of Saudi Arabia. 3Cambridge Centre for Proteomics, Cambridge Systems Biology Centre, and Department of
Biochemistry, University of Cambridge, Cambridge, CB2 1GA, United Kingdom. *These authors contributed equally
to this work. Correspondence and requests for materials should be addressed to B.O. (email: boon.ooi@kaust.edu.sa)
received: 30 March 2016
Accepted: 05 September 2016
Published: 23 September 2016
OPEN

www.nature.com/scientificreports/
2
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
surge in interest in the application of LED lighting in horticulture (for review see 2,7,8,10,11). Red and blue lights
are the photosynthetically dominant wavelengths that are eciently absorbed by plants to promote their growth
and development10,12. e combination of both red and blue monochromatic LEDs at dierent wavebands and
light intensities for the growth and development of green vegetables such as lettuce (Lactuca sativa)9,13–16, spinach
(Spinacia oleracea)17, cabbage (Brassica oleracea)18,19 and cucumber (Cucumis sativus)20,21 as well as herbal plants22
has been reported previously. Despite the many advantages of LED application for indoor plant cultivation, the
electrical-to-optical power conversion of LEDs remains inecient beyond a certain electrical current.
Semiconductor lasers on the other hand, promise unparalleled advantages over existing illumination tech-
nologies23,24 (Fig.1a). Firstly, the input power density-to-optical light output of laser is higher than the current
horticultural lighting because laser diodes (LDs) have much greater power conversion eciency (PCE) than for
example the LEDs especially at high current densities of ≥ 10 kWcm−2 25,26. While the blue and red LEDs have
PCEs of up to 60 and 40% respectively27, they incur a drastic loss of PCE at input power density of ≥ 1 kWcm−2 26.
For instance, with increasing input power densities from 4 to 10 kWcm−2, the PCE of the blue LD remains close to
30% whilst a signicant drop in eciency from 20 to 10% is observed for blue LED25,26. is ‘eciency droop’25,28
renders LEDs inecient for large-scale high intensity lighting applications e.g. in horticulture. Since laser lumi-
naires have a long lifespan and are suitable for directional emissions and operation at higher current densities,
a higher photon ux density can be achieved. is in turn translates into the manufacturing of more cost- and
space-ecient illumination devices that aord the use of smaller electronic chips26,29. Laser diodes on the other
hand are small size, durable and are able to operate at higher optical output power with ease of operation and
manipulation and at comparable costs as compared to LEDs29. Recently, the use of projector laser scanner consist-
ing of laser diodes (50 to 100 mW) combined at three wavelengths (450 nm, 570 nm and 640 nm) in comparison
to uorescent lamp has been shown to be sucient to grow radish sprouts by directing the emitted photons to
the leaf surface30. Fluorescent lighting is less ecient as compared to laser as it emits several discrete wavelengths
ranging from 350 nm to 750 nm in all directions and many of these wavelengths do not match the absorption
prole of the plant photosynthetic apparatus5. erefore, laser technology promises increased energy-eciency
and potentially cost-saving alternative articial light source for small spaces (e.g. space-base plant growth and
human life-support) and industrial-scale horticultural applications29–31. Secondly, unlike the conventional light
sources, the narrow beam angle of laser light enables illumination over far distances thus allowing light to be
generated remotely, eliminating the need to mount light panels directly above the plant growth area. Since the
laser light source can be externally placed, indoor laser-based horticulture can reduce undesirable on-site heat
accumulation that is commonly associated with the currently used articial lighting (Fig.1a). is cool-emitting
feature of laser light is economically attractive especially in larger enclosed growth spaces where extensive cooling
that consumes both energy and water, is employed5,32. ese attributes and the high-power capability of lasers
oer the prospect of cost- and space-savings especially in a vertical horticulture setting where multiple-tiered
growth spaces can be illuminated by a single laser light source that is guided through optical bres or free space
from a remotely installed parent laser illumination system (Fig.1c)24. irdly, laser beams are highly tunable31
where the wavelength and intensity of individual single waveband laser can be customized to specically match
the absorption proles of dierent plant species and growth phases to enhance economically relevant traits8,33,34.
is high degree of exibility can give rise to new lighting architectures as laser beams can be focused, steered and
mixed for optimal results24.
Red laser diode with a peak emission at 680 nm with 500 mW output power supplemented with 5% of blue u-
orescent light has been previously applied to grow rice (Oryza sativa L. cv. Kitaibuki) from the early vegetative to
the seed yield stage. However, this light regime resulted in both lower tiller spikes and seed yield31. Furthermore,
another red laser diode at 650 nm with 7 mW output was used as a supplementary lighting to grow egg plant and
sweet pepper29. In this case, the authors do not state the nature of any additional light sources and it is not con-
ceivable that the reported growth parameters could have been achieved in the absence of blue light29. In contrast
to the previous reports that utilise laser as supplementary lighting for plant cultivation, we demonstrate the use
of single-wavelength laser light as exclusive light source for indoor plant cultivation by applying our laser illu-
mination system on the growth and development of Arabidopsis thaliana (ecotype Col-0) model plant. We show
that these plants are able to complete a full growth cycle from seed to seed solely under single waveband red and
blue lasers.
Results and Discussion
Design and assembly of a laser-illuminated plant growth chamber. We describe the design, assem-
bly and installation of a laser illumination system in a prototype plant growth chamber. is laser illumination
system consists of two diode-pumped solid-state (DPSS) lasers (Laserglow Technologies, Toronto, Canada) that
generate single-wavelength laser beams, adjusted to a ratio of 9:1 of red (671 nm) : blue (473 nm), giving an aver-
age of total photon ux density of 90–100 μ mol m−2 s−1 (see Methods). ese two laser beams emit the photosyn-
thetic dominant wavelengths that correspond to the absorption peaks of light-harvesting antennal pigments1,6,35.
To investigate the eect of light quantity and quality such as the PPFD (μ mol m−2 s−1), wavelengths (nm) and
ratio of light compositions that are optimal for growth and development of Arabidopsis thaliana, we rst assayed
seedling emergence by measuring the hypocotyl length under dierent regimes of LEDs (Supplementary Fig. S1).
