ArticlePDF Available

Evidence for the polyphyly of Encoelia and Encoelioideae with reconsideration of respective families in Leotiomycetes

Authors:

Abstract

This study focuses on the genus Encoelia and the subfamily Encoelioideae in the morphologically and ecologically diverse Helotiales. The 28S and 18S rDNA as well as tef1, rpb1 and rpb2 were sequenced for 70 species. Phylogenetic analyses revealed Encoelia and Encoelioideae to be highly polyphyletic, with species distributed among eight major lineages. Encoelia fascicularis and E. pruinosa belonged to Sclerotiniaceae and were combined in a new genus, Sclerencoelia. Rutstroemiaceae comprised E. tiliacea and Dencoeliopsis johnstonii, both accepted in Rutstroemia. The type of Encoelia, E. furfuracea, was closely related to species of Velutarina, Cenangiopsis and Crumenulopsis. These species together with members of Hemiphacidiaceae formed a clade conforming to the emended concept of Cenangiaceae, introduced here. Another resurrected family, Cordieritidaceae, comprised E. fimbriata, E. heteromera and species of Ameghiniella, Cordierites, Diplocarpa and Ionomidotis, characterised by inamyloid asci and a positive ionomidotic reaction. Encoelia glauca showed closest affinities with Chlorociboria species in Chlorociboriaceae. A new genus, Xeropilidium, with sporodochial and pycnidial synanamorphs, was described for the distinct encoelioid member of the Chaetomellaceae, previously known as E. fuckelii. Morphological and ecological synapomorphies were distinguished from convergent characters to delimit monophyletic taxa including encoelioid fungi. Incorporation of public sequences from various biological samples in ITS rDNA analyses allowed identification of sequenced organisms at species, genus, or family level and added information on the ecology of seversal taxa. Members of Cenangiaceae appeared to be widespread as endophytes. Inclusion of encoelioid genera in Chaetomellaceae and Sclerotiniaceae added xylicolous saprotrophs to these families.
Evidence for the polyphyly of Encoelia and Encoelioideae
with reconsideration of respective families in Leotiomycetes
Kadri Pärtel
1,2
&Hans-Otto Baral
3
&Heidi Tamm
1
&Kadri Põldmaa
1
Received: 30 December 2015/Accepted: 16 July 2016 /Published online: 9 August 2016
#School of Science 2016
Abstract This study focuses on the genus Encoelia and the
subfamily Encoelioideae in the morphologically and ecologi-
cally diverse Helotiales. The 28S and 18S rDNA as well as
tef1,rpb1 and rpb2 were sequenced for 70 species.
Phylogenetic analyses revealed Encoelia and Encoelioideae
to be highly polyphyletic, with species distributed among
eight major lineages. Encoelia fascicularis and E. pruinosa
belonged to Sclerotiniaceae and were combined in a new ge-
nus, Sclerencoelia.Rutstroemiaceae comprised E. tiliacea and
Dencoeliopsis johnstonii,bothacceptedinRutstroemia.The
type of Encoelia,E. furfuracea, was closely related to species
of Veluta r i n a ,Cenangiopsis and Crumenulopsis. These spe-
cies together with members of Hemiphacidiaceae formed a
clade conforming to the emended concept of Cenangiaceae,
introduced here. Another resurrected family,
Cordieritidaceae,comprisedE. fimbriata, E. heteromera and
species of Ameghiniella,Cordierites,Diplocarpa and
Ionomidotis, characterised by inamyloid asci and a positive
ionomidotic reaction. Encoelia glauca showed closest affini-
ties with Chlorociboria species in Chlorociboriaceae. A new
genus, Xeropilidium, with sporodochial and pycnidial
synanamorphs, was described for the distinct encoelioid mem-
ber of the Chaetomellaceae, previously known as E. fuckelii.
Morphological and ecological synapomorphies were distin-
guished from convergent characters to delimit monophyletic
taxa including encoelioid fungi. Incorporation of public se-
quences from various biological samples in ITS rDNA analy-
ses allowed identification of sequenced organisms at species,
genus, or family level and added information on the ecology
of seversal taxa. Members of Cenangiaceae appeared to be
widespread as endophytes. Inclusion of encoelioid genera in
Chaetomellaceae and Sclerotiniaceae added xylicolous
saprotrophs to these families.
Keywords Environmental sequencing .Fungicolous
ascomycetes .Helotiaceae .Lichenicolous fungi .Forest
pathogens .Taxono my
Introduction
The order Helotiales represents one of the largest groups of
inoperculate discomycetes, comprising species of diverse life-
style and morphology (Wang et al. 2006a). The traditional
teleomorph-based taxa are recognised to be closely related to
many anamorphic taxa that inhabit various substrata in aquatic
and terrestrial environments (Baschien et al. 2013; Kohout
et al. 2012; Réblová et al. 2011). In addition, diverse unnamed
lineages have been distinguished through molecular analyses
of complex biological samples (Hazard et al. 2014; Tedersoo
et al. 2009; Walker et al. 2011). Phylogenetic analyses have
shown that the Helotiales is not a monophyletic group and that
Rhytismatales, Erysiphales, Phacidiales, Cyttariales and
Electronic supplementary material The online version of this article
(doi:10.1007/s13225-016-0370-0) contains supplementary material,
which is available to authorized users.
*Kadri Pärtel
kadri.partel@ut.ee
1
Institute of Ecology and Earth Sciences, University of Tartu, Lai 40,
EE-51005 Tartu, Estonia
2
Mycological Collections, Institute of Agricultural and Environmental
Sciences, Estonian University of Life Sciences, Tartu, Estonia
3
Blaihofstraße 42, 72074 Tübingen, Germany
Fungal Diversity (2017) 82:183219
DOI 10.1007/s13225-016-0370-0
Thelebolales are nested within the Helotiales. However, the
delimitation and relationships among most helotialean fami-
lies are obscure (Crous et al. 2014; Johnston et al. 2014a;
Lantz et al. 2011; Schoch et al. 2009;Wangetal.2006a,b).
This study focuses on taxa traditionally assigned to the sub-
family Encoelioideae in the family Helotiaceae and, particu-
larly, in the genus Encoelia.
In 1932 Nannfeldt proposed the Encoelioideae to be a sub-
division of the Helotiaceae, distinguished from the related
Ciborioideae by longevity and leathery consistency of
apothecia. His concept included Cenangiopsis quercicola,
Encoelia furfuracea, E. fascicularis,Encoeliella ravenelii
Unguiculariopsis ravenelii,Encoeliopsis rhododendri,
Holwaya mucida, Midotiopsis bambusicola,andVelutarina
rufoolivacea. Most of these taxa had been assigned previously
to the family Cenangiaceae Rehm. By adhering to observa-
tions by Höhnel (von Höhnel 1923: 104 f.), Nannfeldt (1932:
312) excluded Cenangium ferruginosum Fr., the type species
of the genus, from the Encoelioideae.Korf(1973), however,
assigned Cenangium in its restricted sense to this subfamily
along with Encoelia, Cenangiopsis, Cordierites,
Dencoeliopsis, Discocainia, Holwaya, Nipterella,
Pestalopezia,andVelutarina. Encoelioideae sensu Korf was
distinguished from other members ofthe Leotiaceae (which at
that time included the Helotiaceae)mainlybycharactersof
the excipulum and was accepted by Torkelsen and Eckblad
(1977). Zhuang (1988a,b,c)expandedKorfs concept to in-
clude the genera Ameghiniella, Chlorencoelia, Encoeliopsis,
Hemiglossum, Ionomidotis, Parencoelia, Phaeofabraea,
Sageria,andUnguiculariopsis. Based on morphological evi-
dence, Diplocarpa (Baral 2003) and Llimoniella (Hafellner
and Navarro-Rosinés 1993) were included in this subfamily.
Members of Encoelioideae are characterised by long-lived
and desiccation-tolerant apothecia. While growing on air-
exposed substrata, the apothecia desiccate and revive repeated-
ly, and can periodically discharge ascospores over an extended
period of time. During dry periods, the fruitbodies turn leathery
and horny, often by inrolling and becoming hysteriform or tri-
angular in shape, but regaining their original form upon
rehydratation. The outermost cells of the ectal excipulum are
mostly globose and sometimes loose by forming the character-
istic mealy or pustulate-floccose surface of some taxa, whereas
the medullary tissue consists of thin-walled interwoven hyphae.
Throughout the text we use the term encoelioid taxato refer to
species and genera exhibiting these features.
Encoelia, currently classified in the Sclerotiniaceae (Lumbsch
and Huhndorf 2010), includes ca. 40 species excluding synonym-
ic and misapplied names (Kirk et al. 2015). The name Encoelia
translates as enclosed space, which is appropriate for its type
species, E. furfuracea (Roth) P. Karst. The apothecia of this spe-
cies are initially erumpent under the bark of attached but dead
deciduous branches or standing trunks, remaining closed for a
long period before opening an irregular, crater-like aperture,
thereby leaving the margin lacerate. Characteristic of Encoelia
species in general are the leathery, externally brown or blackish
and scurfy apothecia of >1 mm diam. These are formed on a
short, simple stipe and open in either the prohymenial or the
mesohymenial phase. Asci are clavate to cylindrical, with the
ultrastructure of the apex as described in E. tiliacea (Bellemere
1977), E. fimbriata (Verkley 1995)andE. furfuracea (Pärtel
2014) representing three dissimilar types. Ascospores are cylin-
drical, generally allantoid, hyaline and non-septate when
discharged, and paraphyses cylindric-filiform, usually slightly
and gradually enlarged in their upper part. Species of Encoelia
typically live on angiosperms as saprotrophs (Korf and Kohn
1976, Zhuang 1988a) or parasites (Itturriaga 1994, Juzwik and
Hinds 1984). However, a parasitic or endophytic lifestyle can be
suggested for many species that inhabit recently dead or living
parts of trees, shrubs, or more rarely herbaceous plants.