We conrmed that the composition of red to blue LEDs at 9:1 ratio (Supplementary Fig. S2) is best suited for the
growth of Arabidopsis. is is consistent with previous studies that used the same light ratio to grow lettuce9,14,17,
spinach17 and cucumber21, and we therefore used these light parameters for our laser illumination prototype. It
has been reported16,21 that while increasing blue light fraction promotes photosynthetic eciency for optimal
plant productivity, only 7% of blue light was sucient to prevent dysfunctional photosynthesis20. In this system
(Fig.1b), both the red and blue laser beams are combined when the beams converged at a 1.27 cm short-pass
dichroic mirror (with a cut-o wavelength at 589 nm), guided through free space to a reector secured above

www.nature.com/scientificreports/
3
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
Figure 1. A laser-illuminated plant growth chamber prototype and its benecial attributes for
horticultural applications. (a) Benecial attributes of single-wavelength laser light for horticulture27,64.
(b) A laser-illuminated plant growth chamber prototype used in this study. Inset: (i) Light distribution (magenta
in color) of the laser illuminated growth area upon passing through the engineered diuser. (ii) Position of the
red (671 nm) and blue (473 nm) DPSS lasers and the optics inside the protective black metal case. (c) Schematic
illustration of the prototype and the potential applications of laser as primary and supplementary lighting for
horticulture and light-related research. e laser modules and optics are installed external of a custom-made
growth chamber (Percival Scientic, Perry, IA) and are enclosed in a protective black metal case. e laser
illumination system consists of two diode-pumped solid-state (DPSS) lasers (maximum power output: > 500 mW;
Class IV; Laserglow technologies, Toronto, Canada) that generate a 9:1 ratio of red (671 nm) and blue (473 nm)
laser beams that are combined at a 1.27 cm short-pass dichroic mirror (with a cut-o wavelength at 589 nm)
and guided a 1-inch diameter multiple-ground glass engineered diuser with a 50-degree divergence angle that
is custom-tted at an opening on the roof of the chamber providing a non-Gaussian magenta-colored square
light-pattern distribution illuminating an area of 227 cm2 that is xed at 20 cm vertically below the diuser.

www.nature.com/scientificreports/
4
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
an opening on the roof of the chamber approximately 30 cm away from the rst dichroic mirror. e reector
directs the combined laser beams perpendicularly downwards through an opening at the roof of the custom-built
plant growth chamber (Percival Scientic, Perry, IA) that is tightly tted with a 1-inch diameter multiple-ground
glass engineered diuser with a 50-degree divergence angle (ED1-S50, 90% transmission spectrum from 380 to
1100 nm wavelength) (orlabs Inc., Newton, NJ). Upon passing through the diuser, the emitted red and blue
laser beams diuse and produce a non-Gaussian magenta-colored square light-pattern distribution illuminating
an area of 227 cm2 that is xed at 20 cm vertically below the diuser (Fig.1c). Homogeneity of the light intensity
distribution is largely dependent on the characteristics of the diuser and in this case is limited by the size and
the nature of diuser. Consequently, the light intensities decrease with increasing distance from the central posi-
tion of the diuser29. We took an average of light intensities measured at ve dierent horizontal points within
the illuminated area, adjusted accordingly to the xed total PPFD of 90–100 μ mol m−2 s−1 to account for the
intensity dierences (see Methods). e spectral characteristics such as the dominant wavelengths, the ratios and
color spaces of both the white uorescent and laser light used in this study are given as spectral composition and
chromaticity diagrams (Supplementary Fig. S3). We tested this laser illumination prototype on the Arabidopsis
thaliana model plant and noted that the plants appeared to be healthy and were able to complete a full growth
cycle from seed germination (Supplementary Fig. S4) to the production of viable seeds (Supplementary Fig. S5).
Transcriptional responses of photosynthetic and light stress marker genes. We examined a
number of molecular parameters in plants grown under single-wavelength laser light including the expression
levels of six photosynthetic marker genes, each representing a main component of the photosynthetic pathway
(Fig.2a,b). With the exception of beta carbonic anhydrase 3 (ATBCA3) and photosynthetic electron transfer A
(PetA), the laser-grown plants have a consistently lower expression of photosynthetic genes across all time points
as compared to the control plants grown under cool-white uorescent light (Fig.2b). Since the laser light provides
wavelengths that closely match the main absorption peaks of the photosynthetic pigments, a more ecient pro-
ductivity can be achieved as thermal dissipation of light absorbed in the photosynthetically inecient wavebands
is avoided7. is could account for the lower expression of the photosynthetic marker genes including the light
harvesting chlorophyll A/B-binding protein 1.1 (LHCB1) (Fig.2b) as well as the reduced chlorophyll content in
laser-grown plants. Expression of chloroplast photosystem II reaction center protein A (psbA) gene is generally
associated with photo-inhibition and the photo-damaged of photosystem II (PSII)36–38 especially when the light
absorption exceeds consumption36,37. Notably, the laser-grown plants have lower expression of psbA (Fig.2b),
which suggests reduced photo-inhibition under this light regime. e expression of two light stress marker genes,
ascorbate peroxidase 1 (APX1) and glutathione s-transferase (GST6)36 was lower in the plants grown under laser
light regime (Fig.2c) implying that the laser illumination conditions induce less stress than the white uorescent
light at similar PPFD. is is also in agreement with the reduced expression of psbA, a gene that is diagnostic
for photo-inhibition38. Importantly, anthocyanin accumulation associated with damaging radiations38–40 on the
leaf and stem of the laser-grown plants is reduced, indicating that the laser light regime is not only suitable for
photosynthesis and photo-morphogenesis, but also causes less stress than the white uorescent light. We also
noted a high expression of ATBCA3 in the laser-grown plants (Fig.2b). ATBCA3 is involved in carbon utilization
during photosynthesis, generating carbon dioxide (CO2) from bicarbonate to provide optimal CO2 level at the
carboxylation site of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) by facilitating CO2 diusion
across the chloroplast envelope or through the rapid dehydration of bicarbonate to CO241,42. ATBCA3 also has
non-photosynthetic roles such as lipid biosynthesis for seedling survival43 and for the control of guard cell aper-
ture44–46. Taken together, the gene expression data suggest the suitability of the laser light regime for plants to
operate at a high photosynthetic eciency, presumably synthesizing sucient NADPH and ATP for CO2 xation
and for cellular processes downstream of photosynthesis. In contrast, plants that are grown under high light con-
dition will generate excess NAPDH in the stroma, resulting in the accumulation of potentially harmful excitation
energy in the photosynthetic membrane47,48.
The proteome of plants grown under laser light. To further examine the inuence of single-wavelength
red and blue laser light on plant growth at cellular translational level, we have undertaken a comparative anal-
ysis of the proteomes of laser- and white light-grown plants to reveal changes at the systems level that might be
diagnostic for structural or functional changes induced by the dierent light regimes. Our study revealed that
the laser-grown plants have 115 dierentially regulated proteins of which the majority (98) are down-regulated
(Fig.3a). Among the 17 proteins that are up-regulated, there is no signicant enrichment of biological processes.
However, most of the proteins that are increasing in abundance have roles in metabolic processes (6 proteins)
and in response to abiotic stress (5 proteins). Of the down-regulated proteins, 43 are annotated as localized in the
‘chloroplast and plastid’, 12 are involved in ‘photosynthesis’ and 14 are involved in ‘chlorophyll and tetrapyrrole
binding’ (Fig.3a). ere is an over-representation of down-regulated proteins that are associated with light radia-
tion. is set of proteins includes seven light-harvesting chlorophyll-protein (LHC) complexes of which LHCB1.4
(AT2G34430) and LHCB3 (AT5G54270) are among the most down-regulated proteins in laser-illuminated
plants. ese proteins are a component of the main light harvesting chlorophyll a/b-protein complex of PSII
that function as light receptors. ey are involved in ne-tuning the amount of light energy to be channeled to
the reaction centers, enabling plants to adapt to a wide-spectrum of light environments to drive the processes of
photosynthesis48. Similar to previous ndings49–51, LHC family proteins were observed to be light-stress induced
and consequently, a decrease in the abundance of photosynthetic machinery-associated proteins is indicative of
reduced photo-oxidative stress or light induced stress under laser-illuminated plants. is nding is consistent
with the expression pattern of the examined photosynthetic marker genes, particularly the LHCB1 gene under
the laser light regime (Fig.2b). Importantly, 16 proteins that have a role in the ‘response to light stress or radia-
tion’ are down-regulated in the laser-illuminated plants. us, the reduced expression of the corresponding light

www.nature.com/scientificreports/
5
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
Figure 2. Expression of marker genes implicated in photosynthesis and light stress. (a) Plant photosynthetic
pathway. (b) Six photosynthetic marker genes, photosystem II reaction center protein A, psbA (ATCG00020.1),
photosystem I P700 chlorophyll A apoprotein A1, psaA (ATCG00350.1), photosynthetic electron transfer A,
petA (ATCG00540.1), ferredoxin 2, ATFD2 (AT1G60950.1), chlorophyll A/B binding protein 1.1, LHCB1.1
(AT1G29920.1) and beta carbonic anhydrase 3, ATBCA3 (AT1G23730.1), each representing the main
components of the photosynthetic pathway, are selected for expression study using semi-quantitative PCR.

www.nature.com/scientificreports/
6
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
stress marker genes, APX1 and GST6 examined in this study (Fig.2c) lends support to the notion that the laser
light regime induces less stress than white uorescent light. In addition, the proton gradient regulation 7 protein
(PGR7, AT3G21200) is also down-regulated. Arabidopsis thaliana PGR7 has been shown to be involved in both
PSII and P700 of photosystem I and is necessary for ecient photosynthetic electron transport52. Photosynthetic
electron transport plays functional roles in light-dependent NAPDH and ATP synthesis as well as in photoprotec-
tion during high light condition by generating a high pH gradient across the thylakoid membrane for thermal dis-
sipation of excess light energy. Compared to the wild type, the rate of electron transport between PSII and PSI was
reduced with a signicant change in the redox state of the rst stable electron acceptor of PSII (QA) in Arabidopsis
pgr7 mutant without aecting the cytochrome f accumulation. e P700 was more oxidized in the pgr7 mutant
at light intensities > 150 μ mol m−2 s−1 indicating that PGR7 can modulate electron transport between QA of PSII
and P700 of PSI52. Furthermore, the chlorophyll content measured in pgr7 mutant is lower52, suggesting that the
down-regulation of this protein could explain the lower expression of the photosynthetic marker genes and the
reduced chlorophyll level in laser-illuminated plants. Taken together, the expression patterns of the examined
molecular marker genes and the absence of elevation of light-stress response proteins in the proteomics data
(Fig.3b) lend further support to the suitability of the current laser light regime for plant growth.
Phenotypic and biochemical characterisation of plants grown under laser light. Plants grown
under this specic laser light regime show phenotypic traits that dier only slightly from those grown under white
uorescent light (control) under similar growth conditions (Fig.4a) and are in fact much like those reported for
plants grown under similar monochromatic light with a broader spectra provided by the LEDs5,32 (Supplementary
Figs S1 and S2). In laser-grown plants, the emergence of new leaves is delayed (Fig.4b) and the leaves have lower
total chlorophyll but not carotenoid content (Fig.4c) consistent with a lighter shade of green observed. ey also
have a reduced dry weight while their fresh weight does not dier signicantly from that of white light grown
plants (Fig.4c). It was reported17 that chlorophyll levels and shoot dry weight in spinach (Spinacea oleracea L. cv.
Nordic IV) are reduced under a 9:1 ratio of red LED (660 nm) supplemented with blue uorescent lamp at total
PPFD of 282 μ mol m−2 s−1 as compared to plants grown under cool-white uorescent light. Furthermore, the
proportion of blue light fraction added to the light condition can aect chlorophyll content. It has been shown
that the chlorophyll content increases with decreasing red:blue light ratio16,21. e average leaf length and area of
the rst two leaf pairs are higher than the control plants and equal or lower in the subsequent leaf pairs (Fig.4d–e)
while bolting and owering times are also slightly delayed (Fig.4f). e delay in owering time is most likely a
consequence of the absence of far-red light that promotes owering53,54. e absence of photosynthetically ine-
cient far-red as well as green light is likely to exhibit some eects on the growth and development since both these
wavelengths can also oppose the growth-promoting properties of red and blue light in vegetative development,
photoperiodic owering, stomatal opening and stem growth modulation35,55. Plants do not require the wavebands
of the entire light spectrum for their growth and development, in fact, they have evolved optimized light capture
mechanism to grow under a given specic set of light conditions7,56,57. Given these considerations, further experi-
mentation with additional wavelengths supplemented at specic times of the day and/or developmental phase will
have to be tested in the future before the high power and energy-ecient attributes of lasers can be fully harnessed
for horticultural applications.
In conclusion, we have developed a prototype laser-illuminated growth chamber and showed that the applica-
tion of diused single-wavelength red and blue laser light is sucient for plant growth and development. is will
provide a basis for further optimization of laser light technologies for optimal plant growth. Given the potential
benets of laser light23,24, we foresee that this technology will eventually be used in plant factories and drive highly
energy-ecient plant cultivation.