Zhuang et al. (2000) showed that members of
Encoelioideae sensu Korf cluster with species from distinct
helotialean families, indicative of a polyphyletic subfamily.
Although this study included more representatives of
Encoelioideae than later works, the support for many relation-
ships remained low because only the 18S rDNA of a rather
restricted set of taxa were analysed. Likewise, phylogenetic
revisions of the Leotiomycetes based on rDNA data suggest
the three included encoelioid species are only distantly related
(Wang et al. 2006a,b). Among these species, Chlorencoelia
versiformis formed a clade with members of
Hemiphacidiaceae, and Holwaya mucida with members of
Bulgariaceae, whereas relationships of Cordierites frondosa
remained unresolved. A recent phylogenetic study analysing
sequences of four genes (Peterson and Pfister 2010)revealed
that even the genus Encoelia is not monophyletic, and that
these three species fall into two distinct groups, one
(E. fascicularis) in the Sclerotiniaceae (in agreement with
results by Holst-Jensen et al. 1997) and the other two
(E. heteromera,E. helvola)nearCordierites and Ionomidotis
in the BHelotiaceae^. However, the phylogenetic relationships
of most species of Encoelia and related genera, including the
type species of the genus, E. furfuracea, which had not been
included in any molecular studies, remained largely unknown.
Originating mostly from biological samples such as soil
and plant tissues, the ITS rDNA sequences of
Leotiomycetes, the DNA barcode marker of fungi (Schoch
et al. 2012), are well represented in international nucleotide
sequence databases (INSD). Members of this class, particular-
ly those referred to the Helotiales, have been found to consti-
tute most of the endophytic fungal species in various trees
(Kernaghan and Patriquin 2011, Tedersoo et al. 2009; Toju
et al. 2013; Vralstad et al. 2002), especially in conifers and
in Pinaceae (Arnold et al. 2007; Rodriguez et al. 2009; Sieber
2007), but also in temperate orchids (Kohout et al. 2013;Stark
et al. 2009) and other vascular plants (Higgins et al. 2007).
However, identification of such environmental sequences
184 Fungal Diversity (2017) 82:183219
below the kingdom, phylum, class or order level has usually
been impossible due to the paucity of related sequences from
named voucher specimens.
The aims of this study were (1) to reveal the phylogenetic
affinities of species included in the subfamily Encoelioideae
and particularly in the genus Encoelia, with reference to its
type species E. furfuracea; (2) to define monophyletic groups
including encoelioid fungi; (3) to revise the morphological
delimitation of taxa including encoelioid species; (4) to eluci-
date ecological distinction of taxa by combined analyses of
original specimen-based and INSD biological sample data.
Materials and methods
The studied specimens of Encoelioideae were obtained from
the following fungaria (acronyms according to Thiers 2015):
BPI, C, CUP, DAOM, FH, K, LD, M, NY, O, OULU, QCNE,
S, TAAM, TNS, TU, and from the private collections of Hans-
Otto Baral, Guy Marson, Jens Henrik Petersen, Ingo Wagner
and Enrique Rubio Domínguez.
The morphology of living apothecia and anamorphs was
studied in tap water (unless otherwise stated). Dry, dead spec-
imens were rehydrated and mounted in water to which was
added a 3 % aqueous potassium hydroxide solution (KOH).
In addition, the staining reagents cotton blue (CB, in lactic
acid), cresyl blue (CRB, aqueous), Melzers regent (MLZ)
and Lugols solution (IKI) were used to examine specific struc-
tures. All specimens were tested for an ionomidotic reaction, a
chemical reaction by which an alkaline medium extracts pig-
ments from the fungal tissue (Korf 1958), by applying 310 %
KOH to a water mount of apothecial fragments. The symbols
used in the descriptions indicate the following: * living cells
studied, dead cells studied; t. =texture(textura)ofexcipular
tissue types, ø = specimen not preserved,{} the number of
studied specimens. Microphotos and measurements of micro-
scopical elements were taken from freehand sections or squash
mounts using a Nikon 80i or a Zeiss Standard 14 microscope.
Genomic DNAwas extracted from dried specimens using a
High Pure PCR Template Preparation Kit (Roche, Basel,
Switzerland) or a Qiagen DNeasy96PlantKit(Qiagen,
Crawley, West Sussex, UK) according to the manufacturers
instructions. A piece of apothecium of fresh specimens was
soaked in a buffer of 0.015 U/μl proteinase K (Thermo Fisher
Scientific, Waltham, MA, USA), 0.8 M Tris-HCl, 0.2 M
(NH
4
)
2
SO
4
and 0.2 % w/vTween-20 (Solis BioDyne, Tartu,
Estonia) and incubated at 56 °C for 24 h. After inactivation of
proteinase K at 98 °C for 15 min, the lysate was centrifuged at
8000 rpm for 2 min. The supernatant was diluted by 10 times
and used as a template for PCR.
Selected regions of the nuclear 18S and 28S ribosomal
subunits and of three protein-coding genes, tef1,rpb1 and
rpb2, were amplified in 70 specimens using the primers listed
in Table 1. Because PCR with existing primers often failed to
amplify 18S rDNA and rpb1, we designed new primers that
successfully paired with the target regionsof these loci in most
of the probes. Sequentially, the amplicons obtainedwith prim-
er pairs SSU1/SSU31R and SSU3/SSU42R (Table 1)encom-
pass the region homologous to positions 951585 in the 18S
rDNA of Saccharomyces cerevisiae. The new primer RPB1-B
was used to amplify the B-D region of rpb1 in combination
with RPB1-6R1asc. The ITS region of rDNA, including the
5.8S, was amplified in 79 specimens using the primers listed
in Table 1. PCR was performed using PuRe Taq Ready-To-
GoPCR beads (Amersham Pharmacia Biotech.,
Piscataway, NJ, USA) or 5 x HOT FIREPol® Blend Master
Mix (Solis BioDyne, Tartu, Estonia) with a 25 μl reaction
volume. Although amplification often entailed trials with dif-
ferent combinations of primer pairs, all five gene regions
could not be amplified for several specimens. The PCR prod-
ucts were purified using Exo-SAP enzymes (Sigma, St. Louis,
MO, USA). Sequencing was performed by Macrogen Inc.
(Seoul, Korea or Amsterdam, The Netherlands) or Estonian
Biocentre (Tartu, Estonia). Sequences were edited and assem-
bled with Sequencher 4.10.1 (Gene Codes, Ann Arbor, MI,
USA) and deposited in INSD under the accession numbers
presentedinTableS1. This table also includes Species
Hypothesis (SH) codes (Kõljalg et al. 2013), when available,
for ITS sequences, assigned in the UNITE database via the
PlutoF platform (Abarenkov et al. 2010). Table S2 includes
additional sequences downloaded from INSD.
Sequence alignment was performed using MAFFT v7
(Katoh and Standley 2013), followed by manual adjustment
in Genedoc 2.7 (Nicholas et al. 1997). The combined dataset
of 18S and 28S rDNA, rpb1,rpb2 and tef1 regions was divid-
ed into eight partitions, distinguishing each gene and their
codon positions (first and second together, third separately).
Ambiguously aligned sites were excluded from further analy-
ses. To construct the Bayesian phylogeny, GTR + I + G evo-
lutionary model was selected using MrModeltest (Nylander
2004) for most of the partitions, with the exception of
F81 + I + G for first and second positions of tef1. MrBayes
v. 3.2.6 (Ronquist et al. 2012) was used to analyse the
partitioned five-gene dataset. The analyses were run for 50
million generations at the CIPRES Science Gateway v3.3
(http://www.phylo.org), and sampled at each 1000th
generation. By the end of the run the average standard
deviation of split frequencies attained 0.01. The first 25 % of
the trees were discarded as a burn-in and the posterior proba-
bilities (PP) were calculated from the remaining trees.
Due to the high variability in the ITS regions, these se-
quences were aligned in six separate matrices, conforming to
the relevant families. In addition to our original sequences, most
similar sequences were obtained from GenBank by applying
BLAST search for the target species, and added to the respec-
tive matrices. Two additional matrices were constructed to
Fungal Diversity (2017) 82:183219 185
clarify the distinction of species in Chlorencoelia and
Cenangium. These resulting datasets were analysed using
MrBayes v.3.2.6 (Ronquist et al. 2012) in CIPRES. Of 10 mil-
lion generations, 75 % of the trees were retained to calculate PP.
Results
Phylogenetic analyses
Multigene analysis
The combined dataset of 18S, 28S rDNA and the three
protein-coding genes comprised sequences of 141 specimens,
representing 50 species from diverse groups of Leotiomycetes
and including 28 encoelioid species. Four species of
Sordariomycetes, Hypocrea lutea,Neurospora crassa,
Sordaria fimicola and Xylaria hypoxylon, were included to
constitute the outgroup. Among the total of 10,166 characters,
ambiguously aligned positions and long insertions that were
present in a few sequences were removed, leaving 5641 char-
acters for analyses. Parsimony-informative characters were
distributed as follows: 18S 291 bp; 28S 560 bp; rpb1
Tabl e 1 Primers used for PCR and sequencing of the six target loci
Locus Primer Direc- tion* Reference Sequence
ITS ITS0F fwd Tedersoo et al. 2008 ACTTGGTCATTTAGAGGAAGT
ITS5 fwd White et al. 1990 GGAAGTAAAAGTCGTAACAAGG
ITS4 rev White et al. 1990 TCCTCCGCTTATTGATATGC
18S PNS1 fwd Hibbett 1996 CCAAGCTTGAATTCGTAGTCATATGCTTGTCTC
nssu131 fwd Kauff and Lutzoni 2002 CAGTTATCGTTTATTTGATAGTACC
NS1 fwd White et al. 1990 GTAGTCATATGCTTGTCTC
NS3 fwd White et al. 1990 GCAAGTCTGGTGCCAGCAGCC
NS4 rev White et al. 1990 CTTCCGTCAATTCCTTTAAG
NS8 rev White et al. 1990 TCCGCAGGTTCACCTACGGA
NS19b fwd Hibbett 1996 CCGGAGAGGGAGCCTGAGAAAC
NS24 rev Gargas and Taylor 1992 AAACCTTGTTACGACTTTTA
NS41 rev Hibbett 1996 CCCGTGTTGAGTCAAATTA
NRC3R rev Peterson and Pfister 2010 GAKAACATCGCCCGATCC
NRC4R rev Peterson and Pfister 2010 GCAGGTTAAGGTCTCGTTCG
SSU1 fwd This study GGCTCATTAWATCAGTTATYG
SSU31R rev This study TTRAGACTACGACGGTATCTG
SSU3 fwd This study GCCAGCAGCCGCGGTAATTC
SSU42R rev This study CCTCGTTGAAGAGCAATAATTG
28S LR0R fwd Moncalvo et al. 1993 ACCCGCTGAACTTAAGC
CTB6 fwd Garbelotto et al. 1997 GCATATCAATAAGCGGAGG
LR5 rev Vilgalys and Hester 1990 TCCTGAGGGAAACTTCG
LR7 rev Vilgalys and Hester 1990 TACTACCACCAAGATCT
tef1 EF1-983F fwd Rehner 2001 GCYCCYGGHCAYCGTGAYTTYAT
EF1-2218R rev Rehner 2001 ATGACACCRACRGCRACRGTYTG
rpb1 RPB1-AFasc fwd Hofstetter et al. 2007 ADTGYCCYGGYCATTTYGGT
RPB1-6R1asc rev Hofstetter et al. 2007 ATGACCCATCATRGAYTCCTTRTG
RPB1-Af fwd Stiller & Hall 1997 GARTGYCCDGGDCAYTTYGG
RPB1-Cr rev Matheny et al. 2002 CCNGCDATNTCRTTRTCCATRTA
RPB1-B fwd This Study GARGAYGAYYTRACNTAYAA
rpb2 RPB2-5F fwd Liu et al. 1999 GAYGAYMGWGATCAYTTYGG
RPB2-7cR rev Liu et al. 1999 CCCATRGCTTGYTTRCCCAT
*fwd forward, rev reverse
Fig. 1 Bayesian phylogeny of Leotiomycetes revealing affinities of
encoelioid fungi as inferred from the analysis of combined 18S and 28S
rDNA, rpb1,rpb2 and tef1 data. Species traditionally recognised in
Encoelioideae are presented in bold, with those of Encoelia in capital
letters. Colours distinguish included orders of Leotiomycetes and
families of the Helotiales. Branches with posterior probability scores
0.95 are presented in bold. Scale bar indicates substitutions per site
186 Fungal Diversity (2017) 82:183219
0.1
KL290 Rutstroemia firma
Rutstroemia firma
KL291 Rutstroemia firma
KL292 Rutstroemia firma
KL222 Rutstroemia bolaris
KL234 Rutstroemia juniperi
KL310 Rutstroemia johnstonii
KL160 RUTSTROEMIA TILIACEA
KL393 Rutstroemiaceae sp.
KL288 Rutstroemiaceae sp.
KL217 Lanzia luteovirescens
Rutstroemia sp. as “Ciboria americana”
Lambertella subrenispora
Scleromitrula shiraiana 62001
KL156 SCLERENCOELIA FRAXINICOLA
KL347 SCLERENCOELIA FASCICULARIS
“Encoelia” fascicularis
KL344 SCLERENCOELIA PRUINOSA
Monilinia laxa
ATCC 18683 Sclerotinia sclerotiorum
CBS 499.50 Sclerotinia sclerotiorum
109263 Dumontinia tuberosa
VTT D-071295 Botryotinia fuckeliana
OSC 100012 Botryotinia fuckeliana
Scleromitrula shiraiana KUS-F52447
KL267 Pycnopeziza sejournei
KL212 Ciboria viridifusca
KL243 “Cenangium” acuum
KL276 “Cenangium” acuum
KL374 Piceomphale bulgarioides
KL98 Piceomphale bulgarioides
KL375 “Velutarina” alpestris
KL378 “Velutarina” alpestris
KL157 “Velutarina” alpestris
KL174 Cenangiopsis quercicola
KL377 sp.Cenangiopsis
KL332 Trochila craterium
KL336 Trochila laurocerasi
KL106 ENCOELIA FURFURACEA
KL108 ENCOELIA FURFURACEA
KL107 ENOELIA FURFURACEA
KL92 ENCOELIA FURFURACEA
KL253 Velutarina rufoolivacea
KL244 Cenangiaceae sp.
KL167 Chlorencoelia torta
KL21 Chlorencoelia versiformis
KP606 Chlorencoelia versiformis
KL254 Crumenulopsis sororia
Sarcotrochila longispora
Heyderia abietis
KL216 Heyderia pusilla
KL20 Heyderia abietis
KL390 Cenangium ferruginosum
Rhabdocline laricis
Ionomidotis sp.
KL391 Ameghiniella australis
KL299 Ionomidotis frondosa
KL301 Ionomidotis olivascens
Rhymbocarpus fuscoatrae
“ENCOELIA” HETEROMERA
KL164 “ENCOELIA” HETEROMERA
KL304 “ENCOELIA” HETEROMERA
KL231 Ionomidotis fulvotingens
KL239 Ionomidotis fulvotingens
SK91 Skyttea radiatilis Cordierites guianensis
TH90 Thamnogalla crombiei
SK80x Diplolaeviopsis ranula
TU64867 Unguiculariopsis lettaui
KL154 Ionomidotis irregularis
KL317 Diplocarpa curreyana
KL111 “ENCOELIA” FIMBRIATA
LL95 Llimoniella gregorellae
Chlorociboria aeruginosa
KL238 CHLOROCIBORIA GLAUCA
KL152 Chlorociboria aeruginascens
KL247 Chlorociboria aeruginella
Marssonina brunnea
KL153 Peltigeromyces sp.
KL118 Encoeliopsis rhododendri
Loramyces macrosporus
Mollisia cinerea
Vibrissea truncorum
Cyttaria hariotii 44
Cyttaria hariotii 55
Cyttaria darwinii
Ascocoryne sarcoides
Neobulgaria pura
KL221 Hyaloscypha albohyalina
Connersia rilstonii
KL219 Phaeohelotium geogenum
Cudoniella cf. clavus
KL215 Phaeohelotium imberbe
KL120 Perrotia populina
Lachnum virgineum
Dermea acerina
Pezicula carpinea
Neofabraea malicorticis
AR8 Calycina vulgaris
Bisporella citrina
Blumeria graminis
Erysiphe glycines
Pseudeurotium zonatum
Thelebolus microsporus
Leuconeurospora pulcherrima
TU112863 Holwaya mucida
KL220 Microglossum olivaceum
Microglossum rufum
Leotia lubrica
KL218 Claussenomyces prasinulus
Bulgaria inquinans
Phacidium lacerum
Potebniamyces pyri
Coccomyces strobi Rhytisma huangshanense
Tryblidiopsis pinastri
Cyclaneusma minus
Naemacyclus fimbriatus
KL159 XEROPILIDIUM DENNISII
KL251 XEROPILIDIUM DENNISII
Pilidium acerinum
Pilidium concavum
Chaetomella acutiseta
Zoellneria rosarum
Chaetomella oblonga Neurospora crassa
Sordaria fimicola
Hypocrea lutea
Xylaria hypoxylon
Rutstroemiaceae
Sclerotiniaceae
Cenangiaceae
Piceomphale clade
Cordieritidaceae
Chlorociboriaceae
Mollisiaceae s. l.
CYTTARIALES
RHYTISMATALES
Chaetomellaceae
Dermateaceae
ERYSIPHALES
PHACIDIALES
Tympanidaceae
Leotiaceae
Helotiaceae
Lachnaceae
Gelatinodiscaceae
Hyaloscyphaceae
THELEBOLALES
Pezizellaceae
Marthamycetaceae
SORDARIOMYCETES
Tympanidaceae
Pseudeurotidaceae
Pseudeurotidaceae
Fungal Diversity (2017) 82:183219 187
648 bp; rpb2631 bp; tef1463 bp. Bayesian analysis of the
partitioned five-gene dataset resulted in a well-resolved con-
sensus of the 37,500 trees retained (Fig. 1). Most terminal
clades as well as a large part of the deeper branches received
strong support.
The Bayesian phylogeny based on the five-gene dataset
revealed the Helotiales to be paraphyletic, with members of
the Cyttariales, Thelebolales, Erysiphales, Phacidiales and
Rhytismatales nested within. While the monophyly of these
five orders was highly supported, their relationships with var-
ious families of the Helotiales remained unresolved due to a
lack of support to most of the branches. Species of
Chaetomella,Pilidium and Xeropilidium dennisii (=
Encoelia fuckelii) formed a strongly supported group,
representing Chaetomellaceae, with an unresolved position
at the base of the tree.
Most of the encoelioid taxa were distributed among three
major clades in the multigene phylogeny (Fig. 1). The first
clade included a strongly supported monophyletic group
formed of the Rutstroemiaceae and Sclerotiniaceae together
with Cenangium acuum and Piceomphale bulgarioides as
their sister group. The second strongly supported larger clade
comprised the core group of the subfamily Encoelioideae and
members of the Hemiphacidiaceae that appeared
paraphyletic. All members of this clade are herein treated in
the resurrected family Cenangiaceae Rehm. The third strong-
ly supported clade comprised members of eleven encoelioid
genera of which six are lichenicolous. These are all considered
to constitute the Cordieritidaceae Sacc., another family
resurrected herein. These three major clades formed a strongly
supported group with largely unresolved relationships.
Members of Encoelioideae formed six monophyletic
groups recognised as distinct families, and three clades with
unsettled taxonomy (Encoeliopsis,Holwaya,Piceomphale).