Methods
Design, assembly and installation of a laser illumination system. Pre-aligned laser beams emitted
from the red and blue DPSS laser source respectively (maximum power output: > 500 mW; Class IV; Laserglow
technologies, Toronto, Canada) were combined using a 1.27 cm diameter short-pass dichroic mirror (cut-o
wavelength at 589 nm) attached to an adjustable kinematic mount (Edmund Optics, Barrington, NJ) that is
remotely placed outside of the custom-built plant growth chamber (Percival Scientic, Perry, IA). is mirror
allows the shorter wavelength blue laser beam to pass through but reects the longer wavelength red laser beam
at 90° to achieve parallel beam paths that converge at a reector mirror mounted externally above an upper
opening at the roof of the chamber. Both collimated (non-dispersive) red and blue laser beams are then reected
90° downward onto a 1-inch diameter multiple-ground glass engineered diuser with a 50-degree divergence
angle (ED1-S50, 90% transmission spectrum from 380 to 1100 nm wavelength) (orlabs Inc., Newton, NJ) that
was custom-tted at the bottom opening on the roof of the chamber. Upon passing through the diuser, the
emitted red and blue laser beams diuse and produce a non-Gaussian magenta-colored square light-pattern
(c) Expression levels of two genes implicated in light stress, L-ascorbate peroxidase 1, APX1 (AT1G07890.3) and
glutathione S-transferase phi8, GST6 (AT2G47730.1). 21-days old Arabidopsis plantlets grown under 90–100 μ mol
m−2 s−1 of cool-white uorescent (W) light for 16/8-hour photoperiod at 22 °C with a relative humidity of
50–60% were illuminated with a continuous regime of red and blue (RB) laser light for seven days. Rosette
leaves from three dierent biological replicates were harvested at 0, 1, 2, 4, 8, 16, 32, and 168 hours, aer which
the RNA were isolated and cDNA synthesized for the gene expression studies. All data were normalized against
the protein phosphatase 2A subunit A3, PP2AA3 (AT1G13320) gene. Error bars represent standard error of the
mean calculated from three independent biological replicates.

www.nature.com/scientificreports/
7
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
Figure 3. Comparative proteome analysis of laser-grown Arabidopsis plants. (a) Functional classication
of dierentially expressed Arabidopsis proteins in response to single-wavelength red and blue lasers light. Total
soluble proteins were extracted from Arabidopsis plantlets treated under a continuous laser light for 7 days with
average photon ux density of 90–100 μ mol m−2 s−1. Protein extraction was done with tricarboxylic acid (TCA)
precipitation prior to iTRAQ labeling for liquid chromatography-tandem mass spectrometry (LC-MS/MS).
Proteins that have P value of ≤ 0.05 and fold change of Ι 1.5Ι were considered as dierentially expressed (see
Methods for data analysis). (b) List of dierentially expressed proteins in laser-grown plants.

www.nature.com/scientificreports/
8
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
Figure 4. Phenotypic and biochemical characterizations of plants grown under laser light. (a) 30-days
old Arabidopsis thaliana grown under white uorescent (W) and single-wavelength red and blue (RB) laser
light respectively. (b) Leaf development (leaf count) of plants that are fully-grown under the laser light
regime. (c) Measurement of fresh and dry weights and biochemical analysis (total chlorophyll and carotenoid
quantication) of Arabidopsis plants exposed to a continuous (RB) laser light for seven days. (d) Diameter and
(e) surface area of rosette leaf pair of plants fully-grown under (RB) laser light. (f) Bolting and owering time

www.nature.com/scientificreports/
9
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
distribution illuminating an area of 227 cm2 that is xed at 20 cm vertically below the diuser. e distribution
of light intensity covering the illuminated area was determined by taking an average of light intensities at ve
dierent horizontal points within the illuminated area xed at 20 cm vertically below the diuser. Here, we adjust
the light intensity to an average total photon ux density of 90–100 μ mol m−2 s−1 consisting of 9:1 ratio of red
(671 nm) and blue (473 nm) laser light. Due to the limitation imposed by the type of diuser used and the small
size of our growth chamber prototype, only seven Arabidopsis plants can be grown at the same time in our proto-
type at the present. e light intensity (Photosynthetically Active Radiation (PAR) in μ mol of photons m−2 s−1)
was measured with a LI-250A light meter (LI-COR®, Lincoln, NE) equipped with the LI-190R quantum sensor.
e irradiance spectra and the corresponding chromaticity diagrams of the laser and cool-white uorescent light
were measured in situ using a GL SPECTICS 5.0 Touch spectrometer (JUST Normlicht GmbH, Weilheim an der
Teck, Germany) within the waveband range from 340 to 850 nm. e graphs were plotted using a OriginPro 8.5.1
SR2 soware (OriginLab Corporation, Northampton, MA). We have also created a program using the Labview
soware to achieve automated and continuous control of a pre-dened light regime.
Plant material and growth conditions. Arabidopsis thaliana, ecotype Columbia (Col-0) seeds were strat-
ied at 4 °C in the dark for at least four days prior to sowing and growing on a growth medium consisting of a
mixture of Jiy plant starter pellets (Jiy Products (NB) Ltd., New Brunswick, Canada) and vermiculite at a ratio
of 3:1 in 5.08 cm pots. Plants were regularly watered at intervals of three to four days or as needed depending on
the plant developmental stage. e temperature and relative humidity of the growth environment were main-
tained at 22 °C and at 50–60% respectively. For a complete growth cycle under the laser light regime, stratied
Arabidopsis Col-0 seeds were germinated and grown in our chamber prototype for a 16/8-hour photoperiod
light cycle under an average total photon ux density of 90–100 μ mol m−2 s−1, consisting of a ratio of 9:1 of red
(671 nm): blue (473 nm) single-wavelength laser light. Plants that were germinated and grown under cool-white
uorescent light at the similar light intensity were used as controls. Arabidopsis plants that were used for the meas-
urement of fresh and dry weights, biochemical content, gene expression and comparative proteomics studies were
treated under a continuous regime of laser light for a period of seven days in the chamber prototype under an
average radiant ux of 90–100 μ mol m−2 s−1. ese plants were initially germinated and grown under 16/8-hour
photoperiod of cool-white uorescent light at similar light intensity for three to four weeks prior to the laser light
regime.
Physical and biochemical measurements. Soil-based phenotypic analysis. Visual observation or
inspection was performed every two days beginning from seed germination and continuously throughout the
plant growth and development specically noting the leaf morphology, leaf number and area and bolting and
owering times.