Likewise, the genus Encoelia appeared highly polyphyletic,
with eight species placed six families the whole ingroup. The
type species of Encoelia,E. furfuracea, formed a strongly
supported group together with species of Velutarina and
Cenangiopsis (Encoelioideae s.str.), as well as Trochila spp.
and an undescribed taxon. Its sister clade comprised species of
Chlorencoelia, Sarcotrochila and Heyderia (Hemiphacidium
clade in Wang et al. 2006a), as well as Crumenulopsis sororia
and Cenangium ferruginosum. Altogether these two
subclades as well as Rhabdocline laricis are considered herein
to belong to the Cenangiaceae, which consequently includes
the Hemiphacidiaceae.
Encoelia fascicularis and E. pruinosa, shown to belong to
the Sclerotiniaceae, are reassigned to a newlydescribed genus
Sclerencoelia. However, phylogenetic relationships of this
strongly supported genus with their closest relatives in
Monilinia,Botryotinia, Sclerotinia,Dumontinia,andCiboria
remained largely unresolved. The sister group of the
Sclerotiniaceae,theRutstroemiaceae, comprised E. tiliacea
and Dencoeliopsis johnstonii. These two species formed a
strongly supported subclade with morphologically similar
species of Rutstroemia. For the time being, the taxonomy of
Cenangium acuum and Piceomphale bulgarioides remains
unsettled. One of the INSD strains of Scleromitrula shiraiana
(Henn.) S. Imai clustered with members of Sclerotiniaceae
and the other with Rutstroemiaceae.
In the Cordieritidaceae, the 11 encoelioid species were not
segregated from lichenicolous taxa represented by species of
Diplolaeviopsis, Rhymbocarpus, Skyttea and Thamnogalla.
Among the encoelioid taxa, Encoelia and Ionomidotis ap-
peared polyphyletic, while only one species of Ameghiniella,
Cordierites and Diplocarpa was included in the analysis. Two
species of Encoelia, most distantly related tothe core group of
Encoelioideae in Cenangiaceae, appeared to belong to two
distant families with unclear position in the Leotiomycetes.
Chlorociboriaceae comprised species of Chlorociboria and
E. glauca, which is herein transferred to this genus.Encoelia
fuckelii represented a distinct lineage in the Chaetomellaceae
and was combined in the newly described genus
Xeropilidium.
In addition to Encoelia, other genera of the subfamily
Encoelioideae appeared polyphyletic. These include
Cenangium andVelutarina in the Cenangiaceae and
Ionomidotis in the Cordieritidaceae. Members of
Encoelioideae for which phylogenetic relationships could
not be resolved include Encoeliopsis rhododendri and
Holwaya mucida. The former has been accepted in the
Helotiaceae (Groves 1969; Lumbsch and Huhndorf 2010)
but is assigned to the Mollisiaceae when treated in a broad
sense, while the latter was recently accepted in
Tympanidaceae (Baral 2015).The long-branch attraction
may be the reason for the inclusion of Holwaya mucida in a
clade comprising members of Pseudoeurotiaceae and
Thelebolales. It is likely that Holwaya represents a morpho-
logically and genetically divergent lineage in the
Leotiomycetes, thereby showing diverse affinities depending
on the taxa and genes analysed (Zhuang et al. 2000; Wang
et al. 2006b;Baschienetal.2013; Crous et al. 2014).
ITS rDNA analyses
Cenangiaceae INSD BLAST searches were conducted with
nine sequences representing the different genera of this family
according to the multigene analysis (Fig. 1). In each case, the
ITS sequences of 90 % similarity to the query were
downloaded and merged into one matrix. However, the query
sequence of E. furfuracea, showed only 87 % overlap with the
most similar INSD sequence. Only two of our reference se-
quences showed greater similarity to E. furfuracea, including
Cenangiopsis quercicola (88.3 %) and Cenangium
ferruginosum (88 %).Pairwise ITS sequence similarities
among the analyzed species varied between 83.8 %
188 Fungal Diversity (2017) 82:183219
(Rhabdocline laricis vs. E. furfuracea) and 94.4 %
(Chlorencoelia versiformis vs. Crumenulopsis sororia).
The phylogenetic tree calculated for these 87 sequences
distinguished a number of well-supported lineages, but
remained largely unresolved (Fig. S1). The monophyly of
genera and species was strongly supported for Heyderia,
Rhabdocline, Sarcotrochila and Trochila.OurITSphylogeny
supported the distinction of the endophytic R. parkeri with a
Meria anamorph from the pathogenic species of Rhabdocline
(R. pseudotsugae, R. epiphylla, R. oblonga, R. obovata).
Rhabdocline (= Meria)laricis formed a sister group to all
these species with the genus appearing distinct from all other
members of the Cenangiaceae.
The almost identical sequences from five collections of
E. furfuracea formed a divergent sister group of a clade com-
prising sequences of Trochila, Velutarina alpestris and
Cenangiopsis spp. However, relationships within this clade
and its affinities to other groups could not be clarified.
While the monophyly of Chlorencoelia was not supported,
the strong support received for the clade comprising se-
quences derived from apothecia of Cenangium ferruginosum
and from isolates of various endophytes indicated their con-
specific or congeneric status. Besides C. ferruginosum, se-
quences from biological samples (mostly of foliar endo-
phytes) were included in Heyderia abietis, Rhabdocline
laricis, R. parkeri and in the Chlorencoelia clade. In addition,
three strongly supported groups with unresolved relationships
comprised sequences only from endophytes, mostly from
roots or soil. Obviously, more INSD sequences from biolog-
ical samples belong to the Cenangiaceae, yet the delimitation
of this family could not be determined on the basis of ITS
rDNA data alone.
Further analysis focused on Cenangium ferruginosum and
its closest relatives. Among the 18 unidentified INSD
0.1
SCLERENCOELIA FASCICULARIS Z81431, Corylus avellana, Norway
KL347 , Populus tremula, GermanySCLERENCOELIA FASCICULARIS
KL144 , Populus tremula, EstoniaSCLERENCOELIA FASCICULARIS
KL401 , neotype, Populus tremula, EstoniaSCLERENCOELIA FASCICULARIS
Uncultured Encoelia HM240815, Pinus sylvestris needles, Finland
TAAM198511 SCLERENCOELIA FRAXINICOLA,
holotype, Fraxinus excelsior twig, Germany
Fungal sp. FJ228207, Fraxinus excelsior shoot, Sweden
KL156 , Fraxinus excelsior branch, GermanySCLERENCOELIA FRAXINICOLA
KL344 , Populus tremuloides bark, USA UTSCLERENCOELIA PRUINOSA
KL346 , Populus deltoides bark, USA NYSCLERENCOELIA PRUINOSA
KL343 , Populus tremuloides bark, USA UTSCLERENCOELIA PRUINOSA
Monilinia fructicola FJ515894, China
KL309 Ciboria conformata, Alnus leaves, Denmark
Ciboria conformata KF545323, Alnus glutinosa leaf litter, Netherlands
Ciboria conformata KJ941075, Alnus glutinosa leaves, Spain
Kohninia linnaeicola AY236423, Linnaea borealis, Norway
Botryotinia squamosa EU519208, Allium, China
Sclerotinia sclerotiorum AF455526, Homo sapiens nasal mucus
KL102 Ciboria conformata, Salix glauca leaves, Greenlandaff.
KL402 Elliottinia kerneri, Abies alba twigs, Switzerland
TU109263 Dumontinia tuberosa, Anemone nemorosa, Estonia
KL212 Ciboria viridifusca, Alnus catkins, Estonia
Valdensinia heterodoxa KF212190, Vaccinium corymbosum, Poland
Pycnopeziza sympodialis KF859927, USA
KL365 Ciboria batschiana, Quercus robur ahorn, Estonia
KL217 Lanzia luteovirescens, Acer platanoides petioles, Estonia
Rutstroemia firma KF588368, Quercus robur, Spain
KL312 , Xenotypa aterrima on Betula, DenmarkRutstroemia johnstonii
KL222 Rutstroemia bolaris, Betula twig, Estonia
KL351 Rutstroemia juniperi, Juniperus communis twigs, Norway
KL160 , Tilia branch, GermanyRUTSTROEMIA TILIACEA
Rutstroemia echinophila KF545332, Quercus castaneifolia cupule, Netherlands
KL289 Rutstroemia sydowiana, Quercus robur leaves, Estonia
Rutstroemia sp. as “Ciboria americana” JN033399, chestnut bur, Korea
Lanzia allantospora AY755334, Agathis australis, New Zealand
Lambertella subrenispora KF545329
Rutstroemia paludosa KF545316, Symplocarpus foetidus ,USA NY
Rutstroemia calopus KF545314, dead grass, Netherlands
Rutstroemia maritima KF588372, Ammophila arenaria dead stems, Spain
Scleromitrula shiraiana HQ833456, Morus fruit
Piceomphale bulgarioides KJ941086, Picea abies cone, Switzerland
KL98 Piceomphale bulgarioides, Picea abies cone, Estonia
Piceomphale bulgarioides Z81441, Picea abies, Norway
KL374 Piceomphale bulgarioides, Picea abies cone, Estonia
KL373 Piceomphale bulgarioides, Picea abies cone, Finland
KL232 “ , Pinus sylvestris needles, NorwayCenangium” acuum
KL276 “ , Pinus sylvestris needles, Czech RepublicCenangium” acuum
KL243 “ , Pinus sylvestris needles, GermanyCenangium” acuum
KL233 “ , Pinus sylvestris needles, NorwayCenangium” acuum
Piceomphale clade
Rutstroemia calopus
clade
Rutstroemia
s. str.
Sclerotiniaceae
Fig. 2 Bayesian phylogeny
based on rDNA ITS sequences of
selected members of the
Rutstroemiaceae and the
Sclerotiniaceae with
BCenangium^acuum and
Piceomphale as an outgroup.
Analysis included sequences
from fruitbodies (in italics) and
INSD sequences from other
biological samples with 95 %
similarity to the encoelioid
species (in bold). Species
traditionally recognised in
Encoelia are presented in capital
letters. Branches with posterior
probability scores 0.95 are in
bold. Scale bar indicates
substitutions per site
Fungal Diversity (2017) 82:183219 189
sequences with 95 to 100 % similarity to C. ferruginosum
(KL390), six appeared to belong to this species (Fig. S2).
Specifically, four INSD sequences originating from Viscum
album parasitizing Pinus sylvestris and two others from
needles or twigs of Pinus spp. formed a strongly supported
clade with six sequences obtained from apothecia growing on
twigs of Pinus spp. An isolate of C. japonicum formed their
sister group. The other strongly supported clade comprised
sequences from surface sterilised tissues of two conifers, a
forest grass, a liverwort and a lichen. The relationship of se-
quences from two further hosts remained unresolved at the
base of the tree.
Phylogenetic analysis of nine ITS sequences obtained from
apothecia of Chlorencoelia spp. and ten INSD sequences with
9599 % similarity to KL21 (C. versiformis) distinguished
C. versiformis from two clades of sequences accessioned as
C. torta (Fig. S3).The sister clade of these apothecia-derived
sequences was formed of sequences originating from biolog-
ical samples, mostly from ectomycorrhizal root tips of Larix
spp. and Pinus spp. or from coniferous litter. The anamorphic
Vestigium trifidum, described from Abies balsamea,andan
undescribed teleomorphic member of Cenangiaceae from
Salix branches formed the basal lineages of the ingroup.
Sclerotiniaceae The ITS rDNA phylogeny supported the dis-
tinctiveness of encoelioid members within the family (Fig. 2),
for which the genus Sclerencoelia is described below. Among
these, both S. fascicularis and the new species S. fraxinicola
included apothecial and endophytic isolates in their respective
clades. Phylogenetic relationships among the sclerotiniaceous
genera remained largely unresolved, likewise in the analyses
of an extended dataset (not shown), which included similar
INSD sequences obtained mostly from soil samples.
Rutstroemiaceae The analysis of ITS rDNA of an extended
set of samples (Fig. S4) supported the multigene phylogeny
(Fig.1) in distinguishing the monophyly of this family. The
former, as well as an analysis of ITS data of Rutstroemiaceae
and Sclerotiniaceae (Fig. 2)revealedRutstroemia and Lanzia
as polyphyletic, although only the terminal branches were
supported. Almost all INSD sequences from biological sam-
ples fell into a well-supported clade comprising apothecia-
derived sequences of Rutstroemia calopus, R. maritima and
R. paludosa. This species complex appeared distinct from the
clade comprising the type of the genus, R. firma,aswellasthe
two encoelioid species, Dencoeliopsis johnstonii and
Encoelia tiliacea.
Chlorociboriaceae The initial datamatrix included represen-
tatives of all species of Chlorociboria with available ITS se-
quences, and E. glauca together with >85 % similar INSD
sequences. While this was the lowest ITS similarity value
observed among species of Chlorociboria, the list of all
sequences with >85 % similarity to E. glauca also included
representatives from different families of the Helotiales and
many unidentified sequences from biological samples. In the
initial analysis all these sequences formed an unsupported
clade distinct from that of Chlorociboria sequences, but were
excluded from the final analysis. Despite the high number of
variable characters, the ITS-based phylogeny of remaining
Chlorociboria sequences was largely unresolved and the ge-
nus was not supported as monophyletic (Fig. S5).
Chaetomellaceae The ITS matrix included INSD sequences
with 85%similaritytoKL251(Xeropilidium dennisii)as
well as some more dissimilar sequences from genera shown
to belong to the family (Johnston et al. 2014a; Rossman et al.
2004). The analysis (Fig. S6)revealedXeropilidium dennisii
as the most basal group in the phylogeny. The two sequences
derived from apothecia were indentical to the one obtained
from a culture isolate and to an INSD sequence obtained from
the European elm bark beetle (Scolytus multistriatus), the vec-
tor of Dutch elm disease. The rest of the ingroup included
Chaetomella spp., Pilidium spp., Sphaerographium nyssicola,
Corniculariella brasiliensis and unidentified INSD sequences
originating from various plants.
Taxo nomy
Species combined in Encoelia in the past belong to three pre-
viously described genera (Chlorociboria, Encoelia,
Rutstroemia) and four new genera (Sclerencoelia,
Xeropilidium and two unnamed genera) as revealed by the
phylogenetic analysis of multigene data. In the multigene phy-
logeny (Fig. 1), these genera were distributed among the fam-
ilies Cenangiaceae and Cordieritidaceae, both resurrected
here, Chlorociboriaceae and Chaetomellaceae, proposed re-
cently (Baral 2015), as well as Rutstroemiaceae and
Sclerotiniaceae. Morphological characters of taxa, so far treat-
ed in Encoelia and Encoelioideae (Table S3),were
reevaluated with respect to their phylogenetic relationships,
revealed for the first time in this study. This resulted in several
taxonomic changes, involving descriptions of new genera and
species, new combinations and expansion of the concept of
some genera and families due to the inclusion of previously
misplaced members. In the following we present detailed de-
scriptions of six species previously assigned to Encoelia and
of one new species. In addition, 14 genera of the previous
Encoelioideae for which material was available are discussed.
Cenangiaceae
Rehm (as BFamilie Cenangieae^), in Winter, Rabenh. Krypt.-
Fl., Edn 2 (Leipzig) 1.3(lief. 31): 213 (Rehm 1889) [1896],
emend. Baral & Pärtel. Type genus: Cenangium Fr. (Fig. 3).
190 Fungal Diversity (2017) 82:183219
=Helotiaceae subfam. Encoelioideae Nannf. Nannfeldt
1932 (s. str.) Type genus: Encoelia (Fr.) P. Karst.
=Hemiphacidiaceae Korf 1962 Type genus:
Hemiphacidium Korf (= Sarcotrochila Höhn. fide Stone and
Gernandt 2005).
Apothecia 0.220 mm in diam., opening with a circum-
scissile or lacerate rupture of the overlying host tissue,
immersed or erumpent, stroma absent, cupulate to plane, rare-
ly capitate (Heyderia); the disc often closing upon drying or
retracting under the covering lid (Fig. 3j); ± sessile (but long-
stipitate in Heyderia); leathery or soft, brownish-greyish,
ochraceous, yellowish or greenish; margin and exterior
smooth or tomentose to pustulate due to brownish hair-like
elements. Ectal excipulum of hyaline to brown t. globulosa-
Fig. 3 Morphology in species of Cenangiaceae.aApothecia of
Cenangiopsis quercicola.bdChlorencoelia versiformis,bapothecia,c
marginal cells* with vacuolar bodies (VBs), d ascus apical ring in IKI. e
Closed young apothecia of Encoelia furfuracea.fiCenangium
ferruginosum,fapothecia, gcells of ectal excipulum, hiasci with
asymmetrical apex, h dead state in CB, i living state. jApothecia of
Hysterostegiella dumeti, with lids (arrows). knVe lut a r ina
rufoolivacea, k external cells of excipulum with crystalloid deposits, l
ascus apical ring in IKI, m vesicular cell* with VB in medullary
excipulum, n young apothecia. oqTrochila laurocerasi, o apothecia, p
ascus apical ringin IKI, q marginal cells* of excipulum with VBs. rs
Heyderia pusilla, r hair-like cells* on stipe with VBs, s apothecium on a
needle. Scales: a, f, j, n, o, s = 1 mm; b, e = 1 cm; c, gi, km, p
r=10μm; d = 5 μm. Sources: a H.B. 8521; b, d TU 119720; c M.H.
13.X.08, e TU 112918; f TAAM 198451; g OULU 24441; h OULU
24432; i H.B. 7615; j I.W. 110,703; k, n H.B. 8977; l, m H.B. 9181; o
q M.H. VII.2011, rs H.B. 9617. Photos a by J.H. Petersen; c, oqbyM.
Hairaud; f by B. Perić; j by I. Wagner
Fungal Diversity (2017) 82:183219 191
angularis, strongly reduced in immersed genera, sometimes
with crystals. Paraphyses cylindrical or lanceolate, exceeding
the asci or not; *terminal cell mostly containing a large, hya-
line or yellow to greenish or brownish, elongate (rarely
multiguttulate) refractive vacuole (VB), VBs rarely absent
(Cenangium p.p., Ve lutarina p.p.). Asci cylindric-clavate,
apex hemispherical to conical, inamyloid or amyloid (usually
with Calycina-type apical ring) (Figs. 3dp) with or without
croziers, (24)8-spored, rarely polysporous. Ascospores el-
lipsoidal, ovoid, fusoid, clavate, or allantoid; aseptate, rarely
13-septate when overmature; hyaline, in some species brown
when overmature; lipid content low to high; sometimes cov-
ered by a sheath, sometimes budding microconidia on short
germ tubes. Ionomidotic reaction absent, very rarely positive
(yellowish to reddish-brown in Cenangium ferruginosum).
Anamorphs acervular (Rhabdocline,Rhabdogloeopsis),
sporodochial (Rhabdocline), or stromatic (Crumenulopsis)
but unknown in most of the taxa. Habitat lignicolous or
foliicolous, endophytic, saprotrophic or parasitic on gymno-
and angiosperms, causing leaf blight and branch canker espe-
cially in conifers (Abies,Larix,Picea,Pinus,Pseudotsuga)
(Korf 1962;Hein1983;Gernardtetal.1997,Stoneand
Gernandt 2005,Wangetal.2006a;Wangetal.2009), mostly
desiccation-tolerant.