Shoot fresh and dry weights. Shoots of Arabidopsis thaliana (ecotype Col-0) were harvested and the fresh weight
was determined aer seven days of laser light illumination. e plant material was then dried in at 65 °C until a
consistent dry weight is obtained.
Leaf diameter and surface area. Images of Arabidopsis Col-0 plantlets fully-grown in the laser chamber pro-
totype were photographed daily and the leaf diameter and surface area were measured using ImageJ soware58.
Total chlorophyll and carotenoid contents. Rosette leafs of a similar size were harvested from dierent plants
exposed to white light or continuous laser light for seven days. e total chlorophyll and carotenoid content were
determined as described previously59.
Gene expression study. RNA extraction and cDNA synthesis. RNA from rosette leaves of 21-days old
Col-0 were harvested and extracted at 0, 2, 4, 8, 16, 32 and 168 hours upon illumination under single-wavelength
red and blue laser light using the RNeasy Mini kit (Qiagen, Germantown, MD) according to the manufacturer’s
instructions. e total RNA extracted was quantied and the quality assessed using NanoDrop 2000 UV-Vis
spectrophotometer (ermo Fisher Scientic, Marietta, OH). cDNA was synthesized from 2.5 μ g of the extracted
RNA using Superscript First-Strand Synthesis and Oligo (dT) for RT-PCR (Life Technologies, Carlsbad, CA)
followed by semi-quantitative RT-PCR with gene specic primers (Table 1).
Determination of photosynthetic and light stress-related gene expression by semi-quantitative RT-PCR. The
expression of photosynthetic and stress-related genes in the laser-grown Col-0 plants was measured by
semi-quantitative RT-PCR using the KAPA Taq PCR kit (KAPA Biosystems, Wilmington, MA) on Veriti®
of plants grown under laser. All data collected with the exception for (c), were obtained from plants that were
grown from the rst day of sowing to the completion of growth cycle under (RB) laser light only (9:1 ratio of
red (671 nm) and blue (473 nm) lasers) at an average photon ux density of 90–100 μ mol m−2 s−1 for 16/8-hour
photoperiod at 22 °C with a relative humidity of 50–60%. For (c), Arabidopsis plants were germinated and grown
under cool-white uorescent light at similar light intensity and growth condition for three to four weeks prior
to exposure to a continuous (RB) laser regime for seven days. Both the leaf diameter and surface area were
analyzed and measured using ImageJ soware58. Error bars represent standard error of the mean calculated
from n > 10 for (b, d and e), where n represents the number of leaves from seven independent plant replicates
(n = 7 (c) and n = 3 (f)) where n represents the number of independent biological replicates. One asterisk (*)
signies P < 0.05 and two asterisks (**) signify P < 0.005.

www.nature.com/scientificreports/
10
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
96-Well ermal Cycler (Applied BiosystemsTM, ermo Fisher Scientic, Carlsbad, CA), gene specic primers
(Table 1) and PCR cycles according to the manufacturer’s instruction. e photosynthesis-related genes stud-
ied were photosystem II reaction center protein A, psbA (ATCG00020.1), photosystem I P700 chlorophyll A apo-
protein A1, psaA (ATCG00350.1), photosynthetic electron transfer A, petA (ATCG00540.1), ferredoxin 2, ATFD2
(AT1G60950.1), chlorophyll A/B binding protein 1.1, LHCB1.1 (AT1G29920.1) and beta carbonic anhydrase 3,
ATBCA3 (AT1G23730.1). In this study, two general plant stress genes that are indicative of light stress, L-ascorbate
peroxidase 1, APX1 (AT1G07890.3) and glutathione S-transferase phi8, GST6 (AT2G47730.1) were selected as
molecular markers for stress diagnosis. e ImageLab soware (Bio-Rad Laboratories, Hercules, CA) was used to
quantify the expression of the genes by normalizing against that of protein phosphatase 2A subunit A3, PP2AA3
(AT1G13320) ‘housekeeping’ gene.
Comparative proteome analysis. Total protein extraction. Leaves were harvested and weighed (approx-
imately of 0.5–1.0 g) prior to total soluble protein extraction with 10% (w/v) tricarboxylic acid (TCA) in acetone.
e leaves were re-suspended in TCA solution and lysed by mechanical grinding of two times on ice and incu-
bated at − 20 °C overnight. e remaining TCA extraction solution were removed by centrifugation at 3901 × g
at 4 °C for 20 min. e pellet containing the extracted proteins were washed three to four times with 80% (v/v)
acetone sequentially by centrifugation at 3901 × g at 4 °C for 20 min to remove remaining TCA solution, unbro-
ken cells and debris. e pellet was then air dried at room temperature (RT) for 15 min prior dissolving in urea
lysis buer (7 M urea, 2 M thiourea, pH 8.0) in 1:3 ratio at RT with shaking for 2–4 hrs. e protein amount was
estimated by Bradford method60.
Protein digestion and iTRAQ labeling. Approximately 100 μ g of proteins from both the laser- and
white-uorescent (control) grown Arabidopsis plantlets were reduced with 5 mM DL-dithiothreitol (DTT) for
2 hrs at 37 °C, and alkylated with 14 mM iodoacetamide (IAA/IOA) for 30 min at RT in the dark. e alkylation
reaction was subsequently terminated by adding to a nal concentration of 10 mM of DTT to quench the unre-
acted IAA/IOA at RT, dark condition for 15 min. e samples were then diluted sevenfold with 50 mM triethylam-
monium bicarbonate (TEAB) prior to digestion with trypsin (Promega, Madison, WI) overnight at 37 °C in a 1:25
trypsin-to-protein mass-ratio. e protein digests were desalted using Sep-Pak C18 cartridges (Waters, Milford,
MA) and dried in a SpeedVac (ermo Electron, Waltham, MA). e digested protein samples were labeled with
iTRAQ reagents according to the manufacturer’s protocol (Applied Biosystems, Framingham, MA). e desalted
digests were reconstituted in 30 μ L of 1 M iTRAQ dissolution buer and mixed with 70 μ L of ethanol-suspended
iTRAQ reagents (one iTRAQ reporter tag per protein sample). e samples were labeled with the respective tags
as following: two control represented by two biological replicates for white uorescent-grown plants were labelled
with reporter tags 114 and 116 respectively; and the two laser-grown plants samples with reporter tags 115 and
117. Labeling reactions were carried out at RT for 60 min prior pooling into a single tube and dried in a SpeedVac.
Strong cation exchange fractionation of peptide mixture and mass spectrometric analysis using liquid chromatography-
tandem mass spectrometry (LC-MS/MS). All steps were performed according to the methods described
previously61,62.
Primer Name Sequence (5′–3′)Tm (°C) No. of cycle
psbA qPCR forward TGCCATTATTCCTACTTCTGCA 60 30
psbA qPCR reverse AGCACTAAAAAGGGAGCCG 60 30
psaA qPCR forward GCAGGGCTACTAGGACTTGG 60 30
psaA qPCR reverse GGCCTGTAAATGGACCTTTATG 60 30
petA qPCR forward CAGCAGAATTATGAAAATCCACG 60 30
petA qPCR reverse TATTAGTAGCAGGGTCTGGAGCA 60 30
ATFD2 qPCR forward ACTTCATTCATCCGTCGTTCC 60 30
ATFD2 qPCR reverse AAGAACCAGCACGGCAAG 60 30
LHCB1.1 qPCR forward CCGTGTGACAATGAGGAAGA 60 30
LHCB1.1 qPCR reverse CAAACTGCCTCTCCAAACTTG 60 30
ATBCA3 qPCR forward CGAGTTCATAGAAAACTGGATCC 56 35
ATBCA3 qPCR reverse AGGCAGGGGTAGTCTTGAAGT 56 35
APX1 qPCR forward GGACGATGCCACAAGGATA 58 35
APX1 qPCR reverse GTAT TTCTCGACCAAAGGACG 58 35
GST qPCR forward TCTATAAAACACCATACCTTCCTTCA 58 35
GST qPCR reverse CGAAAAGCGTCAAATCACC 58 35
PP2AAC qPCR forward GCGGTTGTGGAGAACATGATACG * *
PP2AAC qPCR reverse GAACCAAACACAATTCGTTGCTG * *
Table 1. Primers and PCR conditions. *e annealing temperature and PCR cycles of PP2AAC
‘housekeeping’ gene is dependent on the PCR condition of the genes being studied.

www.nature.com/scientificreports/
11
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
Data analysis. All acquired spectra were submitted to MASCOT search engine (Matrix Science, London, UK)
for protein identication as described previously63 as well as including iTRAQ peptide labeling as a xed mod-
ication. Identied proteins were further validated and quantitated using Scaold Q+ soware, version 4.0.4
(Proteome Soware, Portland, OR). For protein identication, a minimum of two unique peptides, a MOWSE
score ≥ 32, peptide probability ≥ 90% and protein threshold ≥ 95% were considered. Proteins were compared
between each iTRAQ data set and considered for comparative analysis if a protein was identied in the two
data sets. Changes in protein abundance were calculated as fold change from average value obtained from all
replicates of each sample. A change in abundance was then determined in comparison with the corresponding
controls (white-uorescent − 114 and − 116 iTRAQ tags). To increase condence level for functional analysis,
only proteins that have P ≤ 0.05 (Student’s T-test) and a fold change of Ι 1.5Ι in all three technical replicates and
are consistent across the two biological replicates were considered as signicant and subjected to gene ontology
(GO) analysis.
Chemicals and statistical analysis. All chemicals were purchased from Sigma-Aldrich, St. Louis, MO,
unless stated otherwise. Statistical analysis was performed using Student’s t-test with Microso Excel 2010.
Signicance was set to a threshold of P < 0.05 and n values represent the number of biological replicates.
References
1. Vanninen, I., Pinto, D. M., Nissinen, A. I., Johansen, N. S. & Shipp, L. In the light of new greenhouse technologies: 1. Plant-mediated
eects of articial lighting on arthropods and tritrophic interactions. Ann. Appl. Biol. 157, 393–414, doi: 10.1111/j.1744-7348.2010.00438.x
(2010).
2. Daro, E., Heydarizadeh, P., Schoefs, B. & Sabzalian, M. . Photosynthesis under articial light: the shi in primary and secondary
metabolism. Phil. Trans. . Soc. Lond. B. 369, doi: 10.1098/rstb.2013.0243 (2014).
3. Heuvelin, E. et al. Horticultural lighting in the Netherlands: New developments. Proc. 5th Intl. Symp. Artif. Light. Hort. 25–33
(2006).
4. Moe, ., Grimstad, S. O. & Gislerod, H. . e use of articial light in year round production of greenhouse crops in Norway. Proc.
5th Intl. Symp. Artif. Light. Hort. 35–42 (2006).
5. Janda, M. et al. Growth and stress response in Arabidopsis thaliana, Nicotiana benthamiana, Glycine max, Solanum tuberosum and
Brassica napus cultivated under polychromatic LEDs. Plant Met. 11, doi: 10.1186/s13007-015-0076-4 (2015).
6. im, H. H., Goins, G. D., Wheeler, . M. & Sager, J. C. Green-light supplementation for enhanced lettuce growth under red- and
blue-light-emitting diodes. Hortscience 39, 1617–1622 (2004).
7. Morrow, . C. LED lighting in horticulture. Hortscience 43, 1947–1950 (2008).
8. Massa, G. D., im, H. H., Wheeler, . M. & Mitchell, C. A. Plant productivity in response to LED lighting. Hortscience 43, 1951–1956
(2008).
9. Bula, . J. et al. Light-emitting diodes as a radiation source for plants. Hortscience 26, 203–205 (1991).
10. Olle, M. & Virsile, A. e eects of light-emitting diode lighting on greenhouse plant growth and quality. Agr. Food Sci. 22, 223–234
(2013).
11. Singh, D., Basu, C., Meinhardt-Wollweber, M. & oth, B. LEDs for energy ecient greenhouse lighting. enew. Sust. Energ. ev. 49,
139–147, doi: 10.1016/j.rser.2015.04.117 (2015).
12. Terashima, I., Fujita, T., Inoue, T., Chow, W. S. & Oguchi, . Green light drives leaf photosynthesis more eciently than red light in
strong white light: evisiting the enigmatic question of why leaves are green. Plant Cell Physiol. 50, 684–697, doi: 10.1093/pcp/
pcp034 (2009).
13. Tamulaitis, G. et al. High-power light-emitting diode based facility for plant cultivation. J. Phys. D. Appl. Phys. 38, 3182–3187, doi:
10.1088/0022-3727/38/17/020 (2005).
14. Stutte, G. W., Edney, S. & Serritt, T. Photoregulation of bioprotectant content of red leaf lettuce with light-emitting diodes.
Hortscience 44, 79–82 (2009).