Included genera: Cenangiopsis Rehm, Cenangium Fr.,
Chlorencoelia J.R. Dixon, Crumenulopsis J.W. Groves,
Encoelia (Fr.) P. Karst.s.str.,Fabrella Kirschst., Heyderia
(Fr.) Link, Rhabdocline Syd., Sarcotrochila Höhn., Trochila
Fr. and Velutarina Korf ex Korf.(Based on morphology,
Didymascella Maire & Sacc., Hysterostegiella Höhn. and
Korfia J. Reid & Cain could be included, but molecular evi-
dence to support this is lacking.)
The core group of Encoelioideae formed a monophyletic
group with several members of the Hemiphacidiaceae in the
multigene phylogeny (Fig. 1).The former group was repre-
sented by type species of two genera, Encoelia furfuracea and
Cenangium ferruginosum,aswellasspeciesofCenangiopsis,
Crumenulopsis,andVe l u t a r i na.Nannfeldt(1932) treated the
Encoelioideae as a subfamily of Helotiaceae, and until now
most of these genera were accepted in thisfamily. The transfer
of E. fascicularis to the Sclerotiniaceae (Holst-Jensen et al.
1997) was later extrapolated to E. furfuracea and to other
species in the genus (Lumbsch and Huhndorf 2010,Kirk
et al. 2015). However, our multigene phylogeny revealed this
affiliation to be erroneous.
Hemiphacidiaceae wasintroducedasagroupofsmallpar-
asitic fungi (genera: Didymascella, Fabrella, Gremmenia,
Hemiphacidium, Korfia, Lophophacidium, Naemacyclus,
Rhabdocline (= Meria)andSarcotrochila) with reduced
excipulum immersed in leaves of conifers (Korf 1962,1973;
Reid and Cain 1963). The family was subsequently expanded
based on results of phylogenetic analyses (Wang et al. 2006a,
b) to include some morphologically more divergent genera,
such as Heyderia and Chlorencoelia. The family has been
distinguished as a sister group of Sclerotiniaceae and
Rutstroemiaceae in previous phylogenetic studies (Spatafora
et al. 2006;Wangetal.2006b;Johnstonetal.2014a; Crous
et al. 2014). In our analyses of the multigene data, however,
neither the core group of Encoelioideae nor the
Hemiphacidiaceae appeared monophyletic while forming a
well-supported sister group of Sclerotiniaceae and
Rutstroemiaceae. Based on this evidence, we consider the
core group of Encoelioideae and the analysed members of
Hemiphacidiaceae (Chlorencoelia,Sarcotrochila,Heyderia,
Rhabdocline), to form a single family, the Cenangiaceae.In
addition, the genera Trochila and Hysterostegiella, previously
accepted in the Dermateaceae (Nauta and Spooner 2000b,
Lumbsch and Huhndorf 2010), are included in the
Cenangiaceae. The transfer of these genera is based on close
relationship of Trochila to studied members of Cenangiaceae
(Fig. 1), and on the morphological similarity of
Hysterostegiella to Trochila and Sarcotrochila.
Alternatively, a division into two families could be attained
by the inclusion of Crumenulopsis and Cenangium
ferruginosum in the Hemiphacidiaceae while recognising its
sister group as a new family. These two groups are distin-
guished by differences in the host, being mostly gymnosperms
in the Hemiphacidiaceae-clade and usually angiosperms in
the Encoelia-Cenangiopsis-Velutarina clade. However, the
two subdivisions cannot be delimited on morphological
grounds, whereas the affinities of Rhabdocline with either of
these clades remained unresolved (Fig. 1).
Cenangiaceae is herein resurrected to include all the
above-mentioned genera, as it is the oldest family name avail-
able for this group. Rehm (1889) described this family to
comprise species that have erumpent, urn-shaped to cupulate,
leathery apothecia with a rough exterior, being closed at the
beginning and opening by a mostly roundish pore with a sharp
margin. Rehm included five genera in the family, of which our
concept retained Cenangium s. str. (C. ferruginosum)and
Crumenulopsis (Crumenula Rehm), with Cenangella
Sacc. placed in synonymy with Dermea (Dermateaceae,
Rehm 1912), Godronia Moug. & Lév. in the recently de-
scribed Godroniaceae (Baral 2015), and Tryblidiella Sacc. in
Patellariaceae, Dothideomycetes (Kutorga and Hawksworth
1997).
Members of the expanded Cenangiaceae including those
of the previous Hemiphacidiaceae share several morphologi-
cal characters. Most of these taxa are characterised by
fruitbodies that are initially or in dry periods closed either by
a lid or a roof-like apothecial margin, while the shape and size
of the apothecia are quite variable among different genera.
The outermost, generally globose cells of the ectal excipulum
are often loosely connected or the excipular tissue is reduced.
Refractive vacuoles, observed solely in the terminal cells of
living paraphyses or in excipular cells (Figs. 3crand4mn),
192 Fungal Diversity (2017) 82:183219
serve as a synapomorphy for almost all genera assigned herein
to the Cenangiaceae for which living material could be stud-
ied. This feature is absent in only a few species (Cenangium
ferruginosum,Velutarina bertiscensis). Refractive vacuoles
have rarely been mentioned in earlier descriptions, because
this feature is usually invisible in dried material. In the lack
of fresh collections, it could so far not be explored in
Didymascella,Fabrella,Korfia and Rhabdocline. The lon-
gevity of fruitbodies is characteristic of many members of
the Cenangiaceae. Their apothecia often grow on corticated
branches or leaves still attached to trees even several meters
above ground.
Fig. 4 Encoelia furfuracea.aClosed juvenile apothecia. bcMature
apothecia showing a lacerate margin. deCross-section of fruitbody. f
Loosely attached outermost cells forming sharp outgrowths covered by
crystalloid matter. gCells of ectal excipulum covered with rough exudate.
hMedullary excipulum. iHymenium*. jAscus apexin KOH + MLZ. k
Asci in KOH + MLZ. lAscospores*, two with microconidia. mn
Paraphyses* with apical refractive vacuole, n in CRB. Scale bars: a
c = 1 cm, d = 50 μm, e = 100 μm, f = 20 μm, gj, kn=10μm.
Sources: a TU 112918; bc TU 104532; de, TAAM 198454; fi, m, n
TU 104527; j, l TU 104533; k TU 104511. Photos b, c by V. Liiv
Fungal Diversity (2017) 82:183219 193
INSD sequences from biological samples that had >90 %
similarity to our reference sequences of the Cenangiaceae
originated mostly from tissues of various plants (Figs. S1
S3). Whereas endophytes from leaves and twigs could often
be identified to genus or species, root endophytes formed sep-
arate clades distinct from identified strains. The data accom-
panying these ITS sequences reveal that an endophytic life-
style is shared by members of the previous Hemiphacidiaceae
and the core group of Encoelioideae. In addition to several
lineages including sequences from only endophytes, these da-
ta provide evidence of the occurrence of the endophytic stage
also in various species that form apothecia.
Cenangium Fr. Fries 1822
Type species: Cenangium ferruginosum Fr.
In Cenangium apothecia are erumpent, leathery and cupu-
late, with margins inrolled when dry. The excipulum is brown
and formed mainly of globose thick-walled cells and the as-
cospores are ellipsoidal (Fig. 3fi). While numerous species
have been included previously in Cenangium, the most recent
works including the genus (Korf 1973; Dennis 1978) have
retained only BC.^acuum in addition to the type species.
Cenangium ferruginosum is distinguished from many other
members of Cenangiaceae by an inamyloid ascus apex,
representing a unique type (Verkley 1995) and a positive
ionomidotic reaction. Both C. ferruginosum (apothecia on xe-
ric pine bark) and BC.^acuum (on xeric pine needles) may
grow endophytically in pine needles, but differ most remark-
ably in the ascus apex, the latter possessing an amyloid apical
ring (Table S3). The closest relatives of C. ferruginosum in the
multigene phylogeny (Fig. 1) were Heyderia spp., which grow
on coniferous needles. By contrast, BC.^acuum formed a
more distantly related group together with Piceomphale
bulgarioides, inhabiting hygric spruce cones.
The presense of C. ferruginosum apothecia on diseased
pines and culture experiments with pine needles have
demonstrated a parasitic-endophytic lifestyle for this
species (Sieber et al. 1999;Jurcetal.2000). It is con-
sidered to cause damage to pines in Poland (Duda and
Sierota 1997), Spain (Santamaria et al. 2007)andJapan
(Koiwa et al. 1997). ITS rDNA provided additional ev-
idence of the parasitic-endophytic lifestyle of
C. ferruginosum with four INSD sequences from
Viscum album on Pinus sylvestris and four sequences
from fruitbodies of C. ferruginosum on pines each dif-
fering only in a few autapomorphies. With respect to
ITS phylogeny, an ITS sequence from apothecia on
P. n i g r a , another from a P. halepensis endophyte and
the third from pine needles were distinguished in the
C. ferruginosum clade by sharing one synapomorphy
(Fig. S1). Altogether these 11 sequences formed a
strongly supported clade with the morphologically very
similar C. japonicum as a sister group. Furthermore,
several presumably congeneric endophytic fungi
detected from various hosts appeared closely related to
these two species of Cenangium (Figs. S1,S2).
Cenangiopsis Rehm 1912
Type species: Cenangiopsis quercicola (Romell) Rehm
Cenangiopsis quercicola is a sessile, cupulate, externally
pustulate and marginally hairy fungus (Fig. 3a). It differs from
Encoelia furfuracea in having more fragile fruitbodies with a
paler (beige) disc and protruding lanceolate paraphyses. The
species forms apothecia on recently dead, thin, corticated
branches of living oak trees (Læssøe and Petersen 2007), re-
sembling E. furfuracea in tolerating long periods of low air
humidity by inrolling the disc. The multigene (Fig. 1.) and ITS
rDNA phylogeny (Fig. S1) both revealed a close relationship
between C. quercicola and an undescribed species of
Cenangiopsis,BVelu t a r i n a^alpestris and Trochila spp.
Chlorencoelia J. R. Dixon 1975
Type species: Chlorencoelia versiformis (Pers.) J. R.
Dixon, Fig. 3bd.
Members of the Cenangiaceae grow typically on xeric
leaves or bark, but Chlorencoelia spp. form apothecia on
hygric, rotten, decorticated wood, mainly of angio- but also
gymnosperms. Dixon (1975) discussed the overlap of charac-
ter ranges of Chlorencoelia versiformis and C. torta.
However, analysis of ITS data, including sequences from re-
cent collections in Estonia and USA, distinguished these two
species (Fig. S3). Ascospores examined in these collections
also provide a clear distinction, being 26-guttulate and
subcylindric-allantoid in C. versiformis, but biguttulate and
subcylindric-ellipsoidal in C. torta. Ascospores from collec-
tions of both species germinated on MEA, producing sterile
olivaceous colonies comprised of hyphae 1.53.5 μmindiam.
All isolates remained sterile over 2 months, with no characters
observed to distinguish the two species in culture.
The ITS phylogenies did not support the monophyly of
Chlorencoelia (Figs. S1 and S3).Among collections labelled
as C. torta, those from North America (collected near the type
locality), were distinct from South-East Asian collections,
suggesting that these represent distinct species. INSD ITS
sequences with 95 % similarity obtained from
ectomycorrhizal root tips or litter of conifers probably repre-
sent one or more closely related taxa, segregated from
C. versiformis and C. torta at the species or generic level.
Whereas these two species produce apothecia on decaying
hygric wood, their close relatives can grow as endophytes of
aerial plant parts, which is characteristic of members of the
Cenangiaceae.
Crumenulopsis J.W. Groves 1969
Type species: Crumenulopsis pinicola (Rebent.) J.W.
Groves.
Crumenulopsis is a genus with rather dark long-haired
apothecia growing on xeric coniferous bark. The genus resem-
bles Cenangiopsis quercicola in that it forms fragile
apothecia. The type species, C. pinicola (Rebent.) J.W.
194 Fungal Diversity (2017) 82:183219
Groves could not be included in the analysis due to the lack of
a recent collection. Crumenulopsis sororia is a parasite caus-
ing pine dieback (Butin 1989), which forms black globular
pycnidia in culture (van Vloten and Gremmen 1953).
Multigene analysis (Fig. 1) supported a close relationship with
Chlorencoelia, while the ITS rDNA data did not resolve its
affinities (Fig. S1).
Encoelia (Fr.) P. Karst. Karsten 1871.
Encoelia was established as a tribe within Peziza sect.
Aleuria by Fries (1822) and raised to generic level by
Karsten (1871). Rehm (1889:219)treatedEncoelia (together
with Eucenangium) as a subgenus of Cenangium in the sub-
family Cenangieae in Dermateaceae. Kirschstein (1935)ac-
cepted Encoelia with three subgenera, Euencoelia,
Encoeliopsis [non Encoeliopsis Nannf.], and Ocellaria.Korf
and Kohn (1976) adopted this concept concerning the former
two subgenera, by using the older name Phibalis Wallr. (as
subgen. Phibalis and Kirschsteinia, respectively). Encoelia
was lectotypified with E. furfuracea (Roth) P. Karst.
(Clements and Shear 1931), and Eckblad et al. (1978)pro-
posed its conservation at the generic level against Phibalis
Wallr., which had shortly before been lectotypified with the
same species, Phibalis furfuracea (Roth) Wallr., by Korf and
Kohn (1976).
Encoelia furfuracea (Roth) P. Karst., Bidr. Känn. Finl.
Nat. Folk 19: 218 (Karsten 1871)(Fig.4)
Peziza furfuracea Roth, Catal. Bot. 1: 257 (1797)
Phibalis furfuracea (Roth) Wallr., Flora Cryptogamica
Germaniae (Norimbergae) 2: 447 (1833)
Cenangium furfuraceum (Roth) De Not., Porp. Rettif.
Profilo Discomyc.: 30 (1864)
= Peziza furfuracea var. caespitosa Alb. & Schwein.,
Consp. fung. (Leipzig): 343 (1805)
Apothecia ca. 520(33) mm in diam., growing usually in
scattered clusters of a few fruitbodies or rarely solitary,
erumpent, arising from a wide stipe-like base, 23×2
2.5 mm, deeply immersed in bark, seated on wood below,
sometimes with black stromatic tissue in wood. At first closed
(cleistohymenial, opening in the mesohymenial phase when
young asci already formed) and usually irregularly cushion-
shaped, sometimes elongated, outside strongly furfuraceous-
flaky, beige, light clay-pink to light cinnamon-brown; tough.
After opening by an irregularly torn aperture which remains as
a lacerate margin, the fruitbodies become ± cupulate or almost
flat by curling outward the margin to expose the disc. In dry
condition the margin is strongly inrolled and the disc closed,
external surface hydrophilous, rapidly taking up water. Disc
smooth, bright hazel- to dark chestnut brown, sometimes with
greyish hue, darkening when dry. Ectal excipulum 80
200 μm thick, of reddish-brownish, loose t. globulosa,cells
715 μmindiam.,withgoldenbrownandpartlyrefractive
thick walls and brown, rough intercellular substance (exu-
date), the outermost layer Bflaking^into c. 5080 μmlong
pyramid-like pustules, sometimes terminally with sharply
pointed and branched, hyaline to brown hyphae, heavily
incrusted with hyaline crystalloid matter that stains turquoise
blue in CRB, KOH does not change or dissolve the pigment
but ± dissolves the crystalloid matter (also MLZ). Medullary
excipulum 2001000 μmthick,incentre24mmthick,oft.
intricata,hyphae(2)47(10) μm wide, thin- to very thick-
walled, loosely interwoven, walls heavily incrusted with hya-
line or light yellowish to brownish exudate, vesicular cells
absent. Subhymenium ochraceous, 50 μmthick,oft.
intricata, hyphae 34μm wide. Asci narrowly clavate, ta-
pered towards the base in a very long and relatively narrow
stipe, *125150 × (7.5)88.5(9.3) μm {2}, 90115 × 5
7(8) μm {5}; apex rounded, subtruncate or subconical, api-
cal ring euamyloid, staining deep blue in IKI and MLZ,
Calycina-like, spores* ± obliquely 23-seriate, pars sporifera
*~2830 μm long, arising from croziers, partly with small
perforation {4}. Ascospores allantoid, slightly to strongly
curved, hyaline, non-septate, *(8)911(12) × 22.5(3)
μm{4},610(12) × (1.5)22.6 μm, with 12medium-
sized and a few small guttules (LBs) near each end; in over-
mature apothecia sometimes producing subglobose to ovoid
microconidia *2.23.2 × 1.82μm directly at one end.
Paraphyses slightly shorter than living asci, narrowly clavate,
23.5 μm thick in lower half, gradually widened near apex to
*3.55(6.5) μm, covered by a thin, hyaline to palebrown gel
sheath, living terminal cell containing a refractive,
ochraceous- to greenish-yellow vacuole *820 × 36μm,
staining turquoise-blue in CRB. Rhomboid crystals absent.
Habitat: on dead, still standing, corticated trunks and
branches of Corylus spp., Alnus spp. and Carpinus betulus,
0.53 m above ground. Phenology: growing mostly in the
cold season but can be found almost all year around.
Distribution: common in boreal and temperate regions of
Europe and North America (Breitenbach and Kränzlin 1984,
Hansen and Knudsen 2000,Beugetal.2014).
Comments: This fungus is one of the few members of the
Helotiales in the temperate and boreal humid zone that de-
velops comparatively large apothecia that persist throughout
the winter when the forest floor can be snow-covered. Based
on our observations the whole fruitbody is drought-tolerant
and can survive desiccation for at least a month.
Morphologically, E. furfuracea most resembles Ve l u t a ri n a
rufoolivacea, and these two species formed a strongly sup-
ported clade in the multigene phylogeny (Fig. 1).Their mor-
phological similarities are manifested in the composition of
the ectal excipulum and its furfuraceous outer layer
(Table S3). A striking difference was noted in regard to water
uptake by the surface of the receptacle. Specifically, dry
apothecia of E. furfuracea (and V. bertiscensis) are soaked
rather rapidly after adding a drop of water on their surface,
whereas V. rufoolivacea is water-repellent and absorbs water
tardily (Baral and Perić2014). Furthermore, Velutarin a
Fungal Diversity (2017) 82:183219 195
rufoolivacea is plurivorous, whereas E. furfuracea is restricted
to species of Betulaceae.
The distinctness of Encoelia furfuracea is manifested not
only in morphology but also at a molecular level. A long
branch distinguished E. furfuracea from other members of
the Cenangiaceae in the multigene (Fig. 1) and ITS phyloge-
ny (Fig. S1). In both trees its closest relatives included species
of Velutarina, Cenangiopsis and Trochila. The most similar
INSD ITS sequences were >13 % different and represented
endophytic isolates from various plants. Intraspecific variation
in ITS, however, was low, with the one North American spec-
imen differing from the European specimens on various hosts
at only one position.
Specimens examined CANADA, Newfoundland and
Labrador, Newfoundland Co, Humber village, Maple Ave
13, 48.98528°N 57.77°W, alt. 11 m, in broad-leaved wood,
Alnus incana subsp. rugosa, on a dead trunk, 22 Mar 2010,
leg. A. Voitk (TAAM 198454, KL 400); ibid., 25 Mar 2010
(TAAM 198456); near Blow-Me-Down hiking trail, 49.06° N
58.29189°W, alt. 240 m, Alnus sp., on dead trunk, 4
May 2015, A. & M. Voitk (TU 104533). ESTONIA,
Jõgevamaa, Puurmani Comm., Kursi forestry sq. 95,
58.5333°N 26.275°E, alt. 43 m, on branches of deciduous
tree, 8 Oct 1997, A. Raitviir (TAAM 137509, KL92);
Raplamaa, Juuru Comm., Järlepa forestry sq. 41, 59.1383°N
24.983°E, alt. 75 m, on dead branches of Corylus avellana,22
May 2004, K. Pärtel (TAAM 165978, KL106); Lääne-
Virumaa, Kadrina Comm., near Pariisi, 59.266°N 26.15°E,
alt. 117 m, C. avellana, on a dead branch, 13 May 2000, K.