15. Johan, M., Shoji, ., Goto, F., Hashida, S. & Yoshihara, T. Blue light-emitting diode light irradiation of seedlings improves seedling
quality and growth aer transplanting in red leaf lettuce. Hortscience 45, 1809–1814 (2010).
16. Wang, J., Lu, W., Tong, Y. & Yang, Q. Leaf morphology, photosynthetic performance, chlorophyll uorescence, stomatal development
of lettuce (Lactuca sativa L.) exposed to dierent ratios of red light to blue light. Front. Plant Sci. 7, 250, doi: 10.3389/fpls.2016.00250
(2016).
17. Yorio, N. C., Goins, G. D., agie, H. ., Wheeler, . M. & Sager, J. C. Improving spinach, radish, and lettuce growth under red light-
emitting diodes (LEDs) with blue light supplementation. Hortscience 36, 380–383 (2001).
18. Avercheva, O. V. et al. Growth and photosynthesis of Chinese cabbage plants grown under light-emitting diode-based light source.
uss. J. Plant. Phys. 56, 14–21, doi: 10.1134/S1021443709010038 (2009).
19. Li, H., Tang, C., Xu, Z., Liu, X. & Han, X. Eects of dierent light sources on the growth of non-heading chinese cabbage (Brassica
campestris L.). J. Agri. Sci. 4, 262–273 (2012).
20. Hogewoning, S. W. et al. Blue light dose-responses of leaf photosynthesis, morphology, and chemical composition of Cucumis
sativus grown under dierent combinations of red and blue light. J. Exp. Bot. 61, 3107–3117, doi: 10.1093/jxb/erq132 (2010).
21. Hernandez, . & ubota, C. Physiological responses of cucumber seedlings under dierent blue and red photon ux ratios using
LEDs. Envi. Exp. Bot. 121, 66–74, doi: 10.1016/j.envexpbot.2015.04.001 (2016).
22. Sabzalian, M. . et al. High performance of vegetables, owers, and medicinal plants in a red-blue LED incubator for indoor plant
production. Agron. Sustain. Dev. 34, 879–886, doi: 10.1007/s13593-014-0209-6 (2014).
23. Fan, F., Turdogan, S., Liu, Z. C., Shelhammer, D. & Ning, C. Z. A monolithic white laser. Nat. Nanot ech. 10, 796–803, doi: 10.1038/
Nnano.2015.149 (2015).
24. Neumann, A. et al. Four-color laser white illuminant demonstrating high color-rendering quality. Opt. Exp. 19, 982–990, doi:
10.1364/Oe.19.00a982 (2011).
25. Wierer, J. J., Tsao, J. Y. & Sizov, D. S. Comparison between blue lasers and light-emitting diodes for future solid-state lighting. Laser
Photon. ev. 7, 963–993, doi: 10.1002/lpor.201300048 (2013).
26. Wierer, J. J., Tsao, J. Y. & Sizov, D. S. e potential of III-nitride laser diodes for solid-state lighting. Phys. Status Sol. C. 11, 674–677,
doi: 10.1002/pssc.201300422 (2014).
27. Gomez, C., Morrow, . C., Bourget, C. M., Massa, G. D. & Mitchell, C. A. Comparison of intracanopy light-emitting diode towers
and overhead high-pressure sodium lamps for supplemental lighting of greenhouse-grown tomatoes. Horttechnology 23, 93–98
(2013).
28. Shen, Y. C. et al. Auger recombination in InGaN measured by photoluminescence. Appl. Phys. Lett. 91, doi: 10.1063/1.2785135
(2007).
29. Hu, Y. G., Li, P. P. & Shi, J. T. Photosynthetically supplemental lighting for vegetable crop production with super-bright laser diode.
P. Soc. Photo-Opt. Ins. 6456, 4560–4560, doi: 10.1117/12.699607 (2007).

www.nature.com/scientificreports/
12
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
30. Murase, H. e latest development of laser application research in plant factory. Agric. Agric. Sci. Proc. 3, 4–8 (2015).
31. Yamazai, A., Tsuchiya, H., Miyajima, H., Honma, T. & an, H. Growth of rice plants under red laser-diode light supplemented with
blue light. Acta Hort., 177–181 (2002).
32. Piovene, C. et al. Optimal red:blue ratio in LED lighting for nutraceutical indoor horticulture. Sci. Hort. 193, 202–208, doi: 10.1016/j.
scienta.2015.07.015 (2015).
33. Tsao, J. Y. et al. Toward smart and ultra-ecient solid-state lighting. Adv. Opt. Mater. 2, 809–836, doi: 10.1002/adom.201400131
(2014).
34. Devlin, P. F., Christie, J. M. & Terry, M. J. Many hands mae light wor. J. Exp. Bot. 58, 3071–3077, doi: 10.1093/jxb/erm251
(2007).
35. Folta, . M. & Maruhnich, S. A. Green light: a signal to slow down or stop. J. Exp. Bot. 58, 3099–3111, doi: 10.1093/jxb/erm130
(2007).
36. Taahashi, S. & Badger, M. . Photoprotection in plants: a new light on photosystem II damage. Trends Plant Sci. 16, 53–60, doi:
10.1016/j.tplants.2010.10.001 (2011).
37. Wientjes, E. & Croce, . e light-harvesting complexes of higher-plant Photosystem I: Lhca1/4 and Lhca2/3 form two red-emitting
heterodimers. Biochem. J. 433, 477–485, doi: 10.1042/Bj20101538 (2011).
38. Winel-Shirley, B. Biosynthesis of flavonoids and effects of stress. Curr. Opin. Plant Biol. 5, 218–223, doi: 10.1016/S1369-
5266(02)00256-X (2002).
39. Tyystjarvi, E. Photoinhibition of photosystem II and photodamage of the oxygen evolving manganese cluster. Coordin. Chem. ev.
252, 361–376, doi: 10.1016/j.ccr.2007.08.021 (2008).
40. Solovcheno, A. E. & Merzlya, M. N. Screening of visible and UV radiation as a photoprotective mechanism in plants. uss. J. Plant
Phys. 55, 719–737, doi: 10.1134/S1021443708060010 (2008).
41. Price, G. D. et al. Specic reduction of chloroplast carbonic anhydrase activity by antisense NA in transgenic tobacco plants has a
minor eect on photosynthetic CO2 assimilation. Planta 193, 331–340 (1994).