Pärtel (TAAM 165633, KL107); Rakvere, in oak forest,
59.33972°N 26.35138°E, alt. 107 m, C. avellana, on a dead
branch, 30 Oct 2011, K. Põldmaa (TU 112918); Tartumaa,
Nõo Comm., Vapramäe, 58.25°N 26.467°E, alt. 58 m,
C. avellana, on a dead branch, 28 Jan. 2001, A. Raitviir
(TAAM 165767, KL108); ibid., 58.25333°N 26.46167°E,
alt. 54 m, C. avellana, on standing dead trunk, K. Pärtel, 28
Mar 2015 (TU 104527); Saaremaa, Lümanda Comm., Viidu,
Viidumäe Nature Reserve, 58.28277°N 22.12916°E, alt.
50 m, C. avellana, on dead trunks, 6 Apr 2011, V. Liiv (TU
118321); ibid. 58.2826°N 22.1294°E, 1 Apr 2015, V. Liiv
(TU104532).GERMANY,Baden-Württemberg,7.5km
NW of Stuttgart, 1.3 km WSW of Weilimdorf, Fasanenwald,
48.812°N, 9.098°E, alt. 340 m, branch of Carpinus betulus,
11 Feb. 1990, O. Baral & H.O. Baral (H.B. 4010); 6 km NW
of Stuttgart, 1 km S of Korntal, Tachensee, 48.821°N 9.124°E,
alt. 320 m, branch of Corylus avellana, 27 Jan. 1974, H.O.
Baral & O. Baral (H.B. 1038); 8 km S of Böblingen, 3.5 km S
of Holzgerlingen, Schleißenhau, 48.607°N, 9.022°E, alt.
500 m, trunk & branch of C. avellana, 18 Dec 1989, H.O.
Baral (ø); Bayern, 8.5 km ESE of Sonthofen, 2.5 km SSE of
Hindelang, E of Hornkapelle, SW of Bruck, 47.483° N
10.383°E, alt. 870 m, branch of C. avellana, 27 Mar 1977,
H.O. Baral (H.B. 1783); 13.5 km ESE of Regensburg, 0.5 km
E of Roith, Moosgraben, 48.982°N 12.28°E, alt. 340 m,
branch of Alnus, 1 Feb. 1990, E. Weber & H.O. Baral (H.B.
3980). SWITZERLAND, Bern, Jura bernois, Tavannes,
47.22°N 7.194°E, alt. 800 m, Corylus avellana, on recently
died branch, 1 Mar 2014, A. Ordynets (TU104511); Thurgau,
4.5 km NW of Frauenfeld, 0.5 km S of Horben, Ittingerwald,
47.585° N 8.86°E, alt. 490 m, branch of Alnus, 15 Dec 1986,
P. Blank (H.B. 3137).
Velutarina Korf ex Korf 1971
Type species: Velutarina rufoolivacea (Alb. & Schwein.)
Korf (Fig. 3kn)
The genus is characterised by erumpent, sessile, brown,
externally pruinose-tomentose, rather thick, cleistohymenial
apothecia. Based on multigene phylogeny, Vel u t a r i n a is
paraphyletic. The type species of the genus, V. rufoolivacea,
resembles most its phylogenetically closest species, Encoelia
furfuracea, from which it differs mainly in the broadly ellip-
soid ascospores.A similar apothecial development with a late
opening in the mesohymenial phase is notable for both taxa.
Moreover, both taxa have tough and revivable apothecia with
the rust-brownish outer surface that appears furfuraceous due
to globose excipular cells, which are loosely interconnected
and lack hyphal orientation. These cells rarely exceed 15 μm
in diam., but in V. rufoolivacea some can measure up to 30 μm
in diam. and have a greenish vacuolar content. Such greenish
vesicular cells are found mainly in the medullary excipulum,
and are absent in E. furfuracea. However, the same greenish
or chlorinaceous vacuolar sap is found in the living terminal
cells of paraphyses in both species. These morphological dif-
ferences between V. rufoolivacea and E. furfuracea (Suppl.
Tab. 3), together with some additional aspects pointed out
by Kohn (1977), do not support merging the two species into
one genus. Recently described Velutarina bertiscensis and
V. Balpestris specimens from Europe lack oversized cells
with greenish content and amyloid asci, and V. bertiscensis
also lacks the refractive vacuoles in the paraphyses (Baral
and Perić2014, see also Suppl. Tab. 3). ITS sequences could
not be obtained for V. rufoolivacea and V. bertiscensis. Further
studies are needed to resolve the generic placement of
Ve l u t a ri n a spp.
Sclerotiniaceae
Whetzel, Mycologia 37(6): 652 (1945).
Type genus: Sclerotinia Fuckel
The phylogenies presented herein corroborate the results
by Holst-Jensen et al. (1997,2004) by assigning
E. fascicularis to the Sclerotiniaceae. This species and
E. pruinosa are transferred to a new genus Sclerencoelia.
Both species, as well as a newly described species, share typ-
ical sclerotiniaceous features such as a subtruncate ascus apex
resembling the Sclerotinia-type, globose cells of the ectal
196 Fungal Diversity (2017) 82:183219
excipulum, and ascospores that form microconidia. However,
the formation of subsessile coriaceous, persistent apothecia
with rich external crystals on woody substrata is untypical in
this family. In addition, the characters of stromatal tissues,
described below, are unique to Sclerencoelia. Baral &
Richter (1997: Figs 12, 17) discussed the uncertain relation-
ship of E. fascicularis to Encoelia subgenus Kirschsteinia
based on the deviating t. globulosa in this species aggregate,
as exemplified by a collection on Fraxinus (H.B. 3005).
Sclerencoelia Pärtel & Baral gen.nov.
MycoBank MB 815439.
Diagnosis: Apothecia growing out from substratal sclero-
tia or crust-like stromatic tissue within bark, erumpent through
bast (secondary phloem) and periderm; gregarious or in small
clusters, cupulate, when dry compressed or retracted,
subsessile, development cleistohymenial, opening rather late-
ly, disc brownish to black, receptacle surface (blackish-)grey,
white-pruinose from crystals. Ectal excipulum of t.
globulosa, inner part of globose to broadly ellipsoid, ± hyaline
cells, sharply delimited from medullary excipulum, outer part
of brown, thick-walled globose cells, pigment olivaceous to
black-brown in KOH. Medullary excipulum of hyaline t.
intricata.Asci cylindric-clavate, 8-spored; apex rounded to
truncate, inamyloid or faintly blue in iodine (IKI), reduced
Sclerotinia-type. Ascospores cylindrical, slightly curved
(allantoid), eguttulate, uninucleate, 01-septate when overma-
ture, budding small subglobose conidia. Paraphyses apically
uninflated to slightly clavate or fusoid, septate, upper part
covered by rough brown exudate. Crystals always present,
hexagonal, abundantly covering the exterior of the ectal
excipulum.
Anamorphs Myrioconium-like (sporodochial, or formed
on germinating ascospores).
Ecology: parasitic or saprobic on xeric bark and wood of
deciduous trees.
Type species:Sclerencoelia fascicularis (Alb. & Schwein.:
Fr.) Pärtel & Baral.
Etymology:Sclerencoelia refers to the presence of
substratalsclerotia and the relatedness to members of the fam-
ily Sclerotiniaceae, and the encoelioid appearance of
apothecia.
Comments: The three species recognized in the genus are
morphologically almost indistinguishable with all having
long-lived, desiccation-tolerant apothecia. In both the
multigene (Fig. 1) and the ITS analysis (Fig. 2), the monophy-
ly of Sclerencoelia was strongly supported, yet its relationship
with other genera remained unresolved. While S. fraxinicola
seems restricted to Fraxinus,S. fascicularis and S. pruinosa
most commonly occur on Populus spp. Which species of
Sclerencoelia occur in North America remains uncertain.
Sclerencoelia fascicularis (Alb. & Schwein.) Pärtel &
Baral comb.nov.
MycoBank MB 815440 (Fig. 5).
Basionym: Peziza fascicularis Alb. & Schwein.,
Conspectus Fungorum in Lusatiae superioris (Leipzig): 315,
tab. XII Fig. 2(von Albertini and von Schweinitz 1805).
Phibalis fascicularis (Alb. & Schwein.) Wallr., Flora
Cryptogamica Germaniae 2: 445 (1833).
Encoelia fascicularis (Alb. & Schwein.) P. Karst., Bidrag
till Kännedom av. Finlands Natur och Folk 19: 217 (Karsten
1871).
Cenangium fasciculare (Alb. & Schwein.) Quél.,
Mémoires de la Société dÉmulation de Montbéliard 5: 415
(1873).
=Peziza populnea Pers., Syn. meth. Fung. (Göttingen) 2:
671 (Persoon 1801).
Encoelia populnea (Pers.) J. Schröt., Krypt.-Fl. Schlesien
(Breslau) 3.2(7): 140 (1893).
Cenangium populneum (Pers.) Rehm, in Winter, Rabenh.
Krypt.-Fl., Edn 2 (Leipzig) 1.3(lief. 31): 220 (1889) [1896].
= Dermea (BDermatea^)fascicularis forma carpini Rehm
in Voss, Verh. Zool.-Bot. Ges. Österreich 37: 223 (1887).
Cenangium carpini Rehm, Discom. Rabenhorsts
KryptogamenFlora, Pilze Ascomyceten 1(3): 221 (1889).
Encoelia carpini (Rehm) Boud., Histoire et
Classification des Discomycètes dEurope: 161 (1907).
Holotype absent. Neotype TU 104531 desi