42. Tanz, S. ., Tetu, S. G., Vella, N. G. F. & Ludwig, M. Loss of the transit peptide and an increase in gene expression of an ancestral
chloroplastic carbonic anhydrase were instrumental in the evolution of the cytosolic C-4 carbonic anhydrase in Flaveria. Plant
Physiol. 150, 1515–1529, doi: 10.1104/pp.109.137513 (2009).
43. Hoang, C. V. & Chapman, . D. Biochemical and molecular inhibition of plastidial carbonic anhydrase reduces the incorporation of
acetate into lipids in cotton embryos and tobacco cell suspensions and leaves. Plant Physiol. 128, 1417–1427, doi: 10.1104/pp.010879
(2002).
44. Aubry, S., Brown, N. J. & Hibberd, J. M. e role of proteins in C-3 plants prior to their recruitment into the C-4 pathway. J. Exp. Bot.
62, 3049–3059, doi: 10.1093/jxb/err012 (2011).
45. Ferreira, F. J., Guo, C. & Coleman, J. . eduction of plastid-localized carbonic anhydrase activity results in reduced Arabidopsis
seedling survivorship. Plant Physiol. 147, 585–594, doi: 10.1104/pp.108.118661 (2008).
46. Hu, H. H. et al. Carbonic anhydrases are upstream regulators of CO2-controlled stomatal movements in guard cells. Nat. Cell Biol.
12, 87–93, doi: 10.1038/ncb2009 (2010).
47. Muneage, Y. et al. Cyclic electron ow around photosystem I is essential for photosynthesis. Nature 429, 579–582, doi: 10.1038/
nature02598 (2004).
48. uban, A. V. Plants in light. Com. Integ. Biol. 2, 50–55 (2009).
49. Adamsa, I. & loppstech, . Evidence for an association of the Early Light-Induced Protein (ELIP) of pea with photosystem-II.
Plant Mol. Bio. 16, 209–223, doi: 10.1007/Bf00020553 (1991).
50. Levy, H., Gohman, I. & Zamir, A. egulation and light-harvesting complex-II association of a Dunaliella protein homologous to
Early Light-Induced Proteins in higher-plants. J. Bio. Chem. 267, 18831–18836 (1992).
51. Fun, C. et al. e PSII-S protein of higher plants - a new type of pigment-binding protein. Biochemistry 34, 11133–11141, doi:
10.1021/bi00035a019 (1995).
52. Jung, H. S. et al. Arabidopsis thaliana PG7 encodes a conserved chloroplast protein that is necessary for ecient photosynthetic
electron transport. PLoS One 5, e11688, doi: 10.1371/journal.pone.0011688 (2010).
53. Ishiguri, Y. & Oda, Y. elationship between red and far-red light on owering of long-day plant, Lemna Gibba. Plant Cell Physiol. 13,
131–138 (1972).
54. unle, E. S. & Heins, . D. Specic functions of red, far red, and blue light in owering and stem extension of long-day plants.
J. Am. Soc. Hort. Sci. 126, 275–282 (2001).
55. Wang, H. & Wang, H. Phytochrome signaling: time to tighten up the loose ends. Mol. Plant. 8, 540–551, doi: 10.1016/j.
molp.2014.11.021 (2015).
56. Dougher, T. A. O. & Bugbee, B. Dierences in the response of wheat, soybean and lettuce to reduced blue radiation. Photochem.
Photobiol. 73, 199–207, doi: 10.1562/0031-8655(2001)073< 0199:Ditrow> 2.0.Co;2 (2001).
57. Muneer, S., im, E. J., Par, J. S. & Lee, J. H. Inuence of green, red and blue light emitting diodes on multiprotein complex proteins
and photosynthetic activity under dierent light intensities in lettuce leaves (Lactuca sativa L.). Int. J. Mol. Sci. 15, 4657–4670,
doi: 10.3390/ijms15034657 (2014).
58. Schneider, C. A., asband, W. S. & Eliceiri, . W. NIH Image to ImageJ: 25 years of image analysis. Nat. Met. 9, 671–675,
doi: 10.1038/nmeth.2089 (2012).
59. Sharhuu, A. et al. A red and far-red light receptor mutation confers resistance to the herbicide glyphosate. Plant J. 78, 916–926,
doi: 10.1111/tpj.12513 (2014).
60. Bradford, M. M. apid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein-dye
binding. Anal. Biochem. 72, 248–254, doi: 10.1006/abio.1976.9999 (1976).
61. Zhang, H. M. et al. Study of monocyte membrane proteome perturbation during lipopolysaccharide-induced tolerance using
iTAQ-based quantitative proteomic approach. Proteomics 10, 2780–2789, doi: 10.1002/pmic.201000066 (2010).
62. Marondedze, C., Groen, A. J., omas, L., Lilley, . S. & Gehring, C. A quantitative phosphoproteome analysis of cGMP-dependent
cellular responses in Arabidopsis thaliana. Mol. Plant 9, 621–623, doi: 10.1016/j.molp.2015.11.007 (2016).
63. omas, L., Marondedze, C., Ederli, L., Pasqualini, S. & Gehring, C. Proteomic signatures implicate cAMP in light and temperature
responses in Arabidopsis thaliana. J. Proteomics 83, 47–59, doi: 10.1016/j.jprot.2013.02.032 (2013).
64. Humphreys, C. J. Solid-state lighting. Mrs Bull. 33, 459–470, doi: 10.1557/mrs2008.91 (2008).
Acknowledgements
is research was fully funded by the King Abdulaziz City for Science and Technology (KACST) and supported
by King Abdullah University of Science and Technology (KAUST). We thank Ivan Gromicho for his help with
the illustrations.
Author Contributions
Both B.O. and A.W. conceived of the project. A.O., A.W. and N.T.K. designed and conducted the experiments. All
authors contributed to the data analyses and writing of the manuscript.

www.nature.com/scientificreports/
13
Scientific RepoRts | 6:33885 | DOI: 10.1038/srep33885
Additional Information
Supplementary information accompanies this paper at http://www.nature.com/srep
Competing nancial interests: e authors declare no competing nancial interests.
How to cite this article: Ooi, A. et al. Growth and development of Arabidopsis thaliana under single-wavelength
red and blue laser light. Sci. Rep. 6, 33885; doi: 10.1038/srep33885 (2016).
is work is licensed under a Creative Commons Attribution 4.0 International License. e images
or other third party material in this article are included in the article’s Creative Commons license,
unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license,
users will need to obtain permission from the license holder to reproduce the material. To view a copy of this
license, visit http://creativecommons.org/licenses/by/4.0/
© e Author(s) 2016